Terminal Megakaryocytic Differentiation of TF-1 Cells
Total Page：16
File Type：pdf, Size：1020Kb
Leukemia (1998) 12, 563–570 1998 Stockton Press All rights reserved 0887-6924/98 $12.00 http://www.stockton-press.co.uk/leu Terminal megakaryocytic differentiation of TF-1 cells is induced by phorbol esters and thrombopoietin and is blocked by expression of PML/RAR␣ fusion protein U Testa1, F Grignani2, HJ Hassan1, D Rogaia2, R Masciulli1, V Gelmetti2, R Guerriero1, G Macioce1, C Liberatore2, T Barberi1, G Mariani1, PG Pelicci3 and C Peschle1,4 ` 1Department of Hematology and Oncology, Istituto Superiore di Sanita, Rome; 2Istituto di Clinica Medica I, Policlinico Monteluce, Perugia University, Perugia; 3European Institute of Oncology, Department of Experimental Oncology, Milan, Italy; and 4Thomas Jefferson University, Philadelphia, PA, USA We have analyzed the differentiation program of growth factor- mia K562 cells leads to an inhibition of hemin-induced dependent TF-1 erythroleukemia cells as well as clones with erythroid differentiation.21 Finally, we observed that inducible expression of the APL-specific PML/RAR␣ protein. ␣ We have shown that TF-1 cells may be induced to megakary- PML/RAR expression in growth factor-dependent human ocytic differentiation by phorbol ester (phorbol dibutyrate, erythroleukemia TF-1 cells elicited a marked decrease of PDB) addition, particularly when combined with thrombopoie- apoptosis induced by growth-factor deprivation.22 tin (Tpo). RT-PCR studies showed that Tpo induces Tpo recep- These biological effects of PML/RAR␣ protein seem to be tor (TpoR or c-mpl), whose expression was further potentiated responsible for the crucial features of the APL phenotype, ie by PDB addition. When the cells are induced with both PDB the accumulation of hematopoietic precursors blocked at the and Tpo erythropoietin receptor (EpoR) expression was 2+ ␣ promyelocytic stage of differentiation. inhibited. In the absence of Zn -induced PML/RAR ␣ expression, PDB and Tpo induced megakaryocytic differen- A crucial question is whether PML/RAR differentiation tiation of TF-1 MTPR clones as observed in ‘wild-type’ TF-1 block occurs only at the promyelocytic stage or may also cells. Conversely, when PML/RAR␣ expression was induced by operate in different cell lineages and at various differentiation + Zn2 , PDB and Tpo treatment of these clones caused only a stages. The 15;17 translocation may occur at the level of reduced level of megakaryocytic differentiation. These obser- myeloblasts/promyelocytes or of committed progenitors or of vations indicate that: (1) TF-1 cells as well as other erythroleu- kemic cells, possess the capacity to differentiate to megakary- an earlier progenitor cell allowing differentiation towards the ocytic cells when grown in the presence of protein kinase granulocytic lineage until the promyelocytic stage. In this con- (PKC) activators and more efficiently when combined with Tpo; text, studies carried out on a few APL patients have shown that (2) the PML/RAR␣ gene has a wide capacity to interfere with CD34+/CD38+, but not CD34+/CD38− hemopoietic progenitor the program of hematopoietic differentiation, including mega- cells, synthesize PML/RAR␣ transcripts.23 At the molecular level karyocytic differentiation. Finally, we also observed that PML/RAR␣ may block specifically granulocytic differentiation PML/RAR␣ expression in TF-1 cells induces an up-modulation of interleukin-3 receptor, c-kit and c-mpl, a phenomenon which or, alternatively, may affect differentiation master genes. may offer these cells a growth advantage. To gain insight into these issues we have explored the Keywords: erythroleukemia; PML/RAR␣; megakaryocytes effects of PML/RAR␣ on differentiation programs distinct from those triggered by Vitamin D3 (monocytic differentiation) or hemin (erythroid differentiation); thus, the fusion protein was Introduction expressed in the TF-1 cell line, which consists of hematopo- ietic precursor cells. We have explored the differentiation Acute promyelocytic leukemia (APL) is characterized at cellu- properties of the TF-1 precursor cell line and showed that lar level by the accumulation of blasts blocked at the promyel- these cells can be forced to terminal megakaryocytic matu- ocytic stage of cell differentiation (reviewed in Refs 1 and 2). ration by phorbol esters and thrombopoietin (Tpo). In these ␣ At the molecular level APL is characterized by a specific cells PML-RAR expression is able to inhibit the megakary- chromosomal translocation involving chromosomes 15 and ocytic differentiation pathway, similarly to the monocytic and 17 [t(15;17)].3–6 As a consequence of this translocation a erythroid pathways. chimeric gene is formed encoding for the fusion protein PML/RAR␣.7–10 RAR␣ encodes one of the retinoic acid recep- tors;11,12 PML encodes a protein of unknown function Materials and methods localized in subnuclear structures called nuclear bodies (NB) ␣ or PML oncogenic domains (POD).13–18 Expression of PML/RAR cDNA in TF-1 cells A major challenge in elucidating the pathogenesis of APL ␣ consists in the understanding of the molecular mechanisms The MT-PML/RAR expression vector has been previously 19 ␣24 through which the PML/RAR␣ protein mediates the differen- described. The MT-PML/RAR and the expression vector tiation block. In this context, we have initially shown that the alone (MT-1 plasmid) were electroporated into TF-1 cells ␣ according to established procedures.25 Two days after transfec- PML/RAR protein can efficiently block Vitamin D3-induced differentiation of promonocytic U-937 cells and increases the tion the medium was changed to selective medium and cells survival and proliferation of cells grown in low serum concen- G418-resistant selected under limiting dilution conditions. trations.19 Furthermore, retinoic acid restores the differen- 20 tiative response to Vitamin D3. Subsequently, we have shown that PML/RAR␣ overexpression in human erythroleuke- Western blotting analysis Western blotting analysis of cell lysates was performed as 9 ␣ Correspondence: U Testa, Department of Hematology and Oncology, described using an anti-human RAR rabbit polyclonal anti- ` body (PPa(F)) directed against the F domain of the RAR␣ pro- Istituto Superiore di Sanita, 00161, Rome, Italy; Fax: 39 649387087 ´ ´ Received 31 July 1997; accepted 8 December 1997 tein (gift from P Chambon, Institut de Genetique et de Biologie Terminal megakaryocytic differentiation of TF-1 cells U Testa et al 564 ´ Moleculaire et Cellulaire, CNRS-INSERM, Strasbourg, France). kit (Immunotech, Marseille, France); purified anti-human c- An anti-rabbit alkaline phosphatase-conjugated antibody mpl (Genzyme, Cambridge, MA, USA). For IL-3R and c-kit (Promega, Madison, WI, USA) was used to stain the immunob- expression the cells were incubated for 60 min at 4°C and lots according to the manufacturer’s instructions. then analyzed for red fluorescence. For c-mpl expression TF- 1 cells were first incubated for 60 min at 4°C in the presence of 5 g/ml of this antibody, washed with cold PBS and then incu- Phenotypic analysis bated for 30 min at 4°C with biotin-conjugated sheep anti-mouse IgGs (Cappel laboratories, Westchester, PA, USA); after washing Monoclonal antibodies: The following mAbs were used to with cold PBS, cells were incubated with PE-labeled streptavidin assess the maturation level of TF-1 cells: (1) progenitor cell (Dakopatt) and then analyzed by flow cytometry. anti-CD34 mAb (clone HpCA2, Becton Dickinson, Mountain View, CA, USA); (2) myeloid mAbs, including anti-CD33 (Leu M9), anti-CD15 (Leu M1), anti-CD13 (Leu M7) and anti-CD14 RT-PCR analysis (Leu M3) (Becton Dickinson); (3) granulo–monocytic mAbs Total RNA from 1 × 105 cells was extracted by CsCl gradient anti- -integrin mAbs, including anti-CD11a, CD11b and 2 technique and reverse transcribed according to the manufac- CD11c (Dakopatt, Copenhagen, Denmark); (4) erythroid anti- turer’s instruction (Boehringer, Mannheim, Germany). PCR glycophorin mAb (Dakopatt); (5) megakaryocytic mAb, was performed in a final volume of 50 l in the presence of including anti-CD41, anti-CD42a, anti-CD42b (Dakopatt), 2.5 U of Taq polymerase (Perkin-Elmer Cetus, Norwalk, CT, anti-CD61 and anti-CD62 (Becton Dickinson). USA). The samples were amplified for EpoR, Mpl, GpllIa, PF4 and NF-E2 using the following primers and probes at the indi- cated annealing temperature for 30 cycles. Surface markers immunofluorescence analysis: The The samples were run on 2% agarose gel and filters erythroid, megakaryocytic, monocytic and granulocytic matu- hybridized using end-labeled probes. ration of TF-1 clones was determined by the percentage of cells reacting with specific mAbs, as assessed by FACS. This Primers and probes: analysis also allowed evaluation of antigen expression level EpoR: by fluorescence-labeling intensity. Thus, cells were incubated ′ ° Primer 5 : TCATGGACCACCTCGGGGCGT (2–19); for 60 min at 4 C in the presence of an appropriate mAb Primer 3′: TAGCGGATGTGAGACGTCATG (519–539); dilution. Each antibody was conjugated with either fluorescein Probe: 5′ TCTGGTGTTCGCTGCCTACAGCCGACACGTC isothyocianate (FITC) or phycoerythrin (PE). After three washes GAGC 3′ (314–348). with cold PBS (HyClone, Cramlington, UK), cells were resus- Annealing at 54°C. pended in PBS containing 2.5% formaldehyde, and then ana- TpoR/mpl: lyzed by FACS for fluorescence intensity. At least 4000 cells Primer 5′: AGCTGATTGCCACAGAAACC (557–576); were analyzed for each determination. Polyclonal mouse Primer 3′: ACTTGGGGAGGTCTGCTTTG (665–684); immunoglobulins (Becton Dickinson) of the same isotype as Probe: 5′ CCAGTCTCCATGTGCTCAGCCCACAATGCC