DOCSLIB.ORG

Supplementary Table 1: Selected Gene Products Used in Cdna Based Array 31

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supplementary Table 1: Selected Gene Products Used in Cdna Based Array 31 Supplementary Table 1: Selected gene products used in cDNA based array 31. Betacellulin BC011618 analysis 32. 3beta hydroxysteroid dehydrogenase M27137 33. 17beta hydroxy steroid degydrogenase BC020710 Serial Gene name (GenBank accession #) 34. Bone morphogenetic protein 1 M22488 35. Bone morphogenetic protein 2 M22489 1. Actin beta X00351 36. Bone morphogenetic protein 3 M22491 2. Actinin alpha 1 X15804 37. Bone morphogenetic protein 4 D30751 3. Actinin alpha 2 M86406 38. Bone morphogenetic protein 5 M60314 4. Actinin alpha 3 M86407 39. Bone morphogenetic protein 6 M60315 5. Activin A receptor type II-like 1 L17075 40. Bone morphogenetic protein 7 M60316 6. Activin A receptor type IB U14722 41. Bone morphogenetic protein 8 M97016 7. Actvin A receptor type II X77533 42. Bradykinin NM_000623 8. Alpha 1anti-trypsin K01396 43. Bradykinin beta2 receptor M88714 9. Alpha fetoproteinV V51514 44. Bystin L36720 10. Alphav beta3 integrin NM_002210 45. C3 complement AY513239 11. Alpha macroglobulin 1 M163959 46. Cdx 2 U51096 12. Alpha macroglobulin 2 M11313 47. C-fos U62538 13. 5alpha reductase NM_000348 48. C-jun NM_002228 14. 17 alpha hydroxylase AH002665 49. C-myc V00568 15. Aminopeptidase A L12468 50. CA 125 EF026424 16. Aminopeptidase N NM_001935 51. Cadherin P X63629 17. Amphiregulin L41352 52. Calcitonin alpha J00109 18. Androgen receptor M20132 53. Calcitonin beta BC093468 19. Angiopoietin 1 U83508 54. Calcitonin receptor L00587 20. Angiotensin receptor 1 M87290 55. Cardiotrophin 1 U43030 21. Angiopoietin 2 NM_001147 56. Cathepsin B M14221 22. Apolipoprotein E M12529 57. Cathepsin D M11233 23. Apolipoprotein J NM_001831 58. Cathepsin L X12451 24. Arachidonate 5-lipooxygenase J03571 59. CD10 Y00811 25. Aromatase P450 NM_00078 60. CD44 M59040 26. Autocrine motility factor receptor L35233 61. CD58 Y00636 27. AXL receptor tyrosine kinase M76125 62. CD63 NM_001780 28. Basigin AY942196 63. Chemokine (C-C motif) receptor 1 D10925 29. B-cell growth factor M15530 64. Chemokine (C-C motif) receptor 2 U03882 30. Beta-catenin AY436643 65. Chemokine (C-X-C motif) receptor 4 D10924 66. Ciliary neurotrophic factor (CNTF) A26792 101. EGF receptor X00588 67. Ciliary neurotrophic factor receptor M73238 102. Elongation factor 1 alpha AF458103 68. Collagen IV alpha 1 M11315 103. Endoglin J05481 69. Collagen IV alpha 2 X05610 104. Endothelin 1 Y00749 70. Collagen IV alpha 3 M92993 105. Endothelin 2 M65199 71. Collagen IV alpha 4 D17391 106. Endothelin 3 J05081 72. Collagen IV alpha 5 M31115 107. Endothelin receptor type A L06622 73. Collagen IV alpha 6 D21337 108. Endothelin receptor type B D90402 74. Collagen VI alpha 1 M20776 109. Enigma BC067806 75. Collagen VI alpha 2 M34570 110. Epiregulin D30783 76. Coagulation factor II receptor M62424 111. ErbB1 U71126 77. Collagenase X05231 112. ErbB2 NM_100586 78. Colony stimulating factor (CSF) 1 NM_000757 113. ErbB3 NM_00198 79. CSF 2 M11220 114. ErbB4 AF060555 80. CSF 3 X03438 115. Estrogen receptor A M12674 81. CSF 1receptor (c-fms) M33208 116. Estrogen receptor B AF074599 82. CSF 2 receptor A X17648 117. FGF acidic FGF1 X51943 83. CSF 2 receptor B M59941 118. FGF basic FGF2 M27968 84. CSF 3 receptor M59818 119. FGF R1 M34641 85. COX 1 HSU63846 120. FGF R2 U11814 86. COX 2 U04636 121. FGF R3 M58051 87. CRH V00571 122. Fibronectin X02761 88. CRH receptor 1 X500 123. Flt 1 NM_002019 89. C-sre kinase NM_004064 124. Flt 4 NM_182925 90. Cyclin 4 inhibitor NM_004064 125. Follistatin-like1 M19481 91. Cyclin B1 M25753 126. Frizzled 1 AB017363 92. Cyclin D2 D13639 127. Frizzled 2 L37882 93. Cystatin C X05607 128. Frizzled 3 AY005130 94. 17,20- desmolase U14953 129. Frizzled 4 BC114622 95. DDEF2 NM_003887 130. Frizzled 5 U43318 96. Dickkopf 1 AB020315 131. Frizzled 6 AB012911 97. Dkk 1 NM_012242 132. Frizzled 7 AB017365 98. DLX4 NM_138281 133. Frizzled 8 AB043703 99. E cadherin Z13009 134. Frizzled 9 U82169 100. EGF X04571 135. FSH NM_181446 136. FSH receptor M65085 171. Hydroxyprostaglandin dehydrogenase NM_000860 137. G3PDH X01677 172. ICAM 1 J03132 138. GnRH1 BC176437 173. ICAM 2 AF340052 139. GRO1 NM_001511 174. IGF 1 M27544 140. GRO2 NM_002089 175. IGF 2 M29645 141. Glycoprotein Ib platelet beta L20860 176. IGF1 R X04434 142. Gp 130 EF064722 177. IGF2 R Y00285 143. Glycogen synthetase kinase 3 beta BC000251 178. IGFBP 1 M31145 144. Haptoglobin X00637 179. IGFBP 2 M35410 145. Human chorionic gonadotropin (HCG) AY083664 180. IGFBP 3 M31159 146. HCG alpha BC010957 181. IGFBP 4 M62403 147. HSP 27 X54079 182. IGFBP 5 M65062 148. HSP 60 M34664 183. Inhibin alpha M13981 149. HSP 70 M11717 184. Inhibin beta A J03634 150. Heparan sulphate proteoglycan M85289 185. Inhibin beta B M31669 151. HB- EGF like growth factor L36024 186. Inhibin beta C X82540 152. Heregulin 1 AF009227 187. Insulin receptor M10051 153. hFAT X87241 188. IL1 converting enzyme NM_033293 154. HGF M60718 189. IL1 receptor antagonist IL 1 alpha M63099 155. HGF receptor NM_004712 190. IL 1beta K02770 156. Histone H2A U90551 191. IL 1Rt1 M27492 157. Histone H2B AJ223352 192. IL 1Rt2 X59770 158. Histone H3 AF531274 193. IL 8 Y00787 159. Histone H4 AF525682 194. IL 11 M57765 160. Histone deacetylase A NM_058177 195. IL 15 U14407 161. Histone deacetylase 1 D50405 196. IL 11R B4298 162. Histone deacetylase 2 U31814 197. IL 3 M14743 163. Histone deacetylase 3 AF005482 198. IL 6 X04602 164. Histone deacetylase 6 NM_006044 199. IL 8 RM20566 165. HOX 7 M97676 200. IL 8Ralpha M68932 166. HOX A9 U41813 201. IL 8Rbeta M94582 167. HOX A10 L08757 202. IL 4 STAT v1 NM_000589 168. HOX A11 AF039307 203. Integrin alpha 2 M28249 169. HOX A13 U82827 204. Integrin alpha 3 M59911 170. HPRT NM_000194 205. Integrin alpha 4 L12002 206. Integrin alpha 5 X06256 241. LH receptor M63108 207. Integrin alpha 6 X53586 242. LIF X13967 208. Integrin alpha 8 L36531 243. LIF receptor X61615 209. Integrin alphaV M14648 244. Macroglobulin 1 NM_144670 210. Integrin beta 1 X07979 245. Metallothionin 2 S52379 211. Integrin beta 2 M15395 246. Metallothionin 3 D13365 212. Integrin beta 3 J02703 247. MIF NM_002415 213. Integrin beta 4 X53587 248. MIP 1alpha U97575 214. Integrin beta 5 J05633 249. MIP 1 beta AF457195 215. Interferron alpha J000207 250. MMP 1 X05231 216. Interferron gamma (IFN G) X01992 251. MMP 2 J03210 217. IFNG R1 NM_000416 252. MMP 3 X05232 218. IFNGR2 NM_005534 253. MMP 7 X07819 219. IRF1 BC009483 254. MMP 9 J05070 220. JAK 1 M35203 255. MMP 10 X07820 221. JAK 2A AF005216 256. MMP 11 X57766 222. JAK 3 U09607 257. MMP 12 L23808 223. JunB M29039 258. MMP 13 X75308 224. KDR NM_002253 259. MMP 14 D26512 225. Keratan sulphotranferase 1 AF219990 260. MMP 15 Z48482 226. Keratin 8 M34225 261. MMP 16 D83646 227. Keratinocyte growth factor (KGF) M60828 262. MMP 17 X89576 228. KGFR U11814 263. MMP 19 X92521 229. Lactoferrin NM_002343 264. MMP 21 NM_147191 230. Laminin alpha2 Z26653 265. Mucin 1 NM_182741 231. Laminin alpha3 L34155 266. Mucin 2 L21998 232. Laminin beta1 M61916 267. Mucin 4 NM_018406 233. Laminin beta2 S77512 268. Mucin 5AC AJ001402 234. Laminin beta3 L25541 269. Mucin 5B U78551 235. Laminin gamma1 J03202 270. Mucin 6 NM_005961 236. Laminin gamma2 Z15009 271. NCAM (CD56) BC029119 237. Lef-1 AY129650 272. NFκB BC093004 238. Leptin U43415 273. NkX5-1 (Hmx 3) AY882602 239. Leptin receptor U43168 274. N-myc (STAT) interactor U32849 240. LH M63108 275. NOS 1 NM_000620 276. NOS 2 NM_000625 311. P450 aromatase NM_031226 277. NOS 3 NM_000603 312. Profinin NM_022752 278. Oncostatin M M27288 313. Progesterone receptor A AF279335 279. Oncostatin M receptor U60805 314. Progesterone receptor B AY382152 280. Osteopontin J04765 315. Prolactin NM_000948 281. Oxytocin BC101843 316. Prolactin receptor S78505 282. Oxytocin receptor X64878 317. Prolactin releasing peptide AB048946 283. PAF acetylhydroxylase alpha XM_112738 318. Proline-serine-threonine phospsphatase NM_003978 284. PAF acetylhydroxylase gamma D63391 interacting protein-1 285. PAF receptor D10202 319. Protein kinase C NM_005400 286. PAI-1 NM_000602 320. Protein kinase C alpha M22199 287. PAI-2 BC096217 321. PSG 11 U25987 288. PAI-3 NM_002638 322. PAPPA U28727 289. Pappalysin 1 NM_002581 323. Pregnancy zone protein NM_002864 290. PDGF A X06374 324. RANTES AF043341 291. PDGF B X02811 325. Ras p21 BC007353 292. PDGF A receptor M21574 326. Ras p21 protein activator M23379 293. PDGF B receptor M21616 327. Relaxin BC126415 294. PECAM 1 NM_00042 328. Retoinic acid binding protein CRABP1 NM_004378 295. Phospholipase A2 cytoplasmic AF064594 329. Retoinic acid binding protein CRABP S74445 296. Phospholipase C alpha D16234 330. Retenoid RAR A BC008727 297. Pleiotrophin BC005916 331. Retenoid RAR B AY501390 298. PLGF S72960 332. Retenoid RAR G M24857 299. POMC CR541826 333. Retenoid RXR B M84820 300. PP14 J04129 334. Retinol binding protein RBP1 NM_002899 301. PGE2 alpha R EP1 L22647 335. Retinol binding protein RBP2 BC069513 302. PGE2 alpha R EP2 U19487 336. Ribosomal protein S7 BC061901 303. PGE2 alpha R EP3 S69200 337. Ribosomal protein S9 U14971 304. PGE2 alpha R EP4 L25124 338. Selectin E M30640 305. PGF2 alpha AF004021 339. Selectin L M25280 306. PGF receptor L24470 340. Selectin P M25322 307. PGF2 receptor AFO004021 341. Sfrp-1 BC036503 308. PGD synthase NM_000954 342. Sfrp-2 BC008666 309. PGI2 synthase D38145 343. Sfrp-4 BC058911 310. PGI 2 receptor D25418 344. SOCS2 BC010399 345. SOCS3 NM_003955 380. TIMP3 Z30183 346. SOCS4 BC060790 381. TNF alpha X02910 347. SOCS5 BC032862 382. TNF beta X02911 348. SOD1 NM_000454 383. TNF R1 NM_001065 349. Sp1 transcription factor NM_138473 384. TNF R2 NM_147187 350. Splicing factor SC35 M90104 385. TPA X13097 351. STAT 1 M97935 386. Transthyretin K02091 352. STAT 2 M97934 387. Tumor suppressor p21 AF040707 353. STAT 3 L29277 388.
Load more

Recommended publications
  • View of the Literature
    Roles of Adipose Tissue-Derived Factors in Adipose Tissue Development and Lipid Metabolism Dissertation Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University By Jinsoo Ahn, M.S. Graduate Program in Ohio State University Nutrition The Ohio State University 2015 Dissertation Committee: Kichoon Lee, Ph.D., Advisor Earl H. Harrison, Ph.D. Ramesh Selvaraj, Ph.D. Ouliana Ziouzenkova, Ph.D. Copyright by Jinsoo Ahn 2015 Abstract Obesity is a global trend and major risk factor for serious diseases including type 2 diabetes, heart disease, and hypertension. Obesity is characterized by excess fat accumulation, especially in the visceral area. The pathogenic effects related to common obesity are largely attributed to dysregulated secretion of adipokines followed by insulin resistance in peripheral tissues when adipose tissue mass is altered. White adipose tissue serves as a dynamic endocrine organ as well as a major energy reservoir for whole-body energy homeostasis. Adipokines influence various metabolic processes in the body including adipocyte differentiation; however, precise physiological roles of adipokines need to be further investigated. In addition, a large proportion of adipokines still needs to be identified. Information from the gene expression omnibus (GEO) profile, a public repository for microarray data, combined with confirmatory studies on mRNA and protein expression were used to identify a novel adipose tissue-specific gene, chordin-like 1 (Chrdl1). Further analysis showed that Chrdl1 encodes a putative secreted protein which is a new adipokine. Chrdl1 expression increases during 3T3-L1 adipocyte development in vitro and mouse adipose tissue development in vivo.
    [Show full text]
  • Bioinformatics Approach for Pattern of Myelin-Specific Proteins And
    CORE Metadata, citation and similar papers at core.ac.uk Provided by Qazvin University of Medical Sciences Repository Biotech Health Sci. 2016 November; 3(4):e38278. doi: 10.17795/bhs-38278. Published online 2016 August 16. Research Article Bioinformatics Approach for Pattern of Myelin-Specific Proteins and Related Human Disorders Samiie Pouragahi,1,2,3 Mohammad Hossein Sanati,4 Mehdi Sadeghi,2 and Marjan Nassiri-Asl3,* 1Department of Molecular Medicine, School of Medicine, Qazvin university of Medical Sciences, Qazvin, IR Iran 2Department of Bioinformatics, National Institute of Genetic Engineering and Biotechnology (NIGEB), Tehran, IR Iran 3Department of Pharmacology, Cellular and Molecular Research Center, School of Medicine, Qazvin university of Medical Sciences, Qazvin, IR Iran 4Department of Molecular Genetics, National Institute of Genetic Engineering and Biotechnology (NIGEB), Tehran, IR Iran *Corresponding author: Marjan Nassiri-Asl, School of Medicine, Qazvin University of Medical Sciences, Qazvin, IR Iran. Tel: +98-2833336001, Fax: +98-2833324971, E-mail: [email protected] Received 2016 April 06; Revised 2016 May 30; Accepted 2016 June 22. Abstract Background: Recent neuroinformatic studies, on the structure-function interaction of proteins, causative agents basis of human disease have implied that dysfunction or defect of different protein classes could be associated with several related diseases. Objectives: The aim of this study was the use of bioinformatics approaches for understanding the structure, function and relation- ship of myelin protein 2 (PMP2), a myelin-basic protein in the basis of neuronal disorders. Methods: A collection of databases for exploiting classification information systematically, including, protein structure, protein family and classification of human disease, based on a new approach was used.
    [Show full text]
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Oral Absorption of Peptides and Nanoparticles Across the Human Intestine: Opportunities, Limitations and Studies in Human Tissues☆
    Advanced Drug Delivery Reviews 106 (2016) 256–276 Contents lists available at ScienceDirect Advanced Drug Delivery Reviews journal homepage: www.elsevier.com/locate/addr Oral absorption of peptides and nanoparticles across the human intestine: Opportunities, limitations and studies in human tissues☆ P. Lundquist, P. Artursson ⁎ Department of Pharmacy, Uppsala University, Box 580, SE-752 37 Uppsala, Sweden article info abstract Article history: In this contribution, we review the molecular and physiological barriers to oral delivery of peptides and nanopar- Received 2 May 2016 ticles. We discuss the opportunities and predictivity of various in vitro systems with special emphasis on human Received in revised form 2 July 2016 intestine in Ussing chambers. First, the molecular constraints to peptide absorption are discussed. Then the phys- Accepted 8 July 2016 iological barriers to peptide delivery are examined. These include the gastric and intestinal environment, the Available online 3 August 2016 mucus barrier, tight junctions between epithelial cells, the enterocytes of the intestinal epithelium, and the Keywords: subepithelial tissue. Recent data from human proteome studies are used to provide information about the protein fi Oral drug delivery expression pro les of the different physiological barriers to peptide and nanoparticle absorption. Strategies that Peptide drugs have been employed to increase peptide absorption across each of the barriers are discussed. Special consider- Nanoparticles ation is given to attempts at utilizing endogenous transcytotic pathways. To reliably translate in vitro data on Ussing chamber peptide or nanoparticle permeability to the in vivo situation in a human subject, the in vitro experimental system Peptide permeability needs to realistically capture the central aspects of the mentioned barriers.
    [Show full text]
  • Propranolol-Mediated Attenuation of MMP-9 Excretion in Infants with Hemangiomas
    Supplementary Online Content Thaivalappil S, Bauman N, Saieg A, Movius E, Brown KJ, Preciado D. Propranolol-mediated attenuation of MMP-9 excretion in infants with hemangiomas. JAMA Otolaryngol Head Neck Surg. doi:10.1001/jamaoto.2013.4773 eTable. List of All of the Proteins Identified by Proteomics This supplementary material has been provided by the authors to give readers additional information about their work. © 2013 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 10/01/2021 eTable. List of All of the Proteins Identified by Proteomics Protein Name Prop 12 mo/4 Pred 12 mo/4 Δ Prop to Pred mo mo Myeloperoxidase OS=Homo sapiens GN=MPO 26.00 143.00 ‐117.00 Lactotransferrin OS=Homo sapiens GN=LTF 114.00 205.50 ‐91.50 Matrix metalloproteinase‐9 OS=Homo sapiens GN=MMP9 5.00 36.00 ‐31.00 Neutrophil elastase OS=Homo sapiens GN=ELANE 24.00 48.00 ‐24.00 Bleomycin hydrolase OS=Homo sapiens GN=BLMH 3.00 25.00 ‐22.00 CAP7_HUMAN Azurocidin OS=Homo sapiens GN=AZU1 PE=1 SV=3 4.00 26.00 ‐22.00 S10A8_HUMAN Protein S100‐A8 OS=Homo sapiens GN=S100A8 PE=1 14.67 30.50 ‐15.83 SV=1 IL1F9_HUMAN Interleukin‐1 family member 9 OS=Homo sapiens 1.00 15.00 ‐14.00 GN=IL1F9 PE=1 SV=1 MUC5B_HUMAN Mucin‐5B OS=Homo sapiens GN=MUC5B PE=1 SV=3 2.00 14.00 ‐12.00 MUC4_HUMAN Mucin‐4 OS=Homo sapiens GN=MUC4 PE=1 SV=3 1.00 12.00 ‐11.00 HRG_HUMAN Histidine‐rich glycoprotein OS=Homo sapiens GN=HRG 1.00 12.00 ‐11.00 PE=1 SV=1 TKT_HUMAN Transketolase OS=Homo sapiens GN=TKT PE=1 SV=3 17.00 28.00 ‐11.00 CATG_HUMAN Cathepsin G OS=Homo
    [Show full text]
  • RBP2 Belongs to a Family of Demethylases, Specific For
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector RBP2 Belongs to a Family of Demethylases, Specific for Tri- and Dimethylated Lysine 4 on Histone 3 Jesper Christensen,1,2,4 Karl Agger,1,2,4 Paul A.C. Cloos,1,2,4 Diego Pasini,1,2 Simon Rose,2 Lau Sennels,3 Juri Rappsilber,3 Klaus H. Hansen,1,2 Anna Elisabetta Salcini,2,* and Kristian Helin1,2,* 1 Centre for Epigenetics 2 Biotech Research and Innovation Centre (BRIC) University of Copenhagen, Ole Maaløes Vej 5, 2200 Copenhagen, Denmark 3 Wellcome Trust Centre for Cell Biology, University of Edinburgh, Edinburgh, EH9 3JR, UK 4 These authors contributed equally to this work. *Correspondence: [email protected] (K.H.), [email protected] (A.E.S.) DOI 10.1016/j.cell.2007.02.003 SUMMARY activity (Strahl and Allis, 2000; Turner, 2000). Thus, some of these modifications appear to play important roles in Methylation of histones has been regarded as dividing the genome into transcriptionally active and a stable modification defining the epigenetic inactive areas. program of the cell, which regulates chromatin As an example of this, tri- and dimethylation of histone structure and transcription. However, the recent H3 at lysine 4 (H3K4me3/me2) is restricted to euchromatin discovery of histone demethylases has chal- and is generally associated with active transcription (Sims lenged the stable nature of histone methylation. and Reinberg, 2006). The H3K4 tri- and dimethylation marks may facilitate transcription by the recruitment of nu- Here we demonstrate that the JARID1 proteins cleosome remodeling complexes and histone-modifying RBP2, PLU1, and SMCX are histone demethy- enzymes or by preventing transcriptional repressors lases specific for di- and trimethylated histone from binding to chromatin.
    [Show full text]
  • BD Pharmingen™ PE Rat Anti-Human Integrin Β7
    BD Pharmingen™ Technical Data Sheet PE Rat Anti-Human Integrin β7 Product Information Material Number: 555945 Size: 100 tests Vol. per Test: 20 µl Clone: FIB504 Isotype: Rat (SD) IgG2a, κ Reactivity: QC Testing: Human Workshop: VI A024, VI 6T-101 Storage Buffer: Aqueous buffered solution containing BSA and ≤0.09% sodium azide. Description FIB504 reacts with mouse integrin β7 subunit (130 kD) but also cross reacts with human integrin β7. Integrin β7 associates with α4 (CD49d) expressed on subsets of lymphocytes and thymus. It also associates with αIEL (CD103) expressed on T cells adjacent to mucosal epithelium and intraepithelial lymphocytes. Integrin β7 plays an important role in the adhesion of leukocytes to endothelial cells promoting the transmigration of leukocytes to extravascular spaces during the inflammatory response. Profile of peripheral blood lymphocytes analyzed on a FACScan (BDIS, San Jose, CA) Preparation and Storage The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography. The antibody was conjugated with R-PE under optimum conditions, and unconjugated antibody and free PE were removed by gel filtration chromatography. Store undiluted at 4° C and protected from prolonged exposure to light. Do not freeze. Application Notes Application Flow cytometry Routinely Tested Suggested Companion Products Catalog Number Name Size Clone 555844 PE Rat IgG2a, κ Isotype Control 100 tests R35-95 555945 Rev. 3 Page 1 of 2 Product Notices 1. This reagent has been pre-diluted for use at the recommended Volume per Test. We typically use 1 X 10e6 cells in a 100-µl experimental sample (a test). 2.
    [Show full text]
  • ONLINE SUPPLEMENTARY TABLE Table 2. Differentially Expressed
    ONLINE SUPPLEMENTARY TABLE Table 2. Differentially Expressed Probe Sets in Livers of GK Rats. A. Immune/Inflammatory (67 probe sets, 63 genes) Age Strain Probe ID Gene Name Symbol Accession Gene Function 5 WKY 1398390_at small inducible cytokine B13 precursor Cxcl13 AA892854 chemokine activity; lymph node development 5 WKY 1389581_at interleukin 33 Il33 BF390510 cytokine activity 5 WKY *1373970_at interleukin 33 Il33 AI716248 cytokine activity 5 WKY 1369171_at macrophage stimulating 1 (hepatocyte growth factor-like) Mst1; E2F2 NM_024352 serine-throenine kinase; tumor suppression 5 WKY 1388071_x_at major histocompatability antigen Mhc M24024 antigen processing and presentation 5 WKY 1385465_at sialic acid binding Ig-like lectin 5 Siglec5 BG379188 sialic acid-recognizing receptor 5 WKY 1393108_at major histocompatability antigen Mhc BM387813 antigen processing and presentation 5 WKY 1388202_at major histocompatability antigen Mhc BI395698 antigen processing and presentation 5 WKY 1371171_at major histocompatability antigen Mhc M10094 antigen processing and presentation 5 WKY 1370382_at major histocompatability antigen Mhc BI279526 antigen processing and presentation 5 WKY 1371033_at major histocompatability antigen Mhc AI715202 antigen processing and presentation 5 WKY 1383991_at leucine rich repeat containing 8 family, member E Lrrc8e BE096426 proliferation and activation of lymphocytes and monocytes. 5 WKY 1383046_at complement component factor H Cfh; Fh AA957258 regulation of complement cascade 4 WKY 1369522_a_at CD244 natural killer
    [Show full text]
  • Supplementary Table 1: Adhesion Genes Data Set
    Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like,
    [Show full text]
  • CD Markers Are Routinely Used for the Immunophenotyping of Cells
    ptglab.com 1 CD MARKER ANTIBODIES www.ptglab.com Introduction The cluster of differentiation (abbreviated as CD) is a protocol used for the identification and investigation of cell surface molecules. So-called CD markers are routinely used for the immunophenotyping of cells. Despite this use, they are not limited to roles in the immune system and perform a variety of roles in cell differentiation, adhesion, migration, blood clotting, gamete fertilization, amino acid transport and apoptosis, among many others. As such, Proteintech’s mini catalog featuring its antibodies targeting CD markers is applicable to a wide range of research disciplines. PRODUCT FOCUS PECAM1 Platelet endothelial cell adhesion of blood vessels – making up a large portion molecule-1 (PECAM1), also known as cluster of its intracellular junctions. PECAM-1 is also CD Number of differentiation 31 (CD31), is a member of present on the surface of hematopoietic the immunoglobulin gene superfamily of cell cells and immune cells including platelets, CD31 adhesion molecules. It is highly expressed monocytes, neutrophils, natural killer cells, on the surface of the endothelium – the thin megakaryocytes and some types of T-cell. Catalog Number layer of endothelial cells lining the interior 11256-1-AP Type Rabbit Polyclonal Applications ELISA, FC, IF, IHC, IP, WB 16 Publications Immunohistochemical of paraffin-embedded Figure 1: Immunofluorescence staining human hepatocirrhosis using PECAM1, CD31 of PECAM1 (11256-1-AP), Alexa 488 goat antibody (11265-1-AP) at a dilution of 1:50 anti-rabbit (green), and smooth muscle KD/KO Validated (40x objective). alpha-actin (red), courtesy of Nicola Smart. PECAM1: Customer Testimonial Nicola Smart, a cardiovascular researcher “As you can see [the immunostaining] is and a group leader at the University of extremely clean and specific [and] displays Oxford, has said of the PECAM1 antibody strong intercellular junction expression, (11265-1-AP) that it “worked beautifully as expected for a cell adhesion molecule.” on every occasion I’ve tried it.” Proteintech thanks Dr.
    [Show full text]
  • Alpha;-Actinin-4 Promotes Metastasis in Gastric Cancer
    Laboratory Investigation (2017) 97, 1084–1094 © 2017 USCAP, Inc All rights reserved 0023-6837/17 α-Actinin-4 promotes metastasis in gastric cancer Xin Liu and Kent-Man Chu Metastasis increases the mortality rate of gastric cancer, which is the third leading cause of cancer-associated deaths worldwide. This study aims to identify the genes promoting metastasis of gastric cancer (GC). A human cell motility PCR array was used to analyze a pair of tumor and non-tumor tissue samples from a patient with stage IV GC (T3N3M1). Expression of the dysregulated genes was then evaluated in GC tissue samples (n = 10) and cell lines (n =6) via qPCR. Expression of α-actinin-4 (ACTN4) was validated in a larger sample size (n = 47) by qPCR, western blot and immunohistochemistry. Knockdown of ACTN4 with specific siRNAs was performed in GC cells, and adhesion assays, transwell invasion assays and migration assays were used to evaluate the function of these cells. Expression of potential targets of ACTN4 were then evaluated by qPCR. Thirty upregulated genes (greater than twofold) were revealed by the PCR array. We focused on ACTN4 because it was upregulated in 6 out of 10 pairs of tissue samples and 5 out of 6 GC cell lines. Further study indicated that ACTN4 was upregulated in 22/32 pairs of tissue samples at stage III & IV (P = 0.0069). Knockdown of ACTN4 in GC cells showed no significant effect on cell proliferation, but significantly increased cell-matrix adhesion, as well as reduced migration and invasion of AGS, MKN7 and NCI-N87 cells.
    [Show full text]
  • Downloaded from Or Mesak Et Al
    Mesak et al. BMC Genomics (2015) 16:989 DOI 10.1186/s12864-015-2210-0 RESEARCH ARTICLE Open Access Transcriptomics of diapause in an isogenic self-fertilizing vertebrate Felix Mesak1,2*, Andrey Tatarenkov1 and John C. Avise1 Abstract Background: Many vertebrate species have the ability to undergo weeks or even months of diapause (a temporary arrest of development during early ontogeny). Identification of diapause genes has been challenging due in part to the genetic heterogeneity of most vertebrate animals. Results: Here we take the advantage of the mangrove rivulus fish (Kryptolebias marmoratus or Kmar)—the only vertebrate that is extremely inbred due to consistent self-fertilization—to generate isogenic lineages for transcriptomic dissection. Because the Kmar genome is not publicly available, we built de novo genomic (642 Mb) and transcriptomic assemblies to serve as references for global genetic profiling of diapause in Kmar, via RNA-Seq. Transcripts unique to diapause in Kmar proved to constitute only a miniscule fraction (0.1 %) of the total pool of transcribed products. Most genes displayed lower expression in diapause than in post-diapause. However, some genes (notably dusp27, klhl38 and sqstm1) were significantly up-regulated during diapause, whereas others (col9a1, dspp and fmnl1) were substantially down-regulated, compared to both pre-diapause and post-diapause. Conclusion: Kmar offers a strong model for understanding patterns of gene expression during diapause. Our study highlights the importance of using a combination of genome and transcriptome assemblies as references for NGS-based RNA-Seq analyses. As for all identified diapause genes, in future studies it will be critical to link various levels of RNA expression with the functional roles of the coded products.
    [Show full text]