Supplementary Table 1: Selected Gene Products Used in Cdna Based Array 31
Total Page：16
File Type：pdf, Size：1020Kb
Load more
Recommended publications
-
View of the Literature
Roles of Adipose Tissue-Derived Factors in Adipose Tissue Development and Lipid Metabolism Dissertation Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University By Jinsoo Ahn, M.S. Graduate Program in Ohio State University Nutrition The Ohio State University 2015 Dissertation Committee: Kichoon Lee, Ph.D., Advisor Earl H. Harrison, Ph.D. Ramesh Selvaraj, Ph.D. Ouliana Ziouzenkova, Ph.D. Copyright by Jinsoo Ahn 2015 Abstract Obesity is a global trend and major risk factor for serious diseases including type 2 diabetes, heart disease, and hypertension. Obesity is characterized by excess fat accumulation, especially in the visceral area. The pathogenic effects related to common obesity are largely attributed to dysregulated secretion of adipokines followed by insulin resistance in peripheral tissues when adipose tissue mass is altered. White adipose tissue serves as a dynamic endocrine organ as well as a major energy reservoir for whole-body energy homeostasis. Adipokines influence various metabolic processes in the body including adipocyte differentiation; however, precise physiological roles of adipokines need to be further investigated. In addition, a large proportion of adipokines still needs to be identified. Information from the gene expression omnibus (GEO) profile, a public repository for microarray data, combined with confirmatory studies on mRNA and protein expression were used to identify a novel adipose tissue-specific gene, chordin-like 1 (Chrdl1). Further analysis showed that Chrdl1 encodes a putative secreted protein which is a new adipokine. Chrdl1 expression increases during 3T3-L1 adipocyte development in vitro and mouse adipose tissue development in vivo. -
Bioinformatics Approach for Pattern of Myelin-Specific Proteins And
CORE Metadata, citation and similar papers at core.ac.uk Provided by Qazvin University of Medical Sciences Repository Biotech Health Sci. 2016 November; 3(4):e38278. doi: 10.17795/bhs-38278. Published online 2016 August 16. Research Article Bioinformatics Approach for Pattern of Myelin-Specific Proteins and Related Human Disorders Samiie Pouragahi,1,2,3 Mohammad Hossein Sanati,4 Mehdi Sadeghi,2 and Marjan Nassiri-Asl3,* 1Department of Molecular Medicine, School of Medicine, Qazvin university of Medical Sciences, Qazvin, IR Iran 2Department of Bioinformatics, National Institute of Genetic Engineering and Biotechnology (NIGEB), Tehran, IR Iran 3Department of Pharmacology, Cellular and Molecular Research Center, School of Medicine, Qazvin university of Medical Sciences, Qazvin, IR Iran 4Department of Molecular Genetics, National Institute of Genetic Engineering and Biotechnology (NIGEB), Tehran, IR Iran *Corresponding author: Marjan Nassiri-Asl, School of Medicine, Qazvin University of Medical Sciences, Qazvin, IR Iran. Tel: +98-2833336001, Fax: +98-2833324971, E-mail: [email protected] Received 2016 April 06; Revised 2016 May 30; Accepted 2016 June 22. Abstract Background: Recent neuroinformatic studies, on the structure-function interaction of proteins, causative agents basis of human disease have implied that dysfunction or defect of different protein classes could be associated with several related diseases. Objectives: The aim of this study was the use of bioinformatics approaches for understanding the structure, function and relation- ship of myelin protein 2 (PMP2), a myelin-basic protein in the basis of neuronal disorders. Methods: A collection of databases for exploiting classification information systematically, including, protein structure, protein family and classification of human disease, based on a new approach was used. -
Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P. -
Oral Absorption of Peptides and Nanoparticles Across the Human Intestine: Opportunities, Limitations and Studies in Human Tissues☆
Advanced Drug Delivery Reviews 106 (2016) 256–276 Contents lists available at ScienceDirect Advanced Drug Delivery Reviews journal homepage: www.elsevier.com/locate/addr Oral absorption of peptides and nanoparticles across the human intestine: Opportunities, limitations and studies in human tissues☆ P. Lundquist, P. Artursson ⁎ Department of Pharmacy, Uppsala University, Box 580, SE-752 37 Uppsala, Sweden article info abstract Article history: In this contribution, we review the molecular and physiological barriers to oral delivery of peptides and nanopar- Received 2 May 2016 ticles. We discuss the opportunities and predictivity of various in vitro systems with special emphasis on human Received in revised form 2 July 2016 intestine in Ussing chambers. First, the molecular constraints to peptide absorption are discussed. Then the phys- Accepted 8 July 2016 iological barriers to peptide delivery are examined. These include the gastric and intestinal environment, the Available online 3 August 2016 mucus barrier, tight junctions between epithelial cells, the enterocytes of the intestinal epithelium, and the Keywords: subepithelial tissue. Recent data from human proteome studies are used to provide information about the protein fi Oral drug delivery expression pro les of the different physiological barriers to peptide and nanoparticle absorption. Strategies that Peptide drugs have been employed to increase peptide absorption across each of the barriers are discussed. Special consider- Nanoparticles ation is given to attempts at utilizing endogenous transcytotic pathways. To reliably translate in vitro data on Ussing chamber peptide or nanoparticle permeability to the in vivo situation in a human subject, the in vitro experimental system Peptide permeability needs to realistically capture the central aspects of the mentioned barriers. -
Propranolol-Mediated Attenuation of MMP-9 Excretion in Infants with Hemangiomas
Supplementary Online Content Thaivalappil S, Bauman N, Saieg A, Movius E, Brown KJ, Preciado D. Propranolol-mediated attenuation of MMP-9 excretion in infants with hemangiomas. JAMA Otolaryngol Head Neck Surg. doi:10.1001/jamaoto.2013.4773 eTable. List of All of the Proteins Identified by Proteomics This supplementary material has been provided by the authors to give readers additional information about their work. © 2013 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 10/01/2021 eTable. List of All of the Proteins Identified by Proteomics Protein Name Prop 12 mo/4 Pred 12 mo/4 Δ Prop to Pred mo mo Myeloperoxidase OS=Homo sapiens GN=MPO 26.00 143.00 ‐117.00 Lactotransferrin OS=Homo sapiens GN=LTF 114.00 205.50 ‐91.50 Matrix metalloproteinase‐9 OS=Homo sapiens GN=MMP9 5.00 36.00 ‐31.00 Neutrophil elastase OS=Homo sapiens GN=ELANE 24.00 48.00 ‐24.00 Bleomycin hydrolase OS=Homo sapiens GN=BLMH 3.00 25.00 ‐22.00 CAP7_HUMAN Azurocidin OS=Homo sapiens GN=AZU1 PE=1 SV=3 4.00 26.00 ‐22.00 S10A8_HUMAN Protein S100‐A8 OS=Homo sapiens GN=S100A8 PE=1 14.67 30.50 ‐15.83 SV=1 IL1F9_HUMAN Interleukin‐1 family member 9 OS=Homo sapiens 1.00 15.00 ‐14.00 GN=IL1F9 PE=1 SV=1 MUC5B_HUMAN Mucin‐5B OS=Homo sapiens GN=MUC5B PE=1 SV=3 2.00 14.00 ‐12.00 MUC4_HUMAN Mucin‐4 OS=Homo sapiens GN=MUC4 PE=1 SV=3 1.00 12.00 ‐11.00 HRG_HUMAN Histidine‐rich glycoprotein OS=Homo sapiens GN=HRG 1.00 12.00 ‐11.00 PE=1 SV=1 TKT_HUMAN Transketolase OS=Homo sapiens GN=TKT PE=1 SV=3 17.00 28.00 ‐11.00 CATG_HUMAN Cathepsin G OS=Homo -
RBP2 Belongs to a Family of Demethylases, Specific For
View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector RBP2 Belongs to a Family of Demethylases, Specific for Tri- and Dimethylated Lysine 4 on Histone 3 Jesper Christensen,1,2,4 Karl Agger,1,2,4 Paul A.C. Cloos,1,2,4 Diego Pasini,1,2 Simon Rose,2 Lau Sennels,3 Juri Rappsilber,3 Klaus H. Hansen,1,2 Anna Elisabetta Salcini,2,* and Kristian Helin1,2,* 1 Centre for Epigenetics 2 Biotech Research and Innovation Centre (BRIC) University of Copenhagen, Ole Maaløes Vej 5, 2200 Copenhagen, Denmark 3 Wellcome Trust Centre for Cell Biology, University of Edinburgh, Edinburgh, EH9 3JR, UK 4 These authors contributed equally to this work. *Correspondence: [email protected] (K.H.), [email protected] (A.E.S.) DOI 10.1016/j.cell.2007.02.003 SUMMARY activity (Strahl and Allis, 2000; Turner, 2000). Thus, some of these modifications appear to play important roles in Methylation of histones has been regarded as dividing the genome into transcriptionally active and a stable modification defining the epigenetic inactive areas. program of the cell, which regulates chromatin As an example of this, tri- and dimethylation of histone structure and transcription. However, the recent H3 at lysine 4 (H3K4me3/me2) is restricted to euchromatin discovery of histone demethylases has chal- and is generally associated with active transcription (Sims lenged the stable nature of histone methylation. and Reinberg, 2006). The H3K4 tri- and dimethylation marks may facilitate transcription by the recruitment of nu- Here we demonstrate that the JARID1 proteins cleosome remodeling complexes and histone-modifying RBP2, PLU1, and SMCX are histone demethy- enzymes or by preventing transcriptional repressors lases specific for di- and trimethylated histone from binding to chromatin. -
BD Pharmingen™ PE Rat Anti-Human Integrin Β7
BD Pharmingen™ Technical Data Sheet PE Rat Anti-Human Integrin β7 Product Information Material Number: 555945 Size: 100 tests Vol. per Test: 20 µl Clone: FIB504 Isotype: Rat (SD) IgG2a, κ Reactivity: QC Testing: Human Workshop: VI A024, VI 6T-101 Storage Buffer: Aqueous buffered solution containing BSA and ≤0.09% sodium azide. Description FIB504 reacts with mouse integrin β7 subunit (130 kD) but also cross reacts with human integrin β7. Integrin β7 associates with α4 (CD49d) expressed on subsets of lymphocytes and thymus. It also associates with αIEL (CD103) expressed on T cells adjacent to mucosal epithelium and intraepithelial lymphocytes. Integrin β7 plays an important role in the adhesion of leukocytes to endothelial cells promoting the transmigration of leukocytes to extravascular spaces during the inflammatory response. Profile of peripheral blood lymphocytes analyzed on a FACScan (BDIS, San Jose, CA) Preparation and Storage The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography. The antibody was conjugated with R-PE under optimum conditions, and unconjugated antibody and free PE were removed by gel filtration chromatography. Store undiluted at 4° C and protected from prolonged exposure to light. Do not freeze. Application Notes Application Flow cytometry Routinely Tested Suggested Companion Products Catalog Number Name Size Clone 555844 PE Rat IgG2a, κ Isotype Control 100 tests R35-95 555945 Rev. 3 Page 1 of 2 Product Notices 1. This reagent has been pre-diluted for use at the recommended Volume per Test. We typically use 1 X 10e6 cells in a 100-µl experimental sample (a test). 2. -
ONLINE SUPPLEMENTARY TABLE Table 2. Differentially Expressed
ONLINE SUPPLEMENTARY TABLE Table 2. Differentially Expressed Probe Sets in Livers of GK Rats. A. Immune/Inflammatory (67 probe sets, 63 genes) Age Strain Probe ID Gene Name Symbol Accession Gene Function 5 WKY 1398390_at small inducible cytokine B13 precursor Cxcl13 AA892854 chemokine activity; lymph node development 5 WKY 1389581_at interleukin 33 Il33 BF390510 cytokine activity 5 WKY *1373970_at interleukin 33 Il33 AI716248 cytokine activity 5 WKY 1369171_at macrophage stimulating 1 (hepatocyte growth factor-like) Mst1; E2F2 NM_024352 serine-throenine kinase; tumor suppression 5 WKY 1388071_x_at major histocompatability antigen Mhc M24024 antigen processing and presentation 5 WKY 1385465_at sialic acid binding Ig-like lectin 5 Siglec5 BG379188 sialic acid-recognizing receptor 5 WKY 1393108_at major histocompatability antigen Mhc BM387813 antigen processing and presentation 5 WKY 1388202_at major histocompatability antigen Mhc BI395698 antigen processing and presentation 5 WKY 1371171_at major histocompatability antigen Mhc M10094 antigen processing and presentation 5 WKY 1370382_at major histocompatability antigen Mhc BI279526 antigen processing and presentation 5 WKY 1371033_at major histocompatability antigen Mhc AI715202 antigen processing and presentation 5 WKY 1383991_at leucine rich repeat containing 8 family, member E Lrrc8e BE096426 proliferation and activation of lymphocytes and monocytes. 5 WKY 1383046_at complement component factor H Cfh; Fh AA957258 regulation of complement cascade 4 WKY 1369522_a_at CD244 natural killer -
Supplementary Table 1: Adhesion Genes Data Set
Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like, -
CD Markers Are Routinely Used for the Immunophenotyping of Cells
ptglab.com 1 CD MARKER ANTIBODIES www.ptglab.com Introduction The cluster of differentiation (abbreviated as CD) is a protocol used for the identification and investigation of cell surface molecules. So-called CD markers are routinely used for the immunophenotyping of cells. Despite this use, they are not limited to roles in the immune system and perform a variety of roles in cell differentiation, adhesion, migration, blood clotting, gamete fertilization, amino acid transport and apoptosis, among many others. As such, Proteintech’s mini catalog featuring its antibodies targeting CD markers is applicable to a wide range of research disciplines. PRODUCT FOCUS PECAM1 Platelet endothelial cell adhesion of blood vessels – making up a large portion molecule-1 (PECAM1), also known as cluster of its intracellular junctions. PECAM-1 is also CD Number of differentiation 31 (CD31), is a member of present on the surface of hematopoietic the immunoglobulin gene superfamily of cell cells and immune cells including platelets, CD31 adhesion molecules. It is highly expressed monocytes, neutrophils, natural killer cells, on the surface of the endothelium – the thin megakaryocytes and some types of T-cell. Catalog Number layer of endothelial cells lining the interior 11256-1-AP Type Rabbit Polyclonal Applications ELISA, FC, IF, IHC, IP, WB 16 Publications Immunohistochemical of paraffin-embedded Figure 1: Immunofluorescence staining human hepatocirrhosis using PECAM1, CD31 of PECAM1 (11256-1-AP), Alexa 488 goat antibody (11265-1-AP) at a dilution of 1:50 anti-rabbit (green), and smooth muscle KD/KO Validated (40x objective). alpha-actin (red), courtesy of Nicola Smart. PECAM1: Customer Testimonial Nicola Smart, a cardiovascular researcher “As you can see [the immunostaining] is and a group leader at the University of extremely clean and specific [and] displays Oxford, has said of the PECAM1 antibody strong intercellular junction expression, (11265-1-AP) that it “worked beautifully as expected for a cell adhesion molecule.” on every occasion I’ve tried it.” Proteintech thanks Dr. -
Alpha;-Actinin-4 Promotes Metastasis in Gastric Cancer
Laboratory Investigation (2017) 97, 1084–1094 © 2017 USCAP, Inc All rights reserved 0023-6837/17 α-Actinin-4 promotes metastasis in gastric cancer Xin Liu and Kent-Man Chu Metastasis increases the mortality rate of gastric cancer, which is the third leading cause of cancer-associated deaths worldwide. This study aims to identify the genes promoting metastasis of gastric cancer (GC). A human cell motility PCR array was used to analyze a pair of tumor and non-tumor tissue samples from a patient with stage IV GC (T3N3M1). Expression of the dysregulated genes was then evaluated in GC tissue samples (n = 10) and cell lines (n =6) via qPCR. Expression of α-actinin-4 (ACTN4) was validated in a larger sample size (n = 47) by qPCR, western blot and immunohistochemistry. Knockdown of ACTN4 with specific siRNAs was performed in GC cells, and adhesion assays, transwell invasion assays and migration assays were used to evaluate the function of these cells. Expression of potential targets of ACTN4 were then evaluated by qPCR. Thirty upregulated genes (greater than twofold) were revealed by the PCR array. We focused on ACTN4 because it was upregulated in 6 out of 10 pairs of tissue samples and 5 out of 6 GC cell lines. Further study indicated that ACTN4 was upregulated in 22/32 pairs of tissue samples at stage III & IV (P = 0.0069). Knockdown of ACTN4 in GC cells showed no significant effect on cell proliferation, but significantly increased cell-matrix adhesion, as well as reduced migration and invasion of AGS, MKN7 and NCI-N87 cells. -
Downloaded from Or Mesak Et Al
Mesak et al. BMC Genomics (2015) 16:989 DOI 10.1186/s12864-015-2210-0 RESEARCH ARTICLE Open Access Transcriptomics of diapause in an isogenic self-fertilizing vertebrate Felix Mesak1,2*, Andrey Tatarenkov1 and John C. Avise1 Abstract Background: Many vertebrate species have the ability to undergo weeks or even months of diapause (a temporary arrest of development during early ontogeny). Identification of diapause genes has been challenging due in part to the genetic heterogeneity of most vertebrate animals. Results: Here we take the advantage of the mangrove rivulus fish (Kryptolebias marmoratus or Kmar)—the only vertebrate that is extremely inbred due to consistent self-fertilization—to generate isogenic lineages for transcriptomic dissection. Because the Kmar genome is not publicly available, we built de novo genomic (642 Mb) and transcriptomic assemblies to serve as references for global genetic profiling of diapause in Kmar, via RNA-Seq. Transcripts unique to diapause in Kmar proved to constitute only a miniscule fraction (0.1 %) of the total pool of transcribed products. Most genes displayed lower expression in diapause than in post-diapause. However, some genes (notably dusp27, klhl38 and sqstm1) were significantly up-regulated during diapause, whereas others (col9a1, dspp and fmnl1) were substantially down-regulated, compared to both pre-diapause and post-diapause. Conclusion: Kmar offers a strong model for understanding patterns of gene expression during diapause. Our study highlights the importance of using a combination of genome and transcriptome assemblies as references for NGS-based RNA-Seq analyses. As for all identified diapause genes, in future studies it will be critical to link various levels of RNA expression with the functional roles of the coded products.