DOCSLIB.ORG

Molecular Mechanisms of Gene Regulation in Response to Environmental and Developmental Stimuli

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Molecular Mechanisms of Gene Regulation in Response to Environmental and Developmental Stimuli Molecular Mechanisms of Gene Regulation in Response to Environmental and Developmental Stimuli Dissertation submitted to attain the academic degree “Doctor of Natural Sciences” at the Department of Biology of the Johannes Gutenberg University Mainz by Sandra Schick born on 19.01.1987 in Mainz Mainz, 2016 Dekan: 1. Berichterstatter: 2. Berichterstatter: Tag der mündlichen Prüfung: Table of Contents Table of Contents Table of Contents…………………………………………………………………………………………………………….II List of Abbreviations………………………………………………………………………………………………………IV Abstract…………………………………………………………………………………………………………………………...X Zusammenfassung…………………………………………………………………………………………………………XI Acknowledgements…………………………………………………………………………………………..…………..XII 1. Introduction…………………………………………………………………………………………………………………1 1.1 Gene regulatory mechanisms…………………………………………………………………………….....1 1.1.1 The organization of the mammalian genome…………………………………………..…1 1.1.2 The regulation of gene expression…………………………………………………………...…3 1.1.3 Epigenetic mechanisms regulate gene expression…………………………………...…6 1.1.3.1 DNA modifications……………………………………………………………………..…7 1.1.3.2 Histone variants…………………………………………………………………………....9 1.1.3.3 Post-translational histone modifications………………………………….…11 1.1.3.4 Chromatin remodeling………………….………………………………………….…15 1.1.3.5 Non-coding RNAs……………………………………………………………………….17 1.1.3.6 Distal regulatory regions…………………………………………………………….19 1.1.3.7 Chromatin organization……………………………………………………………...21 1.2 The effect of ultraviolet light on cells…………………………………………………………….……23 1.2.1 UV light induces DNA damage…………………………………………………………….……23 1.2.2 Influence of UV exposure on gene expression…………………………………….……26 1.2.3 Chromatin changes following UV radiation………………………………………………28 1.3 Circadian rhythm……………………………..………………………………………………………………….32 1.3.1 Adaptation of organisms to circadian rhythm…………………………………………..32 1.3.2 Transcription-translation feedback loops establish the cellular circadian rhythm………………………………………………………………………………………………….….34 1.3.3 Epigenetic modulations can occur in a circadian pattern……….………………...37 1.4 Embryonic neurogenesis…………………………………………………………………………………..…41 1.4.1 Development of the central nervous system…………………………………………….41 1.4.2 Commitment of neural progenitors to neurogenesis………………………………..43 1.4.3 Transcriptional control of neural progenitor fate……………………………………...44 1.4.4 Epigenetic control of the onset of neurogenesis………………………………………48 II Table of Contents 1.5 Aims of the study………………………………………………………………………………………………..52 1.6 References…………………………………………………………………………………………………………..53 2. Results………………………………………………………………………………………………………………………..77 2.1 Chapter 1: Dynamics of chromatin accessibility and epigenetic state in response to UV damage………………………………………………………………………………...…77 2.2 Chapter 2: Identifying novel transcriptional regulators with circadian expression ………………………………………………………………………………………………………..117 2.3 Chapter 3: Mapping gene regulatory circuitry of Pax6 during neurogenesis…...157 3. Discussion and Future Perspective…………………………………………………………………………..197 3.1 Chromatin response to UV irradiation……………………………………………………..……….198 3.2 Cellular adaptation to circadian rhythm……………………………………………………………202 3.3 Regulation of cell fate change during neurogenesis……………………………………...…205 3.4 Concluding remarks……………………………………………………………………….……..…………..208 3.5 References…………………………………………………………………………………….…………..………210 4. Curriculum vitae………………………………………………………………………………….……………..…….217 III List of abbreviations List of abbreviations 5caC 5-carboxycytosine 5fC 5-formylcytosine 5hmC 5-hydroxymethylcytosine 5hmU 5-hydroxymethyluracil 5mC 5-methylcytosine 6mA N6-methyladenine 6-4PP pyrimidine 6-4 pyrimidone photoproduct ΔCT delta cycle threshold A adenine ADAM disintegrin and metalloproteinase domain-containing protein ADP adenosine diphosphate AMPK AMP kinase AP1 activator protein 1 aRG apical radial glial ARNTL, BMAL1 aryl hydrocarbon receptor nuclear translocator-like ARX homeobox protein ARX ASCL1, MASH1 achaete-scute homolog 1 ATAC assay for transposase-accessible chromatin ATM serine-protein kinase ATM, ataxia telangiectasia mutated ATP adenosine triphosphate ATR serine/threonine-protein kinase ATR, ataxia telangiectasia and Rad3-related protein bHLH basic helix-loop-helix bIP basal intermediate progenitor BMI1 polycomb complex protein BMI-1 BMP bone morphogenic protein bp base pairs BrdU bromdeoxyuridine bRG basal radial glial C cytosine CA cellular aggregates CaCl2 Calcium chloride CAF-1, CNOT7 chromatin assembly factor 1, CCR4-NOT transcription complex subunit 7 CBNLR classification by nonlinear regression analysis CBP, CREBBP CREB-binding protein CCG clock-controlled genes CCND1 G1/S-specific cyclin-D1 IV List of abbreviations CDK4 cyclin-dependent kinase 4 CHD chromodomain, helicase, DNA binding ChIP chromatin immunoprecipitation CK1 casein kinase 1 CLOCK circadian locomoter output cycles protein kaput CNS central nervous system CO2 carbon dioxide CP cortical plate CPD cyclobutane pyrimidine dimer CRY cryptochrome CT circadian time CTCF transcriptional repressor CTCF, CCCTC-binding factor d, D day DAMT-1 DNA N6-methyl methyltransferase DAPT N-[N-(3,5-Difluorophenacetyl)-L-alanyl]-S-phenylglycine t-butyl ester DBP DNA-binding protein or D site-binding protein DDB DNA damage-binding protein DDR DNA damage response DFG Deutsche Forschungsgemeinschaft DLL1 delta-like protein 1 DMAD DNA 6mA demethylase DMEM Dulbecco’s modified Eagle’s medium DNA deoxyribonucleic acid DNA-PKcs DNA protein kinase catalytic subunit DNMT DNA (cytosine-5)-methyltransferase D-PBS Dulbecco’s phosphate-buffered saline E9.5 embryonic day 9.5 EB elution buffer e.g. for example EMT epithelial to mesenchymal transition EMX homebox protein EMX Ep300 histone acetyltransferase p300 EpiR epigenetic regulator eRNA enhancer RNA ESC, ES embryonic stem cells EZH2 histone-lysine N-methyltransferase EZH2, enhancer of zeste homolog 2 FACS Fluorescence-activated cell sorting FAIRE formaldehyde-assisted isolation of regulatory elements V List of abbreviations FGF fibroblast growth factor Fos, c-Fos proto-oncogene c-Fos FOXG1, BF-1 forkhead box protein G1 FUS, TLS RNA-binding protein FUS G guanine GEO gene expression omnibus GFP green fluorescent protein GG-NER global-genome nucleotide excision repair GO gene ontology GSEA gene set enrichment analysis h Hill coefficient or hour HAT histone acetyltransferase HDAC histone deacetylase HEPES hydroxyethyl-piperazineethane-sulfonic acid buffer HES transcription factor HES HIRA histone chaperone histone regulator A HMGA2 high mobility group protein HMGI-C hnRNP-K heterogeneous nuclear ribonucleo-protein K HP1 heterochromatin protein 1 HP1BP3 HP1-binding protein 3 HR homologous recombination HULC lncRNA highly upregulated in liver cancer i.e. id est, that is IFT intraflagellar transport IFT74 intraflagellar transport protein 74 INO80 inositol requiring 80 input input DNA INSM1 insulinoma-associated protein 1 IP immunoprecipitated DNA; immune precipitation IPC intermediate progenitors IQR interquartile range ISMARA integrated system for motif activity response analysis ISWI imitation switch IZ intermediate zone JAG1 protein jagged-1 JMJD jumonji domain containing protein JNK c-Jun N-terminal kinase JTK Jonckheere-Terpstra-Kendall Jun, c-Jun transcription factor AP-1 VI List of abbreviations KAT2A, GCN5 histone acetyltransferase KAT2A KDM lysine demethylase KDM6B, JMJD3 lysine-specific demethylase 6B KTM lysine methyltransferase LAD lamina associated domains LCR locus control regions LHX2 LIM/homeobox protein Lhx2 lincRNA long intergenic non-coding RNA lncRNA long non-coding RNA LSD lysine specific demethylase MAML mastermind-like protein MAPK mitogen-activated protein kinase MCC Matthews correlation coefficient MDC1 mediator of DNA-damage checkpoint protein 1 MeCP2 methyl-CpG-binding protein 2 MEF mouse embryonic fibroblasts miRNA micro RNA MLL mixed lineage leukemia, histone-lysine N-methyltransferase MRN Mre11-Rad50-Nbs1 mRNA messenger RNA Myt1l myelin transcription factor 1-like protein n number N neuron NaCl sodium chloride NAD nucleolus associated domains nBAF neuron-specific BAF NCBI National Center for Biotechnology Information ncRNA non-coding RNA NE, NPE neuroepithelial (progenitor) cells NECD notch extracellular domain NER nucleotide excision repair NFκB nuclear factor NF-kappa-B NGN, NEUROG neurogenin NHEJ non-homologous end-joining NICD notch intracellular domain NIH3T3 fibroblast cells derived from Mus musculus NMAD N6-methyl adenine demethylase 1 NMuMG mammary glad cells derived from Mus musculus npBAF BAF complex of neuronal progenitors VII List of abbreviations NPC, NP neural progenitor cell, neuronal precursor cell NR not responding, common double-positive class NR1D1, REV-ERBα nuclear receptor subfamily 1 group D member 1 NR1D2, REV-ERBβ nuclear receptor subfamily 1 group D member 2 NR2E1, TLX nuclear receptor subfamily 2 group E member1 NSC neural stem cell NTC non-targeting control NuRD nucleosome-remodeling deacetylase complex ODE ordinary differential equation P p-value PAX6 paired box protein Pax-6 PcG polycomb group PCNA proliferating cell nuclear antigen PER period circadian protein homolog PIC preinitiation complex PIKK phosphoinositide 3-kinase-related protein kinases piRNA Piwi-interacting RNA Pou3f2, Brn2 POU domain, class 3, transcription factor 2 PRC2 polycomb repressive complex 2 PRMT arginine methyltransferase PTBP1 polypyrimidine Tract-Binding Protein 1 PWS Prader-Willi syndrome q q-value qPCR quantitative polymerase chain reaction R replicate RA retinoic acid RBPJ recombining binding
Load more

Recommended publications
  • Spatially Heterogeneous Choroid Plexus Transcriptomes Encode Positional Identity and Contribute to Regional CSF Production
    The Journal of Neuroscience, March 25, 2015 • 35(12):4903–4916 • 4903 Development/Plasticity/Repair Spatially Heterogeneous Choroid Plexus Transcriptomes Encode Positional Identity and Contribute to Regional CSF Production Melody P. Lun,1,3 XMatthew B. Johnson,2 Kevin G. Broadbelt,1 Momoko Watanabe,4 Young-jin Kang,4 Kevin F. Chau,1 Mark W. Springel,1 Alexandra Malesz,1 Andre´ M.M. Sousa,5 XMihovil Pletikos,5 XTais Adelita,1,6 Monica L. Calicchio,1 Yong Zhang,7 Michael J. Holtzman,7 Hart G.W. Lidov,1 XNenad Sestan,5 Hanno Steen,1 XEdwin S. Monuki,4 and Maria K. Lehtinen1 1Department of Pathology, and 2Division of Genetics, Boston Children’s Hospital, Boston, Massachusetts 02115, 3Department of Pathology and Laboratory Medicine, Boston University School of Medicine, Boston, Massachusetts 02118, 4Department of Pathology and Laboratory Medicine, University of California Irvine School of Medicine, Irvine, California 92697, 5Department of Neurobiology and Kavli Institute for Neuroscience, Yale School of Medicine, New Haven, Connecticut 06510, 6Department of Biochemistry, Federal University of Sa˜o Paulo, Sa˜o Paulo 04039, Brazil, and 7Pulmonary and Critical Care Medicine, Department of Medicine, Washington University, St Louis, Missouri 63110 A sheet of choroid plexus epithelial cells extends into each cerebral ventricle and secretes signaling factors into the CSF. To evaluate whether differences in the CSF proteome across ventricles arise, in part, from regional differences in choroid plexus gene expression, we defined the transcriptome of lateral ventricle (telencephalic) versus fourth ventricle (hindbrain) choroid plexus. We find that positional identitiesofmouse,macaque,andhumanchoroidplexiderivefromgeneexpressiondomainsthatparalleltheiraxialtissuesoforigin.We thenshowthatmolecularheterogeneitybetweentelencephalicandhindbrainchoroidplexicontributestoregion-specific,age-dependent protein secretion in vitro.
    [Show full text]
  • Hes5 Regulates the Transition Timing of Neurogenesis and Gliogenesis In
    © 2017. Published by The Company of Biologists Ltd | Development (2017) 144, 3156-3167 doi:10.1242/dev.147256 RESEARCH ARTICLE Hes5 regulates the transition timing of neurogenesis and gliogenesis in mammalian neocortical development Shama Bansod1,2, Ryoichiro Kageyama1,2,3,4 and Toshiyuki Ohtsuka1,2,3,* ABSTRACT has been reported that the high mobility group AT-hook (Hgma) During mammalian neocortical development, neural stem/progenitor genes regulate gene expression by modulating chromatin structure cells (NSCs) sequentially give rise to deep layer neurons and (Ozturk et al., 2014), maintain neurogenic NSCs, and inhibit superficial layer neurons through mid- to late-embryonic stages, gliogenesis during early- to mid-embryonic stages through global shifting to gliogenic phase at perinatal stages. Previously, we found opening of the chromatin state (Kishi et al., 2012). However, the that the Hes genes inhibit neuronal differentiation and maintain mechanism by which the expression of these epigenetic factors is NSCs. Here, we generated transgenic mice that overexpress Hes5 in controlled remains to be analyzed. NSCs of the central nervous system, and found that the transition Here, we found that Hes5, a transcriptional repressor acting timing from deep to superficial layer neurogenesis was shifted earlier, as an effector of Notch signaling, regulates the timing of while gliogenesis precociously occurred in the developing neocortex neurogenesis and gliogenesis via alteration in the expression of Hes5-overexpressing mice. By contrast, the transition from deep to levels of epigenetic factors. Notch signaling contributes to the superficial layer neurogenesis and the onset of gliogenesis were elaboration of cellular diversity during the development of various delayed in Hes5 knockout (KO) mice.
    [Show full text]
  • Abstracts from the 9Th Biennial Scientific Meeting of The
    International Journal of Pediatric Endocrinology 2017, 2017(Suppl 1):15 DOI 10.1186/s13633-017-0054-x MEETING ABSTRACTS Open Access Abstracts from the 9th Biennial Scientific Meeting of the Asia Pacific Paediatric Endocrine Society (APPES) and the 50th Annual Meeting of the Japanese Society for Pediatric Endocrinology (JSPE) Tokyo, Japan. 17-20 November 2016 Published: 28 Dec 2017 PS1 Heritable forms of primary bone fragility in children typically lead to Fat fate and disease - from science to global policy a clinical diagnosis of either osteogenesis imperfecta (OI) or juvenile Peter Gluckman osteoporosis (JO). OI is usually caused by dominant mutations affect- Office of Chief Science Advsor to the Prime Minister ing one of the two genes that code for two collagen type I, but a re- International Journal of Pediatric Endocrinology 2017, 2017(Suppl 1):PS1 cessive form of OI is present in 5-10% of individuals with a clinical diagnosis of OI. Most of the involved genes code for proteins that Attempts to deal with the obesity epidemic based solely on adult be- play a role in the processing of collagen type I protein (BMP1, havioural change have been rather disappointing. Indeed the evidence CREB3L1, CRTAP, LEPRE1, P4HB, PPIB, FKBP10, PLOD2, SERPINF1, that biological, developmental and contextual factors are operating SERPINH1, SEC24D, SPARC, from the earliest stages in development and indeed across generations TMEM38B), or interfere with osteoblast function (SP7, WNT1). Specific is compelling. The marked individual differences in the sensitivity to the phenotypes are caused by mutations in SERPINF1 (recessive OI type obesogenic environment need to be understood at both the individual VI), P4HB (Cole-Carpenter syndrome) and SEC24D (‘Cole-Carpenter and population level.
    [Show full text]
  • SOX3 Is Required During the Formation of the Hypothalamo-Pituitary Axis
    ARTICLES SOX3 is required during the formation of the hypothalamo-pituitary axis Karine Rizzoti1,5, Silvia Brunelli1,4,5, Danielle Carmignac2, Paul Q Thomas3, Iain C Robinson2 & Robin Lovell-Badge1 The pituitary develops from the interaction of the infundibulum, a region of the ventral diencephalon, and Rathke’s pouch, a derivative of oral ectoderm. Postnatally, its secretory functions are controlled by hypothalamic neurons, which also derive from the ventral diencephalon. In humans, mutations affecting the X-linked transcription factor SOX3 are associated with hypopituitarism and mental retardation, but nothing is known of their etiology. We find that deletion of Sox3 in mice leads to defects of pituitary function and of specific central nervous system (CNS) midline structures. Cells in the ventral diencephalon, where Sox3 is usually http://www.nature.com/naturegenetics highly expressed, have altered properties in mutant embryos, leading to abnormal development of Rathke’s pouch, which does not express the gene. Pituitary and hypothalamic defects persist postnatally, and SOX3 may also function in a subset of hypothalamic neurons. This study shows how sensitive the pituitary is to subtle developmental defects and how one gene can act at several levels in the hypothalamic-pituitary axis. The development of complex organs composed of different cell types review see ref. 5), is implicated in a syndrome of X-linked hypopitu- frequently depends on reciprocal induction events occurring between itarism and mental retardation6. In a single family whose males were distinct tissue layers that lie adjacent to one another in the embryo. deficient in growth hormone, a mutation in SOX3 was identified.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • UNIVERSITY of CALIFORNIA, IRVINE Combinatorial Regulation By
    UNIVERSITY OF CALIFORNIA, IRVINE Combinatorial regulation by maternal transcription factors during activation of the endoderm gene regulatory network DISSERTATION submitted in partial satisfaction of the requirements for the degree of DOCTOR OF PHILOSOPHY in Biological Sciences by Kitt D. Paraiso Dissertation Committee: Professor Ken W.Y. Cho, Chair Associate Professor Olivier Cinquin Professor Thomas Schilling 2018 Chapter 4 © 2017 Elsevier Ltd. © 2018 Kitt D. Paraiso DEDICATION To the incredibly intelligent and talented people, who in one way or another, helped complete this thesis. ii TABLE OF CONTENTS Page LIST OF FIGURES vii LIST OF TABLES ix LIST OF ABBREVIATIONS X ACKNOWLEDGEMENTS xi CURRICULUM VITAE xii ABSTRACT OF THE DISSERTATION xiv CHAPTER 1: Maternal transcription factors during early endoderm formation in 1 Xenopus Transcription factors co-regulate in a cell type-specific manner 2 Otx1 is expressed in a variety of cell lineages 4 Maternal otx1 in the endodermal conteXt 5 Establishment of enhancers by maternal transcription factors 9 Uncovering the endodermal gene regulatory network 12 Zygotic genome activation and temporal control of gene eXpression 14 The role of maternal transcription factors in early development 18 References 19 CHAPTER 2: Assembly of maternal transcription factors initiates the emergence 26 of tissue-specific zygotic cis-regulatory regions Introduction 28 Identification of maternal vegetally-localized transcription factors 31 Vegt and OtX1 combinatorially regulate the endodermal 33 transcriptome iii
    [Show full text]
  • Regulation of Adult Neurogenesis in Mammalian Brain
    International Journal of Molecular Sciences Review Regulation of Adult Neurogenesis in Mammalian Brain 1,2, 3, 3,4 Maria Victoria Niklison-Chirou y, Massimiliano Agostini y, Ivano Amelio and Gerry Melino 3,* 1 Centre for Therapeutic Innovation (CTI-Bath), Department of Pharmacy & Pharmacology, University of Bath, Bath BA2 7AY, UK; [email protected] 2 Blizard Institute of Cell and Molecular Science, Barts and the London School of Medicine and Dentistry, Queen Mary University of London, London E1 2AT, UK 3 Department of Experimental Medicine, TOR, University of Rome “Tor Vergata”, 00133 Rome, Italy; [email protected] (M.A.); [email protected] (I.A.) 4 School of Life Sciences, University of Nottingham, Nottingham NG7 2HU, UK * Correspondence: [email protected] These authors contributed equally to this work. y Received: 18 May 2020; Accepted: 7 July 2020; Published: 9 July 2020 Abstract: Adult neurogenesis is a multistage process by which neurons are generated and integrated into existing neuronal circuits. In the adult brain, neurogenesis is mainly localized in two specialized niches, the subgranular zone (SGZ) of the dentate gyrus and the subventricular zone (SVZ) adjacent to the lateral ventricles. Neurogenesis plays a fundamental role in postnatal brain, where it is required for neuronal plasticity. Moreover, perturbation of adult neurogenesis contributes to several human diseases, including cognitive impairment and neurodegenerative diseases. The interplay between extrinsic and intrinsic factors is fundamental in regulating neurogenesis. Over the past decades, several studies on intrinsic pathways, including transcription factors, have highlighted their fundamental role in regulating every stage of neurogenesis. However, it is likely that transcriptional regulation is part of a more sophisticated regulatory network, which includes epigenetic modifications, non-coding RNAs and metabolic pathways.
    [Show full text]
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • Coordination of Hox Identity Between Germ Layers Along the Anterior-To-Posterior Axis of the Vertebrate Embryo
    Coordination of Hox identity between germ layers along the anterior-to-posterior axis of the vertebrate embryo Ferran Lloret Vilaspasa PhD Developmental Biology Department of Anatomy and Developmental Biology University College of London (UCL) London, United Kingdom 2009 1 Coordination of Hox identity between germ layers along the anterior-to- posterior axis of the vertebrate embryo ‘ I, Ferran Lloret Vilaspasa confirm that the work presented in this thesis is my own. Where information has been derived from other sources, I confirm that this has been indicated in the thesis. ' Thesis for the obtainment of a PhD in Development Biology at the University College of London under the supervision of Prof. dr. Claudio D. Stern and Prof. dr. Antony J. Durston (Leiden University). To be defended by Ferran Lloret Vilaspasa A la meva família… Born in Barcelona, 05-08-1977 2 Abstract During early embryonic development, a relatively undifferentiated mass of cells is shaped into a complex and morphologically differentiated embryo. This is achieved by a series of coordinated cell movements that end up in the formation of the three germ layers of most metazoans and the establishment of the body plan. Hox genes are among the main determinants in this process and they have a prominent role in granting identity to different regions of the embryo. The particular arrangement of their expression domains in early development corresponds to and characterises several future structures of the older embryo and adult animal. Getting to know the molecular and cellular phenomena underlying the correct Hox pattern will help us understand how the complexity of a fully-formed organism can arise from its raw materials, a relatively undifferentiated fertilised egg cell (zygote) and a large but apparently limited repertoire of molecular agents.
    [Show full text]
  • The Role of Hes1 in Pancreas Development Expression, Interdependancy and Notch Signalling
    FACULTY OF SCIENCE UNIVERSITY OF COPENHAGEN PhD thesis Cand.scient. Rasmus Klinck Department of Beta Cell Regeneration, Hagedorn Research Institute, and The PhD School of Science, Faculty of Science, University of Copenhagen, Denmark. The role of Hes1 in pancreas development Expression, Interdependancy and Notch signalling. Academic Advisors Dr. Olaf Nielsen, Department of Biology, Faculty of Science, University of Copenhagen – Denmark Dr. Mette C. Jørgensen, Department of Beta Cell Regeneration, Hagedorn Research Institute Denmark Submitted: 31/05/11 Cover picture: e10.5 mouse embryo expressing EGFP under the control of the Hes1 promoter manually stitched together from 15 complete image stacks. 2 Preface This Ph.D. thesis is based on experimental work performed in the Department of β Cell Regeneration at the Hagedorn Research Institute, Gentofte, Denmark from January 2008 to December 2010. The faculty supervisor on the project was Professor Olaf Nielsen, Department of Genetics, Faculty of Science, University of Copenhagen, and the project supervisor was Mette Christine Jørgensen, Ph.D., Chemist, Department of Beta Cell Regeneration at the Hagedorn Research Institute. This thesis is submitted in order to meet the requirements for obtaining a Ph.D. degree at the Faculty of Science, University of Copenhagen. The thesis is built around three scientific Manuscripts: Manuscript I: “A BAC transgenic Hes1-EGFP reporter reveals novel expression domains in mouse embryos” Submitted to Gene Expression Patterns Rasmus Klinck1, Ernst-Martin Füchtbauer2, Jonas Ahnfelt-Rønne1, Palle Serup1,Jan Nygaard Jensen1, Ole Dragsbæk Madsen1, Mette Christine Jørgensen1 1Department of Beta Cell Regeneration, Hagedorn Research Institute, Niels Steensens Vej 6, DK-2820 Gentofte, Denmark .2Department of Molecular Biology, Aarhus University, C.
    [Show full text]
  • Emx2 Is Required for Growth of the Hippocampus but Not for Hippocampal Field Specification
    The Journal of Neuroscience, April 1, 2000, 20(7):2618–2625 Emx2 Is Required for Growth of the Hippocampus But Not for Hippocampal Field Specification Shubha Tole,1 Guy Goudreau,2 Stavroula Assimacopoulos,1 and Elizabeth A. Grove1 1Department of Neurobiology, Pharmacology, and Physiology, University of Chicago, Chicago, Illinois 60637, and 2Max Planck Institute of Biophysical Chemistry, D-37077 Goettingen, Germany The vertebrate Emx genes are expressed in a nested pattern in positioned in the Emx2 mutant. In particular, a dentate cell early embryonic cerebral cortex, such that a medial strip of population is generated, although it fails to form a morpholog- cortex expresses Emx2 but not Emx1. This pattern suggests ical gyrus. This failure may be part of a more widespread medial that Emx genes could play a role in specifying different areas or cortical defect in the mutant. Examination of cortical cell pro- fields of the cortex along the mediolateral axis. Such a role has liferation and differentiation indicates a disruption of the matu- been supported by the observation that in mice lacking func- ration of the medial cortex in the absence of Emx2. Thus, Emx2 tional Emx2 the hippocampus is shrunken and the most medial is required for normal growth and maturation of the hippocam- field of the cortex, the hippocampal dentate gyrus, appears by pus but not for the specification of cells to particular hippocam- cytoarchitecture to be missing (Pellegrini et al., 1996; Yoshida et pal field identities. al., 1997). Use of region-specific molecular markers shows, Key words: Emx2; hippocampus; patterning; specification; however, that hippocampal fields are specified and correctly cortical maturation; cortical hem The hippocampus, like the rest of the cerebral cortex, is divided Reports that specific mutations lead to morphological defects in into cytoarchitectonic areas or fields (Nauta and Feirtag, 1986).
    [Show full text]