DOCSLIB.ORG

Class 2 . Transferases Ix Ec 2. 7. 1. 38 - 2

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Class 2 . Transferases Ix Ec 2. 7. 1. 38 - 2 CLASS 2 . TRANSFERASES IX EC 2. 7. 1. 38 - 2. 7. 1. 112 1ST EDITION PDF, EPUB, EBOOK Dietmar Schomburg | 9783662500774 | | | | | Class 2 . Transferases IX Ec 2. 7. 1. 38 - 2. 7. 1. 112 1st edition PDF Book Read this book on SpringerLink. Glucosephosphate phosphodismutase Pages Glucosephosphate phosphodismutase. Shikimate kinase. Protamine kinase. Propionate kinase Pages Offers concise and complete description of about 5, enzymes sufficiently well characterized as well as their application in analytical, synthetic and biotechnology processes, in food industry, and for medicinal treatments. Anthocyanidin 3-O- glucosyltransferase Pages Recommended for you. It seems that you're in Germany. Hydroxylysine kinase. Diacylglycerol kinase Pages Phosphoglucan, water dikinase Pages We have a dedicated site for Germany. The total amount of material contained in the Handbook has more than doubled so that the complete second edition consists of 39 volumes as well as a Synonym Index. Alkylglycerol kinase Pages Buy Softcover. New datafields are created: application and engineering for the properties of enzymes where the sequence has been changed. About this book Springer Handbook of Enzymes provides data on enzymes sufficiently well characterized. New datafields are created: application and engineering for the properties of enzymes where the sequence has been changed. Springer Handbook of Enzymes provides data on enzymes sufficiently well characterized. It seems that you're in Germany. Show all. Diphosphate-serine phosphotransferase Pages Buy eBook. Show all. Springer Handbook of Enzymes Free Preview. D -Ribulokinase. N2- 2-Carboxyethyl arginine synthase Pages Phosphoenolpyruvate-fructose phosphotransferase Pages This new, second edition reflects considerable progress in enzymology: many enzymes are newly classified or reclassified. FAQ Policy. Inosine kinase. Class 2 . Transferases IX Ec 2. 7. 1. 38 - 2. 7. 1. 112 1st edition Writer Phosphoramidate-hexose phosphotransferase. It seems that you're in Germany. Dephospho-[reductase kinase] kinase Pages Cyanidin 3-O- rutinoside 5-O-glucosyltransferase Pages PAGE 1. Data sheets are arranged in their EC-Number sequence and the volumes themselves are arranged according to enzyme classes. The total amount of material contained in the Handbook has more than doubled so that the complete second edition consists of 39 volumes as well as a Synonym Index. Deacetylcephalosporin-C acetyltransferase Pages Recommended for you. Read this book on SpringerLink. Alkylglycerone kinase Pages Buy Softcover. Allose kinase Pages UMP Kinase Pages Read this book on SpringerLink. This new, second edition reflects considerable progress in enzymology: many of the enzymes have either been newly classified, or re-classified Content in this new edition has doubled: now consists of 39 volumes as well as a synonym index Starting in all newly classified enzymes are treated in the Supplement Volumes Available in print as well as online see more benefits. Chemistry Biotechnology. This new, second edition reflects considerable progress in enzymology: many of the enzymes have either been newly classified, or re-classified Content in this new edition has doubled: now consists of 39 volumes as well as a synonym index Starting in all newly classified enzymes are treated in the Supplement Volumes Available in print as well as online see more benefits. Show next xx. This service is more advanced with JavaScript available. L- Fuculokinase Pages D -Arabinokinase. Table of contents 78 chapters Table of contents 78 chapters Phosphorylase kinase Pages Class 2 . Transferases IX Ec 2. 7. 1. 38 - 2. 7. 1. 112 1st edition Reviews Tagatose kinase Pages Editors and affiliations. PAGE 1. Show all. Propionate kinase Pages Acyl-homoserine-lactone synthase Pages Protein kinase dual specificity kinase Pages UTP-monosaccharidephosphate uridylyltransferase Pages Phosphorylase kinase. Buy Softcover. Succinylornithine transaminase Pages Kanamycin kinase Pages Buy Hardcover. Each entry is correlated with references and one or more source organisms. It offers concise and complete descriptions of some 5, enzymes and their application areas. Buy eBook. G-Protein-coupled receptor kinase Pages About this book Springer Handbook of Enzymes provides data on enzymes sufficiently well characterized. Buy options. Dephospho- [reductase kinase] kinase Pages Buy Hardcover. Fucokinase Pages Alkylglycerone kinase Pages L -Arabinokinase. Read this book on SpringerLink. FAQ Policy. N-Acetylglucosamine kinase. New datafields are created: application and engineering for the properties of enzymes where the sequence has been changed. Galacturonokinase Pages This new, second edition reflects considerable progress in enzymology: many enzymes are newly classified or reclassified. Receptor protein-tyrosine kinase Pages Theobromine synthase Pages Nicotianamine aminotransferase Pages We have a dedicated site for Germany. D-Arabinokinase Pages Each entry is correlated with references and one or more source organisms. Buy eBook. Nucleoside phosphotransferase Pages Diphosphate-serine phosphotransferase Pages Each entry is correlated with references and one or more source organisms. JavaScript is currently disabled, this site works much better if you enable JavaScript in your browser. Class 2 . Transferases IX Ec 2. 7. 1. 38 - 2. 7. 1. 112 1st edition Read Online Goodpasture-antigen-binding protein kinase Pages Read this book on SpringerLink. Show next xx. Show all. Uridine kinase Pages Dephospho- [reductase kinase] kinase Pages Springer Handbook of Enzymes Free Preview. Uridine kinase. Scyllo -inosamine 4-kinase. L-Arabinokinase Pages Rhodopsin kinase Pages Protamine kinase Pages Protamine kinase. New datafields are created: application and engineering for the properties of enzymes where the sequence has been changed. PAGE 1. Sphinganine kinase Pages FAQ Policy. Riboflavin phosphotransferase Pages In addition, starting in , all newly classified enzymes are treated in Supplement Volumes. Springer Handbook of Enzymes Free Preview. FlavonolO-glucoside glucosyltransferase Pages We have a dedicated site for Germany. Sphingomyelin synthase Pages Offers concise and complete description of about 5, enzymes sufficiently well characterized as well as their application in analytical, synthetic and biotechnology processes, in food industry, and for medicinal treatments. It offers concise and complete descriptions of some 5, enzymes and their application areas. Springer Handbook of Enzymes provides data on enzymes sufficiently well characterized. Advertisement Hide. Recommended for you. JavaScript is currently disabled, this site works much better if you enable JavaScript in your browser. The total amount of material contained in the Handbook has more than doubled so that the complete second edition consists of 39 volumes as well as a Synonym Index. Hydroxymethylpyrimidine kinase Pages This service is more advanced with JavaScript available. Read this book on SpringerLink. About this book Springer Handbook of Enzymes provides data on enzymes sufficiently well characterized. NADH Kinase. Hydroxyethylthiazole kinase. This new, second edition reflects considerable progress in enzymology: many enzymes are newly classified or reclassified. About this book Introduction Springer Handbook of Enzymes provides data on enzymes sufficiently well characterized. UTP-monosaccharidephosphate uridylyltransferase Pages Thymidine kinase. N-Acetylglucosamine kinase Pages Mannitol kinase. Diphosphate-serine phosphotransferase. https://files8.webydo.com/9583068/UploadedFiles/01EFE783-AF76-90A5-11F9-F2238214EAD9.pdf https://files8.webydo.com/9584498/UploadedFiles/C843119A-552C-69C7-0CB4-C11B4DEA7135.pdf https://cdn.starwebserver.se/shops/oliwerhenrikssonny/files/dawn-of-the-akashic-age-new-consciousness-quantum-resonance-and-the-future-of- the-world.pdf https://files8.webydo.com/9583734/UploadedFiles/7D35C161-FA52-01D8-D4BE-32BFA8DDBFB2.pdf https://files8.webydo.com/9583067/UploadedFiles/259FDB12-F069-1E95-6350-879869A22811.pdf.
Load more

Recommended publications
  • METACYC ID Description A0AR23 GO:0004842 (Ubiquitin-Protein Ligase
    Electronic Supplementary Material (ESI) for Integrative Biology This journal is © The Royal Society of Chemistry 2012 Heat Stress Responsive Zostera marina Genes, Southern Population (α=0.
    [Show full text]
  • Interaction of Shikimic Acid with Shikimate Kinase
    BBRC Biochemical and Biophysical Research Communications 325 (2004) 10–17 www.elsevier.com/locate/ybbrc Interaction of shikimic acid with shikimate kinase Jose´ Henrique Pereiraa, Jaim Simo˜es de Oliveirab, Fernanda Canduria,c, Marcio Vinicius Bertacine Diasa,Ma´rio Se´rgio Palmac,d, Luiz Augusto Bassob, Walter Filgueira de Azevedo Jr.a,d,*, Dio´genes Santiago Santose,* a Department of Physics, UNESP, Sa˜o Jose´ do Rio Preto, SP 15054-000, Brazil b Rede Brasileira de Pesquisa em Tuberculose Grupo de Microbiologia Molecular e Funcional, Departamento de Biologia Molecular e Biotecnologia, UFRGS, Porto Alegre, RS 91501-970, Brazil c Center for Applied Toxinology, Institute Butantan, Sa˜o Paulo, SP 05503-900, Brazil d Laboratory of Structural Biology and Zoochemistry, CEIS/Department of Biology, Institute of Biosciences, UNESP, Rio Claro, SP 13506-900, Brazil e Centro de Pesquisa e Desenvolvimento em Biologia Molecular e Funcional, Pontifı´cia Universidade Cato´lica do Rio Grande do Sul, Porto Alegre, RS 90619-900, Brazil Received 24 September 2004 Available online 19 October 2004 Abstract The crystal structure of shikimate kinase from Mycobacterium tuberculosis (MtSK) complexed with MgADP and shikimic acid (shikimate) has been determined at 2.3 A˚ resolution, clearly revealing the amino acid residues involved in shikimate binding. In MtSK, the Glu61 strictly conserved in SK forms a hydrogen bond and salt-bridge with Arg58 and assists in positioning the guan- idinium group of Arg58 for shikimate binding. The carboxyl group of shikimate interacts with Arg58, Gly81, and Arg136, and hydroxyl groups with Asp34 and Gly80. The crystal structure of MtSK–MgADP–shikimate will provide crucial information for elucidation of the mechanism of SK-catalyzed reaction and for the development of a new generation of drugs against tuberculosis.
    [Show full text]
  • Ribonucleotides Incorporated by the Yeast Mitochondrial DNA Polymerase Are Not Repaired
    Ribonucleotides incorporated by the yeast mitochondrial DNA polymerase are not repaired Paulina H. Wanrooija,1, Martin K. M. Engqvistb,c,2, Josefin M. E. Forslunda,2, Clara Navarreteb, Anna Karin Nilssona, Juhan Sedmand, Sjoerd Wanrooija, Anders R. Clausenb, and Andrei Chabesa,e,1 aDepartment of Medical Biochemistry and Biophysics, Umeå University, SE-901 87 Umeå, Sweden; bInstitute of Biomedicine, University of Gothenburg, SE-405 30 Gothenburg, Sweden; cDepartment of Biology and Biological Engineering, Chalmers University of Technology, SE-412 96 Gothenburg, Sweden; dDepartment of Biochemistry, Institute of Molecular and Cell Biology, University of Tartu, Tartu 51010, Estonia; and eLaboratory for Molecular Infection Medicine Sweden, Umeå University, SE-901 87 Umeå, Sweden Edited by Philip C. Hanawalt, Stanford University, Stanford, CA, and approved October 17, 2017 (received for review July 25, 2017) Incorporation of ribonucleotides into DNA during genome replica- Mec1/Rad53 genome integrity checkpoint regulates yeast RNR tion is a significant source of genomic instability. The frequency activity through several different mechanisms (14). of ribonucleotides in DNA is determined by deoxyribonucleoside The incorporation of ribonucleotides (rNMPs) into the genome triphosphate/ribonucleoside triphosphate (dNTP/rNTP) ratios, by the during DNA replication has become recognized as a significant ability of DNA polymerases to discriminate against ribonucleotides, source of genomic instability. Given that the physiological con- and by the capacity of repair mechanisms to remove incorporated centrations of ribonucleoside triphosphates (rNTPs), the building ribonucleotides. To simultaneously compare how the nuclear and blocks of RNA, are one to two orders-of-magnitude higher than mitochondrial genomes incorporate and remove ribonucleotides, those of dNTPs, rNMPs are frequently incorporated into DNA we challenged these processes by changing the balance of cellular during replication (15, 16).
    [Show full text]
  • (12) Patent Application Publication (10) Pub. No.: US 2014/0155567 A1 Burk Et Al
    US 2014O155567A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2014/0155567 A1 Burk et al. (43) Pub. Date: Jun. 5, 2014 (54) MICROORGANISMS AND METHODS FOR (60) Provisional application No. 61/331,812, filed on May THE BIOSYNTHESIS OF BUTADENE 5, 2010. (71) Applicant: Genomatica, Inc., San Diego, CA (US) Publication Classification (72) Inventors: Mark J. Burk, San Diego, CA (US); (51) Int. Cl. Anthony P. Burgard, Bellefonte, PA CI2P 5/02 (2006.01) (US); Jun Sun, San Diego, CA (US); CSF 36/06 (2006.01) Robin E. Osterhout, San Diego, CA CD7C II/6 (2006.01) (US); Priti Pharkya, San Diego, CA (52) U.S. Cl. (US) CPC ................. CI2P5/026 (2013.01); C07C II/I6 (2013.01); C08F 136/06 (2013.01) (73) Assignee: Genomatica, Inc., San Diego, CA (US) USPC ... 526/335; 435/252.3:435/167; 435/254.2: (21) Appl. No.: 14/059,131 435/254.11: 435/252.33: 435/254.21:585/16 (22) Filed: Oct. 21, 2013 (57) ABSTRACT O O The invention provides non-naturally occurring microbial Related U.S. Application Data organisms having a butadiene pathway. The invention addi (63) Continuation of application No. 13/101,046, filed on tionally provides methods of using Such organisms to produce May 4, 2011, now Pat. No. 8,580,543. butadiene. Patent Application Publication Jun. 5, 2014 Sheet 1 of 4 US 2014/O155567 A1 ?ueudos!SMS |?un61– Patent Application Publication Jun. 5, 2014 Sheet 2 of 4 US 2014/O155567 A1 VOJ OO O Z?un61– Patent Application Publication US 2014/O155567 A1 {}}} Hººso Patent Application Publication Jun.
    [Show full text]
  • Supplementary Data for “Sequence and Annotation of the 369-Kb NY-2A and the 345-Kb AR158 Viruses That Infect Chlorella NC64A”: Appendix D: Gene Names C006R – C815L
    University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Virology Papers Virology, Nebraska Center for 2-20-2007 Supplementary Data for “Sequence and annotation of the 369-kb NY-2A and the 345-kb AR158 viruses that infect Chlorella NC64A”: Appendix D: Gene Names C006R – C815L Lisa A. Fitzgerald University of Nebraska-Lincoln, [email protected] Michael V. Graves University of Massachusetts–Lowell, [email protected] Xiao Li University of Massachusetts–Lowell Tamara Feldblyum The Institute for Genomic Research, Rockville, MD Willaim C. Nierman The Institute for Genomic Research, Rockville, MD, [email protected] See next page for additional authors Follow this and additional works at: https://digitalcommons.unl.edu/virologypub Part of the Virology Commons Fitzgerald, Lisa A.; Graves, Michael V.; Li, Xiao; Feldblyum, Tamara; Nierman, Willaim C.; and Van Etten, James L., "Supplementary Data for “Sequence and annotation of the 369-kb NY-2A and the 345-kb AR158 viruses that infect Chlorella NC64A”: Appendix D: Gene Names C006R – C815L" (2007). Virology Papers. 10. https://digitalcommons.unl.edu/virologypub/10 This Article is brought to you for free and open access by the Virology, Nebraska Center for at DigitalCommons@University of Nebraska - Lincoln. It has been accepted for inclusion in Virology Papers by an authorized administrator of DigitalCommons@University of Nebraska - Lincoln. Authors Lisa A. Fitzgerald, Michael V. Graves, Xiao Li, Tamara Feldblyum, Willaim C. Nierman, and James L. Van Etten This article is available at DigitalCommons@University of Nebraska - Lincoln: https://digitalcommons.unl.edu/ virologypub/10 Main article published in Virology 358:2 (February 20, 2007), pp.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Genome-Scale Fitness Profile of Caulobacter Crescentus Grown in Natural Freshwater
    Supplemental Material Genome-scale fitness profile of Caulobacter crescentus grown in natural freshwater Kristy L. Hentchel, Leila M. Reyes Ruiz, Aretha Fiebig, Patrick D. Curtis, Maureen L. Coleman, Sean Crosson Tn5 and Tn-Himar: comparing gene essentiality and the effects of gene disruption on fitness across studies A previous analysis of a highly saturated Caulobacter Tn5 transposon library revealed a set of genes that are required for growth in complex PYE medium [1]; approximately 14% of genes in the genome were deemed essential. The total genome insertion coverage was lower in the Himar library described here than in the Tn5 dataset of Christen et al (2011), as Tn-Himar inserts specifically into TA dinucleotide sites (with 67% GC content, TA sites are relatively limited in the Caulobacter genome). Genes for which we failed to detect Tn-Himar insertions (Table S13) were largely consistent with essential genes reported by Christen et al [1], with exceptions likely due to differential coverage of Tn5 versus Tn-Himar mutagenesis and differences in metrics used to define essentiality. A comparison of the essential genes defined by Christen et al and by our Tn5-seq and Tn-Himar fitness studies is presented in Table S4. We have uncovered evidence for gene disruptions that both enhanced or reduced strain fitness in lake water and M2X relative to PYE. Such results are consistent for a number of genes across both the Tn5 and Tn-Himar datasets. Disruption of genes encoding three metabolic enzymes, a class C β-lactamase family protein (CCNA_00255), transaldolase (CCNA_03729), and methylcrotonyl-CoA carboxylase (CCNA_02250), enhanced Caulobacter fitness in Lake Michigan water relative to PYE using both Tn5 and Tn-Himar approaches (Table S7).
    [Show full text]
  • Identification of Active Molecules Against Mycobacterial Shikimate
    Identification of active molecules against Mycobacterial Shikimate Kinase from Chemical library and their affinity with different domains Sapna Pandey1, Ekta Dhamija1, Sanjay Kumar1, Pragya Yadav1, Tadigopula Narender1, Arnava Dasgupta1, Ravishankar Ramachandran1, and KISHORE SRIVASTAVA1 1Central Drug Research Institute November 9, 2020 Abstract Tuberculosis (TB), regardless of being the oldest disease is still a menace that humans have not been able to control. With the advancement in the drug discovery programme, target-based drug discovery appears to be one of the promising techniques for the development of future therapeutics. It involves identifying an essential gene involved in the pathogenesis of the disease and then targeting the protein against a defined chemical library. Shikimate kinase is one such validated target in mycobacterium. It is vital for the growth of bacteria and is absent in mammals, making it an ideal drug target. Here 6427 compounds were screened through structure based virtual screening where compound S-014-1049 was found active against H37Rv and proven non-cytotoxic in in vitro studies. It specifically binds to the core domain of MTSK. Introduction The development of drug resistance is a severe threat to public health. Presently, use of antibiotics targets bacterial structure and essential functions. Due to the well-identified anti-mycobacterial resistance, there has been an increased interest in the discovery of novel drugs to target other essential processes of bacterial survival. Currently, target-based drug screening is promising and efficient way for development of therapeutic agents. In recent years, extensive efforts have been made for the discovery of inhibitors of enzymes involved in the biosynthesis of aromatic amino acids.
    [Show full text]
  • The Role of the Salvage Pathway in Nucleotide Sugar Biosynthesis
    THE ROLE OF THE SALVAGE PATHWAY IN NUCLEOTIDE SUGAR BIOSYNTHESIS: IDENTIFICATION OF SUGAR KINASES AND NDP-SUGAR PYROPHOSPHORYLASES by TING YANG (Under the Direction of Maor Bar-Peled) ABSTRACT The synthesis of polysaccharides, glycoproteins, glycolipids, glycosylated secondary metabolites and hormones requires a large number of glycosyltransferases and a constant supply of nucleotide sugars. In plants, photosynthesis and the NDP-sugar inter-conversion pathway are the major entry points to form NDP-sugars. In addition to these pathways is the salvage pathway, a less understood metabolism that provides the flux of NDP-sugars. This latter pathway involves the hydrolysis of glycans to free sugars, sugar transport, sugar phosphorylation and nucleotidylation. The balance between glycan synthesis and recycling as well as its regulation at various plant developmental stages remains elusive as many of the molecular components are unknown. To understand how the salvage pathway contributes to the sugar flux and cell wall biosynthesis, my research focused on the functional identification of salvage pathway sugar kinases and NDP-sugar pyrophosphorylases. This research led to the first identification and enzymatic characterization of galacturonic acid kinase (GalA kinase), galactokinase (GalK), a broad UDP-sugar pyrophosphorylase (sloppy), two promiscuous UDP-GlcNAc pyrophosphorylases (GlcNAc-1-P uridylyltransferases), as well as UDP-sugar pyrophosphorylase paralogs from Trypanosoma cruzi and Leishmania major. To evaluate the salvage pathway in plant biology, we further investigated a sugar kinase mutant: galacturonic acid kinase mutant (galak) and determined if and how galak KO mutant affects the synthesis of glycans in Arabidopsis. Feeding galacturonic acid to the seedlings exhibited a 40-fold accumulation of free GalA in galak mutant, while the wild type (WT) plant readily metabolizes the fed-sugar.
    [Show full text]
  • The Microbiota-Produced N-Formyl Peptide Fmlf Promotes Obesity-Induced Glucose
    Page 1 of 230 Diabetes Title: The microbiota-produced N-formyl peptide fMLF promotes obesity-induced glucose intolerance Joshua Wollam1, Matthew Riopel1, Yong-Jiang Xu1,2, Andrew M. F. Johnson1, Jachelle M. Ofrecio1, Wei Ying1, Dalila El Ouarrat1, Luisa S. Chan3, Andrew W. Han3, Nadir A. Mahmood3, Caitlin N. Ryan3, Yun Sok Lee1, Jeramie D. Watrous1,2, Mahendra D. Chordia4, Dongfeng Pan4, Mohit Jain1,2, Jerrold M. Olefsky1 * Affiliations: 1 Division of Endocrinology & Metabolism, Department of Medicine, University of California, San Diego, La Jolla, California, USA. 2 Department of Pharmacology, University of California, San Diego, La Jolla, California, USA. 3 Second Genome, Inc., South San Francisco, California, USA. 4 Department of Radiology and Medical Imaging, University of Virginia, Charlottesville, VA, USA. * Correspondence to: 858-534-2230, [email protected] Word Count: 4749 Figures: 6 Supplemental Figures: 11 Supplemental Tables: 5 1 Diabetes Publish Ahead of Print, published online April 22, 2019 Diabetes Page 2 of 230 ABSTRACT The composition of the gastrointestinal (GI) microbiota and associated metabolites changes dramatically with diet and the development of obesity. Although many correlations have been described, specific mechanistic links between these changes and glucose homeostasis remain to be defined. Here we show that blood and intestinal levels of the microbiota-produced N-formyl peptide, formyl-methionyl-leucyl-phenylalanine (fMLF), are elevated in high fat diet (HFD)- induced obese mice. Genetic or pharmacological inhibition of the N-formyl peptide receptor Fpr1 leads to increased insulin levels and improved glucose tolerance, dependent upon glucagon- like peptide-1 (GLP-1). Obese Fpr1-knockout (Fpr1-KO) mice also display an altered microbiome, exemplifying the dynamic relationship between host metabolism and microbiota.
    [Show full text]
  • Transient Kinetics of Aminoglycoside Phosphotransferase(30)-Iiia Reveals a Potential Drug Target in the Antibiotic Resistance Mechanism
    FEBS Letters 586 (2012) 4223–4227 journal homepage: www.FEBSLetters.org Transient kinetics of aminoglycoside phosphotransferase(30)-IIIa reveals a potential drug target in the antibiotic resistance mechanism Perrine Lallemand a, Nadia Leban a, Simone Kunzelmann b, Laurent Chaloin a, Engin H. Serpersu c, ⇑ Martin R. Webb b, Tom Barman d, Corinne Lionne a, a Centre d’études d’agents Pathogènes et Biotechnologies pour la Santé (CPBS), UMR 5236 CNRS, University Montpellier I & II, 1919 Route de Mende, 34293 Montpellier Cedex 5, France b Division of Physical Biochemistry, MRC National Institute for Medical Research, The Ridgeway, Mill Hill, London NW7 1AA, United Kingdom c Department of Biochemistry and Cellular and Molecular Biology, University of Tennessee, Knoxville, TN 37996, USA d Volunteer, 8 rue Dom Vaissette, 34000 Montpellier, France article info abstract Article history: Aminoglycoside phosphotransferases are bacterial enzymes responsible for the inactivation of ami- Received 25 September 2012 noglycoside antibiotics by O-phosphorylation. It is important to understand the mechanism of Revised 11 October 2012 enzymes in order to find efficient drugs. Using rapid-mixing methods, we studied the transient Accepted 12 October 2012 kinetics of aminoglycoside phosphotransferase(30)-IIIa. We show that an ADP-enzyme complex is Available online 26 October 2012 the main steady state intermediate. This intermediate interacts strongly with kanamycin A to form Edited by Peter Brzezinski an abortive complex that traps the enzyme in an inactive state. A good strategy to prevent the inac- tivation of aminoglycosides would be to develop uncompetitive inhibitors that interact with this key ADP-enzyme complex. Keywords: Quench flow Ó 2012 Federation of European Biochemical Societies.
    [Show full text]
  • The Important Structural Role of the P-Loop Lysine
    Biochemical and X-ray crystallographic studies on shikimate kinase: The important structural role of the P-loop lysine TINO KRELL,1,6,7 JOHN MACLEAN,2,6,8 DEBORAH J. BOAM,1 ALAN COOPER,2 MARINA RESMINI,3 KEITH BROCKLEHURST,4 SHARON M. KELLY,5 5 2 1 NICHOLAS C. PRICE, ADRIAN J. LAPTHORN, AND JOHN R. COGGINS 1Division of Biochemistry and Molecular Biology, Institute of Biomedical and Life Sciences, University of Glasgow, Glasgow G12 8QQ, Scotland, UK 2Department of Chemistry, University of Glasgow, Glasgow G12 8QQ, Scotland, UK 3Department of Chemistry, Queen Mary and Westfield College, University of London, London E1 4NS, UK 4Department of Molecular and Cellular Biology, Queen Mary and Westfield College, University of London, London E1 4NS, UK 5Department of Biological Sciences, University of Stirling, Stirling FK9 4 LA, Scotland, UK (RECEIVED December 20, 2000; FINAL REVISION March 8, 2001; ACCEPTED March 12, 2001) Abstract Shikimate kinase, despite low sequence identity, has been shown to be structurally a member of the nucleoside monophosphate (NMP) kinase family, which includes adenylate kinase. In this paper we have explored the roles of residues in the P-loop of shikimate kinase, which forms the binding site for nucleotides and is one of the most conserved structural features in proteins. In common with many members of the P-loop family, shikimate kinase contains a cysteine residue 2 amino acids upstream of the essential lysine residue; the side chains of these residues are shown to form an ion pair. The C13S mutant of shikimate kinase was found to be enzymatically active, whereas the K15M mutant was inactive.
    [Show full text]