Molecular Genetic Relationships of the Extinct Ostrich, Struthio Camelus Syriacus: Consequences for Ostrich Introductions Into Saudi Arabia

Molecular genetic relationships of the extinct ostrich, Struthio camelus syriacus: consequences for ostrich introductions into Saudi Arabia

Terence J. Robinson and Conrad A. Matthee Department of Zoology and Entomology, University of Pretoria, Pretoria 0002, South Africa (Received 24 September 1998; accepted 26 November 1998)

Abstract We sequenced part of the mitochondrial DNA control region of the extinct Arabian ostrich, Struthio camelus syriacus, to determine its phylogenetic relationship to the surviving subspecies, and to pro- vide genetic information pertinent to the reintroduction of contemporary ostrich into Saudi Arabia. Parsimony, neighbour joining, maximum likelihood and a minimum spanning network all supported a close genetic association between the Arabian S. c. syriacus and the north African S. c. camelus. Furthermore, all our analyses suggest a recent common ancestry for the southern African S. c. australis and the east African S. c. massaicus. The Somali race, S. c. molybdophanes, was phylogenetically the most distinct of the ostrich taxa. Our data are supportive of a management decision to introduce S. c. camelus into areas once occupied by the extinct S. c. syriacus based predominantly on their geographic proximity and phenotypic features. Moreover, the presence of a shared lineage in these taxa indicates that gene ﬂow between the two geographic forms may have been possible in the recent evolutionary past, probably along the Egyptian–Sinai–Israel passageway.

INTRODUCTION taxa was thought to reflect the fact that their current isolation by the ‘miombo’ woodlands of south-central The ostrich, Struthio camelus, is the largest extant flight- Africa (Fig. 1) is of recent origin. less bird. During the recent past, habitat degradation and Prior to 1939 a fifth, now extinct, subspecies, S. c. the persecution of birds for meat, skins, feathers and syriacus, survived in the deserts of central and northern eggs have had a sharp impact on their numbers in the Arabia (Rothschild, 1919; Brown et al., 1982; Jennings, wild. Although records indicate that the ostrich was once 1986). Based on historic, and largely anecdotal, reports, widely distributed throughout Africa, parts of Arabia and S. c. syriacus’ range was thought to be restricted to two nearby regions in the Middle East, they are now discrete regions in the Arabian peninsula, a southern restricted to a fraction of their former range (Brown, population inhabiting the edge of the Rub al Khali, and Urban & Newman, 1982; Jennings, 1986). a northern population encompassing Syria, Jordan and Four extant morphologically defined subspecies, sub- northern Saudi Arabia (Fig. 1; and see Jennings, 1986). divided into discrete northern and southern populations, Two hypotheses have been suggested for the origin are recognized. The species’ northern distribution of the extinct S. c. syriacus (Seddon & Soorae, 1998). includes S. c. camelus, S. c. molybdophanes and S. c. Firstly, that S. c. syriacus arose from a northern exten- massaicus, while S. c. australis is confined to southern sion of S. c. camelus, effected through a landbridge Africa (Fig. 1). A recent study of mitochondrial DNA between the Sinai and the Egypto-Somalian domain restriction fragment length polymorphisms (mtDNA (Fig. 1), which was subsequently disrupted by the Red RFLPs), within and among ostrich populations (Freitag Sea and Gulf of Suez in the late Pleistocene. Secondly, & Robinson, 1993), showed the northern populations to the proximity of Africa to the Arabian peninsula, and be geographically partitioned, and that their phylogeog- documented evidence of landbridge connections in this raphy corresponds well with recognized subspecific region at 53 000, 34 000 and 25 000 to 11 000 years boundaries. In marked contrast, however, low levels of before present (Delany, 1989), suggest an alternative sequence divergence distinguish S. c. australis and S. c. colonization route in this region but, importantly, one massaicus, and the presence of a shared lineage in these which may have been used by S. c. molybdophanes. As part of a larger conservation programme to restore All correspondence to: T. J. Robinson. Tel: +27 12 420 2608; Fax: native biodiversity in Saudi Arabia, the country’s + 27 12 362 5242; E-mail: [email protected]. National Commission for Wildlife Conservation and 166 T. J. ROBINSON & C. A. MATTHEE

Fig. 1. Struthio camelus specimens sampled in this study. Squares represent precisely known collection localities and question marks uncertain localities. Approximate subspecies boundaries (dotted lines) were taken from Brown et al. (1982). Haplotype designations are given in parentheses. Specimen numbers and mtDNA control region haplotypes correspond to those given in Table 1.

Development (NCWCD) has embarked on a series of a land bridge connecting it to Africa, the identification wildlife restoration initiatives that include the reintro- of S. c. syriacus’ closest living relative is still open to duction of species such as the Houbara bustard question. (Chlamydotis macqueenii), the Arabian oryx (Oryx To more clearly characterize the relationship among leucoryx) and the Arabian gazelles (Gazella gazella and the ostrich subspecies we sequenced the highly variable G. subgutturosa; see Dunham et al., 1993; Haque & 5' portion of the mitochondrial DNA control region. The Smith 1996; Dunham, 1997; Ostrawski et al., 1998). The analysis included representatives of all four extant sub- most recent addition to this list is the ostrich. The species species as well as the extinct S. c. syriacus. We show a was selected both for its conservation value as well as close evolutionary relationship between S. c. australis for its role as a ‘flagship’ species that could be used to and S. c. massaicus, that S. c. molybdophanes is phylo- raise public awareness of conservation issues in general genetically the most distinct of the subspecies and, (Seddon & Soorae, 1998). As a result, steps were taken finally, that S. c. camelus and S. c. syriacus are sister to introduce birds into Mahazat as-Sayd in western cen- taxa that share an identical mtDNA lineage. tral Saudi, an area formerly within the range of S. c. syriacus. In the absence of phylogenetic information, MATERIALS AND METHODS NCWCD chose specimens of S. c. camelus for the reintroduction based on the nominates’ geographic proxim- Specimens used in the present study ity and phenotypic resemblance to S. c. syricus (Seddon & Soorae, 1998). However, given the possibility of Our study material comprised 18 Struthio camelus spec- S. c. molybdophanes dispersion into southern Arabia via imens: five S. c. australis, two S. c. massaicus, two Phylogeny of Struthio camelus 167

Table 1. Struthio camelus specimens used in this investigation together with their subspecies designations, country of origin, source of DNA extraction and mtDNA haplotype

Specimen numbers and Origin of material (country of origin) where known Source of DNA mtDNA control subspecies designation region haplotype

1 S. c. australis Hwange National Park (Zimbabwe) Blood A 2 S. c. australis Kalahari National Park (South Africa) Heart tissue B 3 S. c. australis De Hoop Nature Reserve (South Africa) Heart tissue A 4 S. c. australis Pilanesberg National Park (South Africa) Blood C 5 S. c. australis Mabuasehube Game Reserve (Botswana) Blood D 6 S. c. massaicus Arusha district (Tanzania) Blood E 7 S. c. massaicus Kajiado district (Kenya) Blood F 8 S. c. camelus Sudanese Nubian desert (Sudan) Blood G 9 S. c. camelus Sudanese Nubian desert (Sudan) Blood G 10 S. c. camelus Dinder National Park (Sudan) Blood H 11 S. c. camelus Dinder National Park (Sudan) Blood H 12 S. c. camelus Unknown (Sudan) Blood G 13 S. c. camelus British Museum no. 1939.12.9.1030 (Sudan) Feather, tissue I 14 S. c. camelus Meshra, British Museum no. 1915.10.15.38 (Sudan) Feather, tissue J 15 S. c. syriacus British Museum no. 1939.12.9.1020 (Saudi-Arabia) Feather, tissue G 16 S. c. syriacus British Museum no. 1988.15.1 (Saudi-Arabia) Feather, tissue G 17 S. c. molybdophanes Mt Kenya (Kenya) Blood K 18 S. c. molybdophanes Mt Kenya (Kenya) Blood K

S. c. molybdophanes, seven S. c. camelus and two S. c. Table 2. Ostrich control region primers used in this investigation syriacus (Table 1). In selecting specimens from the four Primer sequence extant subspecies we chose 10 animals, each of which was characterized by one of the RFLP defined mtDNA L15533: ACTGTCGTTGTTTTCAACTA L15812: TCATTTAATGTACTAGGAC haplotypes previously identified by Freitag & Robinson H15872: TTAAGAAATCCATCTGATACC (1993, see their Table 1, haplotypes A–J); in other H16067: ATGGTGATTACTCACAATACC words, we employed a taxonomically representative sub- L and H refer to the ‘light’ and ‘heavy’ strand, respectively and all sequences are set of the 97 specimens used by these authors in their given 5’–3’. Numbers correspond to the positions given for the published ostrich phylogeographic analysis of the ostrich. The balance (six mtDNA genome (Härlid et al., 1997). S. c. camelus and two S. c. syriacus) were new specimens that were included to resolve the phylogenetic sta- material (Austin, Smith & Thomas, 1997) our primers tus of the extinct S. c. syriacus subspecies. Both S. c. were constructed to amplify two short fragments (225 syriacus specimens were sampled in the Syrian desert base-pairs (bp) and 339 bp, respectively) with a 60 bp prior to 1939 and form part of the Aharoni collection overlap between them. housed in the British Natural History Museum. The PCR products were separated in 2% (w/v) agarose gels (Promega) and extracted using a commercial puri- fication system (Talent). Sequenase v 2.0 (US Data collection Biochemical) was used for sequencing; terminated frag- Total genomic DNA of all the extant specimens was ments were separated using 7% (w/v) polyacrylamide extracted from 100 µl blood or 0.5 g tissue (Table 1) gels. The sequences were read and aligned manually using standard phenol/chloroform/iso-amyl alcohol using the published ostrich sequence (Härlid et al., 1997) DNA procedures (Maniatis, Fritsch & Sambrook, 1982; as reference. All 18 sequences have been deposited in Wetton et al., 1987). Prior to extraction of DNA from Genbank under the accession numbers AF073001 to the S. c. camelus and S. c. syriacus museum material AF073018. (Table 1), both the feathers and the dry tissue were washed separately in 100% EtOH to reduce surface con- Control region sequence analyses tamination. These extractions were undertaken in a non- DNA laboratory using sterile equipment; additionally, Cluster analyses (parsimony, neighbour joining and the DNA was amplified using the polymerase chain reac- maximum likelihood) of the mtDNA haplotypes detected tion (PCR) method and sequenced independently for in this study were performed using the test version of each specimen, and for feathers versus dry tissue. PAUP4*. We were unable to unambiguously align our Sequences obtained in this manner were compared in control region sequences to those of other bird taxa order to verify the authenticity of the DNA. (rhea, chicken, turnstone, goose) and therefore used mid- Standard PCR procedures were followed (Matthee & point rooting. For the parsimony analyses, the branch Robinson, 1997). Four ostrich specific primers (Table 2) and bound search option using the default settings in were designed to amplify the 5' portion of the control PAUP4* was used. The distance tree and maximum like- region (see Härlid, Janke & Arnason, 1997 for the com- lihood analyses were generated using the HKY 85 cor- plete ostrich mtDNA sequence). Given the expected rection to account for transition bias and unequal degraded nature of the DNA derived from the museum equilibrium base frequencies typically observed in 168 T. J. ROBINSON & C. A. MATTHEE animal mtDNA (Hasegawa, Kishino & Yano, 1985). In Table 3). Our study identified a common haplotype (G: the case of parsimony and neighbour joining analyses, Table 1) present in both S. c. syriacus specimens as well nodal support was assessed using 1000 bootstrap itera- as in three out of the seven S. c. camelus birds analyzed. tions (Felsenstein, 1985). Due to computational diffi- We are confident of this result and exclude possible con- culties no bootstrap cycles were performed to obtain tamination on the grounds that the sequences from the confidence values for the maximum likelihood nodes. extinct syriacus were derived independently from two The g1 statistic (Hillis & Huelsenbeck, 1992), and con- birds, the analyses of which were separated temporally. sistency index values (excluding parsimony uninforma- Moreover, the DNA extractions, PCR and sequencing of tive characters) were obtained from PAUP4*. The these specimens were not done simultaneously or seri- number of transitions and transversions was calculated ally with S. c. camelus, and were spread over a 4 month using MacClade (Maddison & Maddison, 1992). interval. Identical sequences were obtained from differ- We also examined our data using a minimum span- ent tissues (feathers versus skin) from the same speci- ning network to reflect the evolutionary relationships mens (see Materials and Methods). Interestingly, given among the ostrich mtDNA haplotypes (Crandall, the higher substitution rate (expressed as sequence diver- Templeton & Sing, 1994). We calculated the minimum gence estimates) of control region sequences, the inves- number of substitutions between haplotypes and those tigation failed to distinguish all 10 previously identified that were the most similar were connected; the lengths ostrich mtDNA RFLP lineages (Freitag & Robinson, of the connecting branches in the minimum spanning 1993); eight out of the 10 retrieved by the RFLP study tree were drawn proportionally to the number of substi- were delimited by control region sequences. The two tutions in the pairwise comparisons. unresolved RFLP lineages (Freitag & Robinson’s A and C, and I and J; see Table 1 in Freitag & Robinson, 1993) had been previously shown to differ by a single muta- RESULTS tional step. Eleven mtDNA maternal haplotypes (A–K) were found Neighbour joining analysis performed using HKY 85 for the 18 Struthio specimens sampled in this study. corrected sequence divergence values and distinguished Comparisons among the 469 bp of these different con- three main evolutionary lineages (Fig. 2). This was control region sequences revealed 50 variable sites. Of sistent with the UPGMA topology presented by Freitag these, six were characterized by transversions and all & Robinson (1993). The control region sequences remaining substitutions involved transitions. Five of the showed a close association among haplotypes belonging six transversions were restricted to differences between to S. c. australis (A, B, C and D) and S. c. massaicus the east African S. c. molybdophanes lineage (K) and (E and F). These haplotypes together form a sister the remaining ostrich subspecies. Most transitional assemblage to the S. c. camelus/S. c. syriacus cluster changes were C↔T changes (57%) while G↔A changes (haplotypes G, H, I and J). As with the earlier RFLP accounted for only 43% of the substitutions. The fewer study (Freitag & Robinson, 1993), the east African S. c. G↔A changes are most probably due to the nucleotide molybdophanes (haplotype K) was phylogenetically the bias in animal mtDNA, which is also reflected by our most distinct (Fig. 2) taxon. Maximum likelihood analy- data (13.15% Gs, 30.0% As, 27.1% Cs and 29.75% Ts) sis resulted in two trees with identical likelihood scores and a previous study (see Härlid et al., 1997). Our data (998.24055). The topologies differed only in the place- were characterized by a significant g1 value of –0.618 ment of the two closely related S. c. australis haplotypes (Hillis & Huelsenbeck, 1992). (A and C), which substituted each other. Maximum par- Percentage sequence divergence between the haplo- simony resulted in 26 equally parsimonious trees (con- types ranged from a low of 0.214% between members fidence interval (CI) = 0.674), which differed only with of the same subspecies (haplotypes I and J and I and H), respect to the placement of the closely related lineages to 7.792% among subspecies (haplotype K and G: (the A, B and C haplotypes of S. c. australis and the H,

Table 3. Values above the diagonal correspond to the HKY 85 corrected percentage sequence divergence between the 11 Struthio camelus haplotypes observed in this study. Below the diagonal are the absolute number of changes between specimens. Clone numbers correspond to those given in Table 1.

A B C D E F G H I J K

A S. c. australis ***** 1.079 1.738 1.297 1.297 1.738 5.651 4.463 4.698 4.463 7.278 B S. c. australis 5 ***** 1.517 1.079 1.079 1.517 5.412 4.231 4.464 4.230 7.526 C S. c. australis 8 7 ***** 1.738 1.738 2.183 5.172 4.935 5.172 4.935 7.525 D S. c. australis 6 5 8 ***** 0.428 0.861 6.135 4.935 5.172 4.935 7.773 E S. c. massaicus 6 5 8 2 ***** 0.428 6.135 4.935 5.172 4.935 7.279 F S. c. massaicus 8 7 10 2 ***** 5.652 4.935 4.699 4.464 7.279 G S. c. camelus 25 24 23 27 27 25 ***** 1.960 1.738 1.960 7.792 H S. c. camelus 20 19 22 22 22 22 9 ***** 0.214 0.428 6.561 I S. c. camelus 21 20 23 23 23 21 8 1 ***** 0.214 6.805 J S. c. camelus 20 19 22 22 2 20 9 2 1 ***** 7.049 K S. c. molybdophanes 32 33 33 34 32 32 34 29 30 31 ***** Phylogeny of Struthio camelus 169

Fig. 2. Neighbour joining phylogram indicating the evolutionary relationships among the 11 Struthio mtDNA control region haplotypes detected in this study. The values above the branches show the parsimony bootstrap support for each node and the values below the branches were obtained from the neighbour joining analysis. Haplotype numbers correspond to those in Table 1.

I and J haplotypes of S. c. camelus were unstable). The terizing S. c. syriacus evolved (small body size, egg size: topologies of the strict consensus tree and those obtained Rothschild, 1919; Walters, pers comm.). Our sample size by the maximum likelihood analysis were identical to is obviously too small to determine whether the detec- that retrieved by neighbour joining (Fig. 2) when nodes tion of a single maternal lineage in the extinct with <50% bootstrap were collapsed. S. c. syriacus is due to sampling inadequacies or to The evolutionary relationships between the mtDNA lineage sorting as the Arabian population approached lineages are clearly reflected in the minimum evolution extinction. Importantly, however, the shared presence of network (Fig. 3). Apart from the shared presence of the the G haplotype in both S. c. camelus and S. c. syriacus G haplotype in representatives of S. c. camelus and indicates that sporadic interchange between the two geo- S. c. syriacus , there is a close genetic association between graphic forms may have been possible, quite probably lineage G and the other camelus haplotypes (H, I and J). along the Egyptian–Sinai–Israel passageway (Tchernov, As shown by Freitag & Robinson’s (1993) RFLP study, 1989). The S. c. camelus specimens identified as having there is little evidence of structure between the geo- the same haplotype as S. c. syriacus were collected from graphically isolated S. c. massaicus and S. c. australis the Sudanese Nubian desert in the north-eastern region subspecies; the distinctiveness of the east African S. c. of Sudan and represent the closest geographic location molybdophanes subspecies underscores a similar con- in our study to the northern distribution of the Arabian clusion based both on mtDNA RFLPs (Freitag & S. c. syriacus (Fig. 1). In fact, it is not inconceivable that Robinson, 1993) and nuclear markers (Kumari & Kemp, the introgression of the G lineage into S. c. camelus via 1998). a landlink is both relatively recent and geographically restricted. It is indeed unfortunate that syriacus specimens from DISCUSSION the fringes of the Rub Al Khali are not available (the Assuming the recognition of S. c. syriacus as a distinct southern S. c. syriacus population: Fig. 1), as this may form is sound (and that it was not simply a northern have allowed for an alternative view. The records of extension of the nominate race into Arabia), its evolu- ostrich in this region appear to be based largely on anec- tion and the presence of a shared haplotype with S. c. dotal accounts (the population’s extinction in the early camelus may be interpreted in different ways. The most 1900s predated detailed faunal descriptions: Jennings, parsimonious explanation is that S. c. syriacus arose in 1986). However, the proximity of southern Arabia to isolation through the establishment of the barrier created Africa, and the predominant afrotropical faunal compo- by the Red Sea and Gulf of Suez in the late Pleistocene. nent (both mammals as well as birds) which is thought During this period, the phenotypic differences charac- to reflect penetration from this region into southern 170 T. J. ROBINSON & C. A. MATTHEE

Clearly, the patterns of faunal colonization and the sequential climatic changes that may have contributed to the historic distribution of ostrich in Saudi Arabia remain a matter of speculation. Nevertheless, the results of our phylogenetic analysis of mtDNA control region sequences and the detection of a shared mtDNA lineage in both the extinct S. c. syriacus and its near geographic neighbour, S. c. camelus, show that these two ostrich subspecies enjoyed a close evolutionary relationship. This ﬁnding is supportive of the NCWD’s decision to target S. c. camelus for introduction into protected areas in northern Saudi Arabia, an area which falls within the former range of S. c. syriacus. In more general terms, this investigation underscores the importance and value of museum collections in documenting biological diver- sity, as well as their usefulness in providing a temporal perspective to studies of mtDNA sequence variation in natural populations.

ACKNOWLEDGEMENTS We wish to thank Philip Seddon and Pritpal Soorae for allowing us access to their data prior to publication, and members of the Mammal/Veterinary Department of the NWRC (Taif, Saudi Arabia) for blood from S. c. camelus specimens. Dr. Robert Prys-Jones and Mark Adams (Bird Group, British Natural History Museum, London) provided feathers and skin pieces from S. c. syriacus and S. c. camelus specimens held in their collections. We are grateful to David L. Swofford for permission to use the test version of PAUP*. S. Ostrowski, P. Seddon and P. Fig. 3. Minimum evolution network showing the evolutionary Sunnucks provided helpful comment on the manuscript. relationship among the ostrich mtDNA control region haplo- This study was supported by an Open Research types. The lengths of the connecting branches are drawn pro- Programme grant to T. J. R. from the South African portionally to the evolutionary distance between haplotypes. Haplotype numbers correspond those in Table 1. , S. c. mas- Foundation for Research Development. saicus;, S. c. australis;, S. c. camelus;, S. c. camelus/syriacus;, S. c. molybdophanes. REFERENCES Austin, J. J., Smith, A. B. & Thomas, R. H. (1997). Palaeontology Arabia (Delany, 1989), raises the possibility that Arabia in a molecular world: the search for authentic ancient DNA. may have been home to more than one ostrich sub- Trends Ecol. Evol. 12: 303–306. species. Delany (1989) has argued that declining sea lev- Brown, L. H., Urban, E. K. & Newman, K. (1982). The birds of els associated with the glacial maxima (the most recent Africa, vol. 1. London: Academic Press. Crandall, K. A., Templeton, A. R. & Sing, C. F. (1994). of which occurred approximately 18 000 years before Intraspeciﬁc phylogenetics: problems and solutions. In Models present) may have led to narrow water barriers and the in phylogeny reconstruction. Scotland R. W., Siebert D. J. & establishment of landbridges between the present day Williams D. M. (Eds). Oxford: Claredon Press. Eritrea–Somalia and southern Arabia. In turn, these Delany, M. J. (1989). The zoogeography of the mammal fauna of landlinks may have allowed colonization of this region southern Arabia. Mamm. Rev. 19: 133–152. by S. c. molybdophanes founders. Once across the Red Durham, K. M. (1997). Population growth of mountain gazelles, Sea and into Arabia, the proximity of the Asir and other Gazella gazella, reintroduced into central Arabia. Biol. Conserv. 81: 205–214. high mountains in southern Arabia may have had a Durham, K. M., Hichenside, T. B., Lindsay, N., Rietkirk, F. E. & modifying effect on climate and vegetation, particularly Williamson, D. T. (1993). The reintroduction of mountain gazelle when the harsher arid conditions set in (Delany, 1989). Gazella gazella in Saudi Arabia. Int. Zoo Yr Book 32: 107–116. Geographic separation of the Arabian ostrich isolates Felsenstein, J. (1985). Conﬁdence limits on phylogenies: an (one in the south and the other in the north) seems pos- approach using the bootstrap. Evolution 39: 783–791. sible since at least 800 km are thought to have separated Freitag, S. & Robinson, T. J. (1993). Phylogeographic patterns in the nearest historical ranges of the two populations mitochondrial DNA of the ostrich (Struthio camelus). Auk 3: 614–622. (Jennings, 1986) although names of towns and remains Härlid, A., Janke, A. & Arnason, U. (1997). The mtDNA sequence of eggs indicate that ostrich may, in fact, have been more of the ostrich and the divergence between paleognathous and widespread (P. J. Seddon, in litt.). neognathous birds. Mol. Biol. Evol. 14: 754–761. Phylogeny of Struthio camelus 171

Hasegawa, M., Kishino, H. & Yano, T. (1985). Dating of the cloning. A laboratory manual. Cold Spring Harbor, NY: Cold human-ape splitting by a molecular clock of mitochondrial Spring Harbor Laboratory Press. DNA. J. Mol. Evol. 21: 160–174. Matthee, C. A. & Robinson, T. J. (1997). Molecular phylogeny Haque, M. N. & Smith, T. R. (1996). Reintroduction of Arabian of the springhare, Pedetes capensis, based on mitochondrial sand gazelle Gazella subgutturosa marica in Saudi Arabia. Biol. DNA sequences. Mol. Biol. Evol. 14: 20–29. Conserv. 76: 203–207. Ostrowski, S., Bedin, E., Lenain, D. M. & Abuzinada, A. H. Hillis, D. M. & Huelsenbeck, J. P. (1992). Signal, noise and reli- (1998). Ten years of Arabian oryx conservation breeding in ability in molecular phylogenetic analyses. J. Hered. 83: Saudi Arabia – achievements and regional perspectives. Oryx 189–195. 32: 209–222. Jennings, M. C. (1986). The distribution of the extinct Arabian Rothschild, Lord (1919). Struthio camelus syriacus subspecies. ostrich Struthio camelus syriacus Rothschild, 1919. Fauna of Bull. Brit. Ornith. Club 34: 81–83. Saudi Arabia 8: 447–460. Seddon, P. J. & Soorae, P. S. (1998). Guidelines for subspeciﬁc Kumari, P. & Kemp, S. J. (1998). Polymorphic microsatellite substitutions in wildlife restoration projects. Conserv. Biol. (in markers in the ostrich (Struthio camelus). Mol. Ecol. 7: press). 133–134. Tchernov, R. (1989). The zoogeography of Israel. Dordrecht: Maddison, W. P. & Maddison, D. R. (1992). MacClade: analy- Monographic Biologicae. sis of phylogeny and character evolution (version 3). Wetton, J. H., Carter, R. E., Parkin, D. T. & Walters, D. (1987). Sunderland, MA: Sinauer. Demographic study of a wild house sparrow population using Maniatis, T., Fritsch, E. F. & Sambrook, J. (1982). Molecular DNA ﬁngerprinting. Nature, Lond. 327: 147–149.