DOCSLIB.ORG

Overexpression of Switchgrass Sucrose Synthase (Pvsus1)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Overexpression of Switchgrass Sucrose Synthase (Pvsus1) Biotechnology Biotechnol. J. 2015, 10, 552–563 DOI 10.1002/biot.201400499 Journal www.biotechnology-journal.com Research Article Transgenic switchgrass (Panicum virgatum L.) biomass is increased by overexpression of switchgrass sucrose synthase (PvSUS1) Charleson R. Poovaiah1,2, Mitra Mazarei1,2, Stephen R. Decker2,3, Geoffrey B. Turner2,3, Robert W. Sykes2,3, Mark F. Davis2,3 and C. Neal Stewart, Jr.1,2 1 Department of Plant Sciences, University of Tennessee, Knoxville, TN, USA 2 BioEnergy Science Center, Oak Ridge National Laboratory, Oak Ridge, TN, USA 3 National Renewable Energy Laboratory, Golden, CO, USA Sucrose synthase (SUS) converts sucrose and uridine di-phosphate (UDP) into UDP-glucose and Received 21 AUG 2014 fructose. UDP-glucose is used by the cellulose synthase to produce cellulose for cell wall biosyn- Revised 03 OCT 2014 thesis. For lignocellulosic feedstocks such as switchgrass, the manipulation of cell walls to Accepted 16 OCT 2014 decrease lignin content is needed to reduce recalcitrance of conversion of biomass into biofuels. Accepted Of perhaps equal importance for bioenergy feedstocks is increasing biomass. Four SUS genes article online 19 OCT 2014 were identified in switchgrass. Each gene contained 14 or 15 introns. PvSUS1 was expressed ubiq- uitously in the tissues tested. PvSUS2 and PvSUS6 were highly expressed in internodes and roots, respectively. PvSUS4 was expressed in low levels in the tissues tested. Transgenic switchgrass plants overexpressing PvSUS1 had increases in plant height by up to 37%, biomass by up to 13.6%, and tiller number by up to 79% compared to control plants. The lignin content was increased in all lines, while the sugar release efficiency was decreased in PvSUS1-overexpressing transgenic switchgrass plants. For switchgrass and other bioenergy feedstocks, the overexpression of SUS1 genes might be a feasible strategy to increase both plant biomass and cellulose content, and to Supporting information available online stack with other genes to increase biofuel production per land area cultivated. Keywords: Biofuel · Biomass · Overexpression · Sucrose synthase · Switchgrass 1 Introduction catalyzes the reversible conversion of sucrose to uridine di-phosphate (UDP) to UDP-glucose and fructose [1]. The In higher plants, photosynthates are transported from role of SUS in phloem loading and unloading and in car- source tissues (photosynthetically active mature leaves) bon partitioning for storage and metabolism in the plant to sink tissues (photosynthetically less active shoot apex, cell has been well characterized in many species of higher roots, tubers, fruits, seeds, and stems) via phloem load- plants [2, 3]. The breakdown of sucrose by SUS is corre- ing/unloading, which mostly consists of the disaccharide lated with the sink strength of starch storage organs [4, 5], sucrose. Sucrose synthase (SUS), a glycosyltransferase, e.g. SUS activity is high in potato tubers [5] and maize ker- nels [6]. At the cellular level, SUS can be accumulated in the Correspondence: Dr. C. Neal Stewart, Jr., Department of Plant Sciences, cytosol or associated with the plasma membrane. Cytoso- University of Tennessee, 2431 Joe Johnson Dr., Knoxville, TN 37996-4561, lic SUS is mainly associated with metabolic tasks such as USA respiration and synthesis of starch [2]. Plasma membrane- E-mail: [email protected] associated SUS is linked to the synthesis of cell wall poly- Abbreviations: mTP, mitochondrial targeting peptide; RFP, red fluorescent saccharides callose and cellulose [7]. SUS has been found protein; SUS, sucrose synthase; UDP, uridine di-phosphate to accumulate to high levels along the plasma membrane 552 © 2014 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim Biotechnology Biotechnol. J. 2015, 10, 552–563 Journal www.biotechnology-journal.com www.biotecvisions.com and in microtubules beneath the secondary cell wall (ABB53601), EgSUS3 (ABB53602), PtrSUS1 (AAR03498), thickening in tracheary elements [8]. Maize ZmSUS1 is PtrSUS2 (ABW76422), SoSUS2 (AAM68126), StSUS membrane-associated and is expressed during stem elon- (AAO67719), StSUS2 (AAO34668), BvSUS (AAK65960), gation [9]. Functionally, SUS has been identified as an GhSUS1 (ACV72640), GaSUS3 (AAD28641), Ps-NeSUS integral part of the cellulose synthase machinery and the (AAC28107), MsSUS (AAC17867), BvSUS2 (AAR19769), catalytic unit that is part of the plasma membrane-asso- AtSUS1-6 (NP_197583, NP_199730, NP_192137, ciated rosette structure involved in cellulose synthesis NP_566865, NP_198534, NP_177480), PvSUS (ACP17902), [10]. All four identified SUS genes in barley identified to VaSUS (BAH56282), SbSUS2 (ACM69042), CcSUS2 date exist in both soluble and membrane associated (ABI17891), MeSUS (ABD96570), PtrSUS2 (ABW76422), forms, although their exact functions have not been elu- LpSUS (BAE79815), BoSUS1-4 (AAV64256, AAL50571, cidated [11]. AAL50570, AAL50572), ZmSUS1 (NP_001105323), Overexpression of SUS genes has been established to ZmSUS2 (NP_001105194), ZmSUS-SH1 (NP_001266691), increase cellulose content in diverse species such as Ace- OsSUS1-7 (P31924, P30298, Q43009, Q10LP5, H6TFZ4, tobacter xylinum [12] and poplar [13]. Biomass and lignin Q6K973, Q7XNX6), HvSUS1-4 (P31922, P31923, content did not change in poplar plants overexpressing CAZ65725, AEH16642), Le-FSUS (AAA34196), PpSUS SUS [13]. Biomass was increased in tobacco [14] and cot- (XP_001781447). The amino acid sequences were aligned ton [15] when SUS was overexpressed. However, when using the online version of MAFFT v 7.0 [18]. Model test- SUS was downregulated in carrot, there was decreased ing for producing the best-fit model was done using cellulose content [16]. However, whether or not these par- ProtTest v 2.4 [19]. The maximum likelihood tree was con- ticular isoforms were associated with membranes has not structed by PhyML [20] using the model identified by been established. ProtTest and bootstrapping with 100 trees. The resulting In our study, we identified four SUS genes in the lig- tree was visualized in FigTree v.1.4.0 (http://tree.bio.ed. nocellulosic biofuel feedstock switchgrass (Panicum vir- ac.uk/software/figtree) and rooted using the Physco mi - gatum L.) and compared their sequences to previously trella patens gene as the outgroup. identified SUS genes. Subcellular localization of PvSUS1 was studied using a translational fusion construct to a flu- 2.2 PvSUS1 cloning orescent protein gene. Stable transgenic switchgrass plants were made whereby overexpression of PvSUS1 RNA was extracted from E2 to E3 stage [21] stem and leaf yielded variable results including plants with increased of ST1 switchgrass, a clonal genotypye of cultivar Alamo, biomass and cellulose content. Our findings indicated using TRIREAGENT (Molecular Research Center, Inc. PvSUS1 is likely to be membrane-associated and could Cincinnati, OH, USA) following the manufacturer’s guide- play a role in cellulose synthesis, which renders it a good lines. cDNA was synthesized using random hexamers candidate for improving biomass and biofuel yield for sus- and oligo dT using iScript™ cDNA synthesis kit (Bio-Rad tainable energy production, likely in concert with other Laboratories, Inc., Hercules, CA, USA) after DNase treat- genetic modifications. ment (Promega Corporation, Madison, WI, USA). PvSUS1 was amplified from the cDNA using the primers CP33 and CP34 (Table 1). PvSUS1 was cloned into pCR8-GW-TOPO 2 Materials and methods vector (Life Technologies, Carlsbad, CA, USA) for sequence verification. PvSUS1 was subsequently cloned 2.1 Bioinformatic and cluster analyses into pANIC-10A vector [21] using the Gateway recombi- nation reaction to produce the overexpression vector sub- Rice and maize SUS sequences were used for BLAST sequently used for stable switchgrass transformation, searches against the switchgrass sequence database where the gene was driven by maize ubiquitin-1 promot- (www.phytozome.net) to identify putative switchgrass er. members of the SUS gene family. Exon–intron structure was predicted by comparing genomic sequences with 2.3 Subcellular localization experiments mRNA and complementary DNA (cDNA) sequences. To identify conserved domains in SUS proteins, a search was To construct plasmids for subcellular localization PvSUS1 done with the InterPro program using the Pfam database was amplified with restriction sites HindIII and BamHI [17]. using the primers CP210 and CP211 (Table 1) and then To enable cluster analysis, derived amino acid subcloned into the vector pSAT6-RFP-C1 [22] at HindIII sequences of SUS genes were obtained from Genbank. and BamHI restriction sites to generate the plasmid Protein accession numbers of SUS genes from Eucalyp- pSAT6-RFP-C1-PvSUS1. The procedure for transient tus, poplar, sugarcane, potato, beet, cotton, pea, Ara- expression in living onion epidermal cells using particle bidopsis, Phaseolus, Vigna, Lolium, bamboo, maize, rice, bombardment was done as described previously [23] with barley, tomato, and Physcomitrella were used: EgSUS1 slight modifications. Briefly, 10 μg of pSAT6-RFP-C1, sub- © 2014 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim 553 Biotechnology Biotechnol. J. 2015, 10, 552–563 Journal www.biotechnology-journal.com www.biotecvisions.com Table 1. Primer sequences used in cloning, PCR confirmation and qPCR switchgrass sucrose synthase gene experiments Primer no. Primer name Primer sequence 5′ → 3′ CP33 PvSUS1-R TCACTTGCTGGAGGGCTCTCCCTC CP34 PvSUS1-F ATGGGGGAAGCTGCCGGCGACCGC CP43 PCR-F TCGATGCTCACCCTGTTGTTTGG CP44 PCR-R CGATCATAGGCGTCTCGCATATCTC CP101
Load more

Recommended publications
  • Plant Fact Sheet
    United States Department of Agriculture NATURAL RESOURCES CONSERVATION SERVICE Forestry Technical Note No. MT-27 April 2006 FORESTRY TECHNICAL NOTE ______________________________________________________________________ Performance Evaluations of Herbaceous Vegetation on Disturbed Forestland in Southeastern Montana Robert Logar, State Staff Forester Larry Holzworth, Plant Material Specialist Summary Information for seeding herbaceous vegetation following forestland disturbance was identified as a conservation need in southeastern Montana. The herbaceous vegetation could be used to control soil erosion, stabilize disturbed sites, manage noxious weeds and provide forage. The Fulton Ranch field evaluation planting (FEP) was established in November 1995 on a disturbed forestland site in southeastern Montana to study the adaptation, performance and use of various grass species. The site, a Ponderosa pine/Idaho fescue habitat-type, had received a light to moderate burn from a wildfire that occurred in August 1994 and was logged the following spring. Nineteen evaluation plots were established to test seventeen different accessions of grasses; two control (unseeded) plots were established. Each plot was one-quarter of an acre in size. Seeded species included ‘Sherman’ big bluegrass, ‘Latar’ orchardgrass, ‘Paiute’ orchardgrass, ‘Manska’ pubescent wheatgrass, ‘Oahe’ intermediate wheatgrass, ‘Rush’ intermediate wheatgrass, ‘Dacotah’ switchgrass, ‘Forestberg’ switchgrass, 9005308 mountain brome, ‘Regar’ meadow brome, ‘Redondo’ Arizona fescue, ‘Whitmar’ beardless wheatgrass, ‘Goldar’ bluebunch wheatgrass, M-1 Nevada bluegrass, ‘Killdeer’ sideoats grama, ‘Pierre’ sideoats grama, and ‘Pryor’ slender wheatgrass. An evaluation of several species for seeding road systems was also conducted as part of this FEP. Road surface, cut and fill slopes were seeded with ‘Luna’ pubescent wheatgrass, ‘Covar’ sheep fescue, ‘Durar’ hard fescue, ‘Critana’ thickspike wheatgrass, ‘Sodar’ streambank wheatgrass, and ‘Rosana’ western wheatgrass.
    [Show full text]
  • Planting and Managing Switchgrass As a Biomass Energy Crop
    United States Technical Note No. 3 Department of Agriculture Natural Resources Conservation Service Plant Materials Planting and Managing Program September 2009 Switchgrass as a Biomass Energy Crop Issued September 2009 Cover photo: Harvesting dormant switchgrass for biofuel (Photo by Don Tyler, University of Tennessee) The U.S. Department of Agriculture (USDA) prohibits discrimination in all its programs and activities on the basis of race, color, national origin, age, disability, and where applicable, sex, marital status, familial status, parental status, religion, sexual orientation, genetic information, political beliefs, re­ prisal, or because all or a part of an individual’s income is derived from any public assistance program. (Not all prohibited bases apply to all programs.) Persons with disabilities who require alternative means for communication of program information (Braille, large print, audiotape, etc.) should con­ tact USDA’s TARGET Center at (202) 720–2600 (voice and TDD). To file a complaint of discrimination, write to USDA, Director, Office of Civil Rights, 1400 Independence Avenue, SW., Washington, DC 20250–9410, or call (800) 795–3272 (voice) or (202) 720–6382 (TDD). USDA is an equal opportunity provider and employer. Preface The U.S. Department of Agriculture (USDA) Natural Resources Conserva­ tion Service (NRCS) Plant Materials Program has been involved in the col­ lection, evaluation, selection, increase, and release of conservation plants for 76 years. Switchgrass (Panicum virgatum L.) was quickly recognized as one of the key perennial grasses for soil conservation following the dust bowl era of the 1930s. The first named switchgrass cultivar, ‘Blackwell’, was released in 1944 by the NRCS Manhattan, Kansas, Plant Materials Center (PMC) in cooperation with the Kansas Agriculture Experiment Station.
    [Show full text]
  • Plant Sheet-- Switchgrass (Panicum Virgatum)
    September 2005 Jimmy Carter Plant Materials Center Americus, Georgia PLANT SHEET Switchgrass (Panicum virgatum) Special Edition: For Farm Bill Implementation Description: Switchgrass is a native warm season, rhizomatous, perennial grass that ranges in height from 3 to 6 feet. It is a bunch grass with flat leaf blades about ½ inch wide and 30 inches in length. It is a good cover plant for birds and some small game. 'Alamo' is a good forage on sites in coastal plain and Piedmont regions. It can be used for forage, conservation buffers, streambank stabilization, filter strips and wildlife. Alamo Switchgrass Conservation Uses: Grazing Land Wildlife habitat improvement Critical area stabilization Biofuel/Alternative Fuels Streambank Stabilization Nutrient Reclamation Filter Strip Conservation Buffers Urban Conservation 2002 Farm Bill Implementation Grazing Land Study ESTABLISHMENT OF NATIVE WARM SEASON GRASSES Native warm season grasses need special attention given during purchasing, planting and management of established stands. The following features make native warm-season grass planting different from other traditional plantings: • Planting rates for warm season grasses are based on pure live seed (PLS) lb/acre and NOT bulk lb/acre. • All warm-season grasses require a firm seedbed for best establishment. • Traditional seeding equipment works well for switchgrass and eastern gamagrass, but fluffy- seeded species such as big bluestem, little bluestem and indiangrass require special equipment and/or techniques for successful seedings. Streambank Stabilization Conservation Buffers (Alamo switchgrass) Switchgrass Buffer (Panicum virgatum) 2 PURCHASING SEED It is best to purchase certified seed of varieties adapted to the region of planting. Certified seed is guaranteed to be true to a variety, and use of certified seed may lead to a more reliable planting.
    [Show full text]
  • Living Shorelines for Master Gardeners
    Living Shorelines for Master Gardeners David O’Brien National Marine Fisheries Service Gloucester Point, VA Frequently Asked Questions MGs hear from the public about shorelines • What to plant on steep slopes? • What resources are available for local educators? • What to do about an undercut bank? • What can be done about boat wake erosion? • What to do with a shady, eroding bank? • ItdittIs anyone studying ways to capture, stabilize and plant river silt. Coir • How do you identify marsh rolls are too expensive and short grasses? lived; sand bags? • What grasses should I plant in the • Isn’t there a law to make pppeople marsh area (perhaps after killing all who live/own businesses on the the phrag)? water protect the shorelines from • Where can I get these plants and pollution and excessive nitrogen? when/how should they be planted? • How can we create and consistently enforce standards that protect fragile shorelines and yet permit reasonable development? • What do you do if you try to protect the shoreline and your neighbor doesn’t? Cumulative Impacts of Shoreli ne H ard eni ng • Forest loss & fragmentation • Wetland loss • Sediment supply & transport altered • Static shoreline, reduced biodiversity • Aquatic habitat loss Non-Structural & Hybrid Alternatives for Erosion Protection “Living Shorelines” • Succession of natural vegetation buffers – Riparian buffers – Tidal marshes – SdbhSand beaches – Shallow water reefs & underwater grasses • GdGradual ll slopes • Ecosystem services are maintained Least MOST Suitable SUITABLE Bayfront &
    [Show full text]
  • Panicum Virgatum L.)
    Identification, Characterization, and Impact of Pathogenic Fusarium Species on Switchgrass (Panicum virgatum L.) M.S. Research Proposal Seminar Summary Kristie Mantooth February 2013 Biofuel is a promising source of alternative fuel that is the focus of much current research. Switchgrass (Panicum virgatum L.) is being considered as a cellulosic feedstock for biofuel. This warm-season, perennial grass is native to North America. It is seed propagated and can be managed with conventional farming equipment (Lewandowski 2003, McLaughlin 2002) with low agricultural inputs (Bouton 2008). This species is a relatively new crop that has only recently been grown in large acreage monoculture (Bouton 2008). There is limited knowledge of switchgrass pathogens and it is expected that an increase in disease reports will accompany the increase in land dedicated to this promising perennial grass. A recent study in our lab (Vu 2011) found more than 2,000 fungal isolates on switchgrass seeds. Species of Fusarium were among the most common pathogens found. The USDA fungal database (Farr and Rossman 2013) includes 146 fungal isolates recovered from switchgrass, including ten Fusarium species. Species of Fusarium are known pathogens of important crops such as corn, rice, and wheat and some produce toxins that may be harmful to animals. Controlling these pathogens should be included in management practices of switchgrass grown for biofuel. The purpose of this proposed research is to identify and characterize the impacts of Fusarium species on switchgrass. The objectives are 1) identify and characterize Fusarium isolates previously collected from switchgrass seeds produced outside Tennessee 2) determine pathogenicity and virulence of Fusarium species on switchgrass 3) determine impact of selected virulent Fusarium species on stand establishment, plant health and development, and biomass 4) determine pathogenicity and virulence of the most virulent Fusarium species from switchgrass on other hosts and 5) identify seedborne pathogens of switchgrass from fields in the southeast.
    [Show full text]
  • Screening Ornamentals for Their Potential As As Accumulator Plants
    Journal of Agricultural Science; Vol. 5, No. 10; 2013 ISSN 1916-9752 E-ISSN 1916-9760 Published by Canadian Center of Science and Education Screening Ornamentals for Their Potential as As Accumulator Plants Stewart T. Reed1, Tomas Ayala-Silva1, Christopher B. Dunn1, Garry G. Gordon2 & Alan Meerow1 1 USDA, Agricultural Research Service, Subtropical Horticulture Research Station, 13601 Old Cutler Road, Miami, FL 33158, USA 2 Department of Homeland Security, U.S. Customs and Border Protection, Miami Cargo Clearance Center, 6601 NW 25TH Street Room 272, Miami, FL 33122, USA Correspondence: Stewart T. Reed, USDA, Agricultural Research Service, Subtropical Horticulture Research Station, 13601 Old Cutler Road, Miami, FL 33158, USA. Tel: 1-786-573-7048. E-mail: [email protected] Received: August 12, 2013 Accepted: August 28, 2013 Online Published: September 15, 2013 doi:10.5539/jas.v5n10p20 URL: http://dx.doi.org/10.5539/jas.v5n10p20 Abstract Arsenic-based pesticides, herbicides and insecticides are used in horticultural operations resulting in soil contamination around greenhouse structures. Phytoremediation and phytostabilization are two techniques for treating arsenic (As) contaminated soil. Several ornamental plant species, Iris (Iris savannarum), switchgrass (Panicum virgatum), Tithonia rotundiflora, Coreopsis lanceolata, sunflower (Helianthus annuus), and marigold (Tagetes erecta), were evaluated for their potential use as accumulator plants. Based on dry weight, tithonia and coreopsis were most sensitive to As. Tithonia had an 85% reduction in dry weight at 0.75 mg As L-1 and coreopsis a 65% reduction at 2.25 mg As L-1 solution concentration. Iris dry weight increased with increasing solution concentrations but As did not accumulate in tissue.
    [Show full text]
  • Environmental Performance of Miscanthus, Switchgrass and Maize: Can C4 Perennials Increase the Sustainability of Biogas Production?
    sustainability Article Environmental Performance of Miscanthus, Switchgrass and Maize: Can C4 Perennials Increase the Sustainability of Biogas Production? Andreas Kiesel *, Moritz Wagner and Iris Lewandowski Department Biobased Products and Energy Crops, Institute of Crop Science, University of Hohenheim, Fruwirthstrasse 23, 70599 Stuttgart, Germany; [email protected] (M.W.); [email protected] (I.L.) * Correspondence: [email protected]; Tel.: +49-711-459-22379; Fax: +49-711-459-22297 Academic Editor: Michael Wachendorf Received: 31 October 2016; Accepted: 15 December 2016; Published: 22 December 2016 Abstract: Biogas is considered a promising option for complementing the fluctuating energy supply from other renewable sources. Maize is currently the dominant biogas crop, but its environmental performance is questionable. Through its replacement with high-yielding and nutrient-efficient perennial C4 grasses, the environmental impact of biogas could be considerably improved. The objective of this paper is to assess and compare the environmental performance of the biogas production and utilization of perennial miscanthus and switchgrass and annual maize. An LCA was performed using data from field trials, assessing the impact in the five categories: climate change (CC), fossil fuel depletion (FFD), terrestrial acidification (TA), freshwater eutrophication (FE) and marine eutrophication (ME). A system expansion approach was adopted to include a fossil reference. All three crops showed significantly lower CC and FFD potentials than the fossil reference, but higher TA and FE potentials, with nitrogen fertilizer production and fertilizer-induced emissions identified as hot spots. Miscanthus performed best and changing the input substrate from maize to miscanthus led to average reductions of −66% CC; −74% FFD; −63% FE; −60% ME and −21% TA.
    [Show full text]
  • Growing Giant Miscanthus in Illinois
    Growing Giant Miscanthus in Illinois Rich Pyter1, Tom Voigt2, Emily Heaton3, Frank Dohleman4, and Steve Long5 University of Illinois Images Courtesy of Frank Dohleman Highlights • Giant Miscanthus (Miscanthus x giganteus) is a warm-season Asian grass showing great potential as a biomass crop in Illinois; at several Illinois sites, research plantings of Giant Miscanthus have produced greater yields than switchgrass. • Giant Miscanthus is sterile and is propagated by rhizome division. • To grow Giant Miscanthus, plant rhizomes approximately 4-inches deep and 3-feet apart within rows and 3-feet between rows. • Weeds must be controlled during the planting season to ensure a successful planting. • Stems of Giant Miscanthus are harvested in winter when dormant. • To date, there have been no biomass losses due to insects or diseases. Introduction In Illinois, traditional energy sources include coal, oil, and nuclear power. There is presently, however, much interest in locally produced energy sources that can reduce reliance on energy that originates outside of Illinois. Wind, corn-based ethanol, and soybean-based biodiesel are all examples of locally produced alternative energy sources. Other potential Illinois energy sources are crop residues or dedicated plants, primarily perennial grasses, which are burned to produce heat and electricity or treated with enzymes to produce sugars that can then be used to produce cellulosic ethanol. Plants used in these ways may be termed biomass crops, biofuel crops, bioenergy crops, or feedstocks. One such biomass crop is the U.S. native prairie plant, switchgrass (Panicum virgatum). A warm-season grass, switchgrass can grow to six feet or more; produces short, scaly rhizomes; and is tolerant of a variety of soils.
    [Show full text]
  • Transcriptional and Physiological Data Reveal the Dehydration Memory
    Zhang et al. Biotechnol Biofuels (2018) 11:91 https://doi.org/10.1186/s13068-018-1088-x Biotechnology for Biofuels RESEARCH Open Access Transcriptional and physiological data reveal the dehydration memory behavior in switchgrass (Panicum virgatum L.) Chao Zhang1,2, Xi Peng1, Xiaofeng Guo1, Gaijuan Tang3, Fengli Sun1,2, Shudong Liu1,2 and Yajun Xi1,2* Abstract Background: Switchgrass (Panicum virgatum L.) is a model biofuel plant because of its high biomass, cellulose-rich- ness, easy degradation to ethanol, and the availability of extensive genomic information. However, a little is currently known about the molecular responses of switchgrass plants to dehydration stress, especially multiple dehydration stresses. Results: Studies on the transcriptional profles of 35-day-old tissue culture plants revealed 741 dehydration memory genes. Gene Ontology and pathway analysis showed that these genes were enriched in phenylpropanoid biosyn- thesis, starch and sucrose metabolism, and plant hormone signal transduction. Further analysis of specifc pathways combined with physiological data suggested that switchgrass improved its dehydration resistance by changing vari- ous aspects of its responses to secondary dehydration stress (D2), including the regulation of abscisic acid (ABA) and jasmonic acid (JA) biosynthesis and signal transduction, the biosynthesis of osmolytes (L-proline, stachyose and tre- halose), energy metabolism (i.e., metabolic process relating to photosynthetic systems, glycolysis, and the TCA cycle), and lignin biosynthesis. The transcriptional data and chemical substance assays showed that ABA was signifcantly accumulated during both primary (D1) and secondary (D2) dehydration stresses, whereas JA accumulated during D1 but became signifcantly less abundant during D2. This suggests the existence of a complicated signaling network of plant hormones in response to repeated dehydration stresses.
    [Show full text]
  • Nutrient Uptake of Ornamental Plants Exposed to Arsenic in Hydroponic Solution
    Journal of Agricultural Science; Vol. 5, No. 12; 2013 ISSN 1916-9752 E-ISSN 1916-9760 Published by Canadian Center of Science and Education Nutrient Uptake of Ornamental Plants Exposed to Arsenic in Hydroponic Solution Stewart Reed1, Tomas Ayala-Silva1, Christopher B. Dunn1, Garry G. Gordon2 & Alan Meerow1 1 USDA, Agricultural Research Service, Subtropical Horticulture Research Station, 13601 Old Cutler Road, Miami, FL 33158, USA 2 Department of Homeland Security, U.S. Customs and Border Protection, Miami Cargo Clearance Center, 6601 NW 25TH Street Room 272, Miami, FL 33122, USA Correspondence: Stewart Reed, USDA, Agricultural Research Service, Subtropical Horticulture Research Station, 13605 Old Cutler Road, Miami, FL, USA. Tel: 1-786-573-7048. E-mail: [email protected] Received: August 14, 2013 Accepted: September 5, 2013 Online Published: November 15, 2013 doi:10.5539/jas.v5n12p1 URL: http://dx.doi.org/10.5539/jas.v5n12p1 Abstract Arsenic-based agro-chemicals have contaminated considerable acreage on turf-farms, orchards, and around horticultural production structures. A study was undertaken to evaluate iris (Iris savannarum), switchgrass (Panicum virgatum), Tithonia rotundiflora, Coreopsis lanceolata, sunflower (Helianthus annuus), and marigold (Tagetes erecta) for their potential use as arsenic (As) accumulator plants. Plants were grown hydroponically with a modified Hoagland solution containing either 0, 10, 50 or 70 uM As (0.0, 0.75, 3.75, 5.25 mg L-1, respectively). At 5.25 mg As L-1 solution there were no significant reductions in dry weight below that of the controls for iris marigold and sunflower. Maximum shoot As content (mg) for coreopsis and tithonia was reached at 0.75 and for switchgrass at 3.75 mg As L-1 solution.
    [Show full text]
  • Cuticular Wax Variants in a Population of Switchgrass (Panicum Virgatum L.)
    Cuticular wax variants in a population of switchgrass ( Panicum virgatum L.) Item Type Article Authors Weaver, Joshua M.; Lohrey, Greg; Tomasi, Pernell; Dyer, John M.; Jenks, Matthew A.; Feldmann, Kenneth A. Citation Weaver, J. M., Lohrey, G., Tomasi, P., Dyer, J. M., Jenks, M. A., & Feldmann, K. A. (2018). Cuticular wax variants in a population of switchgrass (Panicum virgatum L.). Industrial Crops and Products, 117, 310-316. DOI 10.1016/j.indcrop.2018.02.081 Publisher ELSEVIER SCIENCE BV Journal INDUSTRIAL CROPS AND PRODUCTS Rights © 2018 Elsevier B.V. All rights reserved. Download date 30/09/2021 17:41:20 Item License http://rightsstatements.org/vocab/InC/1.0/ Version Final accepted manuscript Link to Item http://hdl.handle.net/10150/627888 Cuticular Wax Variants in a Population of Switchgrass (Panicum virgatum L.) Joshua M. Weavera,*, Greg Lohreyc, Pernell Tomasic, John M. Dyerc, Matthew A. Jenksb, and Kenneth A. Feldmanna a School of Plant Sciences, University of Arizona, Tucson, AZ 85721, USA b Division of Plant and Soil Sciences, West Virginia University, Morgantown, WV 26506, USA c US Arid-Land Agricultural Research Center, Maricopa, AZ 85138, USA * Corresponding author Joshua M. Weaver School of Plant Sciences University of Arizona 303 Forbes Building P.O. Box 210036 Tucson, AZ 85721-0036 Phone: 520-621-7158 Fax: 520-621-7168 E-Mail: [email protected] Keywords Panicum virgatum; Poaceae; switchgrass; leaf; cuticular wax variants; β-diketones Abstract Leaf cuticular waxes are known to influence both biotic and abiotic stress tolerances of plants. The objective of this work was to characterize the wax phenotypic diversity present in a population of 1849 switchgrass plants.
    [Show full text]
  • Roles of Soil Biotic and Abiotic Factors on Switchgrass's (Panicum Virgatum) Growth, Defense Against Herbivory and Cell Wall Chemistry
    University of Louisville ThinkIR: The University of Louisville's Institutional Repository Electronic Theses and Dissertations 5-2020 Aboveground-belowground interactions: roles of soil biotic and abiotic factors on switchgrass's (panicum virgatum) growth, defense against herbivory and cell wall chemistry. Binod Basyal University of Louisville Follow this and additional works at: https://ir.library.louisville.edu/etd Part of the Biology Commons, Ecology and Evolutionary Biology Commons, and the Plant Sciences Commons Recommended Citation Basyal, Binod, "Aboveground-belowground interactions: roles of soil biotic and abiotic factors on switchgrass's (panicum virgatum) growth, defense against herbivory and cell wall chemistry." (2020). Electronic Theses and Dissertations. Paper 3394. Retrieved from https://ir.library.louisville.edu/etd/3394 This Doctoral Dissertation is brought to you for free and open access by ThinkIR: The University of Louisville's Institutional Repository. It has been accepted for inclusion in Electronic Theses and Dissertations by an authorized administrator of ThinkIR: The University of Louisville's Institutional Repository. This title appears here courtesy of the author, who has retained all other copyrights. For more information, please contact [email protected]. ABOVEGROUND-BELOWGROUND INTERACTIONS: ROLES OF SOIL BIOTIC AND ABIOTIC FACTORS ON SWITCHGRASS’S (PANICUM VIRGATUM) GROWTH, DEFENSE AGAINST HERBIVORY AND CELL WALL CHEMISTRY By Binod Basyal B.Sc. Agriculture, Tribhuvan University, Nepal, 2013 A Dissertation Submitted to the Faculty of the College of Arts and Sciences of the University of Louisville in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy in Biology Department of Biology University of Louisville Louisville, Kentucky May, 2020 ABOVEGROUND-BELOWGROUND INTERACTIONS: ROLES OF SOIL BIOTIC AND ABIOTIC FACTORS ON SWITCHGRASS’S (PANICUM VIRGATUM) GROWTH, DEFENSE AGAINST HERBIVORY AND CELL WALL CHEMISTRY By Binod Basyal B.Sc.
    [Show full text]