DOCSLIB.ORG

Genetic Diversity Within Scorpio Maurus (Scorpiones: Scorpionidae) from Turkey

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Genetic Diversity Within Scorpio Maurus (Scorpiones: Scorpionidae) from Turkey NORTH-WESTERN JOURNAL OF ZOOLOGY 13 (1): 27-33 ©NwjZ, Oradea, Romania, 2017 Article No.: e161304 http://biozoojournals.ro/nwjz/index.html Genetic diversity within Scorpio maurus (Scorpiones: Scorpionidae) from Turkey Halil KOÇ1,*, Hülya SİPAHİ1 and Ersen Aydın YAĞMUR2 1. Sinop University, Science and Art Faculty, Biology Department, Sinop, Turkey 2. Alaşehir Vocational School, Celal Bayar University, Alaşehir, Manisa, Turkey * Corresponding author, H. Koç, E-mail: [email protected] Received: 08. January 2015 / Accepted: 29. June 2016 / Available online: 19. September 2016 / Printed: June 2017 Abstract. In this study, DNA sequence diversity of the mitochondrial (mt) cytochrome oxidase 1 (CO1) gene was investigated in Scorpio maurus specimens from across southeastern Turkey. Nucleotide sequences included 508 conserved sites and 126 variable sites, and the mean nucleotide variation within species was 7.9%. Intraspecific pairwise divergences ranged from 0.5% to 10.7%. Phylogenetic analysis indicated high divergence among specimens. This study is the first mtDNA sequence analysis for Turkish scorpions. Key words: Scorpio maurus, intraspecific variation, mitochondrial DNA, CO1, Turkey. Introduction scorpionid genera based on 12S, 16S, CO1 and 28S rDNA sequence data that included S. m. fuscus Scorpio maurus L. is one of the first species de- (Ehrenberg, 1829) from Israel and S. m. palmatus scribed by Linnaeus (1758). It has long been (Ehrenberg, 1828) from Egypt. More recently, known as a widespread, polymorphic species (Fet Froufe et al. (2008) examined CO1 diversity within 2000). Birula (1910) first reviewed all S. maurus S. maurus from Morocco. Their study included S. populations in northern Africa and the Middle maurus birulai Fet, 1997, S. maurus fuliginosus (Pal- East. His research indicated that all forms of S. lary, 1928) and another unidentified subspecies maurus are subspecies, but all forms were classi- and detected 8.0% sequence divergence within S. fied into two groups as “sectio maurus” [(S. m. maurus fuliginosus. Lourenço (2009) reviewed Va- maurus L. (= S. maurus L.), S. m. tunetanus Birula, chon’s (1952) taxa and elevated all eight subspe- 1910 (= S. punicus Fet, 2000), S. m. palmatus cies that were studied in detail by the latter author (Ehrenberg, 1828), S. m. fuscus (Ehrenberg, 1829), and that occur in North Africa to species level but S. m. subtypicus Birula, 1910 (= S. birulai Fet, 1997), refrained from making taxonomical changes to the S. m. magadorensis Birula, 1910 (= S. magadorensis remaining 11 subspecies. However, despite these Birula, 1910), S. m. hesperus Birula, 1910 (= S. hespe- previous studies, the position of Asian popula- rus Birula, 1910)] and “sectio propinquus” [S. m. tions remains unclear. Additionally, there are no arabicus (Pocock, 1900), S. m. propinquus (Simon, molecular studies of these populations except for 1872), S. m. kruglovi Birula, 1910, S. m. towsendi those in Israel (Prendini et al. 2003), and Desouky (Pocock, 1900) ]. According to Birula (1910), the & Alshammari (2011) analyzed S. m. kruglovi Bi- members of “sectio maurus” are distributed in Af- rula, 1910 from Saudi Arabia using 16S. Recently, rica, and the members of “sectio propinquus” are Talal et al. (2015) reviewed Scorpio populations in distributed in Asia, with the exceptions that S. m. Israel. They confirmed the presence of Scorpio palmatus (found in the south of Israel and Sinai) maurus fuscus (Ehrenberg, 1829) and Scorpio mau- and S. m. fuscus (found in the middle and north of rus palmatus (Ehrenberg, 1828) in Israel and added Israel) (Levy & Amitai 1980) were classified within Scorpio maurus propinquus (Simon, 1872) and Scor- the “maurus” group. Subsequently, Vachon (1952) pio maurus kruglovi Birula, 1910 to the Israeli fauna. reviewed northern African populations, and Levy Additionally, Talal et al. (2015) elevated these taxa & Amitai (1980) reviewed populations in Israel to species level. and Sinai, and they all accepted Birula’s (1910) Very little is known about Turkish Scorpio classification. Fet (2000) reviewed the entire family maurus populations. Birula (1898) first reported Scorpionidae and listed nineteen subspecies be- Scorpio maurus from Turkey (from Gülek Pass, longing to S. maurus. According to Fet (2000), Mersin and Bolkar Mountain) and identified it as twelve of the subspecies occur in Africa. Prendini S. m. fuscus. Later, Birula (1910), Vachon (1947a, et al. (2003) conducted a molecular analysis of all 1947b, 1951), Tolunay (1959), Kinzelbach (1984) 28 H. Koç et al. and Crucitti & Vignoli (2002) followed and ac- (5’TAAACTTCAGGGTGACCAAAAAATCA3’) (Folmer cepted Birula’s (1898) identification. More re- et al. 1994). DNA was amplified at a 50 µl final volume cently, Talal et al. (2015) reported some specimens containing 0.9X PCR buffer, 2.5 mM MgCl2, 10 mM of each dNTP, 0.1 µM forward and 0.1 µM reverse primer, tentatively as Scorpio kruglovi (Ehrenberg, 1829) 50 ng template DNA and 1 µL Taq polymerase. Amplifi- from Turkey, but they did not provide locality or cations were performed with an initial denaturation at diagnostic information about the Turkish speci- 94ºC for 1 min, 5 cycles of 94ºC for 1 min 30 sec, 53ºC for mens. However, the known species seems is Scor- 30 sec, 72ºC for 1 min, followed by 35 cycles of 94ºC for 30 pio fuscus in Turkey at the moment, and it is un- sec, 53ºC for 1 min, 72ºC for 1 min and completed after a clear whether they reported additional records for final elongation at 72 ºC for 5 min After purification of the Turkey or were referring to the population as PCR product, sequences were obtained on an ABI 310 automated sequencer. known Scorpio fuscus in Turkey. Additionally, both species are not yellow and do not comprise yellow Sequence analyses populations from Turkey. Therefore, we use the All new DNA sequences were submitted to GenBank name of Scorpio maurus for all Turkish populations [http://www.ncbi.nlm.nih.gov] (Table 1). Thirteen CO1 examined herein. mtDNA sequences published previously by Froufe et al. The mitochondrial (mt) cytochrome oxidase (2008) and Prendini et al. (2003) (AY156585. AY156584. subunit I (CO1) gene is characterized by its rela- FJ198057, FJ198058. FJ198059, FJ198064. FJ198060, FJ198065, FJ198066, FJ198061, FJ198062, FJ198063, tively large size and the inclusion of both highly AY156575) were extracted from GenBank and used in conserved and variable regions with different subsequent analyses. As an outgroup we selected Het- ranges of mutational rates. Because of these prop- erometrus swammerdami Simon, 1872, classified in the ge- erties, it has become a marker of choice to clarify nus of the family Scorpionidae, which is distributed the taxonomic status of species and for molecular widely across tropical and subtropical southeastern Asia identification (Lunt et al. 1996). The CO1 gene has (Prendini et al. 2003; Kovařík 2004). also been extensively used to investigate genetic All sequences were imported into MEGA 6 (Tamura et al. 2013) and aligned using ClustalW (Thompson et al. diversity within species because of its rapid evolu- 1994) to determine genetic distance and conduct Maxi- tionary rate (Li et al. 2009; Froufe et al. 2008; Xiao mum Parsimony (MP) and Maximum Likelihood (ML) et al. 2008). In S. maurus, this gene has thus far analyses. Node support was determined with 1000 boot- only been used to assess the diversity within the strap pseudoreplicates for both the MP and the ML analy- Moroccan subspecies S. m. birulai and S. m. fuligi- ses. For the ML analysis, the Tamura-Nei + G model was nosus (Froufe et al. 2008). identified as the best substitution model using The objective of this study was to determine MODELTEST version 3.7 (Posada & Crandall 1998). This model of evolution was also used to construct the NJ tree the COI diversity of Scorpio maurus species from (Saitou & Nei 1987). Tamura and Nei genetic distances southeastern Turkey. Nucleotide variation found (Tamura & Nei 1993) were used to estimate sequence di- in this study was compared to other mitochondrial vergence values. surveys of scorpions. Results Materials and methods A total of 634 base pairs from 11 new specimens Sampling and DNA isolation from different locations in southeastern Turkey Eleven specimens of Scorpio maurus were collected from eleven different geographic locations (Fig. 1). Detailed lo- were sequenced and aligned with the outgroup cality data and GenBank accession numbers are provided and 12 previously sequenced specimens. The in Table 1. The scorpions were preserved in 96% ethanol. aligned sequences, including specimens from Total DNA was extracted from preserved muscle tissue (a southeastern Turkey, comprised 508 constant sites leg) using a standard high-salt protocol (Sambrook et al. and 126 variable sites, 75 of which were parsi- 1989). mony informative. The CO1 sequences were AT rich, with an av- Amplification and sequencing of mitochondrial DNA fragments erage incidence of A=20.2%, C=13.9%, G=22.8% A fragment of the mitochondrial cytochrome c oxidase and T=43%. These nucleotide frequencies are con- subunit I gene was amplified by polymerase chain reac- sistent with those from the 12 Scorpio maurus se- tion (PCR) using the primers LCO1490 quences from GenBank (A=20.2%, C=13.7%, ((5’GGGTCAACAAAATCATAAAGATATTGG3’) and G=22.9%, and T= 43.1%). The average nucleotide HCO2198 diversity (Pi) for the 11 sequences was 0.079. The Table 1. Localities and GenBank accession numbers for Scorpio maurus and the outgroup Heterometrus swammerdami. Population
Load more

Recommended publications
  • The Scorpions of Jordan
    © Biologiezentrum Linz/Austria; download unter www.biologiezentrum.at The scorpions of Jordan Z.S. AMR & M. ABU BAKER Abstract: 15 species and subspecies representing 10 genera within three families (Buthidae, Diplocen- tridae and Scorpionidae) have been recorded in Jordan. Distribution and diagnostic features for the scorpions of Jordan are given. Key words: Scorpions, Scorpionida, Buthidae, Jordan, taxonomy, zoogeography, arid environments. Introduction and Scorpionidae are represented by a single genus for each (Nebo and Scorpio). Scorpions are members of the class Arachnida (phylum Arthropoda). They are one of the most ancient animals, and per- Family Buthidae haps they appeared about 350 million years Triangular sternum is the prominent fea- ago during the Silurian period, where they ture of representatives in this family. Three invaded terrestrial habitats from an am- to five eyes are usually present and the tel- phibious ancestor (VACHON 1953). Scorpi- son is usually equipped with accessory ons are characterised by their elongated and spines. This family includes most of the ven- segmented body that consists of the omous scorpions. cephalothorax or prosoma, abdomen or mesosoma and tail or the metasoma. These Leiurus quinquestriatus HEMPRICH & animals are adapted to survive under harsh EHRENBERG 1829 (Fig. 1c) desert conditions. Diagnosis: Yellow in colour. The first Due to their medical importance, the two mesosomal tergites have 5 keels. Adult scorpions of Jordan received considerable specimens may reach 9 cm in length. attention of several workers (VACHON 1966; Measurements: Total length 3-7,7 cm LEVY et al. 1973; WAHBEH 1976; AMR et al. (average 5,8 cm), prosoma 3,8-9,6 mm, 1988, EL-HENNAWY 1988; AMR et al.
    [Show full text]
  • Checklist and Review of the Scorpion Fauna of Iraq (Arachnida: Scorpiones)
    Arachnologische Mitteilungen / Arachnology Letters 61: 1-10 Karlsruhe, April 2021 Checklist and review of the scorpion fauna of Iraq (Arachnida: Scorpiones) Hamid Saeid Kachel, Azhar Mohammed Al-Khazali, Fenik Sherzad Hussen & Ersen Aydın Yağmur doi: 10.30963/aramit6101 Abstract. The knowledge of the scorpion fauna of Iraq and its geographical distribution is limited. Our review reveals the presence in this country of 19 species belonging to 13 genera and five families: Buthidae, Euscorpiidae, Hemiscorpiidae, Iuridae and Scorpionidae. Buthidae is, with nine genera and 15 species, the richest and the most diverse family in Iraq. Synonymies of several scorpion species were reviewed. Due to erroneous identifications and locality data, we exclude 18 species of scorpion from the list of the Iraqi fauna. The geographical distribution of Iraqi scorpions is discussed. Compsobuthus iraqensis Al-Azawii, 2018, syn. nov. is synonymized with C. matthiesseni (Birula, 1905). Keywords: Buthidae, distribution, diversity, Euscorpiidae, Hemiscorpiidae, Iuridae, Scorpionidae Zusammenfassung. Checkliste und Übersicht der Skorpione im Irak (Arachnida: Scorpiones). Die Kenntnisse über die Skorpionfau- na im Irak und deren geografische Verbreitung sind begrenzt. Die Checkliste umfasst 19 Arten aus 13 Gattungen und fünf Familien: Buthidae, Euscorpiidae, Hemiscorpiidae, Iuridae und Scorpionidae. Die Buthidae sind mit neun Gattungen und 15 Arten die artenreichste und diverseste Familie im Irak. Aufgrund von Fehlbestimmungen und falschen Ortsangaben werden 18 Skorpionarten für den Irak ge- strichen. Die geografische Verbreitung der Skorpionarten innerhalb des Landes wird diskutiert. Compsobuthus iraqensis Al-Azawii, 2018, syn. nov. wird mit C. matthiesseni (Birula, 1905) synonymisiert. The scorpion fauna of Iraq is one of the least known in the & Qi (2007), Sissom & Fet (1998), Fet et al.
    [Show full text]
  • The Scorpion Fauna of Mona Island, Puerto Rico (Scorpiones: Buthidae, Scorpionidae)
    The Scorpion Fauna of Mona Island, Puerto Rico (Scorpiones: Buthidae, Scorpionidae) Rolando Teruel, Mel J. Rivera & Alejandro J. Sánchez August 2017 – No. 250 Euscorpius Occasional Publications in Scorpiology EDITOR: Victor Fet, Marshall University, ‘[email protected]’ ASSOCIATE EDITOR: Michael E. Soleglad, ‘[email protected]’ Euscorpius is the first research publication completely devoted to scorpions (Arachnida: Scorpiones). Euscorpius takes advantage of the rapidly evolving medium of quick online publication, at the same time maintaining high research standards for the burgeoning field of scorpion science (scorpiology). Euscorpius is an expedient and viable medium for the publication of serious papers in scorpiology, including (but not limited to): systematics, evolution, ecology, biogeography, and general biology of scorpions. Review papers, descriptions of new taxa, faunistic surveys, lists of museum collections, and book reviews are welcome. Derivatio Nominis The name Euscorpius Thorell, 1876 refers to the most common genus of scorpions in the Mediterranean region and southern Europe (family Euscorpiidae). Euscorpius is located at: http://www.science.marshall.edu/fet/Euscorpius (Marshall University, Huntington, West Virginia 25755-2510, USA) ICZN COMPLIANCE OF ELECTRONIC PUBLICATIONS: Electronic (“e-only”) publications are fully compliant with ICZN (International Code of Zoological Nomenclature) (i.e. for the purposes of new names and new nomenclatural acts) when properly archived and registered. All Euscorpius issues starting from No. 156 (2013) are archived in two electronic archives: • Biotaxa, http://biotaxa.org/Euscorpius (ICZN-approved and ZooBank-enabled) • Marshall Digital Scholar, http://mds.marshall.edu/euscorpius/. (This website also archives all Euscorpius issues previously published on CD-ROMs.) Between 2000 and 2013, ICZN did not accept online texts as "published work" (Article 9.8).
    [Show full text]
  • Arachnides 76
    Arachnides, 2015, n°76 ARACHNIDES BULLETIN DE TERRARIOPHILIE ET DE RECHERCHES DE L’A.P.C.I. (Association Pour la Connaissance des Invertébrés) 76 2015 0 Arachnides, 2015, n°76 LES PREDATEURS DES SCORPIONS (ARACHNIDA : SCORPIONES) G. DUPRE Dans leur revue sur les prédateurs de scorpions, Polis, Sissom & Mac Cormick (1981) relèvent 150 espèces dont essentiellement des espèces adaptées au comportement nocturne de leur proie (chouettes, rongeurs, carnivores nocturnes) mais également des espèces diurnes (lézards, rongeurs, carnivores....) qui débusquent les scorpions sous les pierres ou dans leurs terriers. Dans une précédente note (Dupré, 2008) nous avions effectué un relevé afin d'actualiser cette étude de 1981. Sept ans après, de nouvelles données sont présentées dans cette synthèse. Voici un nouveau relevé des espèces prédatrices. Nous ne faisons pas mention des scorpions qui feront l'objet d'un futur article traité avec le cannibalisme. Explication des tableaux: La première colonne correspond aux prédateurs, la seconde aux régions concernées et la troisième aux références. Dans la mesure du possible, les noms scientifiques ont été rectifiés en fonction des synonymies ou des nouvelles combinaisons appliquées depuis les dates de publication d'origine. ARTHROPODA ARACHNIDA SOLIFUGAE Solifugae Afrique du Nord Millot & Vachon, 1949; Punzo, 1998; Cloudsley-Thompson, 1977 Eremobates sp. USA Bradley, 1983 ARACHNIDA ARANEAE Acanthoscurria atrox Brésil Lourenço, 1981 Aphonopelma sp. et autres Amérique centrale Mazzotti, 1964 Teraphosidae Phormictopus auratus Cuba Teruel & De Armas, 2012 Brachypelma vagans Mexique Dor et al., 2011 Epicadus heterogaster Brésil Lourenço et al. 2006 Latrodectus sp. USA Baerg, 1961 L. hesperus USA Polis et al., 1981 L. mactans Cuba Teruel, 1996; Teruel & De Armas, 2012 L.
    [Show full text]
  • Reanalysis of the Genus Scorpio Linnaeus 1758 in Sub-Saharan Africa and Description of One New Species from Cameroon
    ZOBODAT - www.zobodat.at Zoologisch-Botanische Datenbank/Zoological-Botanical Database Digitale Literatur/Digital Literature Zeitschrift/Journal: Entomologische Mitteilungen aus dem Zoologischen Museum Hamburg Jahr/Year: 2011 Band/Volume: 15 Autor(en)/Author(s): Lourenco Wilson R. Artikel/Article: Reanalysis of the genus Scorpio Linnaeus 1758 in sub-Saharan Africa and description of one new species from Cameroon (Scorpiones, Scorpionidae) 99-113 ©Zoologisches Museum Hamburg, www.zobodat.at Entomol. Mitt. zool. Mus. Hamburg15(181): 99-113Hamburg, 15. November 2009 ISSN 0044-5223 Reanalysis of the genus Scorpio Linnaeus 1758 in sub-Saharan Africa and description of one new species from Cameroon (Scorpiones, Scorpionidae) W ilson R. Lourenço (with 32 figures) Abstract For almost a century, Scorpio maurus L., 1758 (Scorpiones, Scorpionidae) has been considered to be no more than a widespread and presumably highly polymorphic species. Past classifications by Birula and Vachon have restricted the status of different populations to subspecific level. In the present paper, and in the light of new evidence, several African populations are now raised to the rank of species. One of these, Scorpio occidentalis Werner, 1936, is redescribed and a neotype proposed to stabilise the taxonomy of the group. A new species is also described from the savannah areas of Cameroon. This is the second to be recorded from regions outside the Sahara desert zone. Keywords: Scorpiones, Scorpionidae, Scorpio, new rank, new species, Africa, Cameroon. Introduction The genus Scorpio was created by Linnaeus in 1758 (in part), and has Scorpio maurus Linnaeus, 1758 as its type species, defined by subsequent designation (Karsch 1879; see also Fet 2000).
    [Show full text]
  • Full-Text (PDF)
    Vol. 6(1), pp. 21-28, January 2014 DOI: 10.5897/JMA2013.0286 ISSN 2141-2308 ©2014 Academic Journals Journal of Microbiology and Antimicrobials http://www.academicjournals.org/JMA Full Length Research Paper Investigation of the antimicrobial and hemolytic activity of venom of some Egyptian scorpion Wesam Salama* and Naglaa Geasa Zoology Department, Faculty of Science, Tanta University, Egypt. Accepted 16 January, 2014 Leuirus quinquestriatus, Androctonus amoreuxi and Androctonus australis are venomous scorpion in Egypt. Their venom is complex mixture of salts, neurotoxins, peptides and proteins which has therapeutic applications, and can rapidly kill a broad range of microbes. Estimations of total proteins of the venom indicated that L. quinquestriatus had the highest value than the others (10.64 ± 0.04). Hemolytic activity of human erythrocytes was detected and showed that all concentrations (20, 8 and 5 mg/ml) of tested scorpion species crude venom have hemolytic activity against human erythrocytes. The present study was conducted to evaluate the antimicrobial activity of the three Egyptian scorpion’s venom against four Gram-positive and negative bacterial strains (Bacillus cereus, Bacillus subtillis, Citrobacter freundi and Klibsella pneumonia) in addition to one fungus species Candida albicans. The results show that L. quinquestriatus venom has a significant antibacterial effect against B. subtillis and C. freundi. In contrast, A. amoreuxi and A. australis venoms do not have a noticeable effect on tested microbes. So, the aim of the present study was to investigate the antimicrobial activity of crude venom against Gram-negative, as well as Gram-positive bacteria, fungi and to evaluate the hemolytic activity of the three investigated species on human erythrocytes.
    [Show full text]
  • Emperor Scorpion Class: Arachnida
    Pandinus imperator Emperor Scorpion Class: Arachnida. Order: Scorpiones. Family: Scorpionidae. Other names: Imperial Scorpion Physical Description: One of the largest of scorpions in the world, the emperor scorpion has a dark body ranging from dark blue/green through brown to black and reaches lengths up to 8”. The large pincers are blackish-red and have a granular texture. The front part of the body is made up of four sections, each with a pair of legs. Behind the fourth pair of legs are comb-like structures known as pectines, which are sensory appendages that brush the substrate as the scorpion walks. The pectines are paired and can are used to distinguish sexes, as the ventral appendages are longer in males than females. The tail is long and curves back over the body ending with a large receptacle containing the venom glands and tipped with the sharp, curved stinger. Sensory hairs cover the pincers and tail, enabling the scorpion to detect prey through air and ground vibrations. Diet in the Wild: Insects, arachnids, mice and small lizards Diet at the Zoo: Crickets Habitat & Range: The emperor scorpion is found in western Africa and Congo areas, typically in hot and humid forests. They reside in burrows and prefer to live under leaf litter, forest debris, rocks, stream banks, and also in termite mounds Life Span: 5 to 8 years in captivity. Lifespan is likely shorter in the wild. Perils in the wild: Bats, birds, small mammals, large spiders, centipedes, large lizards and other scorpions Physical Adaptations: Eyesight of emperor scorpions is very poor.
    [Show full text]
  • Arachnida Dictionnaire Des Noms Scientifiques Des
    The electronic publication Arachnides - Bulletin de Terrariophile et de Recherche N°61 (2011) has been archived at http://publikationen.ub.uni-frankfurt.de/ (repository of University Library Frankfurt, Germany). Please include its persistent identifier urn:nbn:de:hebis:30:3-371887 whenever you cite this electronic publication. ARACHNIDES BULLETIN DE TERRARIOPHILIE ET DE RECHERCHES DE L’A.P.C.I. (Association Pour la Connaissance des Invertébrés) 61 2011 PREMIERES DONNEES SUR LA DIVERSITE SCORPIONIQUE DANS LA REGION DU SOUF (ALGERIE) Salah Eddine SADINE 1, Samia BISSAT 2 & Mohamed Didi OULD ELHADJ 1 [email protected] 1. Laboratoire de Protection des Écosystèmes en zones Arides et Semi-arides. Université KASDI Merbah-Ouargla. Algérie. BP 511 Route Ghardaïa – Ouargla. 30000. Algérie 2. Laboratoire Bio ressources. Université KASDI Merbah-Ouargla. Algérie. BP 511 Route Ghardaïa – Ouargla. 30000. Algérie ------------------------------------------------------------ Résumé : Le Souf est situé au Sud- Est de l’Algérie, aux confins septentrionaux du Grand Erg Oriental, entre les 33° et 34° de latitude Nord, et les 6° et 8° de longitude Est, touchant les frontières tunisienne et libyenne. Cette immense étendue sablonneuse abrite plusieurs faunes désertiques hautement diversifiées. Une étude originale sur la faune scorpionique dans cette région, nous a permis d’inventorier et identifier en totalité huit (08) espèces des scorpions, réparties d’une manière typique selon les différents biotopes naturels (Erg et reg) et biotopes anthropiques (Palmeraies ou oasis et milieux urbains). Une analyse factorielle des correspondances appliquées aux espèces trouvées nous a révélé que l’ Androctonus autralis est l’espèce omniprésente dans tous les biotopes et l’unique espèce qui fréquente les milieux urbains, Androctonus amoreuxi en deuxième place avec une large répartition qui fréquente la majorité des biotopes sauf le milieu urbain.
    [Show full text]
  • Scorpiones: Scorpionidae)
    An anomaly of chelicera in Scorpio kruglovi Birula, 1910 (Scorpiones: Scorpionidae) Ersen Aydın Yağmur, Mehmet Sait Kılıç & Ömer Yılmaz June 2021 — No. 335 Euscorpius Occasional Publications in Scorpiology EDITOR: Victor Fet, Marshall University, ‘[email protected]’ ASSOCIATE EDITOR: Michael E. Soleglad, ‘[email protected]’ TECHNICAL EDITOR: František Kovařík, ‘[email protected]’ Euscorpius is the first research publication completely devoted to scorpions (Arachnida: Scorpiones). Euscorpius takes advantage of the rapidly evolving medium of quick online publication, at the same time maintaining high research standards for the burgeoning field of scorpion science (scorpiology).Euscorpius is an expedient and viable medium for the publication of serious papers in scorpiology, including (but not limited to): systematics, evolution, ecology, biogeography, and general biology of scorpions. Review papers, descriptions of new taxa, faunistic surveys, lists of museum collections, and book reviews are welcome. Derivatio Nominis The name Euscorpius Thorell, 1876 refers to the most common genus of scorpions in the Mediterranean region and southern Europe (family Euscorpiidae). Euscorpius is located at: https://mds.marshall.edu/euscorpius/ Archive of issues 1-270 see also at: http://www.science.marshall.edu/fet/Euscorpius (Marshall University, Huntington, West Virginia 25755-2510, USA) ICZN COMPLIANCE OF ELECTRONIC PUBLICATIONS: Electronic (“e-only”) publications are fully compliant with ICZN (International Code of Zoological Nomenclature) (i.e. for the purposes of new names and new nomenclatural acts) when properly archived and registered. All Euscorpius issues starting from No. 156 (2013) are archived in two electronic archives: • Biotaxa, http://biotaxa.org/Euscorpius (ICZN-approved and ZooBank-enabled) • Marshall Digital Scholar, http://mds.marshall.edu/euscorpius/.
    [Show full text]
  • Burrowing Activities of Scorpio Maurus Towensendi JEZS 2015; 3 (1): 270-274 © 2015 JEZS (Arachnida: Scorpionida: Scorpionidae) in Province of Received: 08-01-2015
    Journal of Entomology and Zoology Studies 2015; 3 (1): 270-274 E-ISSN: 2320-7078 P-ISSN: 2349-6800 Burrowing activities of Scorpio maurus towensendi JEZS 2015; 3 (1): 270-274 © 2015 JEZS (Arachnida: Scorpionida: Scorpionidae) in province of Received: 08-01-2015 Accepted: 30-01-2015 Khouzestan sw Iran Navidpour SH Razi Reference Laboratory of Navidpour SH, Vazirianzadeh B, Mohammadi A Scorpion Research (RRLS), Dep. of Venomous Animals and Abstract Antivenin Production, Razi However, burrows provide very important facilities for scorpions, a little knowledge has been established Vaccine & Serum Research Institute, Karaj, Iran. so far regarding burrow habitat. The aim of current study was to describe the burrowing biology of S. maurus towensendi in some parts of Khouzestan a south west province of Iran, which is a habitat of this Vazirianzadeh B species. This research study was carried out through a particular nest sampling procedure in 12 nesting Health Research Institute, sites of scorpions of Ahvaz and Shoushtar, sw of Iran. No significant difference was recorded in ratios of Infectious and Tropical Diseases dimensions of scorpion borrows in the present study. Findings of the current study indicated that S. Research Center, Jundishapur maurus used same engineering method in excavating their tunnels. The comparison among the ratios of University of Medical Sciences, width/height using lower and upper limits of nest dimensions showed no significant different in the way Ahvaz, Iran and Dept of Medical of tunnels during making the nests. This fact explained that similar techniques, using the pedipalps, were Entomology Ahvaz. applied in nest making by this species.
    [Show full text]
  • On the Origin of Vertebrates from Arachnids.1
    ON THE OEIGIN OF VERTEBRATES PROM ARACHNIDS. 317 On the Origin of Vertebrates from Arachnids.1 By William Patten, Ph.D., Professor of Biology in the University of North Dakota, Grand Forks. With Plates XXIII and XXIV. " In the growth of each science, not only is correct observation needful for the formation of true theory, but true theory is needful as a preliminary to correct observation."—H. SFENCEB. 2 The " Annelid theory," after fifteen years of dexterous modelling, is now as far as ever either from fitting the facts of Vertebrate structure, or from shedding any direct light on the great problem of the origin of Vertebrates. It certainly is not without significance that, of all those who with willing eyes and minds have grappled with the Annelid theory, not one has discovered a distinctively Annelid feature in Vertebrates : mesoblastic somites, nephridia, segmental appendages, and seg- mental sense-organs are found in nearly all segmented animals. 1 I include in the Arachnida the Spiders, Scorpions, Linvulus, Trilobites, and Merostomata. 2 Most of my observations on Acdlius, Scorpio, and Limulus were made in the Lake Laboratory, Milwaukee, Wis. I am greatly indebted to the founder of that institution, Mr. E. P. Allis, for generously placing at my disposal the excellent facilities for research which his laboratory affords. As a full description of my observations could not be published without considerable delay, it seemed advisable to present my theoretical conclusions first, at the same time giving a short account of those facts bearing directly on the subject-matter. A few simple diagrams have been introduced to make the text more intelligible.
    [Show full text]
  • Scorpion Fauna of Qazvin Province, Iran (Arachnida, Scorpiones)
    International Journal of Research Studies in Zoology Volume 6, Issue 1, 2020, PP 12-19 ISSN No. 2454-941X DOI: http://dx.doi.org/10.20431/2454-941X.0601003 www.arcjournals.org Scorpion Fauna of Qazvin Province, Iran (Arachnida, Scorpiones) * Shahrokh Navidpour Razi Reference Laboratory of Scorpion Research (RRLS), Razi Vaccine & Serum Research Institute, Agricultural Research Education and Extension Organization (AREEO), Karaj, IRAN *Corresponding Author: Shahrokh Navidpour., Razi Reference Laboratory of Scorpion Research (RRLS), Razi Vaccine & Serum Research Institute, Agricultural Research Education and Extension Organization (AREEO), Karaj, IRAN Abstract: Six species of scorpions belonging to two families are reported from the Qazvin Province of Iran. Of these, two species are recorded from the province for the first time: Mesobuthus caucasicus (Normann, 1840) and Scorpio maurus kruglovi Birula, 1910 also presented are keys to all species of scorpions found in the Qazvin province. A BBREVIATIONS: The institutional abbreviations listed below and used throughout are mostly after Arnett et al. (1993). BMNH – The Natural History Museum, London, United Kingdom; FKCP – František Kovařík Collection, Praha, Czech Republic; MCSN – Museo Civico de Storia Naturale “Giacomo Doria”, Genova, Italy; MHNG – Museum d`Histoire naturelle, Geneva, Switzerland; MNHN – Muséum National d´Histoire Naturelle, Paris, France; NHMW – Naturhistorisches Museum Wien, Vienna, Austria; RRLS – Razi Reference Laboratory of Scorpion Research, Razi Vaccine and Serum Research Institute, Karaj, IRAN ZISP – Zoological Institute, Russian Academy of Sciences, St. Petersburg, Russia; ZMHB – Museum für Naturkunde der Humboldt-Universität zu Berlin, Germany; ZMUH – Zoologisches Institut und Zoologisches Museum, Universität Hamburg, Germany. 1. INTRODUCTION This paper continues a comprehensive province-by-province field study of the scorpion fauna of Iran by the RRLS team under Shahrokh Navidpour.
    [Show full text]