NORTH-WESTERN JOURNAL OF ZOOLOGY 13 (1): 27-33 ©NwjZ, Oradea, Romania, 2017 Article No.: e161304 http://biozoojournals.ro/nwjz/index.html Genetic diversity within Scorpio maurus (Scorpiones: Scorpionidae) from Turkey Halil KOÇ1,*, Hülya SİPAHİ1 and Ersen Aydın YAĞMUR2 1. Sinop University, Science and Art Faculty, Biology Department, Sinop, Turkey 2. Alaşehir Vocational School, Celal Bayar University, Alaşehir, Manisa, Turkey * Corresponding author, H. Koç, E-mail: [email protected] Received: 08. January 2015 / Accepted: 29. June 2016 / Available online: 19. September 2016 / Printed: June 2017 Abstract. In this study, DNA sequence diversity of the mitochondrial (mt) cytochrome oxidase 1 (CO1) gene was investigated in Scorpio maurus specimens from across southeastern Turkey. Nucleotide sequences included 508 conserved sites and 126 variable sites, and the mean nucleotide variation within species was 7.9%. Intraspecific pairwise divergences ranged from 0.5% to 10.7%. Phylogenetic analysis indicated high divergence among specimens. This study is the first mtDNA sequence analysis for Turkish scorpions. Key words: Scorpio maurus, intraspecific variation, mitochondrial DNA, CO1, Turkey. Introduction scorpionid genera based on 12S, 16S, CO1 and 28S rDNA sequence data that included S. m. fuscus Scorpio maurus L. is one of the first species de- (Ehrenberg, 1829) from Israel and S. m. palmatus scribed by Linnaeus (1758). It has long been (Ehrenberg, 1828) from Egypt. More recently, known as a widespread, polymorphic species (Fet Froufe et al. (2008) examined CO1 diversity within 2000). Birula (1910) first reviewed all S. maurus S. maurus from Morocco. Their study included S. populations in northern Africa and the Middle maurus birulai Fet, 1997, S. maurus fuliginosus (Pal- East. His research indicated that all forms of S. lary, 1928) and another unidentified subspecies maurus are subspecies, but all forms were classi- and detected 8.0% sequence divergence within S. fied into two groups as “sectio maurus” [(S. m. maurus fuliginosus. Lourenço (2009) reviewed Va- maurus L. (= S. maurus L.), S. m. tunetanus Birula, chon’s (1952) taxa and elevated all eight subspe- 1910 (= S. punicus Fet, 2000), S. m. palmatus cies that were studied in detail by the latter author (Ehrenberg, 1828), S. m. fuscus (Ehrenberg, 1829), and that occur in North Africa to species level but S. m. subtypicus Birula, 1910 (= S. birulai Fet, 1997), refrained from making taxonomical changes to the S. m. magadorensis Birula, 1910 (= S. magadorensis remaining 11 subspecies. However, despite these Birula, 1910), S. m. hesperus Birula, 1910 (= S. hespe- previous studies, the position of Asian popula- rus Birula, 1910)] and “sectio propinquus” [S. m. tions remains unclear. Additionally, there are no arabicus (Pocock, 1900), S. m. propinquus (Simon, molecular studies of these populations except for 1872), S. m. kruglovi Birula, 1910, S. m. towsendi those in Israel (Prendini et al. 2003), and Desouky (Pocock, 1900) ]. According to Birula (1910), the & Alshammari (2011) analyzed S. m. kruglovi Bi- members of “sectio maurus” are distributed in Af- rula, 1910 from Saudi Arabia using 16S. Recently, rica, and the members of “sectio propinquus” are Talal et al. (2015) reviewed Scorpio populations in distributed in Asia, with the exceptions that S. m. Israel. They confirmed the presence of Scorpio palmatus (found in the south of Israel and Sinai) maurus fuscus (Ehrenberg, 1829) and Scorpio mau- and S. m. fuscus (found in the middle and north of rus palmatus (Ehrenberg, 1828) in Israel and added Israel) (Levy & Amitai 1980) were classified within Scorpio maurus propinquus (Simon, 1872) and Scor- the “maurus” group. Subsequently, Vachon (1952) pio maurus kruglovi Birula, 1910 to the Israeli fauna. reviewed northern African populations, and Levy Additionally, Talal et al. (2015) elevated these taxa & Amitai (1980) reviewed populations in Israel to species level. and Sinai, and they all accepted Birula’s (1910) Very little is known about Turkish Scorpio classification. Fet (2000) reviewed the entire family maurus populations. Birula (1898) first reported Scorpionidae and listed nineteen subspecies be- Scorpio maurus from Turkey (from Gülek Pass, longing to S. maurus. According to Fet (2000), Mersin and Bolkar Mountain) and identified it as twelve of the subspecies occur in Africa. Prendini S. m. fuscus. Later, Birula (1910), Vachon (1947a, et al. (2003) conducted a molecular analysis of all 1947b, 1951), Tolunay (1959), Kinzelbach (1984) 28 H. Koç et al. and Crucitti & Vignoli (2002) followed and ac- (5’TAAACTTCAGGGTGACCAAAAAATCA3’) (Folmer cepted Birula’s (1898) identification. More re- et al. 1994). DNA was amplified at a 50 µl final volume cently, Talal et al. (2015) reported some specimens containing 0.9X PCR buffer, 2.5 mM MgCl2, 10 mM of each dNTP, 0.1 µM forward and 0.1 µM reverse primer, tentatively as Scorpio kruglovi (Ehrenberg, 1829) 50 ng template DNA and 1 µL Taq polymerase. Amplifi- from Turkey, but they did not provide locality or cations were performed with an initial denaturation at diagnostic information about the Turkish speci- 94ºC for 1 min, 5 cycles of 94ºC for 1 min 30 sec, 53ºC for mens. However, the known species seems is Scor- 30 sec, 72ºC for 1 min, followed by 35 cycles of 94ºC for 30 pio fuscus in Turkey at the moment, and it is un- sec, 53ºC for 1 min, 72ºC for 1 min and completed after a clear whether they reported additional records for final elongation at 72 ºC for 5 min After purification of the Turkey or were referring to the population as PCR product, sequences were obtained on an ABI 310 automated sequencer. known Scorpio fuscus in Turkey. Additionally, both species are not yellow and do not comprise yellow Sequence analyses populations from Turkey. Therefore, we use the All new DNA sequences were submitted to GenBank name of Scorpio maurus for all Turkish populations [http://www.ncbi.nlm.nih.gov] (Table 1). Thirteen CO1 examined herein. mtDNA sequences published previously by Froufe et al. The mitochondrial (mt) cytochrome oxidase (2008) and Prendini et al. (2003) (AY156585. AY156584. subunit I (CO1) gene is characterized by its rela- FJ198057, FJ198058. FJ198059, FJ198064. FJ198060, FJ198065, FJ198066, FJ198061, FJ198062, FJ198063, tively large size and the inclusion of both highly AY156575) were extracted from GenBank and used in conserved and variable regions with different subsequent analyses. As an outgroup we selected Het- ranges of mutational rates. Because of these prop- erometrus swammerdami Simon, 1872, classified in the ge- erties, it has become a marker of choice to clarify nus of the family Scorpionidae, which is distributed the taxonomic status of species and for molecular widely across tropical and subtropical southeastern Asia identification (Lunt et al. 1996). The CO1 gene has (Prendini et al. 2003; Kovařík 2004). also been extensively used to investigate genetic All sequences were imported into MEGA 6 (Tamura et al. 2013) and aligned using ClustalW (Thompson et al. diversity within species because of its rapid evolu- 1994) to determine genetic distance and conduct Maxi- tionary rate (Li et al. 2009; Froufe et al. 2008; Xiao mum Parsimony (MP) and Maximum Likelihood (ML) et al. 2008). In S. maurus, this gene has thus far analyses. Node support was determined with 1000 boot- only been used to assess the diversity within the strap pseudoreplicates for both the MP and the ML analy- Moroccan subspecies S. m. birulai and S. m. fuligi- ses. For the ML analysis, the Tamura-Nei + G model was nosus (Froufe et al. 2008). identified as the best substitution model using The objective of this study was to determine MODELTEST version 3.7 (Posada & Crandall 1998). This model of evolution was also used to construct the NJ tree the COI diversity of Scorpio maurus species from (Saitou & Nei 1987). Tamura and Nei genetic distances southeastern Turkey. Nucleotide variation found (Tamura & Nei 1993) were used to estimate sequence di- in this study was compared to other mitochondrial vergence values. surveys of scorpions. Results Materials and methods A total of 634 base pairs from 11 new specimens Sampling and DNA isolation from different locations in southeastern Turkey Eleven specimens of Scorpio maurus were collected from eleven different geographic locations (Fig. 1). Detailed lo- were sequenced and aligned with the outgroup cality data and GenBank accession numbers are provided and 12 previously sequenced specimens. The in Table 1. The scorpions were preserved in 96% ethanol. aligned sequences, including specimens from Total DNA was extracted from preserved muscle tissue (a southeastern Turkey, comprised 508 constant sites leg) using a standard high-salt protocol (Sambrook et al. and 126 variable sites, 75 of which were parsi- 1989). mony informative. The CO1 sequences were AT rich, with an av- Amplification and sequencing of mitochondrial DNA fragments erage incidence of A=20.2%, C=13.9%, G=22.8% A fragment of the mitochondrial cytochrome c oxidase and T=43%. These nucleotide frequencies are con- subunit I gene was amplified by polymerase chain reac- sistent with those from the 12 Scorpio maurus se- tion (PCR) using the primers LCO1490 quences from GenBank (A=20.2%, C=13.7%, ((5’GGGTCAACAAAATCATAAAGATATTGG3’) and G=22.9%, and T= 43.1%). The average nucleotide HCO2198 diversity (Pi) for the 11 sequences was 0.079. The Table 1. Localities and GenBank accession numbers for Scorpio maurus and the outgroup Heterometrus swammerdami. Population