Stage-Dependent Differential Gene Expression Profiles of Cranial
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
De Novo MEIS2 Mutation Causes Syndromic Developmental Delay with Persistent Gastro-Esophageal Reflux
Journal of Human Genetics (2016) 61, 835–838 & 2016 The Japan Society of Human Genetics All rights reserved 1434-5161/16 www.nature.com/jhg SHORT COMMUNICATION De novo MEIS2 mutation causes syndromic developmental delay with persistent gastro-esophageal reflux Atsushi Fujita1, Bertrand Isidor2,3, Hugues Piloquet4, Pierre Corre5, Nobuhiko Okamoto6, Mitsuko Nakashima1, Yoshinori Tsurusaki1, Hirotomo Saitsu1, Noriko Miyake1 and Naomichi Matsumoto1 MEIS2 aberrations are considered to be the cause of intellectual disability, cleft palate and cardiac septal defect, as MEIS2 copy number variation is often observed with these phenotypes. To our knowledge, only one nucleotide-level change— specifically, an in-frame MEIS2 deletion—has so far been reported. Here, we report a female patient with a de novo nonsense mutation (c.611C4G, p.Ser204*) in MEIS2. She showed severe intellectual disability, moderate motor/verbal developmental delay, cleft palate, cardiac septal defect, hypermetropia, severe feeding difficulties with gastro-esophageal reflux and constipation. By reviewing this patient and previous patients with MEIS2 point mutations, we found that feeding difficulty with gastro-esophageal reflux appears to be one of the core clinical features of MEIS2 haploinsufficiency, in addition to intellectual disability, cleft palate and cardiac septal defect. Journal of Human Genetics (2016) 61, 835–838; doi:10.1038/jhg.2016.54; published online 26 May 2016 INTRODUCTION at the homeodomain may interfere with DNA binding. Moreover, Meis homeobox 2 (MEIS2;alsoknownasMRG1, NM_170677.4) this female patient also presented with various anomalous features encodes a homeobox (HOX) protein belonging to the three amino and developmental abnormalities. Here, we report on another acid loop extension (TALE) superfamily. -
Detailed Review Paper on Retinoid Pathway Signalling
1 1 Detailed Review Paper on Retinoid Pathway Signalling 2 December 2020 3 2 4 Foreword 5 1. Project 4.97 to develop a Detailed Review Paper (DRP) on the Retinoid System 6 was added to the Test Guidelines Programme work plan in 2015. The project was 7 originally proposed by Sweden and the European Commission later joined the project as 8 a co-lead. In 2019, the OECD Secretariat was added to coordinate input from expert 9 consultants. The initial objectives of the project were to: 10 draft a review of the biology of retinoid signalling pathway, 11 describe retinoid-mediated effects on various organ systems, 12 identify relevant retinoid in vitro and ex vivo assays that measure mechanistic 13 effects of chemicals for development, and 14 Identify in vivo endpoints that could be added to existing test guidelines to 15 identify chemical effects on retinoid pathway signalling. 16 2. This DRP is intended to expand the recommendations for the retinoid pathway 17 included in the OECD Detailed Review Paper on the State of the Science on Novel In 18 vitro and In vivo Screening and Testing Methods and Endpoints for Evaluating 19 Endocrine Disruptors (DRP No 178). The retinoid signalling pathway was one of seven 20 endocrine pathways considered to be susceptible to environmental endocrine disruption 21 and for which relevant endpoints could be measured in new or existing OECD Test 22 Guidelines for evaluating endocrine disruption. Due to the complexity of retinoid 23 signalling across multiple organ systems, this effort was foreseen as a multi-step process. -
Integrated and Functional Genomic Approaches to Elucidate Differential Genetic Dependencies in Melanoma
Integrated and Functional Genomic Approaches to Elucidate Differential Genetic Dependencies in Melanoma The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Wong, Terence. 2018. Integrated and Functional Genomic Approaches to Elucidate Differential Genetic Dependencies in Melanoma. Doctoral dissertation, Harvard University, Graduate School of Arts & Sciences. Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:42014990 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA Integrated and Functional Genomic Approaches to Elucidate Differential Genetic Dependencies in Melanoma A dissertation presented by Terence Cheng Wong to The Division of Medical Sciences in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the subject of Biological and Biomedical Sciences Harvard University Cambridge, Massachusetts November 2017 © 2017 Terence Cheng Wong All rights reserved. Dissertation Advisor: Levi Garraway Terence Cheng Wong Integrated and Functional Genomic Approaches to Elucidate Differential Genetic Dependencies in Melanoma ABSTRACT Genomic characterization of human cancers over the past decade has generated comprehensive catalogues of genetic alterations in cancer genomes. Many of these genetic events result in molecular or cellular changes that drive cancer cell phenotypes. In melanoma, a majority of tumors harbor mutations in the BRAF gene, leading to activation of the MAPK pathway and tumor initiation. The development and use of drugs that target the mutant BRAF protein and the MAPK pathway have produced significant clinical benefit in melanoma patients. -
Prox1regulates the Subtype-Specific Development of Caudal Ganglionic
The Journal of Neuroscience, September 16, 2015 • 35(37):12869–12889 • 12869 Development/Plasticity/Repair Prox1 Regulates the Subtype-Specific Development of Caudal Ganglionic Eminence-Derived GABAergic Cortical Interneurons X Goichi Miyoshi,1 Allison Young,1 Timothy Petros,1 Theofanis Karayannis,1 Melissa McKenzie Chang,1 Alfonso Lavado,2 Tomohiko Iwano,3 Miho Nakajima,4 Hiroki Taniguchi,5 Z. Josh Huang,5 XNathaniel Heintz,4 Guillermo Oliver,2 Fumio Matsuzaki,3 Robert P. Machold,1 and Gord Fishell1 1Department of Neuroscience and Physiology, NYU Neuroscience Institute, Smilow Research Center, New York University School of Medicine, New York, New York 10016, 2Department of Genetics & Tumor Cell Biology, St. Jude Children’s Research Hospital, Memphis, Tennessee 38105, 3Laboratory for Cell Asymmetry, RIKEN Center for Developmental Biology, Kobe 650-0047, Japan, 4Laboratory of Molecular Biology, Howard Hughes Medical Institute, GENSAT Project, The Rockefeller University, New York, New York 10065, and 5Cold Spring Harbor Laboratory, Cold Spring Harbor, New York 11724 Neurogliaform (RELNϩ) and bipolar (VIPϩ) GABAergic interneurons of the mammalian cerebral cortex provide critical inhibition locally within the superficial layers. While these subtypes are known to originate from the embryonic caudal ganglionic eminence (CGE), the specific genetic programs that direct their positioning, maturation, and integration into the cortical network have not been eluci- dated. Here, we report that in mice expression of the transcription factor Prox1 is selectively maintained in postmitotic CGE-derived cortical interneuron precursors and that loss of Prox1 impairs the integration of these cells into superficial layers. Moreover, Prox1 differentially regulates the postnatal maturation of each specific subtype originating from the CGE (RELN, Calb2/VIP, and VIP). -
Olig1 and Sox10 Interact Synergistically to Drivemyelin Basic
The Journal of Neuroscience, December 26, 2007 • 27(52):14375–14382 • 14375 Cellular/Molecular Olig1 and Sox10 Interact Synergistically to Drive Myelin Basic Protein Transcription in Oligodendrocytes Huiliang Li,1 Yan Lu,2 Hazel K. Smith,1 and William D. Richardson1 1Wolfson Institute for Biomedical Research and Department of Biology, University College London, London WC1E 6BT, United Kingdom, and 2Medical Research Council, Clinical Sciences Centre, Imperial College London, London W12 0NN, United Kingdom The oligodendrocyte lineage genes (Olig1/2), encoding basic helix-loop-helix transcription factors, were first identified in screens for master regulators of oligodendrocyte development. OLIG1 is important for differentiation of oligodendrocyte precursors into myelin- forming oligodendrocytes during development and is thought to play a crucial role in remyelination during multiple sclerosis. However, itisstillunclearhowOLIG1interactswithitstranscriptionalcofactorsandDNAtargets.OLIG1wasreportedlyrestrictedtomammals,but we demonstrate here that zebrafish and other teleosts also possess an OLIG1 homolog. In zebrafish, as in mammals, Olig1 is expressed in the oligodendrocyte lineage. Olig1 associates physically with another myelin-associated transcription factor, Sox10, and the Olig1/Sox10 complex activates mbp (myelin basic protein) transcription via conserved DNA sequence motifs in the mbp promoter region. In contrast, Olig2 does not bind to Sox10 in zebrafish, although both OLIG1 and OLIG2 bind SOX10 in mouse. Key words: Olig1; Olig2; Sox10; Mbp; oligodendrocyte; myelin; zebrafish; mouse; evolution; development Introduction directly regulates Mbp transcription (Stolt et al., 2002), and over- Myelin, the multilayered glial sheath around axons, is one of the expression of SOX10 alone is sufficient to induce myelin gene defining features of jawed vertebrates (gnathostomes). It is expression in embryonic chick spinal cord (Liu et al., 2007). -
SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line -
Birth Defects Caused by Mutations in Human GLI3 and Mouse Gli3 Genescga
doi:10.1111/j.1741-4520.2009.00266.x Congenital Anomalies 2010; 50, 1–7 1 REVIEW ARTICLE Birth defects caused by mutations in human GLI3 and mouse Gli3 genescga_ 266 1..71..7 Ichiro Naruse1, Etsuko Ueta1, Yoshiki Sumino1, Masaya Ogawa1, and Satoshi Ishikiriyama2 1School of Health Science, Faculty of Medicine, Tottori University, Yonago, and 2Division of Clinical Genetics and Cytogenetics, Shizuoka Children’s Hospital, Shizuoka, Japan ABSTRACT GLI3 is the gene responsible for Greig cepha- type-A (PAP-A) and preaxial polydactyly type-IV (PPD-IV). A lopolysyndactyly syndrome (GCPS), Pallister–Hall syndrome mimic phenomenon is observed in mice. Investigation of human (PHS) and Postaxial polydactyly type-A (PAP-A). Genetic poly- GLI3 and Gli3 genes has progressed using the knowledge of dactyly mice such as Pdn/Pdn (Polydactyly Nagoya), XtH/XtH Cubitus interruptus (Ci) in Drosophila, a homologous gene of GLI3 (Extra toes) and XtJ/XtJ (Extra toes Jackson) are the mouse and Gli3 genes. These genes have been highly conserved in the homolog of GCPS, and Gli3tmlUrtt/Gli3tmlUrt is produced as the animal kingdom throughout evolution. Now, a lot of mutant mice of mouse homolog of PHS. In the present review, relationships Gli3 gene have been known and knockout mice have been pro- between mutation points of GLI3 and Gli3, and resulting phe- duced. It is expected that the knowledge obtained from mutant and notypes in humans and mice are described. It has been con- knockout mice will be extrapolated to the manifestation mecha- firmed that mutation in the upstream or within the zinc finger nisms in human diseases to understand the diseases caused by the domain of the GLI3 gene induces GCPS; that in the post-zinc mutations in GLI3 gene. -
A Conserved Tissue-Specific Homeodomain-Less Isoform of MEIS1 Is Downregulated in Colorectal Cancer
Thomas Jefferson University Jefferson Digital Commons Department of Microbiology and Immunology Faculty Papers Department of Microbiology and Immunology 8-17-2011 A conserved tissue-specific homeodomain-less isoform of MEIS1 is downregulated in colorectal cancer. Richard C Crist Department of Microbiology and Immunology, Thomas Jefferson University, Philadelphia Jacquelyn J Roth Department of Microbiology and Immunology, Thomas Jefferson University, Philadelphia Scott A Waldman Department of Pharmacology and Experimental Therapeutics, Thomas Jefferson University, Philadelphia Arthur M Buchberg Department of Microbiology and Immunology, Thomas Jefferson University, Philadelphia Follow this and additional works at: https://jdc.jefferson.edu/mifp Part of the Gastroenterology Commons, Medical Genetics Commons, Medical Microbiology Commons, Oncology Commons, and the Pathology Commons Let us know how access to this document benefits ouy Recommended Citation Crist, Richard C; Roth, Jacquelyn J; Waldman, Scott A; and Buchberg, Arthur M, "A conserved tissue-specific homeodomain-less isoform of MEIS1 is downregulated in colorectal cancer." (2011). Department of Microbiology and Immunology Faculty Papers. Paper 25. https://jdc.jefferson.edu/mifp/25 This Article is brought to you for free and open access by the Jefferson Digital Commons. The Jefferson Digital Commons is a service of Thomas Jefferson University's Center for Teaching and Learning (CTL). The Commons is a showcase for Jefferson books and journals, peer-reviewed scholarly publications, unique historical collections from the University archives, and teaching tools. The Jefferson Digital Commons allows researchers and interested readers anywhere in the world to learn about and keep up to date with Jefferson scholarship. This article has been accepted for inclusion in Department of Microbiology and Immunology Faculty Papers by an authorized administrator of the Jefferson Digital Commons. -
Identifying Isl1 Genetic Lineage in the Developing Olfactory System and in Gnrh-1 Neurons 2 3 Ed Zandro M
bioRxiv preprint doi: https://doi.org/10.1101/2020.08.31.276360; this version posted August 31, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Identifying Isl1 genetic lineage in the developing olfactory system and in GnRH-1 neurons 2 3 Ed Zandro M. Taroc1, Raghu Ram Katreddi1 and Paolo E. Forni1*. 4 5 1Department of Biological Sciences; The RNA Institute, and the Center for Neuroscience 6 Research; University at Albany, State University of New York, Albany, NY 12222, USA. 7 8 * Corresponding Author 9 [email protected] 10 11 12 Keywords: Olfactory neurons, vomeronasal sensory neurons, GnRH neurons, Islet-1/Isl1, Isl1 13 Conditional knock-out; genetic lineage tracing, olfactory placode, neural crest. 14 15 Abstract (299, at 245 after editing) 16 During embryonic development, symmetric ectodermal thickenings (olfactory placodes) give rise 17 to several cell types that comprise the olfactory system, such as those that form the terminal nerve 18 ganglion (TN), gonadotropin releasing hormone-1 (GnRH-1) neurons and other migratory 19 neurons in rodents. Even though the genetic heterogeneity among these cell types are 20 documented, unidentified cell populations arising from the olfactory placode remain. One 21 candidate to identify placodal derived neurons in the developing nasal area is the transcription 22 factor Isl1, which was recently identified in GnRH-3 neurons of the terminal nerve in fish, as well 23 as expression in neurons of the nasal migratory mass. Here, we analyzed the Isl1 genetic lineage 24 in chemosensory neuronal populations in the nasal area and migratory GnRH-1 neurons in mice 25 using in-situ hybridization, immunolabeling a Tamoxifen inducible Isl1CreERT and a constitutive 26 Isl1Cre knock-in mouse lines. -
Ablation of Ezh2 in Neural Crest Cells Leads to Hirschsprung's Disease-Like Phenotype in Mice
bioRxiv preprint doi: https://doi.org/10.1101/265868; this version posted February 15, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Ablation of Ezh2 in neural crest cells leads to Hirschsprung’s disease-like phenotype in mice Hana Kim, Ingeborg M. Langohr, Mohammad Faisal, Margaret McNulty, Caitlin Thorn, Joomyeong Kim* Department of Biological Sciences, Louisiana State University, Baton Rouge, LA 70803, USA. Correspondence should be forwarded to: [email protected], 225-578-7692(ph), or 225-578-2597(fax) Running title: Function of Ezh2 in enteric neural crest cell development 1 bioRxiv preprint doi: https://doi.org/10.1101/265868; this version posted February 15, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract In the current study, we examined the role of Ezh2 as an epigenetic modifier for the enteric neural crest cell development through H3K27me3. Ezh2 conditional null mice were viable up to birth, but died within the first hour of life. In addition to craniofacial defects, Ezh2 conditional null mice displayed reduced number of ganglion cells in the enteric nervous system. RT-PCR and ChIP assays indicated aberrant up-regulation of Zic1, Pax3, and Sox10 and loss of H3K27me3 marks in the promoter regions of these genes in the myenteric plexus. Overall, these results suggest that Ezh2 is an important epigenetic modifier for the enteric neural crest cell development through repression of Zic1, Pax3, and Sox10. -
To Proliferate Or to Die: Role of Id3 in Cell Cycle Progression and Survival of Neural Crest Progenitors
Downloaded from genesdev.cshlp.org on October 4, 2021 - Published by Cold Spring Harbor Laboratory Press To proliferate or to die: role of Id3 in cell cycle progression and survival of neural crest progenitors Yun Kee and Marianne Bronner-Fraser1 Division of Biology, California Institute of Technology, Pasadena, California 91125, USA The neural crest is a unique population of mitotically active, multipotent progenitors that arise at the vertebrate neural plate border. Here, we show that the helix–loop–helix transcriptional regulator Id3 has a novel role in cell cycle progression and survival of neural crest progenitors in Xenopus. Id3 is localized at the neural plate border during gastrulation and neurulation, overlapping the domain of neural crest induction. Morpholino oligonucleotide-mediated depletion of Id3 results in the absence of neural crest precursors and a resultant loss of neural crest derivatives. This appears to be mediated by cell cycle inhibition followed by cell death of the neural crest progenitor pool, rather than a cell fate switch. Conversely, overexpression of Id3 increases cell proliferation and results in expansion of the neural crest domain. Our data suggest that Id3 functions by a novel mechanism, independent of cell fate determination, to mediate the decision of neural crest precursors to proliferate or die. [Keywords: Xenopus; Id3; neural crest; cell cycle; survival] Received September 1, 2004; revised version accepted January 19, 2005. The neural crest is an embryonic cell population that origi- et al. 2003), c-Myc (Bellmeyer et al. 2003), and Msx1 nates from the lateral edges of the neural plate during (Tribulo et al. 2003) have been identified in Xenopus nervous system formation. -
A Combination of GATA3 and SOX10 Is Useful for the Diagnosis of Metastatic Triple-Negative Breast Cancer☆ Gary H
Human Pathology (2019) 85,221–227 www.elsevier.com/locate/humpath Original contribution A combination of GATA3 and SOX10 is useful for the diagnosis of metastatic triple-negative breast cancer☆ Gary H. Tozbikian MD⁎, Debra L. Zynger MD Department of Pathology, The Ohio State University Wexner Medical Center, Columbus, OH 43210, USA Received 9 July 2018; revised 2 November 2018; accepted 7 November 2018 Keywords: Summary In metastatic breast cancer (MBC), it can be difficult to establish the origin if the primary tumor is Triple negative; triple negative or if there is a loss of biomarker expression. SOX10 expression has been reported in primary Breast cancer; triple-negative breast cancer but is poorly studied in metastatic lesions. In this study, the diagnostic utility of SOX10; a panel of SOX10, GATA3, and androgen receptor (AR) in MBC negative for estrogen receptor, progester- GATA3; one receptor, and human epidermal growth factor receptor 2 was evaluated and compared with the expres- Metastatic; sion of these markers in the matched primary breast cancer. In a series of 57 triple-negative MBCs, 82% Primary were positive for GATA3, 58% for SOX10, and 25% for AR. Nearly all MBCs (95%) were positive for ei- ther GATA3 or SOX10, with 46% dual positive and 5% of cases negative for both markers. Most GATA3- negative MBC cases were SOX10 positive (70%). AR expression was only seen in GATA3-positive MBC (25%) and was significantly more frequent in SOX10-negative MBC (48%) versus SOX10-positive MBC (9%; P = .001). Concordance for GATA3, SOX10, and AR between the primary and metastasis was 89%, 88%, and 80%, respectively.