Terminal Megakaryocytic Differentiation of TF-1 Cells

Leukemia (1998) 12, 563–570  1998 Stockton Press All rights reserved 0887-6924/98 $12.00 http://www.stockton-press.co.uk/leu Terminal megakaryocytic differentiation of TF-1 cells is induced by phorbol esters and thrombopoietin and is blocked by expression of PML/RAR␣ fusion protein U Testa1, F Grignani2, HJ Hassan1, D Rogaia2, R Masciulli1, V Gelmetti2, R Guerriero1, G Macioce1, C Liberatore2, T Barberi1, G Mariani1, PG Pelicci3 and C Peschle1,4 ` 1Department of Hematology and Oncology, Istituto Superiore di Sanita, Rome; 2Istituto di Clinica Medica I, Policlinico Monteluce, Perugia University, Perugia; 3European Institute of Oncology, Department of Experimental Oncology, Milan, Italy; and 4Thomas Jefferson University, Philadelphia, PA, USA

We have analyzed the differentiation program of growth factor- mia K562 cells leads to an inhibition of hemin-induced dependent TF-1 erythroleukemia cells as well as clones with erythroid differentiation.21 Finally, we observed that inducible expression of the APL-specific PML/RAR␣ protein. ␣ We have shown that TF-1 cells may be induced to megakary- PML/RAR expression in growth factor-dependent human ocytic differentiation by phorbol ester (phorbol dibutyrate, erythroleukemia TF-1 cells elicited a marked decrease of PDB) addition, particularly when combined with thrombopoie- apoptosis induced by growth-factor deprivation.22 tin (Tpo). RT-PCR studies showed that Tpo induces Tpo recep- These biological effects of PML/RAR␣ protein seem to be tor (TpoR or c-mpl), whose expression was further potentiated responsible for the crucial features of the APL phenotype, ie by PDB addition. When the cells are induced with both PDB the accumulation of hematopoietic precursors blocked at the and Tpo erythropoietin receptor (EpoR) expression was 2+ ␣ promyelocytic stage of differentiation. inhibited. In the absence of Zn -induced PML/RAR ␣ expression, PDB and Tpo induced megakaryocytic differen- A crucial question is whether PML/RAR differentiation tiation of TF-1 MTPR clones as observed in ‘wild-type’ TF-1 block occurs only at the promyelocytic stage or may also cells. Conversely, when PML/RAR␣ expression was induced by operate in different cell lineages and at various differentiation + Zn2 , PDB and Tpo treatment of these clones caused only a stages. The 15;17 translocation may occur at the level of reduced level of megakaryocytic differentiation. These obser- myeloblasts/promyelocytes or of committed progenitors or of vations indicate that: (1) TF-1 cells as well as other erythroleukemic cells, possess the capacity to differentiate to megakary- an earlier progenitor cell allowing differentiation towards the ocytic cells when grown in the presence of protein kinase granulocytic lineage until the promyelocytic stage. In this con- (PKC) activators and more efficiently when combined with Tpo; text, studies carried out on a few APL patients have shown that (2) the PML/RAR␣ gene has a wide capacity to interfere with CD34+/CD38+, but not CD34+/CD38− hemopoietic progenitor the program of hematopoietic differentiation, including mega- cells, synthesize PML/RAR␣ transcripts.23 At the molecular level karyocytic differentiation. Finally, we also observed that PML/RAR␣ may block specifically granulocytic differentiation PML/RAR␣ expression in TF-1 cells induces an up-modulation of interleukin-3 receptor, c-kit and c-mpl, a phenomenon which or, alternatively, may affect differentiation master genes. may offer these cells a growth advantage. To gain insight into these issues we have explored the Keywords: erythroleukemia; PML/RAR␣; megakaryocytes effects of PML/RAR␣ on differentiation programs distinct from those triggered by Vitamin D3 (monocytic differentiation) or hemin (erythroid differentiation); thus, the fusion protein was Introduction expressed in the TF-1 cell line, which consists of hematopoietic precursor cells. We have explored the differentiation Acute promyelocytic leukemia (APL) is characterized at cellu- properties of the TF-1 precursor cell line and showed that lar level by the accumulation of blasts blocked at the promyel- these cells can be forced to terminal megakaryocytic matu- ocytic stage of cell differentiation (reviewed in Refs 1 and 2). ration by phorbol esters and thrombopoietin (Tpo). In these ␣ At the molecular level APL is characterized by a specific cells PML-RAR expression is able to inhibit the megakary- chromosomal translocation involving chromosomes 15 and ocytic differentiation pathway, similarly to the monocytic and 17 [t(15;17)].3–6 As a consequence of this translocation a erythroid pathways. chimeric gene is formed encoding for the fusion protein PML/RAR␣.7–10 RAR␣ encodes one of the retinoic acid receptors;11,12 PML encodes a protein of unknown function Materials and methods localized in subnuclear structures called nuclear bodies (NB) ␣ or PML oncogenic domains (POD).13–18 Expression of PML/RAR cDNA in TF-1 cells A major challenge in elucidating the pathogenesis of APL ␣ consists in the understanding of the molecular mechanisms The MT-PML/RAR expression vector has been previously 19 ␣24 through which the PML/RAR␣ protein mediates the differen- described. The MT-PML/RAR and the expression vector tiation block. In this context, we have initially shown that the alone (MT-1 plasmid) were electroporated into TF-1 cells ␣ according to established procedures.25 Two days after transfec- PML/RAR protein can efficiently block Vitamin D3-induced differentiation of promonocytic U-937 cells and increases the tion the medium was changed to selective medium and cells survival and proliferation of cells grown in low serum concen- G418-resistant selected under limiting dilution conditions. trations.19 Furthermore, retinoic acid restores the differen- 20 tiative response to Vitamin D3. Subsequently, we have shown that PML/RAR␣ overexpression in human erythroleuke- Western blotting analysis

Western blotting analysis of cell lysates was performed as 9 ␣ Correspondence: U Testa, Department of Hematology and Oncology, described using an anti-human RAR rabbit polyclonal anti- ` body (PPa(F)) directed against the F domain of the RAR␣ pro- Istituto Superiore di Sanita, 00161, Rome, Italy; Fax: 39 649387087 ´ ´ Received 31 July 1997; accepted 8 December 1997 tein (gift from P Chambon, Institut de Genetique et de Biologie Terminal megakaryocytic differentiation of TF-1 cells U Testa et al 564 ´ Moleculaire et Cellulaire, CNRS-INSERM, Strasbourg, France). kit (Immunotech, Marseille, France); purified anti-human c- An anti-rabbit alkaline phosphatase-conjugated antibody mpl (Genzyme, Cambridge, MA, USA). For IL-3R and c-kit (Promega, Madison, WI, USA) was used to stain the immunob- expression the cells were incubated for 60 min at 4°C and lots according to the manufacturer’s instructions. then analyzed for red fluorescence. For c-mpl expression TF- 1 cells were first incubated for 60 min at 4°C in the presence of 5 ␮g/ml of this antibody, washed with cold PBS and then incu- Phenotypic analysis bated for 30 min at 4°C with biotin-conjugated sheep anti-mouse IgGs (Cappel laboratories, Westchester, PA, USA); after washing Monoclonal antibodies: The following mAbs were used to with cold PBS, cells were incubated with PE-labeled streptavidin assess the maturation level of TF-1 cells: (1) progenitor cell (Dakopatt) and then analyzed by flow cytometry.

anti-CD34 mAb (clone HpCA2, Becton Dickinson, Mountain View, CA, USA); (2) myeloid mAbs, including anti-CD33 (Leu M9), anti-CD15 (Leu M1), anti-CD13 (Leu M7) and anti-CD14 RT-PCR analysis (Leu M3) (Becton Dickinson); (3) granulo–monocytic mAbs Total RNA from 1 × 105 cells was extracted by CsCl gradient anti-␤ -integrin mAbs, including anti-CD11a, CD11b and 2 technique and reverse transcribed according to the manufac- CD11c (Dakopatt, Copenhagen, Denmark); (4) erythroid anti- turer’s instruction (Boehringer, Mannheim, Germany). PCR glycophorin mAb (Dakopatt); (5) megakaryocytic mAb, was performed in a final volume of 50 ␮l in the presence of including anti-CD41, anti-CD42a, anti-CD42b (Dakopatt), 2.5 U of Taq polymerase (Perkin-Elmer Cetus, Norwalk, CT, anti-CD61 and anti-CD62 (Becton Dickinson). USA). The samples were amplified for EpoR, Mpl, GpllIa, PF4 and NF-E2 using the following primers and probes at the indicated annealing temperature for 30 cycles. Surface markers immunofluorescence analysis: The The samples were run on 2% agarose gel and filters erythroid, megakaryocytic, monocytic and granulocytic matu- hybridized using end-labeled probes. ration of TF-1 clones was determined by the percentage of cells reacting with specific mAbs, as assessed by FACS. This Primers and probes: analysis also allowed evaluation of antigen expression level EpoR: by fluorescence-labeling intensity. Thus, cells were incubated ′ ° Primer 5 : TCATGGACCACCTCGGGGCGT (2–19); for 60 min at 4 C in the presence of an appropriate mAb Primer 3′: TAGCGGATGTGAGACGTCATG (519–539); dilution. Each antibody was conjugated with either fluorescein Probe: 5′ TCTGGTGTTCGCTGCCTACAGCCGACACGTC isothyocianate (FITC) or phycoerythrin (PE). After three washes GAGC 3′ (314–348). with cold PBS (HyClone, Cramlington, UK), cells were resus- Annealing at 54°C. pended in PBS containing 2.5% formaldehyde, and then ana- TpoR/mpl: lyzed by FACS for fluorescence intensity. At least 4000 cells Primer 5′: AGCTGATTGCCACAGAAACC (557–576); were analyzed for each determination. Polyclonal mouse Primer 3′: ACTTGGGGAGGTCTGCTTTG (665–684); immunoglobulins (Becton Dickinson) of the same isotype as Probe: 5′ CCAGTCTCCATGTGCTCAGCCCACAATGCC 3′ the specific mAb were used as negative controls for the (621–650). immunofluorescence reaction. Annealing at 56°C. GpIIIa: ′ 26 Primer 5 : ACTTTGGCAAGATCACGGG (1631–1649); Cell cultures: The wild-type TF-1 cell line as well as Primer 3′: CGGTTGCAGGTATTTTCGTC (1975–1994); transfected mutants were maintained in RPMI 1640 medium Probe: 5′ GCTCCTATGGGGACACCTGTGAGAA 3′ (Hyclone) and 10% FCS (Hyclone), supplemented with (1871–1895). 10 ng/ml recombinant human GM-CSF (Sandoz, Basel, Annealing at 52°C. Switzerland). ␣ PF4: 1 25OH-VitD3 and 9cis-retinoic acid (9cis-RA) were gen- Primer 5′: GCGCTGAAGGTGAAGAAGATG (89–109); erously provided by Roche (Basel, Switzerland). Phorbol-dibu- Primer 3′: GCACACACGTAGGCAGCTAGT (309–329); tyrate, all trans-RA (ATRA) and dimethylsulfoxide (DMSO) Probe: 5′ TCACCAGCCTGGAGGTGATCAAGGC 3′ were purchased from Sigma (St Louis, MO, USA). Recombi- (164–188). nant human Tpo was generously provided by Genentech (San Annealing at 56°C. Francisco, CA, USA). NF-E2: For induction of cell differentiation TF-1 wild-type or ′ ␣ Primer 5 : ATGTCCATCACCGAGCTG (205–222); PML/RAR transfectants were diluted with fresh medium at Primer 3′: CAATGTCCAGGAGGGCTA (482–499); 50 000 cells/ml and an aliquot of cells was first incubated for ′ ′ ␮ ␮ Probe: 5 CAATCCACCCAGATTCTGGCTTCCCAC 3 8 h with 80 M ZnSO4 and 300 g/ml human apotransferrin (317–343). (Sigma) prior to the addition of chemical inducers. For induc- Annealing at 56°C. tion of megakaryocytic differentation the cells were incubated × −8 for 4 days in the presence of 2 10 M PDB plus 20 ng/ml Tpo. RT-PCR was normalized for the ribosomal gene (amplification within the linear range was achieved by 20 PCR cycles).

Growth factor receptor expression SP26 protein: Primer 5′: GCCTCCAAGATGACAAAG (15–32) The expression of IL-3 receptor (IL-3R), c-kit and c-mpl was Primer 3′: CCAGAGAATAGCCTGTCT (395–412) analyzed by ﬂow cytometry using speciﬁc mAbs: PE-labeled Probe: 3′ GAGCGTCTTCGATGCCTATGTGCTTCCCAA 3′ anti-IL-3R mAb, clone 9F5 which interacts with IL-3R␣ chain (191–220). (PharMingen, San Diego, CA, USA); PE-labeled anti-human c- Annealing at 56°C. Terminal megakaryocytic differentiation of TF-1 cells U Testa et al 565 Table 1 Membrane phenotype of TF-1 cells grown in the presence of differentiation inducers

% Positive cells Control Tpo PDB PDB + Tpo ATRA D3 + TGF␤ DMSO

CD34 98 ± 296± 378± 626± 391± 595± 396± 3 HLA-DR 62 ± 768± 819± 45± 266± 571± 448± 5 Glycophorin-A 48 ± 746± 611± 27± 255± 658± 659± 4 CD33 100 100 68 ± 855± 4 100 100 100 CD13 100 100 100 100 100 100 100 CD15 0 0 0 0 0 0 0 CD14 0 0 0 0 0 0 0 CD11a 0 0 0 0 0 0 0 CD11b 96 ± 395± 429± 510± 291± 495± 296± 3 CD18 77 ± 672± 541± 721± 479± 671± 459± 6 CD44 30 ± 533± 739± 835± 527± 635± 439± 6 CD54 100 100 88 ± 475± 5 100 100 100 CD41 25 ± 422± 641± 474± 518± 319± 523± 2 CD42a 13 ± 314± 519± 321± 411± 29± 315± 2 CD42b 24 ± 527± 339± 662± 720± 218± 326± 6 CD61 27 ± 525± 444± 669± 921± 425± 219± 3 CD62 4 ± 29± 115± 539± 75± 24± 37± 2

Figure 1 Morphological features of wild-type TF-1 cells and two PR clones grown for 4 days in the absence of inducers (control) or in the ¨ presence of PDB + Tpo or Zn + PDB + Tpo. Cells are cytospun on glass slides and stained with May–Grunwald. Terminal megakaryocytic differentiation of TF-1 cells U Testa et al 566 Results a significant proportion (Ͼ40%) of them are polyploid dis- playing up to eight nuclei per cell. PDB and Tpo induce MK differentiation of TF1 cells Parallel studies carried out by RT-PCR mRNA analysis showed that (see Figure 2): (1) undifferentiated TF-1 cells TF-1 cells are CD34+ hematopoietic precursor cells blocked express GpIIIa, as well as NF-E2 mRNA but only low levels at an early stage of hemopoietic differentiation.26–28 They pos- of mRNA encoding mpl; furthermore, they possess EpoR sess the capacity to proliferate in either GM-CSF or IL-3 or mRNA; (2) Tpo-treated TF-1 cells exhibited the induction of Epo26 and express several erythroid and myeloid markers.26,27 TpoR; (3) PDB-treated TF-1 cells displayed a slight induction Undifferentiated TF-1 cells routinely grown in the presence of mpl and GpIIIa mRNA and relevant induction of PF4 of GM-CSF display membrane markers of early hemopoietic mRNA; and (4) TF-1 cells grown in the presence of PDB + progenitor cells (ie they are almost entirely CD34 and CD33 Tpo showed a marked increase of mpl, Gpllla, PF4 mRNA positive) and coexpress both erythroid (glycophorin A) and levels, associated with a marked decline of EpoR mRNA level. MK membrane markers (CD41, CD42a, CD61 and CD62) (Table 1). In a first set of experiments we have evaluated the capacity Effects of PML/RAR␣ expression on MK differentiation of TF-1 erythroleukemic cells to undergo MK differentiation of TF-1 cells using a PKC inducer (PDB) or the specific MK HGF Tpo added alone or in combination. Incubation of TF-1 cells with Tpo PML/RAR␣ cDNA was expressed in TF-1 cells by electropor- alone did not modify the level of expression of erythroid and ation of a plasmid containing the PML/RAR␣ cDNA under the MK membrane markers (Table 1). Furthermore, Tpo alone did control of the Zn2+-inducible MT1 promoter. Cells were selec- not sustain the growth of TF-1 cells (data not shown). ted in G418 and subcloned by limiting dilution. PML/RAR␣ Addition of PDB to TF-1 cells induces adherence to the protein expression levels were assessed by Western blot using plastic surface and growth arrest, associated with inhibition of a specific antibody directed against the RAR␣ F region9 erythroid marker expression (glycophorin A) and increase of (Figure 3). Two clones that overexpressed PML/RAR␣ MK membrane markers (CD41, CD42a, CD61 and CD62) (MTPR1A and MTPR2A) were selected for further analysis. (Table 1). No monocytic membrane markers (ie CD14) are Both PML/RAR␣-uninduced TF-1 clones displayed a cell detectable following PDB addition (Table 1). The simul- morphology and a membrane phenotypic pattern comparable taneous addition of both PDB and Tpo further enhanced the to that observed for wild-type TF-1 cells (Figures 4 and 5). induction of MK membrane markers, as compared to the lev- These clones induced in the absence of Zn2+ by PDB + Tpo els observed in cells treated with PDB alone (Table 1). exhibited a morphologic and phenotypic megakaryocytic Morphological analysis of TF-1 cells showed that (see maturation, comparable to that observed for wild-type TF-1 Figure 1): (1) TF-1 cells grown in the presence of GM-CSF dis- cells (Figures 1, 4 and 5). However, in the presence of Zn2+ play a typical blast-like morphology with prominent nucleoli within the nucleus; (2) cells treated with PDB for 4 days display morphological features of MKs in that they are large, a part of them (Ͻ10%) are binuclear with small granulations within the cytoplasm; and (3) cells grown for 4 days in the presence of PDB + Tpo exhibit a typical MK morphology and

Figure 2 Western blot analysis of inducible expression of the PML/RAR␣ protein in TF-1 cells. Cell lysates were prepared before (−) + ␮ or after ( ) a 12 h treatment with 100 M ZnSO4 in the presence of 300 ␮g/ml apotransferrin. TF-1 MT, control cells carrying an ‘empty’ expression vector; TF-1 MTPR3, MTPR and MTPR2A, cell clones carrying the PML/RAR␣ inducible expression vector; U937 MTPR9, posi- Figure 3 RT-PCR analysis of mRNA encoding EpoR, c-mpl, Gpllla, tive control cells expressing PML/RAR␣. Filters were stained with an PF4 and NF-E2 in wild-type TF-1 cells grown in the absence of anti-RAR␣ antiserum. inducers or in the presence of PDB, Tpo or PDB + Tpo. Terminal megakaryocytic differentiation of TF-1 cells U Testa et al 567

Figure 4 Expression of membrane differentiation antigens CD34, CD33 and glycophorin-A in wild-type TF1 cells, and two PR clones grown in the absence of inducers (control) and in the presence of either PDB + Tpo or Zn + PDB + Tpo. Data represent mean ± s.e.m. observed in three separate experiments.

TF-1 PML/RAR␣ induced with PDB + Tpo showed a marked inhibition of their capacity to differentiate to megakaryocytic Figure 5 Expression of membrane megakaryocytic differentiation cells. Particularly, cell morphology of PML/RAR␣ clones antigens CD41, CD42a, CD61 and CD62 in wild-type TF-1 cells, and grown in the presence of Zn2+ and PDB + Tpo displayed only two PR clones grown in the absence of inducers (control) or in the a partial megakaryocytic differentiation, as indicated by the presence of either PDB + Tpo or Zn + PDB + Tpo. Data represent + absence of large cells, by the virtual absence of cells showing mean s.e.m. observed in three separate experiments. two, four or more nuclei per cell and by the presence of a basophilic cytoplasm with no granulations (Figure 1). determined by a down-regulation of its receptor. Therefore, Importantly, wild-type TF-1 cells treated with Zn2+ and PDB here we have investigated the effect of PML/RAR␣ on growth + Tpo showed a level of megakaryocytic maturation compara- factor receptor expression. Interestingly, induction of ble to that observed in the same cells grown in the presence PML/RAR␣ expression in these cells was associated with a sig- of PDB + Tpo, thus indicating that the inhibitory effect on niﬁcant up-modulation of three hematopoietic growth factor megakaryocytic differentiation elicited by Zn2+ in PML/RAR␣ receptors (IL-3R, c-kit and c-mpl), all involved in the control clones is related to the expression of transfected genes and of hematopoietic cell proliferation (Figure 6). The levels of IL- not to an inhibitory activity of Zn2+ on megakaryocytic 3R, c-kit and c-mpl expression observed in TF-1 PML/RAR␣+ differentiation. clones before Zn2+ addition are comparable to those observed in wild-type TF-1 cells, while after Zn2+ addition, which induces PML/RAR␣ synthesis, they are signiﬁcantly higher Evaluation of the effect of PML/RAR␣ on growth factor than those observed in wild-type TF-1 cells (Figure 6 and data receptor expression in TF-1 cells not shown). The increased expression of these growth factor receptors may contribute to increased resistance of TF-1 cells Previous studies have shown that PML/RAR␣ expressing TF-1 to apoptosis. cells are resistant to apoptosis induced by growth factor depri- Following induction of TF-1 cells with PDB + Tpo c-kit vation;22 in addition, resistance to the effect of Tpo could be expression is down-modulated, while c-mpl and IL-3R Terminal megakaryocytic differentiation of TF-1 cells U Testa et al 568

Figure 6 Flow cytometric analysis of IL-3R, c-kit and c-mpl expression in a TF-1 PR clone grown in the absence of additives (control), or with Zn addition or in the presence of PDB + Tpo or Zn + PDB + Tpo. One representative experiment is shown.

expression are up-modulated (Figure 6). These observations model to study megakaryocytopoiesis.36–40 Particularly, UT-7 are in line with the corresponding pattern of expression of TPO and UT-7 GM38 sublines undergo megakaryocytic differ- these receptors observed during normal human megakaryo- entiation following incubation with Tpo. UT-7 cells have poiesis.29 many similarities with TF-1 cells. Optimal megakaryocytic differentiation of TF-1 cells was obtained by the combination of a phorbol ester (PDB) and Discussion Tpo, the cytokine regulating megakaryocytic differentiation and maturation.41 Previous studies carried out on a variety of Previous studies26,28 assessed, on the basis of morphologic or either erythroleukemic or megakaryocytic lines have shown phenotypic criteria, that TF-1 cells induced with a phorbol that PKC activators (phorbol esters) are inducers of megakary- ester undergo monocytic/macrophagic differentiation. We ocytic differentiation.30–32 The capacity of TF-1 cells to be show in the present study that, under appropriate conditions, stimulated to differentiate by Tpo is not surprising in that these PDB causes MK differentiation of TF-1 cells. This conclusion cells possess low, but significant levels of TpoR,42 whose is in line with the observation that the majority of human expression is greatly potentiated by Tpo and by PDB + Tpo erythroleukemic cell lines isolated from patients with either (present study). This observation is in line with a recent study acute or chronic leukemias exhibit the capacity to differentiate showing that Tpo markedly stimulates the expression of its in vitro along both the erythroid and megakaryocytic lin- membrane receptor in highly purified human hemopoietic eages.30–32 This property reflects the existence of a common progenitor cells.29 However, it must be underlined that TF-1 erythroid and megakaryocytic progenitor.33,34 cells cannot differentiate to mature megakaryocytic cells when Previous studies have shown that UT-7, a growth factor- grown with Tpo alone but only when Tpo is added together dependent cell line established from a patient with acute with PDB. In this context, the precise role of Tpo consists in megakaryoblastic leukemia,35 represents a useful in vitro potentiating the stimulatory effect of PDB which is required to Terminal megakaryocytic differentiation of TF-1 cells U Testa et al 569 bypass the leukemic differentiation block and thus to induce induced by growth factor starvation. Furthermore, in a pre- megakaryocytic differentiation. vious study carried out by Dubois et al47 on 16 APL patients PML/RAR␣ expression in TF-1 cells induces a marked inhi- it was shown that patients whose blasts secrete CSF, GM-CSF bition of the megakaryocytic differentiative potential triggered or IL-3 did not achieve complete remission following induc- by PDB plus Tpo. This observation, together with previous tion therapy with ATRA. studies,19–21 suggests that PML/RAR␣ overexpression possesses In conclusion, the present study provides evidence that: (1) a wide capacity to interfere with different hematopoietic pro- TF-1 erythroleukemic cells possess the capacity to undergo grams, including monocytic,19,20 erythroid21 and megakary- terminal megakaryocytic differentiation when grown with ocytic (the present study). These observations suggest that PDB + Tpo; and (2) overexpression of PML/RAR␣ in these cells PML/RAR␣ may act on master differentiation genes that leads to a marked inhibition of the megakaryocytic differen- are involved in the process of hematopoietic tiation program. differentiation/maturation. The inhibitory effect of PML/RAR␣ on megakaryocytic differentiation is a phenomenon involving the coordinated References ´ reduction of CD41, CD42a, CD42b, CD61 and CD62 antigen 1 Warrell RP, De The H, Wang ZY, Degos L. Acute promyelocytic expression and polyploidy. This observation suggests that leukemia. New Engl J Med 1993; 329: 177–189. PML/RAR␣ interferes with factors that regulate the entire cellu- 2 Grignani F, Fagioli M, Alcalay M, Longo L, Pandolfi PP, Donti E, lar differentiation program and does not simply regulate the Biondi A, Lo Coco F, Pelicci PG. Acute promyelocytic leukemia: from genetics to treatment. Blood 1994; 83: 10–25. expression of a few markers. ´ Since PML/RAR␣ appears to interfere with the basic regu- 3 De The H, Chomienne C, Lanotte M, Degos L, Dejean A. The t(15;17) translocation of acute promyelocytic leukemia fuses the lation of cell differentiation, we have studied the expression retinoic acid receptor alpha gene to a novel transcribed locus. of known transcription factors that were shown to participate Nature 1990; 347: 558–561. in the control of the early stages of hematopoietic differen- 4 Borrow J, Goddard AD, Sheer D, Solomon E. Molecular analysis tiation. In this context, an inhibitory effect of PML/RAR␣ on of acute promyelocytic leukemia breakpoint cluster region on the expression of NF-E2 and GATA-1, two transcription factors chromosome 17. Science 1990; 249: 1577–1580. involved in the control of megakaryopoiesis43,44 can be ruled 5 Longo L, Pandolfi PP, Biondi A, Rambaldi A, Mencarelli A, Lo ␣ Coco F, Diverio D, Pegoraro L, Avanzi G, Tabilio A,Zangrilli P, out; in fact, overexpression of PML/RAR did not modify the Alcalay M, Donti E, Grignani F, Pelicci PG. Rearrangements and level of NF-E2 and GATA-1, both transcription factors being aberrant expression of the retinoic acid receptor alpha gene in highly expressed both in uninduced and PDB plus Tpo-treated acute promyelocytic leukemia. J Exp Med 1991; 172: 1571–1575. TF-1 cells (data not shown). 6 Alcalay M, Zangrilli D, Pandolfi PP, Longo L, Mencarelli A, Giaco- The mechanism(s) through which PML/RAR␣ inhibits hema- mucci A, Rocchi M, Biondi A, Rambaldi A, Lo Coco F, Diverio topoietic differentiation remain largely unknown. However, D, Donti E, Grignani F, Pelicci PG. Translocation breakpoint of acute promyelocytic leukemia lies within the retinoic acid recep- the fact that the fusion protein blocks differentiation along vir- tor alpha locus. Proc Natl Acad Sci USA 1991; 88: 1977–1981. tually all hematopoietic lineages (granulocytic, monocytic, 7 Kakizuka A, Miller WH, Umesono K, Warrell RP, Frankel SR, erythroid and megakaryocytic) implies major interference with Murty VV, Dmitrovsky E, Evans RM. Chromosomal translocation key molecular events involving either differentiation of pluri- t(15;17) in human acute promyelocytic leukemia fuses RAR ␣ with potent stem cells into committed hemopoietic progenitors or a novel putative transcription factor, PML. Cell 1991; 66: 663– 674. of the different committed progenitors into the respective pre- ´ 8 De The H, Lavau C, Marchio A, Chomienne C, Degos L, Dejean cursors. Experiments involving enforced expression of A. The PML-RAR␣ fusion mRNA generated by the t(15;17) translo- PML/RAR␣ into pluripotent hematopoietic progenitors would cation in acute promyelocytic leukemia encodes a functionally clarify this point. In this context, it is important to underline altered RAR. Cell 1991; 66: 675–684. that the maturation block is a prominent feature of APL and 9 Pandolfi PP, Alcalay M, Fagioli M, Zangrilli D, Mencarelli A, ATRA, and although induces differentiation of APL blasts from Diverio D, Biondi A, Lo Coco F, Rambaldi A, Grignani F, Roch- promyelocytes to neutrophils, is unable to induce a complete ette-Egly C, Gaube M-P, Chambon P, Pelicci PG. Genomic varia- bility and alternative splicing generate multiple PML/RAR␣ tran- morphological maturation of APL cells as shown by second- scripts that encode aberrant PML proteins and PML/RAR␣ isoforms ary-granule deficiency, a hallmark of abberantly differentiated in acute promyelocytic leukaemia. EMBO J 1992; 11: 1397–1407. leukemic cells.45 10 Pandolfi PP, Grignani F, Alcalay M, Mencarelli A, Biondi A, Lo Finally, we also observed that PML/RAR␣ expression in TF- Coco F, Pelicci PG. Structure and origin of the acute promyelo- ␣ 1 cells markedly stimulates IL-3R, c-kit and c-mpl expression. cytic leukemia myl/RAR cDNA and characterization of its reti- This finding rules out the hypothesis that low Tpo response noid-binding and transactivation properties. Oncogene 1991; 6: 1285–1292. might be due to receptor down-regulation. All three receptors 11 Giguere V, Ong ES, Segui P, Evans RM. Identification of a receptor mediate hematopoietic cell proliferation/ differentiation for the morphogene retinoic acid. Nature 1987; 330: 624–629. (discussed in Ref. 29). This phenomenon may be relevant for 12 Petkovich M, Brand NJ, Krust A, Chambon P. A human retinoic the understanding of the mechanism which render APL cells acid receptor which belongs to the family of nuclear receptors. more resistant to apoptosis than their normal counterparts.19 Nature 1987; 330: 444–450. In line with this interpretation, recent studies indicate that IL- 13 Goddard AD, Borrow J, Freemont PS, Solomon E. Characterization ␣ of a zinc finger gene disrupted by the t(15;17) in acute promyelo- 3R chain overexpression in cytokine-dependent FDCP-1 cell cytic leukemia. Science 1991; 254: 1371–1374. line allowed the cells either to proliferate in suboptimal con- 14 Fagioli M, Alcalay M, Pandolfi PP, Venturini L, Mencarelli A, centration of IL-3 or to became growth factor-independent.46 Simeone A, Acampora D, Grignani F, Pelicci PG. Alternative splic- In this context, it is of interest that in a previous study we ing of PML transcripts predicts coexpression of several carboxy- showed that PML/RAR␣ expressing TF-1 cells are more resist- terminally different protein isoforms. Oncogene 1992; 7: 1083– ant to apoptosis induced by growth factor deprivation than 1091. 15 Daniel MT, Koken M, Romagne O, Barbey S, Bazarbachi A, wild-type TF-1 cells.25 The increased expression of growth ´ + Stadler M, Guillemin MC, Degos L, Chomienne C, De The H. factor receptors observed in PML/RAR␣ TF-1 cells may par- PML protein expression in hematopoietic and acute promyelocytic tially explain their increased resistance toward apoptosis leukemia cells. Blood 1993; 82: 1858–1867. Terminal megakaryocytic differentiation of TF-1 cells U Testa et al 570 16 Weis K, Rambaud S, Lavau C, Jansen J, Carvalho T, Carmo-Fon- 31 Tabilio A, Rosa JP, Testa U, Kieffer N, Nurden AT, Del Canizo MC, seca M, Lamond A, Dejean A. Retinoic acid regulates aberrant Breton-Gorius J, Vainchenker W. Expression of platelet membrane nuclear localization of PML-RAR ␣ in acute promyelocytic leuke- glycoproteins and alpha granule proteins by a human erythro- mia cells. Cell 1994; 76: 345–356. leukemia cell line (HEL). EMBO J 1984; 3: 453–459. 17 Dyck JA, Maul GG, Miller WH, Chen JD, Kakizuka A, Evans RM. 32 Hong Y, Martin JF, Vainchenker W, Erusalimsky JD. Inhibition of A novel macromolecular structure is a target of the promyelocyte- protein kinase C suppresses megakaryocytic differentiation and retinoic acid receptor oncoprotein. Cell 1994; 76: 333–343. stimulates erythroid differentiation in HEL cells. Blood 1996; 87: 18 Flenghi L, Fagioli M, Tomassoni L, Pileri S, Gambacorta M, Pacini 123–131. R, Grignani F, Casini T, Ferrucci PF, Martelli MF, Pelicci PG, Falini 33 McDonald TP, Sullivan PS. Megakaryocytic and erythrocytic cell B. Characterization of a new monoclonal antibody (PG-M3) lines share a common precursor cell. Exp Hematol 1993; 21: directed against the aminoterminal portion of the PML gene pro- 1316–1320. duct: immunocytochemical evidence for high expression of PML 34 Debili N, Coulombel L, Crosille L, Katz A, Guichard J, Breton- proteins on activated macrophages, endothelial cells, and epi- Gorious J, Vainchenker W. Characterization of a bipotent erythro– thelia. Blood 1995; 85: 1871–1880. megakaryocytic progenitor in human bone marrow. Blood 1996; 19 Grignani F Jr, Ferrucci PF, Testa U, Talamo GP, Fagioli M, Alcalay 88: 1284–1296. M, Mencarelli A, Grignani F, Peschle C, Nicoletti I, Pelicci PG. 35 Komatsu N, Nakauchi H, Miwa A, Ishihara T, Eguchi M, Moroi The acute promyelocytic leukemia-specific PML/RAR␣ fusion pro- M, Okada M, Sato Y, Miura Y. Establishment and characterization tein inhibits differentiation and promotes survival of U937 of a human leukemic cell line with megakaryocytic features: myeloid precursor cells. Cell 1993; 74: 423–431. dependency on granulocyte–macrophage colony-stimulating fac- 20 Testa U, Grignani F, Barberi T, Fagioli M, Masciulli R, Ferrucci tor, interleukin-3, or erythropoietin for growth and survival. Can- PF, Seripa D, Camagna A, Alcalay M, Pelicci PG, Peschle C. cer Res 1991; 51: 341–348. PML/RAR␣+ U937 mutant and NB4 cell lines: retinoic acid 36 Porten F, Rouyez MC, Cocault L, Benit L, Charon M, Picard F, Gisselbrecht S, Souzy M, Dusanter-Fort I. Functional regions of the restores the monocytic differentiation response to vitamin D3. Can- cer Res 1994; 54: 4508–4515. mouse thrombopoietin receptor cytoplasmic domain: evidence for 21 Grignani F, Testa U, Fagioli M, Barberi T, Masciulli R, Mariani a critical region which is involved in differentiation and can be G, Peschle C, Pelicci PG. Promyelocytic leukemia-specific PML- complemented by erythropoietin. Mol Cell Biol 1966; 16: 2473. retinoic acid alpha receptor fusion protein interferes with erythroid 37 Komatsu N, Kunitama M, Yamada M, Hagiwara T, Kato T, Miya- differentiation of human erythroleukemia K562 cells. Cancer Res zaki H, Eguchi M, Yamamoto M, Miura Y. Establishment and 1995; 55: 440–443. characterization of the thrombopoietin-dependent megakary- 22 Rogaia D, Grignani F, Nicoletti I, Pelicci PG. The acute promyelo- ocytic cell line, UT-7/TPO. Blood 1996; 87: 4552–4560. cytic leukemia-specific PML/RAR␣ fusion protein reduces the fre- 38 Komatsu N, Kirito K, Shimizu R, Kusitama M, Yamad M, Uchida quency of commitment to apoptosis upon growth factor depri- M, Takatoku M, Eguchi M, Miura Y. In vitro development of vation of GM-CSF-dependent myeloid cells. Leukemia 1995; 9: erythroid and megakaryocytic cells from a UT-7/GM. Blood 1997; 1467–1472. 89: 4021–4033. 23 Turhan AG, Lemoine FM, Debert C, Bonnet ML, Baillou C, Picard 39 Takatoku M, Kametaka M, Shimizu R, Miura Y, Komatsu N. Identi- F, Macintyze EA, Varet B. Highly purified primitive hematopoietic fication of functional domains of the human thrombopoietin stem cells are PML/RAR␣ negative and generate nonclonal pro- receptor required for growth and differentiation of megakaryocytic genitors in acute promyelocytic leukemia. Blood 1995; 85: cells. J Biol Chem 1997; 272: 7259–7263. 2154–2161. 40 Baiocchi M, Olivetta E, Chelucci C, Santarcangelo AC, Bona R, D’Aloja P, Testa U, Komatsu N, Verani P, Federico M. Human 24 Grignani F, Testa U, Rogaia D, Ferrucci PF, Samoggia P, Pinto A, + Aldinucci D, Gelmetti V, Fagioli M, Alcalay M, Seeler I, Grignani immunodeficiency virus (HIV)-resistant CD4 UT-7 megakaryocytic human cell line becomes highly HIV-1 and HIV-2 suscep- F, Nicoletti I, Peschle C, Pelicci PG. Effects on differentiation of tible upon CXCR4 transfection: induction of cell differentiation by the promyelocytic leukemia PML/RAR␣ protein depend on the HIV-1 infection. Blood 1997; 89: 2670–2678. fusion of the PML protein dimerization and RAR␣ DNA binding 41 Wendling F, Vainchenker W. Thrombopoietin and its receptor, the domains. EMBO J 1996; 15: 4949–4958. proto-oncogene c-mpl. Curr Opin Hematol 1995; 2: 331–338. 25 Grignani F, Lombardi L, Inghirami G, Sternas L, Cechova K, Dalla- 42 Debili N, Wendling F, Cosman D, Titeux M, Florindo C, Dusanter- Favera R. Negative autoregulation of c-myc gene expression is Fourt I, Schooley K, Methia N, Charon M, Nador R, Bettaieb A, Vain- inactivated in transformed cells. EMBO J 1990; 9: 3913–3922. chenker W. The Mpl receptor is expressed in the megakaryocytic lin- 26 Kitamura T, Tange T, Terasawa T, Chiba S, Kuwaki T, Miyagawa eage from late progenitors to platelets. Blood 1995; 85:391–401. K, Piao YF, Miyazono K, Urabe A, Takaku F. Establishment and 43 Romeo PH, Prandini MH, Joulin V, Mignotte V, Prenant M, Vain- characterization of a unique human cell line that proliferates chenker W, Marguerie G, Uzan G. Megakaryocytic and erythro- dependently on GM-CSF, IL-3, or erythropoietin. J Cell Physiol cytic lineages share specific transcription factors. Nature 1990; 1989; 140: 323–334. 344: 447–449. 27 Kitamura T, Tojo A, Kuwaki T, Chiba S, Miyazono K, Urabe A, 44 Shivdasani RA, Rosemblatt MF, Zucker-Franklin D, Jackson CW, Takaku F. Identification and analysis of human erythropoietin Hunt P, Saris CJ, Orkin SH. Transcription factor NF-E2 is required receptors on a factor-dependent cell line, TF-1. Blood 1989; 73: for platelet formation independent of the actions of 375–380. thrombopoietin/MGDF in megakaryocyte development. Cell 28 Hoang T, Paradis E, Brady G, Billia F, Nakahara K, Iscove NN, 1995; 81: 695–704. Kirsch IR. Opposing effects of the basic helix–loop–helix transcrip- 45 Miyauchi J, Ohyashiki K, Inatomi Y, Toyama K. Neutrophil sec- tion factor SCL on erythroid and monocytic differentiation. Blood ondary-granule deficiency as a hallmark of all-trans retinoic acid- 1996; 87: 102–111. induced differentiation of acute promyelocytic leukemia cells. 29 Testa U, Fossati C, Samoggia P, Masciulli R, Mariani G, Hassan Blood 1997; 90: 803–813. HJ, Sposi NM, Guerriero R, Rosato V, Gabbianelli M, Pelosi E, 46 Steelman LS, Algate PA, Blalock WL, Wang XY, Prevost KD, Hoyle Valtieri M, Peschle C. Expression of growth factor receptors in PE, McCubrey JA. Oncogenic effects of overexpression of the unilineage differentiation culture of purified hematopoietic pro- interleukin-3 receptor on hematopoietic cells. Leukemia 1996; 10: genitors. Blood 1996; 88: 3391–3406. 528–542. 30 Tabilio A, Pelicci PG, Vinci G, Mannoni P, Civin CI, Vainchenker 47 Dubois C, Schlageter MH, De Gentile A, Guidez F, Ballitrand N, Tou- W, Testa U, Lipinski M, Rochant H, Breton-Gorius J. Myeloid and bert ME, Krawice I, Fenaus P, Castaigne S, Najean Y, Degos L, Chomi- megakaryocytic properties of K-562 cell lines. Cancer Res 1983; enne C. Hematopoietic growth factor expression and ATRA sensitivity 43: 4569–4574. in acute promyelocytic blast cells. Blood 1994; 83: 3264–3270.