• Abstract and Figures
• Public Full-text

Animal Conservation (1999) 2, 165–171 © 1999 The Zoological Society of London Printed in the United Kingdom Molecular genetic relationships of the extinct ostrich, Struthio camelus syriacus: consequences for ostrich introductions into Saudi Arabia Terence J. Robinson and Conrad A. Matthee Department of Zoology and Entomology, University of Pretoria, Pretoria 0002, South Africa (Received 24 September 1998; accepted 26 November 1998) Abstract We sequenced part of the mitochondrial DNA control region of the extinct Arabian ostrich, Struthio camelus syriacus, to determine its phylogenetic relationship to the surviving subspecies, and to pro- vide genetic information pertinent to the reintroduction of contemporary ostrich into Saudi Arabia. Parsimony, neighbour joining, maximum likelihood and a minimum spanning network all supported a close genetic association between the Arabian S. c. syriacus and the north African S. c. camelus. Furthermore, all our analyses suggest a recent common ancestry for the southern African S. c. australis and the east African S. c. massaicus. The Somali race, S. c. molybdophanes, was phyloge- netically the most distinct of the ostrich taxa. Our data are supportive of a management decision to introduce S. c. camelus into areas once occupied by the extinct S. c. syriacus based predominantly on their geographic proximity and phenotypic features. Moreover, the presence of a shared lineage in these taxa indicates that gene flow between the two geographic forms may have been possible in the recent evolutionary past, probably along the Egyptian–Sinai–Israel passageway. INTRODUCTION taxa was thought to reflect the fact that their current iso- lation by the ‘miombo’ woodlands of south-central The ostrich, Struthio camelus, is the largest extant flight- Africa (Fig. 1) is of recent origin. less bird. During the recent past, habitat degradation and Prior to 1939 a fifth, now extinct, subspecies, S. c. the persecution of birds for meat, skins, feathers and syriacus, survived in the deserts of central and northern eggs have had a sharp impact on their numbers in the Arabia (Rothschild, 1919; Brown et al., 1982; Jennings, wild. Although records indicate that the ostrich was once 1986). Based on historic, and largely anecdotal, reports, widely distributed throughout Africa, parts of Arabia and S. c. syriacus’ range was thought to be restricted to two nearby regions in the Middle East, they are now discrete regions in the Arabian peninsula, a southern restricted to a fraction of their former range (Brown, population inhabiting the edge of the Rub al Khali, and Urban & Newman, 1982; Jennings, 1986). a northern population encompassing Syria, Jordan and Four extant morphologically defined subspecies, sub- northern Saudi Arabia (Fig. 1; and see Jennings, 1986). divided into discrete northern and southern populations, Two hypotheses have been suggested for the origin are recognized. The species’ northern distribution of the extinct S. c. syriacus (Seddon & Soorae, 1998). includes S. c. camelus, S. c. molybdophanes and S. c. Firstly, that S. c. syriacus arose from a northern exten- massaicus, while S. c. australis is confined to southern sion of S. c. camelus, effected through a landbridge Africa (Fig. 1). A recent study of mitochondrial DNA between the Sinai and the Egypto-Somalian domain restriction fragment length polymorphisms (mtDNA (Fig. 1), which was subsequently disrupted by the Red RFLPs), within and among ostrich populations (Freitag Sea and Gulf of Suez in the late Pleistocene. Secondly, & Robinson, 1993), showed the northern populations to the proximity of Africa to the Arabian peninsula, and be geographically partitioned, and that their phylogeog- documented evidence of landbridge connections in this raphy corresponds well with recognized subspecific region at 53 000, 34 000 and 25 000 to 11 000 years boundaries. In marked contrast, however, low levels of before present (Delany, 1989), suggest an alternative sequence divergence distinguish S. c. australis and S. c. colonization route in this region but, importantly, one massaicus, and the presence of a shared lineage in these which may have been used by S. c. molybdophanes. As part of a larger conservation programme to restore All correspondence to: T. J. Robinson. Tel: +27 12 420 2608; Fax: native biodiversity in Saudi Arabia, the country’s + 27 12 362 5242; E-mail: [email protected]. National Commission for Wildlife Conservation and 166 T. J. ROBINSON & C. A. MATTHEE Fig. 1. Struthio camelus specimens sampled in this study. Squares represent precisely known collection localities and question marks uncertain localities. Approximate subspecies boundaries (dotted lines) were taken from Brown et al. (1982). Haplotype designations are given in parentheses. Specimen numbers and mtDNA control region haplotypes correspond to those given in Table 1. Development (NCWCD) has embarked on a series of a land bridge connecting it to Africa, the identification wildlife restoration initiatives that include the reintro- of S. c. syriacus’ closest living relative is still open to duction of species such as the Houbara bustard question. (Chlamydotis macqueenii), the Arabian oryx (Oryx To more clearly characterize the relationship among leucoryx) and the Arabian gazelles (Gazella gazella and the ostrich subspecies we sequenced the highly variable G. subgutturosa; see Dunham et al., 1993; Haque & 5' portion of the mitochondrial DNA control region. The Smith 1996; Dunham, 1997; Ostrawski et al., 1998). The analysis included representatives of all four extant sub- most recent addition to this list is the ostrich. The species species as well as the extinct S. c. syriacus. We show a was selected both for its conservation value as well as close evolutionary relationship between S. c. australis for its role as a ‘flagship’ species that could be used to and S. c. massaicus, that S. c. molybdophanes is phylo- raise public awareness of conservation issues in general genetically the most distinct of the subspecies and, (Seddon & Soorae, 1998). As a result, steps were taken finally, that S. c. camelus and S. c. syriacus are sister to introduce birds into Mahazat as-Sayd in western cen- taxa that share an identical mtDNA lineage. tral Saudi, an area formerly within the range of S. c. syriacus. In the absence of phylogenetic information, MATERIALS AND METHODS NCWCD chose specimens of S. c. camelus for the rein- troduction based on the nominates’ geographic proxim- Specimens used in the present study ity and phenotypic resemblance to S. c. syricus (Seddon & Soorae, 1998). However, given the possibility of Our study material comprised 18 Struthio camelus spec- S. c. molybdophanes dispersion into southern Arabia via imens: five S. c. australis, two S. c. massaicus, two Phylogeny of Struthio camelus 167 Table 1. Struthio camelus specimens used in this investigation together with their subspecies designations, country of origin, source of DNA extraction and mtDNA haplotype Specimen numbers and Origin of material (country of origin) where known Source of DNA mtDNA control subspecies designation region haplotype 1 S. c. australis Hwange National Park (Zimbabwe) Blood A 2 S. c. australis Kalahari National Park (South Africa) Heart tissue B 3 S. c. australis De Hoop Nature Reserve (South Africa) Heart tissue A 4 S. c. australis Pilanesberg National Park (South Africa) Blood C 5 S. c. australis Mabuasehube Game Reserve (Botswana) Blood D 6 S. c. massaicus Arusha district (Tanzania) Blood E 7 S. c. massaicus Kajiado district (Kenya) Blood F 8 S. c. camelus Sudanese Nubian desert (Sudan) Blood G 9 S. c. camelus Sudanese Nubian desert (Sudan) Blood G 10 S. c. camelus Dinder National Park (Sudan) Blood H 11 S. c. camelus Dinder National Park (Sudan) Blood H 12 S. c. camelus Unknown (Sudan) Blood G 13 S. c. camelus British Museum no. 1939.12.9.1030 (Sudan) Feather, tissue I 14 S. c. camelus Meshra, British Museum no. 1915.10.15.38 (Sudan) Feather, tissue J 15 S. c. syriacus British Museum no. 1939.12.9.1020 (Saudi-Arabia) Feather, tissue G 16 S. c. syriacus British Museum no. 1988.15.1 (Saudi-Arabia) Feather, tissue G 17 S. c. molybdophanes Mt Kenya (Kenya) Blood K 18 S. c. molybdophanes Mt Kenya (Kenya) Blood K S. c. molybdophanes, seven S. c. camelus and two S. c. Table 2. Ostrich control region primers used in this investigation syriacus (Table 1). In selecting specimens from the four Primer sequence extant subspecies we chose 10 animals, each of which was characterized by one of the RFLP defined mtDNA L15533: ACTGTCGTTGTTTTCAACTA L15812: TCATTTAATGTACTAGGAC haplotypes previously identified by Freitag & Robinson H15872: TTAAGAAATCCATCTGATACC (1993, see their Table 1, haplotypes A–J); in other H16067: ATGGTGATTACTCACAATACC words, we employed a taxonomically representative sub- L and H refer to the ‘light’ and ‘heavy’ strand, respectively and all sequences are set of the 97 specimens used by these authors in their given 5’–3’. Numbers correspond to the positions given for the published ostrich phylogeographic analysis of the ostrich. The balance (six mtDNA genome (Härlid et al., 1997). S. c. camelus and two S. c. syriacus) were new speci- mens that were included to resolve the phylogenetic sta- material (Austin, Smith & Thomas, 1997) our primers tus of the extinct S. c. syriacus subspecies. Both S. c. were constructed to amplify two short fragments (225 syriacus specimens were sampled in the Syrian desert base-pairs (bp) and 339 bp, respectively) with a 60 bp prior to 1939 and form part of the Aharoni collection overlap between them. housed in the British Natural History Museum. The PCR products were separated in 2% (w/v) agarose gels (Promega) and extracted using a commercial puri- fication system (Talent). Sequenase v 2.0 (US Data collection Biochemical) was used for sequencing; terminated frag- Total genomic DNA of all the extant specimens was ments were separated using 7% (w/v) polyacrylamide extracted from 100 µl blood or 0.5 g tissue (Table 1) gels. The sequences were read and aligned manually using standard phenol/chloroform/iso-amyl alcohol using the published ostrich sequence (Härlid et al., 1997) DNA procedures (Maniatis, Fritsch & Sambrook, 1982; as reference.

Load more

  8

Copy Link