DOCSLIB.ORG

Quantitative Profiling of Codon 816 KIT Mutations Can Aid in The

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Quantitative Profiling of Codon 816 KIT Mutations Can Aid in The Letters to the Editor 1574 Acknowledgements 3 Hurt EM, Wiestner A, Rosenwald A, Shaffer AL, Campo E, Grogan T et al. Over expression of c-maf is a frequent oncogenic event in This study was supported by a grant from Cancer Research Society multiple myeloma that promotes proliferation and pathological Inc. and a grant from Leukemia and Lymphoma Research Society interactions with bone marrow stroma. Cancer Cell 2004; 5: 191–199. of Canada to HC. 4 Suzuki A, Iida S, Kato-Uranishi M, Tajima E, Zhan F, Hanamura I Hong Chang1,2,QQi1,2,WXu3 and B Patterson1,2 et al. ARK5 is transcriptionally regulated by the Large-MAF family 1Department of Laboratory Hematology, Toronto General and mediates IGF-1-induced cell invasion in multiple myeloma: ARK5 as a new molecular determinant of malignant multiple Hospital, University Health Network, Toronto, Ontario, myeloma. Oncogene 2005; 24: 6936–6944. Canada; 2 5 Avet-Loiseau H, Facon T, Grobois B, Magrangeas F, Rapp MJ, Department of Laboratory Medicine and Pathobiology, Harousseau JL et al. Intergroupe Francophone du Myelome. Toronto General Hospital, University Health Network, Oncogenesis of multiple myeloma: 14q32 and 13q chromosomal Toronto, Ontario, Canada and 3 abnormalities are not randomly distributed, but correlate with Department of Biostatistics, University Health Network, natural history, immunological features, and clinical presentation. University of Toronto, Toronto, Ontario, Canada Blood 2002; 99: 2185–2191. E-mail: [email protected] 6 Fonseca R, Blood E, Rue M, Harrington D, Oken MM, Kyle RA et al. Clinical biologic implications of recurrent genomic aberrations in References myeloma. Blood 2003; 101: 4569–4575. 7 Chang H, Samiee S, Qi WY, Yi QL, Mikhael J, Chen C et al. Genetic 1 Nishizawa M, Kataoka K, Goto N, Fujiwara KT, Kawai S. v-maf,a risk identifies myeloma patients who do not benefit from autologous viral oncogene that encodes a ‘leucine zipper’ motif. Proc Natl stem cell transplantation. Bone Marrow Transplant 2005; 36: Acad Sci USA 1989; 86: 7711–7715. 793–796. 2 Chesi M, Bergsagel PL, Shonukan OO, Martelli ML, Brents LA, Chen 8 Chang H, Stewart AK, Qi XY, Li ZH, Yi QL, Trudel S. T et al. Frequent dysregulation of c-maf proto-oncogene at 16q23 by Immunohistochemistry accurately predicts FGFR3 aberrant expres- translocation to an Ig locus in multiple myeloma. Blood 1998; 91: sion and t(4;14) in multiple myeloma. Blood 2005; 106: 4457–4463. 353–355. Quantitative profiling of codon 816 KIT mutations can aid in the classification of systemic mast cell disease Leukemia (2007) 21, 1574–1576; doi:10.1038/sj.leu.2404680; were also analyzed by direct sequencing using the standard published online 5 April 2007 dideoxy-chain termination (Sanger) method. Cases that were negative for codon 816 KIT mutation were also assessed using a D816V mutation specific-probe TaqMan real-time quantitative The KIT receptor tyrosine kinase is normally highly expressed in PCR method. To increase the sensitivity of analysis in BM biopsy myeloid cells and mast cells and promotes growth through material, mast cell clusters, identified on parallel hematoxylin interaction with its ligand, stem cell factor.1 Activating kinase and eosin-stained section, were manually dissected from domain point mutations in KIT at codon 816 in exon 17, formalin-fixed paraffin-embedded sections before DNA extrac- predominantly Asp816Val and less commonly Asp816Phe, are tion and PCR amplification in a subset of cases. highly associated with mast cell disorders (MCD) and result in The pyrosequencing genomic PCR assay assessed exon 17 of ligand-independent kinase signaling.2,3 A number of studies KIT between codons 815 and 822, with a sequencing dispensa- have shown that KIT mutations can be present in a variety of cell tion order maximized for interrogation of codon 816. PCR lineages4 and this results in a spectrum of systemic MCD with (forward 50-TCATGGTCGGATCACAAAGAT, reverse 50-Biotin- associated hematological clonal non-mast cell lineage disease CAGGACTGTCAAGCAGAGAATGG) was done for 35 cycles at (AHNMCD) that have differing clinical behavior.5,6 Mast cells in 941C for 30 s, 561C for 90 s, and 721C for 45 s, followed by bone marrow (BM) in MCD can be easily enumerated by direct purification of product over streptavidin sepharose beads and microscopic examination, with the aid of mast cell tryptase or sequencing using a third primer (50-TGATTTTGGTCTAGCCAG) CD117 immunostaining, or by flow cytometric analysis (e.g. performed on a PSQ HS 96 Pyrosequencer (Biotage, Uppsala, gating on CD117 þ CD25 þ CD2À mast cells). However, MCD Sweden). PCR were run in duplicate and quantification of the with AHNMCD is not as easily recognized. We show here that ratio of codon 816 mutated versus unmutated PCR product was quantitative pyrosequencing and mutation-specific quantitative determined by averaging the peak heights. To optimize the polymerase chain reaction (qPCR) assays for the detection of KIT relative quantitative features of the pyrosequencing assay, PCR codon 816 mutation can be used to highlight the mixed and conditions were optimized to allow as small a number of pure forms of MCD to better aid in disease classification. amplification cycles as possible to generate adequate product Pyrosequencing is a DNA sequencing-by-synthesis method for sequence determination. Assuming most tumor cells will developed for single-nucleotide polymorphism analysis7 that we have one normal and one mutant allele of KIT, the percentage of have adapted here to provide quantitation of the levels of mutated PCR product would be expected to be half as high as mutated and unmutated product at codon 816 of KIT. For this the number of tumor cells. In cases with low level of mutated study, genomic DNA was isolated from BM core biopsy and/or PCR product, qPCR was also performed using KIT-816V BM aspirate samples from 39 patients with morphological (mutated) and KIT-816D (unmutated) FAM dye-labeled MGB evidence of MCD using WHO criteria,6 and subjected to probes in separate PCRs using the TaqMan method on a 7900HT pyrosequencing of KIT exon 17. The majority of cases (n ¼ 34) detection system (Applied Biosystems, Foster City, CA, USA). Leukemia Letters to the Editor 1575 Figure 1 Correlation of levels of KIT D816V mutation with myeloid cell counts as an aid in classification of the type of mast cell disorder. Mast cell and combined non-mast cell myeloid cell counts were done on BM aspirates, and compared to percentage of KIT mutated PCR product detected in a parallel BM aspirate sample. Final diagnoses listed in groups 1 (cases 1–6), 2 (cases 7–10) and 3 (cases 11–16) were based on a review of all pathological material and clinical features. Table 1 Correlation of KIT mutation levels and clinical disease patterns in MCD with D816V No. Age/gender Mast Other myeloid PB Eos (K/UL) %KIT mutant Final diagnosis (pyrosequencing) 1 66/F 94 3 0.02 20 Mast cell leukemia 2 65/F 50 23 0.04 30 Pure MCD 3 47/M 20 43 0.17 17 Pure MCD 4 58/F 20 56 0.06 6 Pure MCD 5 60/F 10 56 0.05 6 Pure MCD 6 71/F 10 56 0.11 13 Pure MCD 7 42/F 25 36 0.44 32 MCD-EOS 8 56/F 30 39 1.09 19 MCD-EOS 9 59/F 2 71 0.82 5 MCD-EOS 10 66/F 15 69 0.57 47 MCD-EOS 11 70/M 60 15 0.04 33 MCD-CMML 12 57/M 30 30 0.8 21 MCD-CMML 13 48/M 12 50 0.04 31 MCD-MDS 14 57/M 1 71 0 45 MCD-MDS 15 67/M 1 82 0.48 45 MCD-MPD 16 67/M o1 71 0.12 40 MCD-MDS Abbreviations: ANMHD; associated clonal hematologic non-mast cell lineage disorder (unspecified type), CMML; chronic myelomonocytic leukemia, EOS; associated isolated eosinophilia (normal reference range 0.04–0.4 Â 109/L), MCD; mast cell disorder, MDS; myelodysplastic syndrome, MPD; myeloproliferative disorder (unspecified type). Thermocyling conditions were 951C for 10 min followed by 40 the Sanger method correlated with pyrosequencing in all cycles of 951C for 15 s and 611C for 1 min. The sensitivity of samples with greater than 15% mast cells but failed to detect each assay was determined by serially diluting DNA with KIT- unequivocally mutations below that level. KIT mutation was not 816V into DNA obtained from cells with umutated KIT. The unequivocally detected by pyrosequencing in any case where sensitivity established by this technique was 5% mutated cells the mast cell counts were below 5% establishing a lower limit of for pyrosequencing, 1% for qPCR and 20% for direct Sanger sensitivity of detection of this assay. Pyrogram peak heights sequencing. corresponding to the mutated product which were below 5%, Using the exon 17 pyrosequencing assay, we tested 74 were considered equivocal and those cases were subjected to samples (29 BM biopsies, 45 BM aspirates) from 39 patients with further analysis with mutation-discrimination qPCR and de- morphologic evidence of MCD. The levels of marrow involve- tected D816V KIT mutation in five additional patients for an ment determined by mast cell number in a 400-cell aspirate overall mutation incidence of 54% for all MCD cases. There differential or semi-quantification of the area occupied by mast were no discordances between qPCR and pyrosequencing when cell aggregates in a parallel section of the biopsy varied from mast cell counts were above 5%. 1 to 60% but was below 5% in 21 of the cases. Codon 816 KIT Figure 1 shows the correlation between the numbers of mast mutation was detected in 16 of 39 patients (41%) by cells and myeloid cells in BM aspirate samples and the levels of pyrosequencing and included D816V in 15 cases and D816F mutated PCR product determined in the 16 cases with KIT in one.
Load more

Recommended publications
  • Haematopoiesis to Describe the Components of Normal Blood, Their Relative Proportions and Their Functions
    Haematopoiesis To describe the components of normal blood, their relative proportions and their functions Blood 8% of body weight Plasma (55%) clear, 90% water, contains salts, enzymes, proteins WBCs and platelet (1%) RBCs (45%) bioconcave– disc, no nucleus = anuclear- 120days lifespan Immature = blasts– Mature= cytes In white blood cells myeloblast goes to neutrophils, basophils, eosinophils Monoblast= monocyte can also become dendritic cells and macrophages – White blood cells (leukocytes)– Polymorphonuclear= neutrophils, eosinophil s, basophils Mononuclear= lymphocytes= T cells, B cells and’ monocytes Lymphoid= NK cells, T-Lymphocyte, B-lymphocyte Myeloid= Monocyte, erythrocyte, neutrophils, basophils, eosinophils, mast cells, megakaryocyte, mast cells BOTH Dendritic cells (from monocyte in myeloid) (lymphoid precursor) Neutrophil – protection from bacteria and fungi Eosinophil- protection against parasites Basophil – increase during allergic reactions Lymphocytes – T cells- protection against viruses, B cells immunoglobulin synthesis Monocyte- protection from back bacteria and fungi phagocytosis – How do blood go from bone to blood vessels? – The bones are perfused with blood vessels- How do we investigate blood? In venepuncture, the superficial veins of the upper limbs are selected and hollow needle is inserted through the skin into the veins. Blood is then collected into evacuated tubes. These veins are present in numbers and are easily accessible. Anticoagulant, EDTA is used to stop blood clotting 1.Using Automated the sample full collected…. blood count Whole blood for a FBC is usually taken into an EDTA tube to stop it from clotting. The blood is well mixed and put through a machine called an automated analyser, counts the numbers and size of RBC and platelets within the blood using sensors Reticulocyte Assessing the young RBCs numbers performed by automated cell counters give indication of output of young RBC by bone marrow – 2.
    [Show full text]
  • 1 the Potential Role of Cytokines and Growth Factors in the Pathogenesis
    Preprints (www.preprints.org) | NOT PEER-REVIEWED | Posted: 10 August 2021 doi:10.20944/preprints202108.0237.v1 The Potential Role of Cytokines and growth factors in the pathogenesis of Alzheimer's Disease Gilbert Ogunmokun1, Saikat Dewanjee2, Pratik Chakraborty2, Chandrasekhar Valupadas3,4 Anupama Chaudhary5, Viswakalyan Kolli6, Uttpal Anand7, Jayalakshmi Vallamkondu8, Parul Goel9, Hari Prasad Reddy Paluru10, Kiran Dip Gill11, P. Hemachandra Reddy12-16 , Vincenzo De Feo17*, ,Ramesh Kandimalla18,19*, 1The University of Texas Health Science Center at Houston (UTHealth) School of Public Health, Houston, Texas, USA 2Advanced Pharmacognosy Research Laboratory, Department of Pharmaceutical Technology, Jadavpur University, Kolkata 700032, India 3Professor, Internal Medicine & Medical Superintendent, MGM Hospital, Warangal, India 4In charge Medical Superintendent, KMC Superspeciality Hospital, Warangal, India 5Orinin-BioSystems, LE-52, Lotus Road 4, CHD City, Karnal, Karnal, Haryana -132001, India 6Professor, Department of Biochemistry, GITAM Institute of Medical Sciences and Research, Visakhapatnam, India 7Department of Life Sciences and the National Institute for Biotechnology in the Negev, Ben-Gurion University of the Negev, Beer-Sheva, Israel 8National Institute of Technology, Warangal 506004, Telangana, India 9Department of Biochemistry, Maharishi Markandeshwar Institute of Medical Sciences & Research, Mullana, Ambala, India 10Sri Krsihnadevaraya University, Anantapur, Andhra Pradesh, India 11Department of Biochemistry, Posgraduate Institute
    [Show full text]
  • Neutrophil-Mediated Treatment of Neurodegenerative and Other Inflammatory Disorders Alain L
    RESEARCH ARTICLE Neutrophil-mediated Treatment of Neurodegenerative and Other Inflammatory Disorders Alain L. Fymat Professor, International Institute of Medicine and Science, California, USA ABSTRACT Conventionally, neuroinflammation has been seen as a branch of immunology linked to neurodegenerative and other inflammatory disorders. The diagnosis and treatment of these disorders are dependent on the ability of delivering diagnostic and therapeutic pharmaceuticals through the blood–brain barrier. While itself contributing to the inflammatory process, the barrier largely hinders or even forbids this delivery but allows neutrophils to pass freely through it. This article discusses the use of a nanobiotechnology-based, neutrophil-mediated treatment of neurodegenerative and other inflammatory disorders. Key words: Dopamine, levodopa, paclitaxel INTRODUCTION A schematic representation of the cells and molecules involved in cerebral inflammation is shown in Figure 1. onventionally, neuroinflammation has been seen as The schema summarizes the pathogenic paths that may a central nervous system (CNS) -centric and specific link intravascular inflammatory events to proepileptogenic branch of immunology. Thus, a great deal of effort events in the brain parenchyma. The BBB and its component C cells forming tight junctions are diagrammed by the oblique has been made to find immunocompetent or inflammatory cells in the brain (or spinal cord) parenchyma. The purpose descending gray lines. External activated microglia and of this article is to query whether neutrophils, which pass gliotic astrocytes interact with the BBB being mediated by freely through the blood–brain barrier (BBB), can mediate the interleukin (IL-1β, IL-6, and IL-12) and tumor necrosis factor delivery of diagnostic and therapeutic drugs to the brain to alpha (TNF-α).
    [Show full text]
  • Hematopathology
    320A ANNUAL MEETING ABSTRACTS expression of ALDH1 was analyzed using mouse monoclonal ALDH1 antibody (BD Conclusions: Based on the present results we conclude that miR29ab1 ko’s have Biosciences, San Jose, CA). Correlations between ALDH1 expression and clinical and decreased hematopoietic stem cell population compared to the wild types and that histological parameters were assessed by Pearson’s Chi-square and M-L Chi-square miR29ab1 might have an important role in the maintenance of this cell population. tests. Survival curves were generated using the Kaplan-Meier method and statistical Also, miR29 genes might regulate immunity and life span, since both miR29ab1 and differences by log rank test. miR29ab1/b2c ko’s seem to have markedly decreased life spans. Results: Majority of the tumors (116, 63%) showed stromal staining only, 21 (11%) tumors showed both epithelial and stromal expression, 47 (26%) tumors did not show 1347 The Majority of Immunohistochemically BCL2 Negative FL Grade either epithelial or stromal staining. The normal salivary gland showed epithelial I/II Carry A t(14;18) with Mutations in Exon 1 of the BCL2 Gene and Can expression only. Statistical analyses did not show any correlation between tumor pattern, Be Identifi ed with the BCL2 E17 Antibody tumor size, the presence of perineural invasion and the patterns of ALDH1 expression. P Adam, R Baumann, I Bonzheim, F Fend, L Quintanilla-Martinez. Eberhard-Karls- The survival analysis using Kaplan-Meier method and log rank test did not show any University, Tubingen, Baden-Wurttemberg, Germany. signifi cant differences among the three patterns of ALDH1 expression with survival.
    [Show full text]
  • Blood and Immunity
    Chapter Ten BLOOD AND IMMUNITY Chapter Contents 10 Pretest Clinical Aspects of Immunity Blood Chapter Review Immunity Case Studies Word Parts Pertaining to Blood and Immunity Crossword Puzzle Clinical Aspects of Blood Objectives After study of this chapter you should be able to: 1. Describe the composition of the blood plasma. 7. Identify and use roots pertaining to blood 2. Describe and give the functions of the three types of chemistry. blood cells. 8. List and describe the major disorders of the blood. 3. Label pictures of the blood cells. 9. List and describe the major disorders of the 4. Explain the basis of blood types. immune system. 5. Define immunity and list the possible sources of 10. Describe the major tests used to study blood. immunity. 11. Interpret abbreviations used in blood studies. 6. Identify and use roots and suffixes pertaining to the 12. Analyse several case studies involving the blood. blood and immunity. Pretest 1. The scientific name for red blood cells 5. Substances produced by immune cells that is . counteract microorganisms and other foreign 2. The scientific name for white blood cells materials are called . is . 6. A deficiency of hemoglobin results in the disorder 3. Platelets, or thrombocytes, are involved in called . 7. A neoplasm involving overgrowth of white blood 4. The white blood cells active in adaptive immunity cells is called . are the . 225 226 ♦ PART THREE / Body Systems Other 1% Proteins 8% Plasma 55% Water 91% Whole blood Leukocytes and platelets Formed 0.9% elements 45% Erythrocytes 10 99.1% Figure 10-1 Composition of whole blood.
    [Show full text]
  • 10 Maturation and Development of Leucocytes
    MODULE Maturation and Development of Leucocytes Hematology and Blood Bank Technique 10 Notes MATURATION AND DEVELOPMENT OF LEUCOCYTES 10.1 INTRODUCTION The leucocytes develop from the multipotent hematopoietic stem cell which then gives rise to a stem cell committed to formation of leucocytes. Both these cells cannot be identified morphologically by routine methods. The various types of leucocytes are granulocytes (neutrophils, eosinophils and basophils), monocytes and lymphocytes. The three cell types develop separately and accordingly these processes will be discussed separately. OBJECTIVES After reading this lesson, you will be able to: z explain the various stages in the development of leucocytes. z describe the different types of leucocytes seen normally in PBF. 10.2 MYELOPOIESIS This is the process of formation of myeloid cells. It is restricted to the bone marrow after birth. The committed progenitor cell for granulocytes and monocytes is the GM-CFU which proliferates and differentiates to form myeloblast and monoblast. The myeloblast is the earliest morphologically identifiable cell. It is 10-18µm in size. The cytoplasm is scant and basophilic, usually agranular and may contain a few azurophilic cytoplasmic granules in the blast transiting to the next stage 80 HEMATOLOGY AND BLOOD BANK TECHNIQUE Maturation and Development of Leucocytes MODULE of promyelocyte. It has a large round to oval nucleus with a smooth nuclear Hematology and Blood membrane. The chromatin is fine, lacy and is evenly distributed throughout the Bank Technique nucleus. Two-five nucleoli can be identified in the nucleus. The next stage of maturation is the Promyelocyte. It is larger than a myeloblast, 12-20 µm with more abundant cytoplasm which has abundant primary azurophilic granules .
    [Show full text]
  • Chronic Myeloid Leukemia: a Guide for Patients
    Chronic Myeloid Leukaemia What is chronic myeloid leukaemia? Let us explain it to you. www.anticancerfund.org www.esmo.org ESMO/ACF Patient Guide Series based on the ESMO Clinical Practice Guidelines CHRONIC MYELOID LEUKEMIA: A GUIDE FOR PATIENTS PATIENT INFORMATION BASED ON ESMO CLINICAL PRACTICE GUIDELINES This guide for patients has been prepared by the Anticancer Fund as a service to patients, to help patients and their relatives better understand the nature of Chronic Myeloid Leukemia (CML) and appreciate the best treatment choices available according to the subtype of CML. We recommend that patients talk to their doctors about the tests or treatments that are needed for their type and stage of disease. The medical information described in this document is based on the clinical practice guidelines of the European Society for Medical Oncology (ESMO) for the management of Chronic Myeloid Leukemia. This guide for patients has been produced in collaboration with ESMO and is disseminated with the permission of ESMO. It has been written by a medical doctor and reviewed by two oncologists from ESMO including the lead author of the clinical practice guidelines for professionals. It has also been reviewed by patients’ representatives from ESMO’s Cancer Patient Working Group. More information about the Anticancer Fund: www.anticancerfund.org More information about the European Society for Medical Oncology: www.esmo.org For words marked with an asterisk, a definition is provided at the end of the document. CML: a guide for patients - Information based on ESMO Clinical Practice Guidelines - v.2013.1 Page 1 This document is provided by the Anticancer Fund with the permission of ESMO.
    [Show full text]
  • Bleeding Fevers! Thrombocytopenia and Neutropenia
    Bleeding fevers! Thrombocytopenia and neutropenia Faculty of Physician Associates 4th National CPD Conference Monday 21st October 2019, Royal College of Physicians, London @jasaunders90 | #FPAConf19 Jamie Saunders MSc PA-R Physician Associate in Haematology, Guy’s and St Thomas’ NHS Foundation Trust Board Member, Faculty of Physician Associates Bleeding fevers; Thrombocytopenia and neutropenia Disclosures / Conflicts of interest Nothing to declare Professional Affiliations Board Member, Faculty of Physician Associates Communication Committee, British Society for Haematology Education Committee, British Society for Haematology Bleeding fevers; Thrombocytopenia and neutropenia What’s going to be covered? - Thrombocytopenia (low platelets) - Neutropenia (low neutrophils) Bleeding fevers; Thrombocytopenia and neutropenia Thrombocytopenia Bleeding fevers; Thrombocytopenia (low platelets) Pluripotent Haematopoietic Stem Cell Myeloid Stem Cell Lymphoid Stem Cell A load of random cells Lymphoblast B-Cell Progenitor Natural Killer (NK) Precursor Megakaryoblast Proerythroblast Myeloblast T-Cell Progenitor Reticulocyte Megakaryocyte Promyelocyte Mature B-Cell Myelocyte NK-Cell Platelets Red blood cells T-Cell Metamyelocyte IgM Antibody Plasma Cell Secreting B-Cell Basophil Neutrophil Eosinophil IgE, IgG, IgA IgM antibodies antibodies Bleeding fevers; Thrombocytopenia (low platelets) Platelet physiology Mega Liver TPO (Thrombopoietin) TPO-receptor No negative feedback to liver Plt Bleeding fevers; Thrombocytopenia (low platelets) Platelet physiology
    [Show full text]
  • Download (6MB)
    THE OXYDASE OF MYELOID TISSUE and THE USE OF . THE OXYDASE REACTION IN THE DIFFERENTIATION OF ACUTE LEUIIAEMIAS. by JOHN SHAW DUNN, M.A. , M.B., Ch.B. ProQuest Number: 27626761 All rights reserved INFORMATION TO ALL USERS The quality of this reproduction is dependent upon the quality of the copy submitted. In the unlikely event that the author did not send a com plete manuscript and there are missing pages, these will be noted. Also, if material had to be removed, a note will indicate the deletion. uest ProQuest 27626761 Published by ProQuest LLO (2019). Copyright of the Dissertation is held by the Author. All rights reserved. This work is protected against unauthorized copying under Title 17, United States C ode Microform Edition © ProQuest LLO. ProQuest LLO. 789 East Eisenhower Parkway P.Q. Box 1346 Ann Arbor, Ml 48106- 1346 1 - PRELIMINARY. The oxidising property of leucocytes was pointed out by Vitali (1887)^^, when he showed that pus added to tincture of guaiacum produced guaiac-blue, without the addition of hydrogen peroxide. He found that the reaction did not take place if the pus were previously boiled, thus showing that the oxygenating substance was thermo-labile. Brandenburg (1900)^, in a further investigation of this subject, was able, by extracting pus with chloroform water and precipitat­ ing with alcohol, to obtain a powder which possessed the oxidising property in a marked degree. He considered it to be of the nature of a ferment, and to have the con­ stitution of a nucleo-albumin. It could be obtained readily from organs vhich contained abundant granular leucocytes, such as bone marrow, but not from purely lymphocytic organs, such as lymphatic glands or thymus, nor from normal liver.
    [Show full text]
  • Hematopoiesis Hematopoietic Stem Cells in Adult AML1/Runx1 Negatively Regulates Quiescent
    AML1/Runx1 Negatively Regulates Quiescent Hematopoietic Stem Cells in Adult Hematopoiesis This information is current as Motoshi Ichikawa, Susumu Goyama, Takashi Asai, Masahito of September 28, 2021. Kawazu, Masahiro Nakagawa, Masataka Takeshita, Shigeru Chiba, Seishi Ogawa and Mineo Kurokawa J Immunol 2008; 180:4402-4408; ; doi: 10.4049/jimmunol.180.7.4402 http://www.jimmunol.org/content/180/7/4402 Downloaded from References This article cites 37 articles, 18 of which you can access for free at: http://www.jimmunol.org/content/180/7/4402.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on September 28, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2008 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology AML1/Runx1 Negatively Regulates Quiescent Hematopoietic Stem Cells in Adult Hematopoiesis1 Motoshi Ichikawa, Susumu Goyama, Takashi Asai, Masahito Kawazu, Masahiro Nakagawa, Masataka Takeshita, Shigeru Chiba, Seishi Ogawa, and Mineo Kurokawa2 Transcription factor AML1/Runx1, initially isolated from the t(8;21) chromosomal translocation in human leukemia, is essential for the development of multilineage hematopoiesis in mouse embryos.
    [Show full text]
  • Blood Lab First Week
    Blood Lab First Week This is a self propelled powerpoint study atlas of blood cells encountered in examination of the peripheral blood smear. It is a requirement of this course that you begin review of these slides with the first day of class in order to familiarize yourself with terms used in describing peripheral blood morphology. Laboratory final exam questions are derived directly from these slides. The content of these slides may duplicate slides (1-37) listed on the Hematopathology Website. You must familiarize yourself with both sets of slides in order to have the best learning opportunity. Before Beginning This Slide Review • Please read the Laboratory information PDF under Laboratory Resources file to learn about – Preparation of a blood smear – How to select an area of the blood smear for review of morphology and how to perform a white blood cell differential – Platelet estimation – RBC morphology descriptors • Anisocytosis • Poikilocytosis • Hypochromia • Polychromatophilia Normal blood smear. Red blood cells display normal orange pink cytoplasm with central pallor 1/3-1/2 the diameter of the red cell. There is mild variation in size (anisocytosis) but no real variation in shape (poikilocytosis). To the left is a lymphocyte. To the right is a typical neutrophil with the usual 3 segmentations of the nucleus. Med. Utah pathology Normal blood: thin area Ref 2 Normal peripheral blood smear. This field is good for exam of cell morphology, although there are a few minor areas of overlap of red cells. Note that most cells are well dispersed and the normal red blood cell central pallor is noted throughout the smear.
    [Show full text]
  • Regulation of Bone Marrow Myeloblast Proliferation in Chronic Myeloid Leukemia1 P
    [CANCER RESEARCH 36, 3034-3038, September 1976) Regulation of Bone Marrow Myeloblast Proliferation in Chronic Myeloid Leukemia1 p. Stryckmans, L. Debusscher, and M. Socquet Service de MédecineetLaboratoire d'Investigation Clinique Institut Jules Bordet,2 1000 Brussels, Belgium SUMMARY CML myeloblasts when the WBC count was high was com pared to the labeling index of CML myeloblasts when the The in vitro [3H]thymidine-labeling index of bone marrow WBC count was normal or close to normal, generally as a myeloblasts and myelocytes was determined for 9 hemato consequence of the treatment. The same comparison was logically normal individuals and 20 Ph'-positive chronic made for CML myelocytes to determine whether the degree myeloid leukemia (CML) patients in the chronic phase of of maturation of the cells plays a role in their sensitivity to their disease. The mean labeling index of myeloblasts from the hypothesized regulation mechanism. CML patients when the white blood cell (WBC) count was lower than 20,000/cu mm (42.4%) was not significantly dif ferent from that of normal myeloblasts (49.9). This index MATERIALS AND METHODS was found to be significantly (p < 0.05) decreased to an average of 20.9% when the WBC count was higher than The proliferative activity of the myeloid cells was studied 40,000/cu mm. The mean labeling index of CML myelocytes for 9 hematologically normal patients and 20 Ph'-positive was not significantly influenced by the level of WBC. CML patients. The CML patients were investigated once or The data presented indicate that such variations in the several times either before treatment (11 observations), dun labeling index of the leukemic myeloblasts represent ing busulfan treatment (4 observations), off busulfan then changes of their proliferative activity related to the level of apy for 35 to 189 days (7 observations), on off another form WBC.
    [Show full text]