sign in sign up
<<
Home , CLEC7A, Collectin, Pokeweed mitogen

CLEC7A/Dectin-1 attenuates the immune response against dying and dead cells

(CLEC7A/Dectin-1 verringert die Immunantwort gegen sterbende und tote Zellen)

Der Naturwissenschaftlichen Fakultät der Friedrich-Alexander-Universität Erlangen-Nürnberg zur Erlangung des Doktorgrades Dr. rer. nat.

vorgelegt von Connie Hesse aus Eberswalde-Finow Als Dissertation genehmigt von der Naturwissenschaftlichen Fakultät der Friedrich-Alexander-Universität Erlangen-Nürnberg

Tag der mündlichen Prüfung: 21.12.2010 Vorsitzender der Promotionskommision: Prof. Dr. Rainer Fink Erstberichterstatter: Prof. Dr. Lars Nitschke Zweitberichterstatter: PD Dr. Reinhard Voll Table of Contents

Table of Contents

Table of Contents ...... 1

Abstract ...... 3

Zusammenfassung...... 4

1 Introduction ...... 6 1.1 C-type ...... 8 1.1.1 CLEC4L/DC-SIGN ...... 11 1.1.2 CLEC7A/Dectin-1...... 12 1.1.3 CLEC9A/DNGR1 ...... 13 1.2 Cell death: , primary necrosis, secondary necrosis ...... 14 1.3 Cell death and clearance...... 17 1.3.1 “Find-me” signals ...... 18 1.3.2 “Eat-me” signals (PS dependent)...... 19 1.3.3 “Eat-me” signals (PS independent)...... 19 1.3.4 “Tolerate-me” signals...... 22 1.4 Clearance deficiency and autoimmunity...... 22

2 Materials & Methods ...... 26 2.1 Materials...... 26 2.2 Methods...... 30 2.2.1 Cells, culture conditions, isolations and generations...... 30 2.2.2 Induction and detection of apoptosis and necrosis ...... 33 2.2.3 Cell stainings...... 33 2.2.4 Binding Experiments...... 34 2.2.5 Assays...... 37 2.2.6 In vitro release assays ...... 38 2.2.7 Immunization experiments ...... 39 2.2.8 Antibody determination ...... 41 2.2.9 Cytokine determination ...... 42 2.2.10 Flow cytometry analyses ...... 43 2.2.11 Microscopy anaylses ...... 44

1 Table of Contents

2.2.12 Statistical analyses ...... 44

3 Results ...... 45 3.1 Cell death is reflected by characteristic morphological changes ...... 45 3.2 Plant binding ...... 47 3.3 C-type lectin CLEC9A/DNGR1 ...... 50 3.4 C-type lectin CLEC4L/DC-SIGN...... 61 3.5 C-type lectin CLEC7A/Dectin-1 ...... 66

4 Discussion...... 82 4.1 Lectin binding is a special feature of late apoptotic cells...... 82 4.2 C-type lectin CLEC9A/DNGR1 binds late apoptotic PMN endowed with intact membranes...... 84 4.3 C-type lectin CLEC4L/DC-SIGN binds apoptotic cells endowed with intact membranes...... 86 4.4 C-type lectin CLEC7A/Dectin-1 downregulates the response against late apoptotic and primary necrotic cells...... 88

5 Concluding remarks ...... 95

6 References...... 96

7 List of abbreviations...... 109

8 List of figures ...... 112

Acknowledgements...... 114

Curriculum Vitae...... 116

2 Abstract

Abstract

Analysing apoptotic cell death it has been observed that late apoptotic cells expose internal membranes with heavily altered glycocalyx. The latter is the target for a plethora of sugar-epitope recognizing such as pentraxins, , , and, less physiological, plant lectins. These lectins bind to late apoptotic as well as to primary and secondary necrotic cells. Strong binding to late apoptotic cells with intact membranes was observed for the plant lectins Narcissus pseudonarcissus (NPn) and Griffonia simplicifolia (GSL II). Within this thesis the C-type lectins CLEC4L/DC-SIGN, CLEC9A/DNGR1, CLEC7A/Dectin-1 and their role in recognition, uptake of apoptotic and necrotic cells and/or their influence on the immunogenicity of dead and dying cells has been investigated. Enhanced binding for CLEC4L/DC-SIGN and CLEC9A/DNGR1 to late apoptotic cells was observed. CLEC9A/DNGR1 binding, which until now was only reported for necrotic cells, could also be demonstrated for late apoptotic PMN endowed with intact membranes. CLEC9A/DNGR1 could, therefore, act as recognition receptor of dying cells at the edge of late apoptosis and secondary necrosis. Its physiological role is yet unkown, but might become clear, when CLEC9A/DNGR1 ligands are revealed. For CLEC7A/Dectin-1 no direct binding to apoptotic or necrotic cells was observed. However, a co-operation with other receptors is proposed, since phagocytosis assays revealed differences in uptake and/or degradation in the absence or presence of CLEC7A/Dectin-1 receptor. In vivo studies revealed an attenuated immune response in the presence of CLEC7A/Dectin- 1 against dead and dying cells. This thesis points out that the role of lectin receptors in the clearance process seems to be much more important than assumed. The anti- inflammatory PS-dependent clearance of early apoptotic cells is well characterized. Hence, if apoptotic cells escape clearance, the recognition of their altered surface glycosylation pattern with exposed modified autoantigens by C-type lectin receptors on professional phagocytes and presenting cells is very likely. The role of C- type lectins in immune stimulation in co-operation with other phagocytic receptors is subject to deeper investigation. If involved in the clearance process of late apopotic cells, as the data in this thesis indicate, C-type lectins might be targets for a therapeutic concept for the chronic inflammatory autoimmune diseases SLE, which is linked with clearance deficiencies.

3 Zusammenfassung

Zusammenfassung

Untersuchungen zum Zelltod haben gezeigt, dass spät apoptotische Zellen innere Membranen mit stark veränderter Glykokalyx exponieren. Letztere ist Zielstruktur für zahlreiche Zucker-Epitop-erkennende Proteine, wie z.B. Pentraxine, Kollektine, Galektine, und weniger physiologisch Pflanzenlektine. Diese Moleküle binden sowohl spät apoptotische als auch primär und sekundär nekrotische Zellen. Starke Bindung an spät apoptotische Zellen mit intakter Zellmembran wurde für die Pflanzenlektine Narcissus pseudonarcissus (NPn) and Griffonia simplicifolia (GSL II) beobachtet. Im Rahmen dieser Arbeit wurde die Rolle der C-typ Lektine CLEC4L/DC-SIGN, CLEC9A/DNGR1, CLEC7A/Dectin-1 bei der Erkennung sowie der Aufnahme apoptotischer und nekrotischer Zellen und/oder ihr Einfluss auf die Immunogenität toter und sterbender Zellen untersucht. Es wurde verstärkte Bindung von CLEC4L/DC-SIGN und CLEC9A/DNGR1 an spät apoptotische Zellen beobachtet. CLEC9A/DNGR1 Bindung, die bisher nur für nekrotische Zellen berichtet wurde, konnte in dieser Arbeit auch für spät apoptotische PMN mit intakter Membran nachgewiesen werden. CLEC9A/DNGR1 könnte demnach als Erkennungsrezeptor für sterbende Zellen an der Grenze von später Apoptose und sekundärer Nekrose agieren. Die physiologische Bedeutung von CLEC9A/DNGR1, die bis jetzt noch unbekannt ist, könnte aufgeklärt werden, wenn dessen Liganden analysiert sind. Für CLEC7A/Dectin-1 wurde keine direkte Bindung an apoptotische oder nekrotische Zellen beobachtet. Eine Kooperation mit anderen Rezeptoren ist aber denkbar, da Phagozytoseversuche Unterschiede in der Aufnahme und/oder der Degradation sterbender und toter Zellen in Abwesenheit oder Gegenwart vom CLEC7A/Dectin-1 Rezeptor aufwiesen. In vivo Studien zeigten eine verringerte Immunantwort in Gegenwart von CLEC7A/Dectin-1 gegen tote und sterbende Zellen. Diese Arbeit zeigt, dass die Rolle von Lektinrezeptoren im Clearance-Prozess viel bedeutender ist als bisher angenommen. Die anti-inflammatorische PS-abhängige Clearance früh apoptotischer Zellen ist gut charakterisiert. Wenn jedoch apoptotische Zellen ihrer Beseitigung entkommen, ist die Erkennung ihrer veränderten Glykokalyx mit exponierten, modifizierten Autoantigenen durch C-typ Lektinrezeptoren auf professionellen Phagozyten und antigenpräsentierenden Zellen sehr wahrscheinlich. Die Rolle von C-typ Lektinen bei der Immunstimulation in Kooperation mit anderen phagozytischen Rezeptoren ist Gegenstand weiterer Untersuchungen. Wenn C-typ

4 Zusammenfassung

Lektine am Clearance-Prozess spät apoptotischer Zellen beteiligt sind, worauf die Ergebnisse dieser Arbeit hinweisen, könnten C-typ Lektine therapeutische Targets für die chronische Autoimmunerkrankung SLE, welche mit Clearance-Defizienz verknüpft ist, darstellen.

5 1 Introduction

1 Introduction

Lectins are proteins that bind sugar epitopes of glycoconjugates like glycoproteins or glycolipids. This group of proteins do not act enzymatically on their ligand nor do they belong to the class of antibodies [1], but due to their -carbohydrate-interaction they are involved in a variety of cellular processes. Soluble and cell bound lectins serve different functions including intracellular trafficking, cell adhesion, cell-cell signalling, glycoprotein clearance, and modulation of innate immunity [2]. They are ubiquitous in nature and they are to be found in plants, bacteria, viruses, and animals [3]. Their history started over 100 years ago with Silas Weir Mitchell’s studies on snake venoms. He observed agglutination of erythrocytes by rattlesnake venom. A few years later H. Stillmark isolated within his doctoral thesis, an extremely toxic hemagglutinin, from seeds of the castor plant (Ricinus communis). The word “lectin” (Latin: legere, meaning, among other things, "to select") was coined in 1954 by William C. Boyd who discovered that plant agglutinins were able to distinguish between erythrocytes of different blood types [4]. The term was generalized by Sharon et al. to embrace all sugar-specific agglutinins of non-immune origin, irrespective of source and blood type specificity [5]. Purification of various lectins led to the modern era of “lectinology” providing new tools for cancer research and for studying polysaccharides, glycoproteins, and cell surfaces. Table 1 depicts an overview of the history of the "lectinology". Analysing apoptotic cell death it has been observed that late apoptotic cells expose internal membranes with heavily altered glycocalyx [6]. The latter is the target for a plethora of sugar-epitope recognizing proteins that bind to late apoptotic as well as to primary and secondary necrotic cells, such as C1q, PTX-3, galectins, SP-A, and, less physiological, plant lectins. The biological function of animal lectins with respect to apoptosis, clearance, clearance failure, and is a wide field that remains to be elucidated.

6 1 Introduction

Table 1: Milestones in lectinology (adapted from [7] and [8]) 1860 Description of blood coagulation as indication for lectin activity in rattlesnake venom (S.W. Mitchell) 1888 Detection of erythrocyte agglutination by a toxic protein fraction from castor beans (termed ricin) and seeds of related plants (H. Stillmark) 1890 Detection of a toxic lectin in the bark of black locust (Robinia pseudoacacia) (O. Power, O. Cambier) 1891 Application of toxic plant agglutinins as model (P. Ehrlich) 1898 Introduction of the term ‘haemagglutinin’ or ‘’ for plant proteins that agglutinate red blood cells (M. Elfstrand) 1902 Detection of bacterial agglutinins (R. Kraus, S. Ludwig) and confirmation of lectin presence (seven to nine decades later shown to depend on the presence of a C-type lectin) in snake venom (S. Flexner, H. Noguchi) 1906 Detection of an agglutinin in bovine serum (later characterized as the C-type lectin conglutinin) by use of activated complement-coated erythrocytes (H.-J. Bordet, F.P. Gay); detection of a haemagglutinin in mushrooms (Amanita spp.) (W.W. Ford) 1907/09 Detection of non-toxic plant agglutinins (K. Landsteiner, H. Raubitschek) 1913 Use of intact cells for the purification of lectins, like ricin (R. Kobert) 1919 Crystallization of a globulin from jack bean, , which was later defined as lectin and used in pioneering studies (J.B. Sumner) 1935/36 Discovery of a carbohydrate as a ligand for concanavalin A (J.B. Sumner, S.F. Howell) 1941 Detection of viral agglutinins (G.K. Hirst, L. McClelland, R. Hare) 1947/48 Detection of blood group-specific lectins (W.C. Boyd, K.O. Renkonen) 1952 Carbohydrate nature of blood group determinants detected by lectin- mediated agglutination (W.M. Watkins, W.T.J. Morgan) 1954 Introduction of the term “lectin” for plant (antibody-like), carbohydrate-binding proteins/agglutinins (W.C. Boyd) 1960 Detection of the mitogenic potency of lectins toward lymphocytes (P. C. Nowell) 1963-65 Introduction of affinity chromatography for the isolation of lectins (I.J. Goldstein, B.B. L. Agrawal) 1972 Determination of the amino acid sequence and the three-dimensional structure of a lectin – concanavalin A or ConA (G.M. Edelman, K.O. Hardman, C.F. Ainsworth) 1974 Isolation of the first mammalian lectin (asialoglycoprotein receptor) from liver (G. Ashwell) 1978 First International Lectin Meeting (T.C. Bøg-Hansen) 1979 Detection of endogenous ligands for plant lectins (H. Rüdiger) 1983 Detection of the insecticidal action of a plant lectin (L.L. Murdock)

7 1 Introduction

1984 Isolation of lectins from tumors (H.-J. Gabius; R. Lotan, A. Raz) 1985 Immobilized glycoproteins as pan-affinity adsorbents for lectins (H. Rüdiger) 1989 Detection of the fungicidal action of a plant lectin (W. J. Peumans) 1992/93 Detection of impaired synthesis of lectin () ligands by defective fucosylation as cause for leukocyted adhesion deficiency type II, a congenital disorder of glycosylation (CDG IIc) (A. Etzioni and colleagues) 1995 Structural analysis of a lectin-ligand complex in solution by NMR spectroscopy (J. Jiménez-Barbero and colleagues) 1996-2003 Detection of differential conformer selection by plant, bacterial, and animal lectins (H.-J. Gabius and colleagues; L. Poppe and colleagues) 2001-2005 Development of glycan/lectin microarrays for specifity analysis of lectins/structural analysis of glycans and glycoproteomics (various laboratories worldwide) 2001- today Advances in lectinology and glycosciences honoured by devoting special issues in internationally renowned journals

1.1 C-type lectins

Several families of glycan-binding proteins or lectins have been implicated in a wide variety of immunological functions including first-line defense against pathogens, cell trafficking, cell differentiation, and immune regulation. These include, among others, the C-type lectins (collectins, , , and others), S-type lectins (galectins), I-type lectins ( and others), P-type lectins (phosphomannosyl receptors), pentraxins, and tachylectins (Table 2). Many biological effects of complex carbohydrates are mediated by lectins that contain discrete carbohydrate-recognition domains. At least seven structurally distinct families of carbohydrate-recognition domains are found in lectins that are involved in intracellular trafficking, cell adhesion, cell-cell signalling, glycoprotein turnover, and innate immunity.

Table 2: Most important structural families of animal lectins and their classification (from [9] and [8], with modifications) Family Structural motif Carbohydrate Examples ligand(s) C-type conserved CRD variable (mannose, collectins, selectins, glucose, galactose, endocytic lectins fucose) S-type conserved CRD ß-galactosides galectins I-type or Ig- immunoglobulin-like sialic acids or other siglecs and others type CRD sialylated structures

8 1 Introduction

Family Structural motif Carbohydrate Examples ligand(s) P-type conserved CRD oligosaccharides phosphomannosyl bearing terminal receptors Mannose-6-phosphate residues Pentraxins pentameric subunit galactose, sulfated small pentraxins: e.g. arrangement and phosphorylated C-reactive protein monosaccharides (CRP), serum amyloid P component protein (SAP); long pentraxins: e.g. PTX3 Tachylectins six internal tandem certain N-acetyl sugars Tachylectin-5a, -5b and repeats forming ß- others propeller domains

Table 3: C-type lectin subfamilies (from [10] and [11], with modifications) Evol. Name Function Organization Example group I Lecticans cell adhesion, extended aggregan, () tissue integration , , and II Asialoglycoprotein endocytosis type II CLEC4L/DC-SIGN and DC receptors transmembrane III Collectins innate immune soluble, MBL, SP-A, SP-B defense collagenous IV Selectins cell adhesion type I L- (leukocyte)-, P- transmembrane ()- and E- (endothelial)- selectin V ‘NK - cell endocytosis, type II CLEC7A/Dectin-1, receptors’ associated with transmembrane CLEC9A/DNGR1 inhibition or activation of NK cells VI Multi-CTLD endocytosis type I endocytic transmembrane mannose receptor receptors (MMR), DEC-205

9 1 Introduction

Evol. Name Function Organization Example group VII Reg group involvement soluble Pancreatic stone shown in various protein (PSP) physiological and pathological processes VIII- see [11] XVII

The family names of lectins were given according to their special requirements for binding activity, e.g.: C-type lectins requiring calcium and S-type lectins requiring “free” thiols. C-type lectins (“CLEC”) are carbohydrate-binding proteins that were formerly designated by their calcium requirement for binding. However, today there are many known C-type lectins lacking calcium binding sites and thus engaging their ligands in a calcium-independent manner, such as CLEC7A/Dectin-1 [12]. Though, not all C-type lectins require calcium for binding, they have one or more so-called ‘carbohydrate recognition domains’ (CRD) with conserved homologous residue motifs in common. This domain has been designated ‘C-type CRD’ or ‘C-type lectin domain’ (CTLD). Analysing more CRDs of different lectins it became obvious, that a number of proteins containing C-type CRDs can neither bind calcium nor carbohydrates. To overcome this contradiction a more general term ‘C-type lectin-like domains’ was coined to refer to such homologues domains (reviewed in [11]). The lectins lacking sugar-binding and/or calcium-binding activity are often referred to as “non-classical C-type lectins”. However, one has to be aware that in literature all the terms are used simultaneously regardless of binding specifity. Often proteins containing the domain are being regarded as members of the ‘C-type lectin family’ though many of them are not even lectins. Taken together CRD, CTLD, and CLEC confer to proteins that share a homologous domain, but which may differ regarding their carbohydrates binding specifities and their calcium-requirements. Drickamer et al. classified C-type lectins (CLEC) into 7 subgroups (I to VII) based on the order of the various protein domains in each protein [13]. This classification was subsequently updated in 2002 by addition of seven additional groups (VIII to XIV) [14] and most recently extended by addition of further three subgroups (XV to XVII) [15] (Table 3). An additional common classification is based on their molecular

10 1 Introduction structure. Depending on the orientation of their amino (N) terminus two groups of membrane-bound C-type lectins can be distinguished. These are type I and type II C- type lectins having their N termini pointing outwards or into the cytoplasm of the cell, respectively. The type I surface lectins contain several CRDs or CRD-like domains (e.g. Macrophage Mannose Receptor and DEC-205), whereas the type II C-type lectins identified so far have only a single domain of this type (e.g. CLEC7A/Dectin-1, CLEC4L/DC-SIGN) [16]. Proteins containing CTLD or C-type lectin-like domains or CRDs have a diverse range of functions including cell-cell adhesion, immune response to pathogens, and apoptosis [17,18].

1.1.1 CLEC4L/DC-SIGN

CLEC4L/DC-SIGN is a type II transmembrane receptor that is classified as a group II classical C-type lectin [19,20]. It consists of an extracellular C-terminal CTLD, a repetitive stalk region (seven, plus one incomplete, 23-amino-acid tandem repeats), a single transmembrane region, and a cytoplasmic tail containing a number of internalisation motifs (Figure 1) [21]. The C-type lectin receptors belonging to the ‘SIGN’ (specific ICAM-3-grabbing non-integrin) family consists of three members in humans DC-SIGN, L-SIGN, and LSECtin and five homologues in mice mDC-SIGN and mSIGNR1 to mSIGNR4 [22]. Human DC-SIGN is expressed on myeloid DC and its most homologous murine counterpart mDC-SIGN is expressed on plasmacytoid preDC (p-preDC) and CD8α-DC [22]. Its most extensively studied homologue mSIGNR1 is predominantly expressed by liver sinusoidal endothelial cells, similar to human L-SIGN, and is not present on DC [23]. Moreover mSIGNR1 is expressed on peritoneal and marginal zone [22]. Within the CRD hDC-SIGN, LSIGN, mSIGNR1 to mSIGNR3 have a highly conserved Glu-Pro-Asn (EPN) motif necessary for the recognition of mannose and fucose structures. Murine SIGNR4 has a Gln-Pro- Asp (QPD) motif within its CRD necessary for the recognition of galactose structures [22]. The ligands of CLEC4L/DC-SIGN are high mannose and fucose structures found in a number of viruses (HIV-1 gp120, measles virus), bacteria (such as tuberculosis, Mycobacterium leprae, and Candida albicans) and protozoa, but also binds self-proteins (ICAM-2 on endothelial cells, ICAM-3 on T cells) [21,24]. CLEC4L/DC-SIGN establishes cellular interactions of DC with endothelial cells during DC migration and with T cells during antigen presentation. Interestingly, internalized 11 1 Introduction

HIV-1 and other virus particles are not processed and presented by DC. HIV-1 mediates internalization and promotes efficient infection in trans of T cells that express the classical HIV-1 receptors (CD4 and receptors). It has been reported, that pathogens are able to target CLEC4L/DC-SIGN and to modulate Toll- like receptor signalling [25]. ManLAM secreted by M. tuberculosis-infected cells binds to CLEC4L/DC-SIGN on DC, blocks TLR-induced maturation of DC and induces the production of immunosuppressive cytokine IL-10 [26]. Controlling DC maturation by means of specific targeting of CLEC4L/DC-SIGN or other lectin receptors may play a pivotal in preventing autoimmune disease.

1.1.2 CLEC7A/Dectin-1

CLEC7A/Dectin-1 is a type II transmembrane receptor that is classified as a group V non-classical C-type lectin lacking the conserved residues involved in calcium binding [12,20]. It has a single extracellular CTLD connected by a stalk to a transmembrane region and a cytoplasmic tail containing an ITAM-like or hemITAM motif (Figure 1) [27]. CLEC7A/Dectin-1 contains only a single YxxL motif that activates Syk. Usually an ITAM-motif contains two such motifs (ITAMs; YxxL x(7–8) YxxL) for Syk-activation and further downstream signalling. In contrast to the murine receptor, the mRNA of human homologue is alternatively spliced, resulting in two major (A and B) and six minor isoforms [12]. In mice, CLEC7A/Dectin-1 is expressed predominantly by myeloid cells, including macrophages, , , and DC, but also at low levels by a subset of splenic T cells [28]. The human homologue of CLEC7A/Dectin-1 shows a similar expression compared to murine CLEC7A/Dectin-1, except that it is also present on B cells, , and mast cells [29,30]. Overall the human and murine CLEC7A/Dectin-1 are structurally and functionally very similar. They act as pattern recognition receptors (PRR) and recognize predominantly ß-1,3- and/or ß-1,6-linked glucans. CLEC7A/Dectin-1 mediates the phagocytosis of zymosan particles and intact yeast whose cell wall consists of ß-glucans. CLEC7A/Dectin-1 also binds to T cells thus it must posses a different, yet undefined, binding site enabling both endogenous and exogenous ligand recognition [12]. The ß-glucan receptor CLEC7A/Dectin-1 is considered the predominant receptor on macrophages involved in anti-fungal immunity [31], but also binding of human CLEC7A/Dectin-1 to apoptotic HEK-293 cells has been reported [32]. Inflammatory immune response upon CLEC7A/Dectin-1 engagement might be 12 1 Introduction activated via three different, still not very well characterized pathways, involving Syk, Raf-1 or Card9 (reviewed in [33]). After ß-glucan binding CLEC7A/Dectin-1 can trigger DC maturation, ligand uptake by endocytosis and phagocytosis, the and the production of arachadonic acid metabolites, multiple and , such as TNFα, CXCL2, IL-2, IL-23, IL-6 and IL-10. The induction of IL-12, TNFα and reactive oxygen species (ROS) production also require collaborative Toll-like receptor (TLR)-2 and TLR-6 signalling through MyD88 and Nf- kB [33,34]. However, the TLR2–TLR6 ligand in zymosan is not known, since these TLR do not recognize ß-glucan [35]. It has been reported further, that CLEC7A/Dectin-1 on macrophages and DC can also interact with more MyD88- coupled TLRs (TLR-2, TLR-4, TLR-5, TLR7, TLR-9), resulting in the synergistic induction of numerous cytokines including TNF, IL-10, IL-6, and IL-23 [33,36,37].

1.1.3 CLEC9A/DNGR1

CLEC9A/DNGR1 is a type II transmembrane receptor classified as a group V non- classical C-type lectin lacking the conserved residues involved in calcium and carbohydrate binding [38,39]. It has a single extracellular C-type lectin-like domain, a transmembrane region, and a cytoplasmic tail containing a hemITAM motif (Figure 1). Murine CLEC9A/DNGR1 appears to be structurally different from human CLEC9A/DNGR1. Murine, but not human, receptor is alternatively spliced, resulting in a number of different isoforms. Furthermore, murine CLEC9A/DNGR1 is not glycosylated nor does the receptor dimerize [38]. Different functions might, therefore, be implicated for CLEC9A/DNGR1 in mice and humans. CLEC9A/DNGR1 in mice is selectively expressed at high levels by CD8α+ DC and at low levels by pDC. In humans, CLEC9A/DNGR1 is expessed by BDCA3+ DC and a small subset of CD14+CD16- monocytes, but in contrast to mouse not on pDC [38,40,41]. The ligands of CLEC9A/DNGR1, both endogenous and pathogen-associated molecular patterns (PAMP), are unknown. It was reported by Sancho et al. that the ligands for CLECA are exposed after cell death by necrotic cells [42]. Though being an endocytic receptor [38,40], CLEC9A/DNGR1 does not seem to be required for the process of uptake of necrotic cell fragments. Instead it is necessary for efficient cross-presentation by CD8a+ DC of dead-cell associated antigens [42]. Revealing its ligand(s) would certainly throw light on its physiological role, which is still elusive.

13 1 Introduction

Carbohydrate recognition domain C Carbohydrate recognition-like domain Type II Fibronectin type II repeat N Tyr-based, potential ITAM motif Triad of acidic amino acids Di-leucine motif CLEC4L (DC-SIGN, CD209) ITAM-like motif CLEC7A (Dectin-1) CLEC9A (DNGR1)

Figure 1: Structure of three C-type lectins expressed on DC ([16], modified) The cartoon structure of the classical C-type lectin CLEC4L/DC-SIGN shows a single extracellular carbohydrate recognition domain, a repetitive stalk region, a single transmembrane region, and a cytoplasmic tail containing a number of internalisation motifs. The cartoon structures of the non- classical C-type lectin CLEC7A/Dectin-1 shows a single extracellular carbohydrate recognition-like domain that lacks conserved residues involved in calcium binding. The single extracellular carbohydrate recognition-like domain of the non-classical C-type lectin CLEC9A/DNGR1 lacks conserved residues involved in calcium and carbohydrate binding. The cytoplasmic tails of CLEC7A/Dectin-1 and CLEC9A/DNGR1 contain an ITAM-like motif or hemITAM. All three presented lectins are type II transmembrane receptors.

1.2 Cell death: apoptosis, primary necrosis, secondary necrosis

There are two major forms of cell death in multicellular organisms: apoptosis and necrosis. Usually, apoptosis is a physiological process and plays an essential role in the embryogenesis, development, and homeostasis of multicellular organisms. In addition, apoptosis can be induced by various stimuli, for example by UV radiation, DNA damaging agents, ischemia, as well as viral infections. Apoptosis is a programmed cellular suicide pathway characterized by cell shrinkage, loss of contact to neighbouring cells, chromatin condensation, and degradation [43]. Intracellular material gets packed into apoptotic bodies and is shed from the surface, referred to as plasma membrane ‘blebbing’. During all these processes, the plasma membranes of the apoptotic cells and of the apoptotic bodies maintain their integrity and become

14 1 Introduction rapidly cleared by phagocytes via pathways usually not provoking inflammation [44,45]. Apoptosis is a highly genetically controlled and enzymatically regulated program for the elimination of either unnecessary or damaged cells without causing impairment to the surrounding tissues [46]. Necrosis is always revealing a pathological, not genetically controlled process, caused by acute physical or chemical noxes, oxidative stress, heat, lack of nutrients, or by infection, and can, therefore, be viewed as a more violent, accidental form of cell death. In necrotic cells (the plasma membranes have lost their ion selectivities) the cytoplasm starts swelling, and, eventually, the cells rupture, thereby spilling into the microenvironment intracellular materials [47]. The latter contain potentially noxious intracellular molecules, so-called danger signals or damage-associated molecular patterns (DAMP) such as autoantigens, high mobility group protein B1 (HMGB1), proteases, and uric acid and have the potential to provoke injury and inflammation in the surrounding tissues [46]. Between these forms of cell death, apoptosis and primary necrosis, there are several mixed forms often referred to as secondary necrosis. In healthy humans apoptotic cells are usually cleared efficiently. Hence if apoptotic cells escape their clearance, they may enter later stages of apoptosis, which may finally lead to loss of membrane integrity and to release of intracellular, autoantigens, nuclear material, proteins, and DNA. This process, referred to as secondary necrosis, is no longer “silent”, but steadily develops pro-inflammatory and immunostimulatory features. This process has been observed in vitro, but it remains to be elucidated if this indeed happens under physiological conditions in vivo [46,48]. Many autoantigens are modified during the process of apoptosis, and would consequently not be considered “self”, but “altered self” by the immune system. The putative “non-self” material might be taken up by antigen presenting cells such as DC which activate T cells and, consecutively, start an immune response against (altered) autoantigens. A chronic autoimmune disease like systemic lupus erythematosus (SLE), which is linked with a clearance defect of dying cells may finally develop [49-51]. Induction of apoptosis occurs via various stimuli from inside or outside the cell, e.g. by DNA damage, treatment with cytotoxic drugs or irradiation, lack of survival signals, or developmental death signals such as Fas ligand and α (TNFα). The multitude of diverse death signals all activate overlapping cell death machineries with common players (caspases = cysteine-dependent aspartate-

15 1 Introduction specific proteases) culminating in the characteristic features of apoptotic cell death. There are also caspase-independent forms of apoptosis [52,53], but the main pathways involve caspase activation. To date, there are three pathways known that trigger the execution of the death program involving the death receptors, the mitochondria, and the endoplasmatic reticulum (ER), respectively. In the extrinsic, death receptor pathway apoptosis is induced from outside the cell by the activation of death receptors (e.g. TNFR1 and Fas). Upon binding their ligands (TNFα and FasL, respectively) initiator procaspase 8 is activated and cleaves downstream effector procaspases (such as 3 or 7) which orchestrate apoptosis [54- 57]. DNA-damage induced apoptosis usually triggers the intrinsic, mitochondrial pathway. Several different types of DNA damage activate the transcription factor p53 [58] [59], which then induces the release of cytochrome c from mitochondria [60]. The release of cytochrome c results in formation of the “apoptosome” with apoptosis protease activating factor 1 (Apaf-1) in dATP/ATP-dependent manner [61-63]. That large multimeric Apaf-1 cytochrome c complex binds and activates procaspase-9 [64] with the subsequent proteolytic activation of effector caspases 3 or 7 [65]. The mitochondrial pathway is modulated by members of the Bcl-2 family proteins; Bcl-2- like survival factors (e.g. Bcl-2, Bcl-xL) inhibit, whereas proapoptotic Bax-like death factors (e.g. Bax, Bak) and proapoptotic BH3-only death factors (e.g. Bid, Noxa, PUMA) stimulate cytochrome c release [63,66]. The DNA-damage induced transcription factor p53 is known to activate proapoptotic Bax [67] [68], PUMA [69] and Noxa [70]. Thirdly, the accumulation in the ER of misfolded proteins and alterations in Ca2+ homeostasis causes ER stress and leads to apoptosis [71], which is mediated by activation of procaspase-12/9 and 4/9 in rodents and humans, respectively [71,72]. However, other molecular mechanisms and proapoptotic factors are discussed to be involved in the ER apoptosis pathway [73,74] and have to be further investigated. All three pathways merge at the level of active caspases-3/6/7. Caspase 3 is crucial for for apoptotic chromatin condensation and DNA fragmentation [75]. Caspases that specifically cleave their substrates after Asp residues are divided into initiator (caspase-2, -8, -9 and -10) and effector (caspase-3, -6 and -7) enzymes [65]. They are central in apoptotic signalling and execution [76]. Effector caspases cleave several structural as well as regulatory proteins (e.g. lamins, Poly(ADP-ribose)

16 1 Introduction polymerase, cytokeratines and many others) thereby actively (a) impairing homeostatic and repair processes, (b) halting cell cycle progression, (c) inactivating inhibitors of apoptosis, (d) mediating structural disassembly and morphological changes, and (e) marking the dying cell for engulfment and disposal [77]. Caspases destroy several proteins involved in maintenance of the cytoskeletal architecture such as paxillin, and vimentin [78]. This deprivation of the cytoskeleton causes a loss of rigidity of the plasma membrane. Concomitantly with changes in the cytoskeleton, there is an alteration of the cellular distribution of phosphatidylserine (PS) [79]. During apoptosis the transient exposure PS on the surfaces of viable cells becomes persistent, since the aminophospholipid translocase that reimports the PS via an ATP-dependent mechanism loses its activity accompanied by an increased nonspecific phospholipid flip-flop [80]. However, the mechanism of PS-esposure on apoptotic cell is still discussed controversially [81]. PS exposure is a rather early feature of apoptosis. Upon apoptosis caspase 3 cleaves the inhibitor of caspase- activated deoxyribonuclease (ICAD), releasing CAD, which then degrades chromosomal DNA in the nucleus [82,83]. The human homologue of ICAD is DNA Fragmentation Factor DFF45 [84]. However, the so-called characteristic DNA laddering is rather a late event in apoptosis [85]. The subsequent redistribution of fragmented DNA from the nucleus into membrane and apoptotic blebs is triggered by caspase-mediated Rho-kinase I (ROCK I) activation [86]. The apoptotic program is completed by the silent and efficient removal of the apoptotic corpes without causing inflammation and immune response.

1.3 Cell death and clearance

The removal by professional phagocytes of apoptotic cells (e.g. monocytes, macrophages, neutrophils) is a well regulated process. It involves four distinct steps: (a) phagocyte recruitment, (b) prey recognition, (c) prey engulfment and processing, and (d) postphagocytic anti-inflammation [46]. A multitude of receptors and molecules are involved in the clearance process of apoptotic cells. They are categorized according to the clearance step they are involved in as (a) “find-me” signals”, secreted by the apoptotic cells; (b) “Eat-me-signals” and (c) signalling molecules exposed by apoptotic prey; and (d) “Tolerate-me-signals” released by the phagocyte [46,87].

17 1 Introduction

1.3.1 “Find-me” signals

The “find-me” signals released from apoptotic cells promoting the recruitment of professional phagocytes include: lysophosphatidylcholine (LPC) [88], sphingosine-1- phosphate (S1P) [89], CX3CL1/fractalkine [90], and nucleotides UTP and ATP [91] (Figure 2). The latter finding is rather surprising since ATP is considered a classical danger signal [92,93]. Also apoptosis-induced IL6R shedding from neutrophils is discussed being involved in attraction [94]. However, under in vivo conditions only fractalkine and nucleotides have been verified being capable of acting as find-me signals [90,91]. Various other potential attraction signals such as thrombospondin-1 (TSP-1), a crosslinked dimer of S19 ribosomal protein (dRP S19), endothelial monocyteactivating polypeptide II (EMAP II), and cleavage products of human tyrosyl-tRNA synthetase (TyrRS) have been found in the supernatant of apoptotic cells (reviewed in [95]). However, the release mechanisms, the range of the gradient, and their receptors and recognition machineries are still elusive [96].

Apoptotic cell

Movement to dying cell

Release of attraction signals

CX3CL1/fractalkine Verified in vivo ATP UTP nucleotides

LPC

S1P Analysed in vitro TSP-1 Professional and others (dRP S19, phagocytes EMAP II, TyrRS, IL6R)

Figure 2: “Find-me” signals involved in the clearance process Apoptotic cells release different molecules, so-called “find-me” signals to attract professional phagocytes. A subsequent migration of professional phagocytes, such as monocytes, macrophages or neutrophils, to the dying cells ensures swift and efficient apoptotic cell clearance.

18 1 Introduction

1.3.2 “Eat-me” signals (PS dependent)

Once recruited, the professional phagocytes require the exposure on the apoptotic prey of “eat-me” signals followed by engagement of the corresponding adaptors and/or receptors. The most prominent “eat-me” signal on surfaces of apoptotic cells is PS [97] (Figure 3). Several candidates for counter receptors/adaptors of professional phagocytes that directly or indirectly (via bridging molecules) bind PS, have been identified [98]. Receptors proposed to directly bind PS include members of the TIM family (, immunoglobulin, mucin domain-containing molecules) Tim- 1, Tim-3, and Tim-4 [99-101]), brain-specific angiogenesis inhibitor 1 (BAI1) [102], and Stabilin-2 [103]. Further receptors that have been reported to recognize PS directly include class B scavenger receptors SR-BI and CD36 [104], oxidized low- density lipoprotein receptor (OxLDLR, CD68) [105,106], and lectin-like OxLDL1 (LOX-1) [107]. OxLDLR and LOX-1 have been shown to mediate the uptake of apoptotic cells in mouse peritoneal macrophages [105] and endothelial cells [108], respectively. Beside receptors, soluble adaptor molecules that bridge the phagocyte with the PS- exposing apoptotic cell are of major importance for the clearance process (Figure 3). Milk fat globule-EGF-factor 8 (MFG-E8) and developmental endothelial locus-1 (Del-

1) bridge PS of the apoptotic cells with the vitronectin receptor, the integrin ανß3, of the phagocyte and promote clearance [109,110]. Growth arrest specific 6 (Gas6), protein S, and ß2GPI serve as further molecules bridging PS and phagocytes via TAM-(Tyro3/Axl/Mer)-tyrosine kinases (GAS6 and Protein S) [111- 114] or undefined receptors (ß2GPI) [115-117], respectively. The ATP-binding- cassette transporter 1 (ABC1) triggers the exposure of PS at the cells’ surfaces on one hand. On the other hand macrophage-expressed ABC1 is required for the engulfment of apoptotic cells by macrophages [118]. Its relevance in the clearance process is not clear yet. PS exposed on the apoptotic cells may also require modification, e.g. oxidation, to get accessible to the bridging molecules like MFG-E8 [119] or the scavenger receptor CD36 [120].

1.3.3 “Eat-me” signals (PS independent)

Whereas PS-dependent recognition is rather an early event, many PS-independent changes occur during late phases of apoptosis. Several PS-independent membrane

19 1 Introduction changes are discussed to play a role in recognition of the apoptotic cell (Figure 3). Annexin-1 exposure is reported to promote apoptotic cell engulfment [121,122]. Alteration of ICAM-3 epitopes on the surface of leucocytes upon apoptosis induction is proposed to allow apoptotic-leukocyte recognition and clearance by macrophages via CD14-receptor [123]. Further membrane changes that are important in the clearance process involve alterations in the glycosylation pattern [124-126]. First hints were given in a study where the interaction of apoptotic thymocytes and macrophages could be blocked in the presence of N-acetyl glucosamine [125]. In other studies a direct role of sugar- recognizing lectins was demonstrated. Franz et al. and Beer et al. observed increased binding to apoptotic cells of various plant lectins [126] and galectins [127], respectively. Dini et al. demonstrated that phagosytosis of apoptotic rat hepatocytes is mediated by liver sugar recognition systems, since their clearance was mediated by the asialoglycoprotein receptor [124]. All three studies point to exposed desialytated sugars on the surfaces of apoptotic cells indicating that other lectin receptors might be involved in the recognition of apoptotic cells. The pentraxins CRP, SAP, and PTX3 bind apoptotic cells [128,129] and foster their uptake via Fcγ receptors [130]. Members of the family such as surfactant protein (SP)-A, mannose-binding lectin (MBL), and the complement component C1q [131] as well as [132] are defence collagens having an important role in the . They bind to invading pathogens and promote their removal by professional phagocytes. Interestingly, those collectins MBL [133,134], C1q [133,134], (SP)-A [134], -2 [135], and Ficolin-3 [136] also bind to apoptotic cells with altered surface pattern and promote their removal by ligation of the /CD91 receptor complex on the phagocytes’ surfaces [133,134]. The Mannose receptor, a classical receptor for pathogens, plays a role in the removal of apoptotic cells [137]. Natural IgM-mediated opsonization of apoptotic cells via LPC exposure is also reported to be important for an efficient clearance [138].

20 PS-dependent PS-independent

Apoptotic cell Altered carbohydrates Altered carbohydrates Altered carbohydrates ABC1 ICAM-3 PS or oxPS PS or oxPS OxLDL DNA LPC

AxI ? (-2) ? (-3)? ? ? IgM TSP-1 SAP SAP CRP C1-q lectins Gas6 PTX3 Ficolins (-2;-3) CRP MFG-E8 Del-1 Protein S SP-A/D ß2GP1 MBL ? ?

av ß3

Class B Class B scavenger TIM-family CD36 TAM-family undefined Fc Calreticulin/ Complement CD14 Stabilin-2 scavenger ABC1 receptors: Lectin receptors BAI1 Vitronectin receptors ß2GP1 receptors CD91 receptor receptors Fc receptors: SR-BI, SR-BI, CD36, CD68, receptors (TIM-1;-3;-4) receptor (Tyro3/Axl/Mer) receptors complex receptors Phagocyte CD36, CD68, LOX-1 LOX-1 (e.g. MMR)

Direct recognition Indirect recognition of PS of PS via adaptor molecules

Figure 3: “Eat-me” signals involved in the clearance process Apoptotic cell recognition is mediated by different, so-called “eat-me” signals. The latter include cell receptors on both, the phagocyte and dying cell, specifically exposed surface molecules, as well as various adaptor molecules. Early apoptotic cells are usually removed by PS-dependent recognition mechanisms. Late apoptotic cells that have not been removed in time may be cleared by PS-independent recognition mechanisms mediated by adaptor molecules such as pentraxins, collectins, ficolins, and lectins which recognize neo-epitopes on the dying cell. Note: The localization of DNA in the membrane is questionable. The question marks point out that some ligands and their exact molecular interactions are still under debate. [87,97-139] 2 1 1 Introduction

1.3.4 “Tolerate-me” signals

Whereas pathogen uptake triggers inflammation, the removal of apoptotic cells mediates anti-inflammatory clearance. Thus, finally after engulfment of apoptotic cells macrophages actively release anti-inflammatory ‘tolerate me’ cytokines like interleukin (IL)-10 and decrease the secretion of the pro-inflammatory cytokines IL- 1ß, TNFα, and IL-12 to keep the clearance process ‘silent’ [45].

1.4 Clearance deficiency and autoimmunity

Apoptotic cells are usually removed swiftly and efficiently without provoking inflammatory immune responses. If apoptotic cells escape clearance they may enter later stages of cell death, progressing to secondary necrosis (Figure 4). The final loss of the membrane integrity results in the release of modified autoantigens that might trigger inflammatory response [48,140]. Clearance deficiency may result if any of the recognition steps fail. However, this may not ultimately lead to autoimmunity. There are studies, where the lack of MBL or CD14 macrophage receptor result in defective clearance in vivo, but no spontaneous autoimmunity, lymphoproliferation, germinal center expansion or inflammation and increased autoantibody production was to be observed [141,142]. The loss of function of single receptors and molecules involved in the clearance process may thus be compensated by the uptake via backup mechanisms. Alternatively, apoptotic cells may have developed mechanisms to persist in tissues without causing inflammation. However, not all losses can be compensated. There are clearance involved factors, whose loss is severe and cannot be counterbalanced. Mice lacking c-mer Membrane Tyrosine Kinase [143], or receptor tyrosine kinases Tyro 3 and Axl [144], MFG-E8 [145], C1q [146,147], Natural IgM [148]; Transglutaminase 2 (TG2) [149] or liver X receptor (LXR) [150] have all been reported to develop lupus-like autoimmunity, age-dependent autoimmunity or glomerulonephritis most likely due to accumulation of apoptotic cells in various tissues. The autoimmunity was always accompanied by increased autoantibody production. Their targeted autoantigens are considered to be derived from and modified in apoptotic and necrotic cells. Several groups have observed that some, but not all, subgroups of patients with SLE show in vitro and in vivo deficiencies or impairments in their ability to clear apoptotic cells. Reduced clearance was observerd in monocyte-derived macrophages from a 22 1 Introduction subgroup of patients with SLE [151]. Analyzing lymph node biopsies revealed an accumulation of apoptotic cells in germinal centers in some patients with SLE and furthermore a reduced number of tingible body macrophages, which usually engulf apoptotic cells in the germinal centres. Compared to controls, apoptotic material was observed directly associated with the surfaces of follicular dendritic cells (FDC) [152]. If not removed swiftly apoptotic debries may serve as survival signal for B cells that have become autoreactive by somatic hypermutation and could foster their autoimmune reaction. Munoz et al. has observed that opzonization with IgG enhanced the uptake by blood-borne non-professional phagocytes of secondary necrotic cell-derived material (SNEC). This was accompanied by a significant increase in the secretion of the inflammatory cytokines TNFα and IL-8 [153]. In a healthy body an escape from clearance may happen occasionally without pathological consequences. However, if the defect is severe and long lasting, the accumulation of dead cells occurs causing a state of chronic inflammation followed by a risk to development autoimmunity and finally autoimmune diseases such as SLE. Munoz et al. considers it a “vicious circle”: Clearance deficiency may lead to the accumulation of SNEC in germinal centers. SNEC may then attach to FDC. The latter then present SNEC to autoreactive B cells leading to the induction of autoreactive proliferation with final break of self tolerance. Autoantibodies encounter nucleic- acid-containing apoptotic remnants present in circulation or deposited in tissues. SNEC-containing immune complexes will be cleared by professional phagocytes via Fcγ receptors (FcγR), shifting the response of the immune system towards inflammation and, consequently, autoimmunity. Multiple organ damage with subsequent enhanced cell death closes the vicious circle and may foster the etiopathogenesis of the chronic autoimmune disease SLE [46]. Intracellular modified autoantigens or complexes of autoantibodies, proteins, and nucleic acids are also likely to be mistaken by the immune system for opsonized viruses or bacteria fostering the engagement with TLR-receptors on macrophages and pDC and thereby activating the innate immune system [154-158]. Taken together, a swift and efficient clearance of apoptotic cells is inevitable for the maintenance of tolerance. The latter may be broken, if this well regulated process is disturbed. The immune system may cope with it and compensate occasionally occurring clearance failures. However, a permanent dysregulation in this process resulting in accumulation of apoptotic cells with final loss of plasma membrane

23 1 Introduction integrity and access of intracellular modified autoantigens may challenge and overwork the immune system. Autoimmune reactions and diseases are likely to occur, either by inherited or acquired long lasting clearance deficiencies, which also may be restricted to certain organs.

Regarding defective clearance, late changes, such as alteration in glycosylation pattern, may play an important role for the recognition of apoptotic cells by surface lectin receptors on professional phagocytes or on antigen presenting cells (APC) before progression to secondary necrosis (Figure 4). A closer look on lectin receptors and their role in clearance and maintenance of tolerance might reveal new insights into the complex field of cell death, immunity and homeostasis. Within this thesis the following hypotheses were analysed:

Hypotheses:

I. Mammalian cells expose neo-epitopes in the late stages of apoptosis, which are recognized by several exogenous and endogenous lectins.

II. Surface lectins of DC recognize and bind ligands exposed by late apoptotic cells.

III. Surface lectins and adaptors are involved in the clearance of late apoptotic or necrotic cells.

IV. Lectins involved in the clearance of apoptotic and necrotic cells modulate their immunogenicity and inflammatory potential.

24 1 Introduction

viable cell early apoptotic cell late apoptotic cell secondary necrotic cell

Clearance deficiency: Pro-inflammatory

Phosphatidyl- Immature glycoproteins Accumulation of modified serine (PS) with sugar epitopes autoantigens and release without protective sialic acid of danger signals

Clearance: Tolearance ? Inflammation ? anti-inflammatory

Recognition by professional Recognition by DC of immature phagocytes of exposed Glycoproteins as „altered self“ MHC-I „eat me“-signals, such as PS CD80 Receptors Adaptors and FcR CLEC7A Receptors (Dectin-1) BDCA-2 CLEC-1 + ? CLEC4L (DC-SIGN, C1q + C1qR CD209) CRP + FcR DCIR CLEC9A MHC-II DEC-205 Autoantibodies (DNGR1) CLEC7a (Dectin-1) CLEC4L Professional CD86 phagocytes CLEC9A (DNGR1) Anti-ACAMP + FcR (DC-SIGN, (CD207) Anti-Adaptor + FcR CD209) MMR (CD206)

Figure 4: Schedule of apoptotic cell death Apoptosis is a well organized programmed form of cell death. Cell shrinkage due to a blebbing process, loss of contact to neighbouring cells, chromatin condensation, and degradation are characteristics of apoptosis. During all these processes, the plasma membranes of the apoptotic cells and of the apoptotic bodies maintain their integrity and become rapidly cleared by phagocytes via pathways usually not provoking inflammation. If not cleared in time apoptotic cells may progress to secondary necrosis. Danger signals and damage-associated molecular patterns (DAMP) may be released provoking inflammation. Late apoptotic cells show a heavily altered glycosylation pattern, but have still remained membrane integrity. These modified cells may not be recognized as self anymore but ‘altered self’ by the immune system. Certain lectin receptors on DC may be involved in the recognition process, the final processing of late apoptotic cells and the decision if the APC responds with inflammation or not.

25 2 Materials & Methods

2 Materials & Methods

2.1 Materials

Table 4: Reagents and sources Reagents Sources Annexin V (AxV) Responsif, Erlangen, Germany Anti-CD14 linked magnetic microbeads Miltenyi Biotec, Bergisch-Gladbach, Germany Anti-human CD14 PE conjugated BD Biosciences, Heidelberg, Germany

Anti-human CD19 PE conjugated BD Biosciences, Heidelberg, Germany Anti-human IgG Fab fragment horseradish Southern Biotech, Birmingham, AL, USA peroxidase labelled Anti-human IgG FITC BD Biosciences, Heidelberg, Germany Bovine serum albumine Merck, Darmstadt, Germany Calcein-AM Sigma-Aldrich, Taufkirchen, Germany Carboxyfluorescein diacetate succinimidyl Sigma-Aldrich, Taufkirchen, Germany ester (CFDA-SE) Chloroform Sigma-Aldrich, Taufkirchen, Germany Citric acid Sigma-Aldrich, Taufkirchen, Germany Deoxycholate Sigma-Aldrich, Taufkirchen, Germany DMSO Roth, Karlsruhe, Germany DNA from herring sperm Sigma-Aldrich, Taufkirchen, Germany DNase I Roche Diagnostics Deutschland GmbH, Mannheim, Germany EDTA Sigma-Aldrich, Taufkirchen, Germany Ethanol Sigma-Aldrich, Taufkirchen, Germany Fetal calf serum Invitrogen, Karlsruhe, Germany G418 PAA Laboratories GmbH, Cölbe, Germany Glutamine Invitrogen, Karslruhe, Germany β-Glycerol phosphate disodium salt Sigma-Aldrich, Taufkirchen, Germany pentahydrate Glycerophosphocholine (GPC) Chemos GmbH, Regenstauf, Germany

H2O2 (30%) Merck, Darmstadt, Germany

H2SO4 Merck, Darmstadt, Germany

26 2 Materials & Methods

Halt Protease Inhibitor Cocktail Thermo Fisher Scientific GmbH, Dreieich, Germany HCl Merck, Darmstadt, Germany HEPES Merck, Darmstadt, Germany hIL-2 (Proleukin) Novartis Pharma GmbH, Vienna, Austria hIL-4 Miltenyi Biotec, Bergisch-Gladbach, Germany Igepal CA 360 Sigma-Aldrich, Taufkirchen, Germany Immunoselect Antifading Mounting Medium Dianova, Hamburg, Germany (AKS-38447) Laminarin Sigma-Aldrich-Aldrich, Taufkirchen, Germany L-glutamine Invitrogen, Paisly, UK LPS from E. coli Sigma-Aldrich, Taufkirchen, Germany Lymphoflot Biotest, Dreieich, Germany Mannan Sigma-Aldrich, Taufkirchen, Germany 2-Mercaptoethanol Sigma-Aldrich, Taufkirchen, Germany Mouse Th1/Th2 10plex FlowCytomix Bender MedSystems GmbH, Vienna, Austria Multiplex Kit Nuclease S7 Roche Diagnostics Deutschland GmbH, Mannheim, Germany Paraformaldehyde (PFA) Sigma-Aldrich, Taufkirchen, Germany PBS Invitrogen, Karslruhe, Germany Penicillin-streptomycin Invitrogen, Karslruhe, Germany Phenylmethylsulfonyl fluoride (PMSF) Calbiochem, Merck, Darmstadt, Germany Phytohemagglutinine (PHA) Sigma-Aldrich, Taufkirchen, Germany Propidium iodide (PI) Sigma-Aldrich, Taufkirchen, Germany rhGM-CSF Behringwerke, Marburg, Germany Ringer’s solution Delta Select, Pfullingen, Germany rmGM-CSF R&D Systems, Abingdon, UK RPMI 1640 Invitrogen, Karslruhe, Germany RPMI 1640/Glutamax Invitrogen, Paisly, UK

Sodium azide (NaN3) Merck, Darmstadt, Germany

Sodium carbonate (Na2CO3) Merck, Darmstadt, Germany Sodium chloride (NaCl) Merck, Darmstadt, Germany

Sodium di-hydrogen carbonate (NaHCO3) Merck, Darmstadt, Germany

27 2 Materials & Methods

Sodium di-hydrogen phosphate (NaH2PO4) Merck, Darmstadt, Germany Sodium dodecyl sulfate (SDS) Sigma-Aldrich, Taufkirchen, Germany Sodium fluoride (NaF) Sigma-Aldrich, Taufkirchen, Germany

Sodium hydrogen phosphate (Na2HPO4) Merck, Darmstadt, Germany Sodium orthovanadate Merck, Darmstadt, Germany 3,3′,5,5′-Tetramethylbenzidine Sigma-Aldrich, Taufkirchen, Germany Thioglycollate BD Biosciences, Franklin Lakes, NJ [3H]Thymidin Amersham Biosciences Tris-HCl Sigma-Aldrich, Taufkirchen, Germany Trypan blue Sigma-Aldrich, Taufkirchen, Germany Trypsin-EDTA solution Sigma-Aldrich, Taufkirchen, Germany Tween®20 Sigma-Aldrich, Taufkirchen, Germany VybrantTM Cell-Labeling Solutions (DiI, Molecular Probes, Invitrogen, Karlsruhe, DiO) Germany

Table 5: Material and sources Material Sources Cell culture flasks (50, 250, 600 ml) Greiner, Frickenhausen, Germany Cell culture plates (6-, 12-, 24-, 48-, 96 Greiner, Frickenhausen, Germany wells) Cellstar PP-tubes (15 ml, 50 ml) Greiner, Frickenhausen, Germany Combitips plus (0.5, 2.5, 5, 12.5 ml) Eppendorf, Hamburg, Germany EpT.I.P.S. standard (100, 200, 1000 µl) Eppendorf, Hamburg, Germany Falcon 5 ml polystyrene round-bottom tube Becton Dickinson, Bedford, MA, USA 1.2 µM non-pyrogenic, hydrophilic syringe Sartorius Stedim Biotech GmbH, Goettingen, filter Germany PP-96 tubes Micronic B.V., Lelystad The Netherlands Gilson micro volume pipettes (P 10, P 29, P Gilson, Wisconsin, USA 100, P 200, P 1000) Laboratory film Parafilm “M” American National Can, USA Lab-Tek™ Chambered Coverglass, 1.0 Thermo Scientific Nunc, Langenselbold, Borosilicate coverglass; 8 chambers Germany Micro test tubes Safe-Lock (0.5, 1.5 ml) Eppendorf, Hamburg, Germany Nunc cryo tube vials Nalgene Nunc, New York, NY, USA Nunc Maxisorp plates Nalgene Nunc, New York, NY, USA Pipetboy comfort Integra Biosciences, Chur, Switzerland Pipette tips (200, 100 µl) Greiner, Frickenhausen, Germany Serological pipettes (2, 5, 10, 20 ml) Greiner, Frickenhausen, Germany Tissue culture dish, PS (94 x 16 mm) Greiner, Frickenhausen, Germany

28 2 Materials & Methods

Table 6: Instruments and sources Instruments Sources Auto MACS Miltenyi Biotec, Bergisch-Gladbach, Germany Axiovert 200M inverted microscope, Zeiss, Oberkochen, Germany equipped with a ApoTome and Incubator XL-3 for life microscopy Caliper (B110T) Kroeplin GmbH, Schluechtern, Germany Cell culture incubator HERA cell Heraeus, Hanau, Germany Centrifuge Rotina 46 RS Hettich, Tuttlingen, Germany Eppendorf Centrifuge 5417R Eppendorf, Hamburg, Germany Clean work bench HERA safe Heraeus, Hanau, Germany Coulter XLTM software, version 3 Coulter Electronics Inc., Miami, USA Flow cytometer EPICS XL-MCL Coulter Electronics Inc., Miami, USA FACSCalibur Benchtop Cytometry Analyser BD Biosciences, Oxford, UK HTS 7000 Microplate Reader Perkin Elmer, Waltham, MA, USA Inverted System Microscope Olympus IX70 Olympus Optical Co., Hamburg, Germany Leica TCS SP5 Leica Microsystems, Mannheim, Germany Microcentrifuge MiniSpin Eppendorf, Hamburg, Germany Perkin-Elmer Ultra-View spinning disc Nikon GmbH, Düsseldorf, Germany confocal on Nikon TE2000-E Spectra MAX 190 plate reader Molecular Devices, Ismaning, Germany Thermomixer comfort Eppendorf, Hamburg, Germany UV table TFP – M/WL Vilber Lourmat, Marne-La-Vallee Cedex 1, France 1205 Wallac Beta counter Wallac/Pharmacia, Waltham, MA, USA

Table 7: Cell lines and sources Cell lines Sources RAW pfB, RAW-CLEC7A/Dectin-1 Provided by Prof. G.D. Brown (University of Aberdeen, Aberdeen, UK). Raji, Raji-CLEC4L/DC-SIGN Provided by Prof. S. Poehlmann (Hannover Medical School, Hannover, Germany)

Table 8: Proteins and sources Fc Fusion Proteins Source mCLEC7A/Dectin-1, mCLEC9A/DNGR1, Provided by Prof. G.D. Brown (University of hCLEC9A/DNGR1 Aberdeen, Aberdeen, UK).

29 2 Materials & Methods

2.2 Methods

2.2.1 Cells, culture conditions, isolations and generations

Cell lines and culture Raji and stably transfected Raji-CLEC4L/DC-SIGN were cultured in RPMI 1640 (Invitrogen) medium supplemented with 10% heat-inactivated FCS, 1 % glutamine, 15 mM HEPES-solution and 1 % penicillin-streptomycin mixture in a humidified atmosphere with 5 % CO2 at 37 °C.

RAW 264.7 cells, stably transfected with mouse CLEC7A/Dectin-1 (RAW-Dectin-1) and vector control (RAW pFB, described further as RAW), were kindly provided by Prof. Gordon Brown (University of Aberdeen, Aberdeen, UK) and were constructed as described previously [159]. The cells are grown in RPMI with 10 % FCS, 1 % glutamine, 15 mM HEPES and 1 % penicillin-streptomycin mixture, and 1 mg of G418/ml. The adherent cells were harvested using Trypsin/EDTA 1x solution.

Isolation of PBMC and PMN from peripheral blood Venous blood was obtained from healthy volunteers in full agreement with institutional guidelines. It served as source for peripheral blood mononuclear cells (PBMC) and polymorphonuclear cells (PMN) after addition of 20 U/ml heparin for anti-coagulation. PBMC were isolated by Ficoll density gradient centrifugation using Lymphoflot (Biotest). Cells were then reconstituted in phosphate-buffered saline (PBS; Invitrogen). Remaining were removed by centrifugation through fetal calf serum (FCS; Invitrogen). PMN were isolated from heparinized blood using routine Ficoll density gradient centrifugation. The PMN were collected from buffy coats. Residual erythrocytes were eliminated by two times performed hypotonic lysis using sterile 10x concentrated PBS and sterile distilled water. Cells were cultured in RPMI 1640 (Invitrogen) medium supplemented with 10 % heat-inactivated FCS, 1% glutamine, 15 mM HEPES and 1 % penicillin-streptomycin mixture (Invitrogen) in a humidified atmosphere with 5 % CO2 at 37 °C.

Isolation of PBL from peripheral blood by magnetic cell separation PBL and monocytes were separated from isolated PBMC by immunomagnetic depletion with anti-CD14 antibody-linked microbeads (Miltenyi Biotec).

30 2 Materials & Methods

Isolated PBMC were pelleted, reconstituted in 10 ml MACS running buffer (PBS, 2 mM EDTA, 0.5 % FCS, pH7.2), counted, pelleted again and reconstituted in MACS running buffer (8 µl per 1 Mio cells), anti-CD14 antibody-linked microbeads were added (1.5 µl per 1 Mio cells), incubated on ice for 45 min, washed with 10 ml MACS running buffer, pelleted, reconstituted in MACS running buffer (max. 100 Mio cells per 500 µl) and separated with the program ‘possel’ using the AutoMacs seperator (Miltenyi Biotec). Separation was checked by flow cytometry analysis (Flow cytometer EPICS XL-MCL, Beckman Coulter) with anti-human CD14 staining (BD Bioscience). The positive fraction contained the monocytes, the negatve fraction the PBL. PBL and monocytes were used for further experiments.

Generation of activated lymphoblasts and apoptotic blebs To generate lymphoblasts, isolated PBMC or PBL were activated with 1 µg/ml phytohemagglutinine (PHA, Sigma-Aldrich) and 500 IE/ml IL-2 (Proleukin S, Novartis Pharma GmbH) on day 0 and day 2 after isolation. Thereafter, cells were expanded with 500 IE/ml IL-2 another 2 days. On day 6 after isolation resulting lymphoblasts were washed, stained with CFDA-SE as described in section 2.2.3 and apoptosis was induced by UV-B irradiation with 90 mJ/cm2. For this, the lymphoblasts were adjusted to a concentration of 3 mio lymphoblasts/ml medium. On day 7 blebs were isolated as follows: I) With ultra-centrifugation: 16 h after induction of apoptosis, the cell culture supernatant was collected. For this, a centrifugation step (544 x g, 5 min) was performed first to remove remaining cells. The supernatant was then passed through a 1.2 µM non-pyrogenic, hydrophilic syringe filter. After centrifugation at 100,000 x g for 30 min at 14 °C, the pellet containing apoptotic blebs was harvested and used for further experiments. II) Without ultra-centrifugation: 16 h after induction of apoptosis, the cell culture supernatant was collected. For this, two centrifugation steps (416 x g, 5 min) were performed to remove remaining cells. The supernatant containing apoptotic blebs was harvested and used for further experiments.

Isolation of thioglycollate-elicited peritoneal macrophages To induce sterile peritonitis, 7-10 weeks old SV129 WT and SV129 CLEC7A/Dectin-1 KO mice were injected i.p. with 1 ml 4 % thioglycollate (BD Biosciences) 4 days

31 2 Materials & Methods before peritoneal lavage. After humane killing of the animals, inflammatory cells were collected by peritoneal lavage with ice-cold 5 mM EDTA in PBS. Peritoneal macrophages were identified by their expression of F4/80. The peritoneal macrophages were washed, resuspended in medium and used for further experiments.

Generation of mBMDDC 7–10 week old SV129 WT and SV129 CLEC7A/Dectin-1 KO mice were sacrificed and hind limbs were collected. Bone marrow cells were flushed from the tibia and femur with PBS. The marrow clusters were disaggregated by vigorous pipetting. Bone marrow cells were washed, resuspended in serum-free medium, filtered through a 70 µm sieve followed by centrifugation and reconstitution in RPMI 1640/Glutamax (Invitrogen) supplemented with 10 % FCS (Invitrogen), L-glutamine (Invitrogen), Penicillin and Streptomycin (Invitrogen), 50 µM 2-mercaptoethanol (Sigma-Aldrich), and 20 ng/ml GM-CSF (R&D). The cells were cultured in 10 cm petri-dishes at a concentration of 106 cells/ml in a humidified atmosphere with 5 %

CO2 at 37 °C. Cytokine supplemented culture media were replenished on days 3 and 6. At day 9 the purity of generated BMDDC were checked by flow cytometry by assessment of the amount of CD11c+MHC-II+ double positive cells and used for further experiments.

Generation of nucleosomes of viable or apoptotic Jurkat cells Nucleosomes were prepared from Jurkat cells that were left untreated or treated with staurosporine treatment for 4 – 8 h. The preparation was done by and according to Vilma Urbonaviciute [160]. In brief, isolated nuclei were digested with 500 U of micrococcal nuclease (S7; Roche) for 30 min at 37 ° C, lysed with 10 mM Tris and 2 mM EDTA, and the suspension was layered onto 12 ml of a 10 – 50% sucrose gradient. The gradients were centrifuged at 34,000 rpm for 22 h at 4 °C in a SW41 Beckman rotor. Fractions of 1.5 ml were collected and analyzed for DNA content by 1.5 % agarose gel electrophoresis in the presence of 0.1 % SDS followed by visualization with ethidium bromide. Histones and HMGB1 were detected by 15 % SDS PAGE and Coomassie staining as well as Western blotting. Before use, the nucleosome fractions were extensively dialysed against PBS. To exclude contaminations with LPS, we used sterile endotoxin-free plastic ware and reagents

32 2 Materials & Methods for nucleosome preparations. All nucleosome preparations were tested for LPS contaminations using the E-TOXATE kit (Sigma-Aldrich) and the QCL-1000 chromogenic endotoxin detection assay (Cambrex). Nucleosome preparations were used only if the Limulus (E-TOXATE) assay was negative and the endotoxin concentration was < 0.2 U/ml as detected by QCL-1000 [160].

2.2.2 Induction and detection of apoptosis and necrosis

PMN undergo spontaneous progressive apoptosis during in vitro culture. Apoptosis of PBMC or PBL was induced by UV-B irradiation with 180 mJ/cm2. Lymphoblasts were stressed with UV-B at a dose of 90 mJ/cm2. Primary necrosis was induced by heat treatment at 58 °C for 30 min of freshly isolated cells. Secondary necrosis was induced by heat treatment at 58°C for 30min of already apoptotic cells. The monitoring of apoptosis and necrosis was performed by (I) analysis of morphological changes by flow cytometry (FSc/SSc) and (II) staining with FITC-coupled AnnexinV (AxV; Responsif) in the presence of propidium iodide (PI; Sigma-Aldrich). AxV was used to identify phosphatidylserine exposure, PI was employed as a means to distinguish between apoptotic (AxV+/PI-) and necrotic (AxV+/PI+) cells. Measurements were performed with a flow cytometer EPICS XL-MCL (Beckman Coulter, Hialeah, FL, USA) or FACSCalibur Benchtop Cytometry Analyser (BD Biosciences, Oxford, UK). Excitation was at 488 nm, the FITC fluorescence was recorded on a FL1 sensor (515 nm - 545 nm-BP) and the PI fluorescence on a FL4 sensor (600 nm-LP). Data analysis was performed with Coulter XL™ software, version 3, after routine electronic compensation to eliminate bleed through of fluorescence. In detail, about 105 cells/400 µl Ringer’s solution (Delta Select) were incubated in the presence of labelled AxV (1 µg/ml) and PI (0.07 µg/ml) for 20 min at 4 °C and subsequently analyzed by flow cytometry. Assignment of cells to apoptosis and necrosis was based on recording the FL1 and FL4 mean fluorescence intensity (MFI), respectively.

2.2.3 Cell stainings

Vybrant DiI or DiO cell-labelling Cells were stained by addition of 5 µl of Vybrant DiI or DiO cell-labelling solution (Molecular Probes, Invitrogen) to 5 mio cells/ml PBS or serum free medium. After

33 2 Materials & Methods incubation for 20 min at 37 °C the cells were washed twice with serum-containing medium and resuspended in serum containing medium for further use.

PI staining of cell prey in phagocytosis assays Heat-treated primary necrotic or aged and UV-B irradiated secondary necrotic cells at a concentration of 5 mio cells/ml culture medium were stained with 10 µg PI/ml for 20 min at 37 °C and were then used for further experiments.

CFDA-SE staining of cell prey in phagocytosis assays Cells at a concentration of 2 mio cells/ml culture medium were stained with 0.25 µg CFDA-SE/ml for 15 min at 37 °C, were washed with serum-containing medium and resuspended in serum-containing medium. The cells were incubated for another 60 min to give them the opportunity to pump out not-bound CSFE. The cells were washed again, reconstituted in serum-containing medium at a concentration of 106 cells/ ml and used for further experiments. (Non-fluorescent CFDA-SE enters the cytoplasm of cells. Intracellular esterases remove the acetate groups and convert the molecule to the fluorescent ester, CFSE, which is retained within cells and couples covalently, via its succinimidyl group, to intracellular molecules.)

CFDA-SE staining of lymphoblasts Cells were stained with 4 µM (=2.2 µg/ml) CFDA-SE in PBS for 20 min at 37 °C. After two washing steps with serum-containing medium cells were reconstituted in culture medium for further use.

2.2.4 Binding Experiments

Cell staining with plant lectins NPn and GSLII A suspension of 100 µl cells (about 200,000 viable, heat-necrotized, apoptotic or secondary necrotic PMN and/or PBL) was incubated with 2 µl of lectin NPn-FITC or GSLII-FITC (2mg/ml) for 30min at 4°C. After adjustment to 400 µl with PBS containing 0.02 µg PI, the fluorescence was measured by flow cytometry. PI was added to exclude necrotic cells.

34 2 Materials & Methods

Cell staining with lectin-Fc fusion proteins (CLEC9A/DNGR1, CLEC7A/Dectin-1) To test the binding of the lectin Fc-fusion proteins (mCLEC7A/Dectin-1, mCLEC9A/DNGR1, and hCLEC9A/DNGR1) to viable, heat-necrotized, apoptotic or secondary necrotic PMN and/or PBL, cells were pelleted and resuspended in medium or PBS containing 5 % heat-inactivated rabbit serum at a concentration of 107 cells/ml in a final volume of 100 µl. After 30 min incubation at 4 °C the cells were washed and incubated with 5 µg Fc-protein/ml in medium or PBS for another 30 min at 4 °C. After washing FITC- (or PE-) conjugated goat anti-human IgG, F(ab')2 fragment specific antibody (dilution 1:100, Jackson ImmunoResearch Laboratories) was added for 30 min at 4 °C. After further washing the cells were resuspended in PI- containing PBS and were analysed by flow cytometry. All staining steps were performed in the presence of 5 % heat-inactivated rabbit serum.

Cell staining with lectin-Fc fusion protein hCLEC9A/DNGR1 after various pre- treatments to dermine the ligand of hCLEC9A/DNGR1 Differently treated PMN were stained according to the protocol described above (‘Cell staining with lectin-Fc fusion proteins’). For lysis, cells were fixed and permeabilized with Perm Fix/Perm Wash (BD Bioscience) according to the manufactures instructions or necrotized by heat for 30min at 58°C. Pre-incubations of hCLEC9A/DNGR1 with herring sperm DNA (20 and 100 µg/ml), nucleosomes, prepared from viable or apoptotic Jurkat cells (20 and 60 µg/ml; preparation, see section 2.2.1), and glycerophosphocholine (GPC, 100 µg/ml) before staining of apoptotic PMN (aged in vitro for 24h) were done to reveal the ligand of CLEC9A/DNGR1. Additionally, apoptotic PMN were pretreated with nuclease S7

(100 U), Benzonase (25 U), DNase I (25 U) plus 5 mM MgCl2 / CaCl2 or 5 mM MgCl2

/ CaCl2 for 15 min at 37 °C prior staining with hCLEC9A/DNGR1.

Cell staining with lectin-Fc fusion protein hCLEC9A/DNGR1 to test membrane integrity of viable, dead and dying cells by flow cytometry Viable or in vitro aged PMN and viable or UV-B irradiated apoptotic PBL were pelleted and incubated in medium containing 5 % heat-inactivated rabbit serum at a concentration of 107 cells/ml for 30 min in ice-cold water. Then 5 µg Fc- hCLEC9A/DNGR1/ml and FITC-conjugated goat anti-human IgG, F(ab')2 fragment specific antibody (dilution 1:100, Jackson ImmunoResearch Laboratories) were

35 2 Materials & Methods added, followed by incubation for another 30 min in ice-cold water. The labelled cells were then fixed with PBS/PFA at final concentration of 2 % for 30 min in ice-cold water. These cells were then splitted into halfs with one half being heat-necrotized at 58 °C for 30 min. The cells were then splitted again into thirds with one third left without treatment, one third added with PI (endconcentration 0,132µg PI/ 200,000 cells/400 µl), and one third added with Trypan Blue (endconcentration 0.01 % Trypan Blue/ 200,000 cells/400 µl). All staining steps were performed in ice- cold water. After incubation of at least 5 min the Trypan Blue samples were washed with PBS. Finally all samples were filled up to 600 µl with PBS/ 1 % PFA and analysed by flow cytometry.

Cell staining with lectin-Fc fusion protein hCLEC9A/DNGR1 to test membrane integrity of apoptotic PMN by flow cytometry and by means of in situ heating Apoptotic PMN with hCLEC9A/DNGR1 was performed as described above. However, after fixing the cells with PBS/PFA at final concentration of 2 % for 30 min at 4 °C PI-containing culture medium (endconcentration 0,66 µg PI/ 106 cells/2.5 ml) was added and the cells directly heated in the flow cytometer with the help of an infrared lamp. The temperature at the site of the reaction was checked using an infrared thermometer. The temperature ranged from 25 °C till 90 °C. The increase in PI MFI of the CLEC9A/DNGR1 positive PMN population was monitored.

Cell staining with lectin-Fc fusion protein hCLEC9A/DNGR1 to test membrane integrity of apoptotic PMN by confocal microscopy Apoptotic PMN were pelleted and blocked in medium containing 5 % heat-inactivated rabbit serum at a concentration of 107 cells/ml for 30 min in ice-cold water. Unlabeled cells were fixed with PBS/PFA at final concentration of 2 % for 30 min in ice-cold water. These cells were then splitted into halfs with one half being heat-necrotized at 58 °C for 30 min. Then 5 µg Fc-hCLEC9A/DNGR1 / ml and FITC-conjugated goat anti-human IgG, F(ab')2 fragment specific antibody (dilution 1:100, Jackson ImmunoResearch Laboratories) were added, followed by incubation for another 30 min in ice-cold water. PBS/ 1 % PFA was added, 300 µl cells of each condition transferred into one well of a Lab-Tek™ 8-Chambered Coverglass (Thermo Scientific Nunc) with addition of 75 µl Immunoselect Antifading Mounting Medium (Dianova) and analysed by confocal microscopy.

36 2 Materials & Methods

Cell staining with Calcein-AM to test membrane integrity of apoptotic PMN by flow cytometry Freshly isolated PMN were stained with 1 µM Calcein-AM (Sigma-Aldrich) in PBS for 20 min at 37 °C. After washing with serum containing medium cells were reconstituted in culture medium and incubated in a humidified atmosphere with 5 %

CO2 at 37 °C to undergo apoptosis by ageing. The next day 24 h-aged Calcein-AM- stained PMN were pelleted and blocked in medium containing 5 % heat-inactivated rabbit serum at a concentration of 107 cells/ ml for 30 min in ice-cold water. The cells were then fixed with PBS/PFA at final concentration of 2 % for 30 min in ice-cold water. These cells were then splitted into halfs with one half being heat-necrotized at 58 °C for 30 min. Afterwards 200,000 cells were transferred into FACS tubes, filled up to 600 µl with PBS/ 1 % PFA and analysed by flow cytometry.

2.2.5 Phagocytosis Assays

Raji and Raji-CLEC4L/DC-SIGN co-incubation with PMN Vybrant DiI-labelled Raji and Raji-CLEC4L/DC-SIGN cells (staining, see section 2.2.3) were co-incubated with CFDA-SE-labelled human PMN (staining, see section 2.2.3) for up to 29 h in the absence and presence of CLEC4L/DC-SIGN specific inhibitor mannan (at a final concentration of 100 µg/ml). Before co-incubation Raji and Raji-CLEC4L/DC-SIGN cells were pre-incubated with mannan for 30 min. The Raji-PMN-mixes were then incubated in 48-well plates with a final volume of 750 µl/well. At definite time points the wells were resuspended, 100 µl sample harvested, PBS added and analysed by flow cytometry to monitor the change in MFI of the Raji and PMN cell population. Additionally the samples were harvested and transferred into Lab-Tek™ Chambered Coverglasses (Thermo Scientific Nunc) for analysis by fluorescence microscopy.

Raji and Raji-CLEC4L/DC-SIGN co-incubation with blebs Raji and Raji-CLEC4L/DC-SIGN were co-incubated with CFDA-SE-labelled apoptotic blebs (see 2.2.1, bleb-isolation method (I or II); 2.2.3) for up to 24 h in the absence or presence of CLEC4L/DC-SIGN specific inhibitor mannan (at a final concentration of 100 µg/ml). Before co-incubation Raji and Raji-CLEC4L/DC-SIGN cells were pre- incubated with mannan for 30 min. The Raji-apoptotic blebs mixes were incubated in FACS tubes in a final volume of 400 µl/ tube in a humidified atmosphere with 5 % 37 2 Materials & Methods

CO2 at 37 °C. At definite time points the samples were analysed by flow cytometry to monitor the increase in FITC MFI of the Raji cell population. For analysis by confocal microscopy Raji and Raji-CLEC4L/DC-SIGN were co-incubated with CFDA-SE- labelled apoptotic blebs (see 2.2.1, bleb-isolation method (I); 2.2.3) for 24 h in Lab- Tek™ Chambered Coverglasses (Thermo Scientific Nunc) in a humidified atmosphere with 5 % CO2 at 37 °C. Shortly before confocal microscopy analysis Raji and Raji-CLEC4L/DC-SIGN were labelled with CD19-PE.

RAW and RAW-CLEC7A/Dectin-1 co-incubation with necrotic and secondary necrotic cells RAW pFB and RAW-CLEC7A/Dectin-1 were co-incubated with PI-labelled primary or secondary necrotic PMN for up to 24 h in the absence and presence of CLEC7A/Dectin-1 specific inhibitor laminarin (at a final concentration of 100 µg/ml) or CLEC4L/DC-SIGN specific inhibitor mannan (at a final concentration of 100 µg/ml). The adherent RAW pFB and RAW-CLEC7A/Dectin-1 cells were detached the day before and cultured overnight in a loosely closed 50-ml Cellstar PP-tubes in a humidified atmosphere with 5 % CO2 at 37 °C. After a cell status check by flow cytometry of RAW macrophages, primary as well as secondary necrotic prey cells the next day, the phagocytes and prey cells were mixed at a ratio of 1:3 and co- incubated in FACS tubes in a final volume of 400 µl/ tube in a humidified atmosphere with 5 % CO2 at 37 °C. RAW pFB and RAW-CLEC7A/Dectin-1 were pre-incubated with the laminarin or mannan 30 min before co-incubation with prey cells in case of inhibitors present. At definite time points the samples were analysed by flow cytometry to monitor the increase in PI MFI of the RAW cell population. All data sets acquired here were monoplicates. At least three data sets of the same condition were grouped and used for statistical analysis.

2.2.6 In vitro cytokine release assays

Thioglycollate-elicited peritoneal macrophages co-incubated with dead and dying human PMN Thioglycollate-elicited peritoneal macrophages from SV129 WT and SV129 CLEC7A/Dectin-1 KO mice were isolated (see section 2.2.1), plated in a 24-well plate overnight in a humidified atmosphere with 5 % CO2 at 37 °C, washed four times the next day and were then co-incubated with 24h aged or 24h aged and heat- 38 2 Materials & Methods necrotized (secondary necrotic) human PMN at a ratio of 1:4 in the absence or presence of 10 ng/ml LPS for 16 h. This experiment was done once with n = 5. The supernatants were harvested after centrifugation of the plates and stored at -80 °C for later cytokine determination (see section 2.2.9).

BMDDC co-incubated with dead and dying human PMN BMDDC from SV129 WT and CLEC7A/Dectin-1 KO mice were generated (see section 2.2.1) and plated at day9 in a 48-well plate. 24 h aged or 24 h aged and heat-necrotized (secondary necrotic) human PMN were then added to BMDDC at a ratio of 4:1 in the absence or presence of 10ng/ml LPS and GM-CSF. After co- incubation for 21 h the supernatants were harvested after centrifugation of the plates. This experiment was done once with n = 4. The supernatants were stored at -80 °C for later cytokine determination (see section 2.2.9).

2.2.7 Immunization experiments

Mice and cells Female and male 6-9 weeks old SV129 (WT) or SV129 CLEC7A−/− (CLEC7A/Dectin-1 KO) mice were immunized with viable, heat-necrotized, aged (apoptotic) human polymorphonuclear cells (PMN) (8 mice per group) and Ringer’s solution as control (5 mice per group). For the injection into the peritoneum 1.5 x 106 PMN were suspended in 500 μl Ringer’s solution. Mice were immunized three times, one immunization and 2 boosts, 2 weeks apart. Blood for cytokine production analysis was drawn before immunization, before the second boost and at the end of the experiment (2 weeks after the second boost).

DTH reaction The delayed type hypersensitivity (DTH) test was carried out 14 days after second booster immunization. Five million viable PMN, resuspended in 50 μl Ringer’s solution, were injected subcutaneously into the left hind paw and 50 µl Ringer’s solution-injection as control into the right hind paw of the mice. The diameter of the paw before and 24 h after the injections was measured with a caliper (B110T, Kroeplin GmbH). The paw swelling was calculated by: (diameter of the foot 24h after the injection – diameter of the footpad before the injection) / (diameter of the footpad before the injection) x 100. The relative % 39 2 Materials & Methods swelling (percent swelling of the PMN-injected paw minus percent swelling of the Ringer-injected paw) was finally analysed.

Spleen removal After reading the DTH-reaction the mice were sacrificed by exposing them to carbon dioxide. Blood was collected by cardiac puncture and the serum obtained was stored at -80 °C until further examination. The spleens, cutted into thirds, were collected. From one third of the spleen the splenocytes were isolated for the MLR (splenocytes versus human PMN). The other two thirds were snap frozen in liquid nitrogen, then stored at -80 °C and used later for RNA isolation.

MLR Spleen preparation: One third of each spleen was stored on ice until further preparation. The spleens were then put on a 70 µm cell strainer placed on a 50 ml cellstar PP-tube. The spleen was wetted with medium, pressed through the cell strainer using the rubber tip of a syringe plunger and rinsed afterwards with medium. After centrifugation for 10min at 300xg at 4°C erylysis was performed by resuspending the pellet in 5 ml red blood cell (RBC) lysis buffer (0,15 M NH4Cl, 20 mM HEPES) for a maximum of 5 min at room temperature. After addition of 5 ml medium and centrifugation for 10 min at 300 x g at 4 °C the pellet was reconstituted in 5 ml medium and the splenocyte count determined using the Z2™ COULTER COUNTER®, Analyzer (Beckman Coulter). The cell suspensions were adjusted to a concentration of 106 splenocytes/ml medium and were stored on ice until further use.

The mixed lymphocyte reaction (MLR) was conducted by culturing 105 splenocytes together with 0.5 x 105 or 0.25 x 105 apoptotic PMN in a final volume of 200 µl/well in round-bottom 96-well-plates. Spleen cells alone served as control. Cells were co- cultured for 72 h and pulsed with 1µCi [3H]thymidine per well (Amersham Biosciences) during the final 16-18 h of culture. Incorporation of [3H]thymidine was measured on a 1205 Wallac Beta counter (Wallac/Pharmacia).

40 2 Materials & Methods

2.2.8 Antibody determination

ELISA for detection of anti-human PMN autoantibodies (mIgG) To detect the presence of autoantibodies and quantitate their levels home made ELISA tests were performed. In detail, the surface of Maxisorb immunoplates (Nalgene Nunc) were coated with 1 µg PMN lysate/well at a concentration of

10 µg/ml diluted in coating buffer (0,1 M Na2CO3 and 0,1 M NaHCO3 in Millipore water). The solution was incubated at 4 °C overnight. After three washing steps with ELISA wash buffer (PBS/0.05% TWEEN®20) the plates were blocked with 1 % BSA in PBS at room temperature for 2 h with 200µl/well. After thorough washes mice sera diluted in ELISA buffer (PBS/1 % BSA, 0.05 % TWEEN®20) were incubated for 3 h at room temperature with 100 µl/well. Thereafter, the plates were washed thouroughly and 100 µl horseradish peroxidase-labelled anti-mouse IgG Fab-fragment (Southern Biotech, Birmingham, Alabama, USA) at a dilution of 1:50,000 in ELISA buffer was added and incubated at room temperature for 1 h. After washing, 100 µl 3,3′,5,5′- Tetramethylbenzidine-substrate (1 ml TMB-Stock-solution (0.01 g TMB/ 10 ml

DMSO) + 9 ml substrate buffer (0.1 M Na2HPO4, 0.05 M citric acid; ph 4.5-5.5) + 2 µl

30 %-H2O2) was added and the enzymatic reaction stopped with 25 % H2SO4 after 20 min incubation at room temperature, carefully protected from daylight. All sera were routinely tested in triplicates. Optical density (OD) was measured at 450 nm and also at 650 nm as correction factor using Spectra MAX 190 plate reader. Sera were analyzed at the dilution of 1:800.

PMN lysate preparation A pellet of 50mio PMN was resuspended in 1 ml RIPA buffer (50 mM Tris pH8, 150 mM NaCl, 0.5 % Deoxycholate, 1 % NP40, 1 SDS with freshly added protease inhibitors at different dilutions: HALT 1:100 (Thermo Fisher Scientific); PMSF 1:100 (Calbiochem); NaF 1:1,000 (Sigma-Aldrich); Sodium Orthovanadate 1:1,000 (Merck); ß-Glycerol 1:1,000 (Sigma-Aldrich)). The cell suspension was kept on ice for 30 min. During incubation the cells were frequently vortexed vigorously. After centrifugation at 14,000 rpm for 15 min at 4 °C (Eppendorf centrifuge 5417R) the supernatant, containing the PMN lysate, was taken off and stored in aliquots at -80 °C until further use. The protein concentration was determined using the BCA Protein Assay Kit (Thermo Fisher Scientific) according to the manufacturer’s instructions using the HTS 7000 Microplate Reader (Perkin Elmer, Waltham, MA, USA).

41 2 Materials & Methods

2.2.9 Cytokine determination

Cytokine determination in the spleen using real-time qRT-PCR analysis The measurement of splenocyte cytokine mRNA expression levels was performed by SYBR green real-time qRT-PCR analysis using the ABI Prism 7000 Sequence Detection System (Applied Biosystems, Foster City, CA) and qPCR Mastermix (Fermentas). Primers were designed to generate amplicons spanning exon-exon junctions to avoid genomic DNA amplification and were synthesized by Sigma- Aldrich. The following primers were used: mIL-2 forward 5'CCCAGGATGCTCACCTTCAA3' reverse 5'ATGCCGCAGAGGTCCAAGT3’, mIL-6 forward 5'TTACACATGTTCTCTGGGAAATCGT3' reverse 5'AAGTGCATCATCGTTGTTCATACAA3’, mIL-10 forward 5'GAAGACCCTCAGGATGCGG3' reverse 5'ACCTGCTCCACTGCCTTGC3’, mIL-12p35 forward 5'GGTGTCTTAGCCAGTCCCGA3' reverse 5'GATCGATGTCTTCAGCAGTGCA3’, mIL-12p40 forward 5'CCAAATTACTCCGGACGGTTC3' reverse 5’GACGCCATTCCACATGTCACT3’, mIL-17A forward 5’CTGATCAGGACGCGCAAAC3' reverse 5’GGACACGCTGAGCTTTGAGG 3’, mIL-17F forward 5’ATGAAGTGCACCCGTGAAACA3' reverse 5’CTACCTCCCTCAGAATGGCAAGT3’, mIL-23p19 forward 5’GTTGTGACCCACAAGGACTCAAG3' reverse 5’AGATGTCAGAGTCAAGCAGGTGC3’, mTNFα forward 5’GCCACCACGCTCTTCTGTCTAC3' reverse 5’TGTGAGGGTCTGGGCCATAG3’, mIFNγ forward 5’TCTGGCTGTTACTGCCACGG3' reverse 5’TGCCAGTTCCTCCAGATATCCA3’.

50 - 100 mg of each spleen has been added to 1 ml TRIzol Reagent (Invitrogen) and homogenized using an Ultra-Turrax power homogenizer. Total RNA was extracted according to the manufacturer’s instructions. RNA concentration was measured before genomic DNA was digested with DNAse I (Invitrogen). Then, 1.5 µg of total

42 2 Materials & Methods

RNA were reversely transcribed with 200 U Revert Aid H Minus Reverse transcriptase (Fermentas) in the presence of 50 µM random hexamers (Fermentas), 400 µM dNTPs (Fermentas), and 1.6 U/µl Ribolock RNase Inhibitor (Fermentas) in of a final volume of 25 µL. Thirty to 50 ng of the resulting cDNA were applied to the following qRT-PCR analyzes (20 µL final volume) with 300 nM primers in 1x qPCR Mastermix (Fermentas) and amplified with the standard temperature profile [2 min 50 °C, 10 min 95 °C, 40x (15 s 95 °C, 1 min 60 °C)]. Relative quantification was performed using the standard curve method. The results for target were normalized on 18S rRNA as endogenous control, and the mean values of the Ringer-injected population were set as calibrator. The qRT-PCR analysis was done in co-operation with Prof. Dr. Kirsten Lauber, Munich.

Cytokine determination in serum or supernatants by flow cytometry analysis Cytokines in serum or supernatant were measured with the Mouse Th1/Th2 10plex FlowCytomix Multiplex Kit (Bender MedSystems GmbH) according to the manufacturer’s instructions using flow cytometer EPICS XL-MCL (Beckman Coulter, Hialeah, FL, USA). Different from the manual, mini FACS tubes were used and thus reduced amounts of reagents were required as follows: The beads were diluted 1:33 in Assay Buffer, the biotin conjugate was diluted 1:16.5 in Assay Buffer and thereafter 10 µl of each dilution was mixed with 25 µl sample (e.g. serum, supernatant or standard mix). The secondary antibody Strepavidin-PE was used at a dilution of 1:30 and 10 µl of this dilution was given to 100 µl sample. The volume in the mini FACS tube used for measurement was about 300 µl. The incubation times and washing steps were kept unchanged according to the manufacturer’s instructions.

2.2.10 Flow cytometry analyses

Analyses by flow cytometry were performed using Flow cytometer EPICS XL-MCL (Beckman Coulter) or FACSCalibur Benchtop Cytometry Analyser (BD Biosciences). Data analyses were performed with Coulter XL™ software, version 3 or FlowJo software, version 7.5 and WinMDI software, version 2.9, respectively. Fluorescence signals were determined using appropriate electronic compensation to exclude emission spectra overlap.

43 2 Materials & Methods

2.2.11 Microscopy anaylses

Light and fluorescence microscopy was performed on an Olympus IX70 Inverted Microscope (Olympus, Hamburg, Germany). Confocal microscopy was performed on a Leica TCS SP5 (Leica Microsystems, Mannheim, Germany) microscope or on a Perkin-Elmer Ultra-View spinning disc confocal on Nikon TE2000-E inverted microscope (Nikon GmbH, Düsseldorf, Germany; excitation at 488, 568, 647 nm, detection at 650 nm, shown red and 488 nm, shown green) in co-operation with Dr. Martin Schiller, Petra Heyder, and Marijo Parcina in Heidelberg.

2.2.12 Statistical analyses

All data sets were processed by the Mann-Whitney U Test, Kruskal-Wallis-Test or two-tailed Student's t-test. Results are presented as median or mean ± standard deviation (SD) with * indicating p < 0.05; ** p < 0.01, and *** p < 0.005. The in vivo experiments were done with n = 8 mice per group unless stated otherwise. The in vitro experiments were done at least in triplicates and repeated at least three times unless stated otherwise.

44 3 Results

3 Results

3.1 Cell death is reflected by characteristic morphological changes

Viable, apoptotic, primary necrotic or secondary necrotic cells can be distinguished by flow cytometry analysis. Those cells display different characteristics in cell size, granularity, and cell surface molecule expression analysed by their change in forward scatter (FSc), side scatter (SSc), and Mean Fluorescence Intensitity (MFI) due to surface molecule binding, respectively. Polymorphonuclear cells (PMN) undergo apoptosis spontaneously as soon as isolated from whole blood and held in culture. Apoptosis in peripheral blood lymphocytes (PBL) and lymphoblasts is induced by UV- B irradiation. Since lymphoblasts are generated from PBL over 7 days in the presence of phytohaemagglutinin (PHA) and IL-2 some cells undergo apoptosis already due to activation.

Cell shrinkage and AxV binding are early features in apoptosis Figure 5 displays typical morphological changes after induction of apoptosis and necrosis of PMN, PBL, and lymphoblasts with their subcellular fragments (blebs) employed in the experiments. Viable, early apoptotic non-shrunken, late apoptotic shrunken and primary necrotic cell populations as well as subcellular fragments can be distinguished by change in FSc/SSc (Figure 5a). Dying cells shrink during apoptosis due to the so-called “blebbing”-process. Apoptotic bodies or subcellular fragments (“blebs”) are shed from the plasma membrane during apoptosis. An increase in the amount of blebs is shown for apoptozing lymphoblasts. A change in surface molecule expression is reflected by AnnexinV (AxV) binding to exposed phosphatidylserine (PS) (Figure 5b). Whereas viable cells do not bind AxV, early apoptotic cells are already positive for AxV. Cells which enter later stages of apoptosis and finally progress to secondary necrosis become leaky and positive for the DNA-intercalating cationic dye propidium iodide (PI). Upon heat treatment (30 min at 58 °C) cells become primary necrotic with characteristically decreased FSc and SSc. Primary as well as secondary necrotic cells are double positive for AxV/PI. Compared to PBL and lymphoblasts, only PMN and apoptotic blebs seem to maintain membrane integrity even in late stages of apoptosis reflected by PI negativity.

45 3 Results

a) FSc/SSc analysis b) AxV/PI staining PMN PMN wo 24 h ageing 48 h ageing 30 min 58°C wo 24 h ageing 48 h ageing 30 min 58°C

100 100 100 100 80 80 80 80 s

C l A B C B D l 60 60 60 60 e c

40 40 40 40

% 20 20 20 20 0 0 0 0 A BC BC D 77% 23% 26% 74% PBL PBL wo UV-B, 14 h UV-B, 25 h 30 min 58°C wo UV-B, 14 h UV-B, 25 h 30 min 58°C

100 100 100 100 s

C C l 80 80 80 80 l

e 60 60 60 60 c

D c A B B 40 40 40 40 % S

S 20 20 20 20

g 0 0 0 0 o l A BC BC D 85% 15% 66% 34% FSc

Lymphoblasts including blebs Lymphoblasts including blebs wo 16h 30 min 58°CUV-B, wo UV-B, 16 h 30 min 58°C 100 100 100 C C 80 80 80 60 s 60 60

D l l

B B e 40 40 40 c c

E E E S 20

% 20 20 S

g 0 0 0 o

l E BC EBCED 21% 69% 10% 39% 28% 33% 26% 74% log FSc A (viable) Ax-/PI- (viable) B (non shrunken, early apoptotic) Ax+/PI- (apoptotic) C (shrunken, late apoptotic) Ax+/PI+ (necrotic) D (primary necrotic) E (blebs)

Figure 5: Detection of morphological changes of viable, dying and dead human PMN, PBL and lymphoblasts by flow cytometry analysis a) Cell populations of viable, dying, and dead cells can be distinguished according to different FSc and SSc properties by flow cytometry analysis. Viable cells shown represent freshly isolated cells. Isolated PMN undergo apoptosis spontaneously whereas apoptosis in PBL and lymphoblasts was induced by UV-B irradiation. Primary necrosis was induced by heat (30 min at 58 °C). Population A represent the viable, B non-shrunken early apoptotic, C shrunken apoptotic, and D necrotic cell population. A further population E consists of subcellular fragments (or blebs) of apoptotic lymphoblasts. B) The corresponding vital stainings of the cells with AxV/PI is displayed. The fact that the non-shrunken AxV positive cell population was hardly PI positive compared to the shrunken AxV positive cells leads to a definition of early and late apoptotic cells, respectively.

46 3 Results

3.2 Plant lectin binding

It has been shown, that lectins detect changes of the glycosylation status of plasma membrane constituents during late apoptosis [126]. We analysed the hypothesis that mammalian cells expose neo-epitopes in the late stages of apoptosis, which are recognized by several exogenous lectins. This hypothesis was confirmed using exogenous, non-lytic, FITC-labelled plant lectins derived from Narcissus pseudonarcissus (NPn) and Griffonia simplicifolia (GSL II). There was an increased lectin binding to PMN aged in vitro for 24h as well as to PBL and lymphoblasts irradiated with UV-B in the late apoptosis stage (Figure 6b). There was a similar or even weaker binding of the lectins to the non-shrunken, early apoptotic cells (PI negative) when compared to the viable cell population. Only the shrunken, late apoptotic, PI negative cell population showed an increased FITC MFI which was even enhanced in necrotic, PI positive cells (Figure 6a, b). Cell shrinkage and AxV binding preceded binding by lectins as only the shrunken, late apoptotic cell population displayed increased NPn-FITC and GSLII-FITC MFI compared to the viable cells. The non-shrunken, early apoptotic cell population was already positive for AxV but still only marginally positive for specific plant lectin binding.

47 3 Results

a) FSc/SSc analysis b) NPn and GSLII staining PMN PMN wo 24 h ageing 30 min 58°C NPn GSLII Popu- MFI MFI lation NPn GSLII

A 5,6 4,6 C B 3,4 4,3 A B D C 10,0 12,6 D 70,0 102,0

PBL PBL Popu- MFI MFI wo UV-B, 25 h 30 min 58°C NPn GSLII lation NPn GSLII

C A 7,8 12,7 B 6,7 13,9 D A B C 14,9 21,2

c D 38,0 55,1 t S n S u

o g c o l A (viable) FSc MFI FITC B (non shrunken, early apoptotic) C (shrunken, late apoptotic) D (primary necrotic)

Lymphoblasts including blebs Lymphoblasts including blebs

wo UV-B, 16 h 30 min 58°C NPn GSLIIPopu- MFI MFI lation NPn GSLII C1 C2 B2 13,3 21,1 D C2 28,1 44,1 B1 B2 D 79,3 71,2

c E1 E2 E3 t E2 5,3 6,7 S n S u

o g c o l B2 (non shrunken, early apoptotic) log FSc MFI FITC C2 (shrunken, late apoptotic) D (primary & secondary necrotic)

Figure 6: Detection of cell status by flow cytometry analysis employing non-toxic plant lectins a) Cell populations of viable, apoptotic, and necrotic PMN, PBL, and lymphoblasts are displayed. Population A represents freshly isolated, B early apoptotic, C late apoptotic, and D primary necrotic cells. For lymphoblasts a further population E containing subcellular fragments (blebs) is displayed. b) Mean fluorescence intensities (MFI) of the cells when stained with FITC-labelled plant lectins NPn and GSLII (see histograms and corresponding tables with mean values) are shown. Note: Only PI negative cells were included for analysis of lectin binding to apoptotic cells. Lymphoblasts were generated over 7 days. Note: Activated T cells that were not irradiated with UV-B were in parts already apoptotic due to activation. NPn and GSLII binding analysis was done for UV-B irradiated lymphoblasts since apoptosis rate was increased in the latter.

In Figure 7 the differences in FITC MFI after NPn and GSLII binding to viable, early, and late apoptotic PMN, PBL, and lymphoblasts are displayed. For the comparison only PI negative cells were included. There are hardly any differences between the viable and non-shrunken early apoptotic cell populations. Lectin binding to the

48 3 Results shrunken, late apoptotic cell population is significantly increased for all the different cell types.

NPn GSLII *** * *** 14 ** 14 *** 12 12 C

T 10 10 I

F 8 8

I

PMN F 6 6 (culture, 24 h) M 4 4 2 2 0 0 A B C A B CCAB * ** ** 25 **25 ** 20 20 C T

I 15 15 F

PBL I 10 10 (UV B, 25 h) F M 5 5 0 0 A B C A B CCAB

50 * 50 ** 40 40 C T

I 30 30

Lymphoblasts F

I 20 20 (UV B, 16 h) F M 10 10 0 0 BCBC

A viable (freshly isolated) B non shrunken, early apoptotic C shrunken, late apoptotic

Figure 7: Increased NPn and GSLII plant lectin binding to late apoptotic PMN, PBL, and lymphoblasts The change in MFI after plant lectin binding of NPn-FITC and GSLII-FITC to viable; non-shrunken early apoptotic, and shrunken late apoptotic PMN (aged in culture), PBL, and lymphoblasts (both: UV- B irradiated) was compared. Only cells that excluded PI were analysed. (Mean ± SD. * p < 0.05; ** p < 0.01; *** p < 0.001 using the Student's t-test.)

These changes in the glycosylation patterns of cells during the stages of early and of late apoptosis emphasize an investigation of their binding by surface lectins which are to be found on immunologic important cells such as DC. Within this thesis we focused on the C-type lectins CLEC9A/DNGR1, CLEC4L/DC-SIGN and CLEC7A/Dectin-1, which are expressed on phagocytes of the innate immune system.

49 3 Results

3.3 C-type lectin CLEC9A/DNGR1

As seen in Figure 5b a great fraction of the shrunken, late apoptotic cell population of PBL and lymphoblasts was positive for PI and thus necrotic. Early apoptosis is the stage of death where cells have maintained membrane integrity. Therefore, to investigate this phase of apoptois, cells should be selected which have maintained their membrane integrities, reflected by PI exclusion. PMN seem to be ideal cells for this purpose, since even late apoptotic cells remain negative for PI (Figure 5b). Employing the C-type lectin CLEC9A/DNGR1, we analysed the hypothesis that C- type lectin CLEC9A/DNGR1 binds to ligands exposed on the surface of late apoptotic cells.

CLEC9A/DNGR1 does not bind viable or early apoptotic, but late apoptotic cells The CLEC9A/DNGR1 binding to viable, dead, and dying PMN and PBL was investigated using an hCLEC9A/DNGR1-Fc fusion protein. In all experiments done only the shrunken, late apoptotic PMN population was positive for CLEC9A/DNGR1 (Figure 8). Viable and non-shrunken, early apoptotic PMN did not bind CLEC9A/DNGR1. In the case of apoptosing PBL CLEC9A/DNGR1 exclusively bound PBL that already had undergone secondary necrosis and showed up in the analysis as cells double positive for CLEC9A/DNGR1 and PI (Figure 11).

50 3 Results

PMN (aged for 24 h)

BA c S S

g o L FSc Population B Population A (27 % of all cells) (73 % of all cells)

0 0%00% 80,0 %20,0 % 0,5 %99,5 I P

Clec9A-FITC 99 % 38 % t n u o c

AxV-FITC

Figure 8: CLEC9A/DNGR1 binds only to cells of the shrunken, late apoptotic PMN population The FSc/SSc dot plot for aged PMN shows the characteristic two populations: non-shrunken early apoptotic (A), and shrunken late apoptotic (B). These ageing PMN were stained with the C-type lectin CLEC9A/DNGR1-FITC and PI (see dot plots). The histograms of the corresponding AxV-FITC- stainings are presented underneath.

CLEC9A/DNGR1 binds shrunken apoptotic PMN with very low PI stainability PI is used to determine the integrity of the cytoplasmic membranes. This cationic dye only enters perforated or necrotized cells where it intercalates the DNA resulting in a prominent hyperchrome shift of its fluorescence. The latter can be analysed by fluorescence microscopy or flow cytometry. The binding of CLEC9A/DNGR1 to PMN was investigated in detail, since all published data on CLEC9A/DNGR1-binding to mammalian cells argue for the fact that CLEC9A/DNGR1 exclusively binds to cells that are already permeable for PI and must thus be considered necrotic. We analysed the CLEC9A/DNGR1-binding to ageing, apoptotic PMN since these cells often show morphologically deviant execution of apoptosis. Our data indicate that a shrunken, late apoptotic PMN

51 3 Results population binds CLEC9A/DNGR1 although these cells had preserved their membrane integrities. In none of our experiments CLEC9A/DNGR1 bound viable or non-shrunken, early apoptotic cells. Instead all CLEC9A/DNGR1 positive cells were shrunken. Among these, PI positive and negative populations could be discriminated by flow cytometry analyses. Freshly isolated PMN showed a very low PI signal (1) and no CLEC9A/DNGR1 binding (Figure 9). When the freshly isolated, CLEC9A/DNGR1- stained PMN got fixed and heat-necrotized (30 min at 58 °C) the PI signal increased strongly (4). PMN in vitro aged for 24 h consisted of three PMN populations. There was a CLEC9A/DNGR1 negative population (A) with a very low PI signal (1), a CLEC9A/DNGR1 positive population (B) with a low PI signal (2) and CLEC9A/DNGR1 negative cells (C) with an intermediate PI signal (3) (Figure 9).

To our knowledge all to this day published CLEC9A/DNGR1-stained cells show a high PI fluorescence and must, therefore, be considered necrotic. CLEC9A/DNGR1 binding to non-PMN cells confirms the published data. Only those UV-B irradiated PBL were positive for CLEC9A/DNGR1 that already displayed a high PI signal indicating secondary necrosis (Figure 11). Since, CLEC9A/DNGR1-bound PMN showed a low PI sinal, we hypothesize, that PMN in contrast to other mammalian cells expose the CLEC9A/DNGR1-ligand already at late stages of apoptosis before entering secondary necrosis. A careful investigation of the CLEC9A/DNGR1-binding PMN population was necessary to clarify whether the cells of the shrunken late apoptotic PMN population really have maintained their membrane integrities. To this end aged PMN that had been stained with CLEC9A/DNGR1-FITC, were fixed with PFA and were subjected to heat treatment to investigate if the (low) PI signal of the CLEC9A/DNGR1 positive cells is further increased by this procedure which permeabilizes the plasma membrane. Aged, fixed, CLEC9A/DNGR1 negative PMN that had been heat-necrotized showed a high PI signal (3-4). In contrast, aged, fixed, CLEC9A/DNGR1 positive PMN that had been heat-necrotized showed only a marginally increased PI signal (2*) (Figure 9).

52 Freshly isolated PMN Freshly isolated PMN PMN aged for 24h PMN aged for 24h Stained with CLEC9A Stained with CLEC9A Stained with CLEC9A Stained with CLEC9A w/o heat treatment 30 min, 58°C w/o heat treatment 30 min, 58°C Viable PMN Primary necrotic PMN Apoptotic PMN Secondary necrotic PMN

4 3 C 2 B

A 1

4 MFI PI 22 I

P 3-4 MFI PI 15 3 MFI PI 8,4 2* MFI PI 1,8 CLEC9A-FITC 2 MFI PI 1,6 1 MFI PI 0,2

Figure 9: Aged and necrotized CLEC9A/DNGR1-binding PMN show a low PI signal The CLEC9A/DNGR1-FITC/PI staining of freshly isolated; freshly isolated and heat-necrotized (30 min at 58 °C); 24 h aged; 24 h aged and heat-necrotized PMN is presented in dot plots. After CLEC9A/DNGR1-FITC staining, the cells were fixed with PFA before further treatments. Before measurement PI was added to the samples. The MFI PI signals of the different observed PMN populations are displayed. There was a CLEC9A negative population (A) with a very low PI signal (1), a CLEC9A positive population (B) with a low PI signal (2) and CLEC9A negative cells (C) with an intermediate PI signal (3). PI signal (4) belongs to the primary necrotic PMN population that was stained with CLEC9A/DNGR1-FITC after isolation and before heat treatment. MFI (2*) marks a marginal increase of the PI signal of the aged CLEC9A positive population after heat treatment. PI signal (3-4) results from CLEC9A negative, secondary necrotic PMN. 5 3 3 Results

We now heated aged, fixed CLEC9A/DNGR1-stained PMN in situ during measurement in the flow cytometer using an infrared lamp. We observed a slight increase of the PI signal in CLEC9A/DNGR1 positive cells whereas CLEC9A/DNGR1 negative PMN showed a robust PI signal (Figure 10). The CLEC9A/DNGR1 positive aged PMN population displayed a low PI signal compared to all published CLEC9A/DNGR1-binding cells. This usually indicates intact membranes. However, there was only a marginal increase after induction of heat necrosis.

128 CLEC9A negative PMN

64

I CLEC9A positive PMN P 32

I F M

16 g o l 8

4

2 15 30 45 60 time (min)

25 70 8090 °C

Figure 10: In situ heated CLEC9A/DNGR1 positive cells slightly increase their PI signal Aged, fixed CLEC9A/DNGR1-stained PMN were heated in situ during measurement in the flow cytometer using an infrared lamp in the presence of PI. The increasing PI MFI signals of the CLEC9A/DNGR1 positive and negative PMN populations with the corresponding time and temperature scales are presented.

UV-B irradiated, CLEC9A/DNGR1 positive, fixed PBL showed the same high PI signal before and after heat treatment (Figure 11). The CLEC9A/DNGR1 positive aged PMN population contains only traces of stainable DNA and PI staining does not allow the clear answer whether these cells have maintained their membrane integrity. Thus PI-staining was not the appropriate method to investigate secondary necrosis of PMN.

54 3 Results

PBL UV-B, 17h UV-B, 17h + 30 min at 58°C I P

CLEC9A-FITC

Figure 11: CLEC9A/DNGR1 binding PBL show a high PI signal Isolated PBL were irradiated with UV-B. After 17 h the cells were stained with CLEC9A/DNGR1-FITC, got fixed with PFA and heat-necrotized (30 min at 58 °C) or were left untreated. After addition of PI the cells were analysed by flow cytometry. The CLEC9A/DNGR1 / PI dot plots are presented.

CLEC9A/DNGR1-bound shrunken apoptotic PMN show an increase in Trypan Blue signal after induction of necrosis From the above mentioned paragraph we conclude that a further vital stain has to be employed to clarify the condition of the plasma membrane of the CLEC9A/DNGR1 positive late apoptotic PMN. Ideally this stain should be independent from nucleic acids. A common method to distinguish dye permeable and impermeable cells is staining with the dicisive dye Trypan blue. It is a vital stain that is usually used in light microscopy where it selectively identifies necrotic cells. We employed Trypan blue as a cytoplasm stain for the analysis by flow cytometry. Trypan blue is nucleic acid independent and seems, therefore, suitable to answer the question whether CLEC9A/DNGR1 positive shrunken PMN are already necrotic. Freshly isolated PMN showed a very low Trypan Blue signal (1) and no CLEC9A/DNGR1 binding (Figure 12). When the freshly isolated, CLEC9A/DNGR1- stained PMN got fixed and heat-necrotized (30 min at 58 °C) the Trypan Blue signal increased strongly (4). PMN in vitro aged for 24 h consisted of three PMN populations. There was a CLEC9A/DNGR1 negative population (A) with a very low Trypan Blue signal (1), a CLEC9A/DNGR1 positive population (B) with a low Trypan Blue signal (2) and CLEC9A/DNGR1 negative cells (C) with an intermediate Trypan Blue signal (3). Aged, fixed, CLEC9A/DNGR1 negative PMN that had been heat- necrotized after CLEC9A/DNGR1 staining displayed the same high Trypan Blue signal (4) like primary necrotic PMN. Aged, fixed, CLEC9A/DNGR1 positve PMN that had been heat-necrotized showed a doubling of their Trypan Blue signals (23*). 55 Freshly isolated PMN Freshly isolated PMN PMN aged for 24h PMN aged for 24h Stained with CLEC9A Stained with CLEC9A Stained with CLEC9A Stained with CLEC9A w/o heat treatment 30 min, 58°C w/o heat treatment 30 min 58°C Viable PMN Primary necrotic PMN Apoptotic PMN Secondary necrotic PMN

4 3 C 2 B

A 1

n 4 MFI TB 21/20 a e u p

l 3 MFI TB 8,1 y r B

T 3* MFI TB 7,8 2 MFI TB 3,7 CLEC9A-FITC 1 MFI TB 0,2

Figure 12: CLEC9A/DNGR1-bound shrunken apoptotic PMN show an increase in Trypan Blue signal after induction of necrosis Trypan Blue (TB) was employed for staining, since this stain is independent from nucleic acids. Freshly isolated or in vitro aged, CLEC9A/DNGR1-stained PMN got fixed, were heat-necrotized (30 min at 58 °C) or were left untreated. Finally, Trypan Blue was added and the cells were analysed by flow cytometry. The CLEC9A/DNGR1 / Trypan Blue dot plots and the Trypan Blue MFI of different observed PMN populations are displayed. Aged, CLEC9A/DNGR1-stained PMN consisted of a CLEC9A/DNGR1 negative population (A) with a very low Trypan Blue signal (1), a CLEC9A/DNGR1 positive population (B) with a low Trypan Blue signal (2) and CLEC9A/DNGR1 negative cells (C) with an intermediate Trypan Blue signal (3). Trypan Blue signal (4) belongs to the primary necrotic PMN population (stained with CLEC9A/DNGR1 after isolation and before heat treatment) and to the secondary necrotic PMN population. MFI (3*) marks a doubling of 5

6 the Trypan Blue signal of the aged CLEC9A/DNGR1 positive population after heat treatment. 3 Results

We conclude that the CLEC9A/DNGR1 positve PMN can be heat-necrotized arguing for the functional ion impermeability of this population before heat treatment and consider this data as a first hint for our hypothesis that PMN expose CLEC9A/DNGR1 ligands before undergoing secondary necrosis.

The cells of the shrunken, late apopotitc, Calcein-AM-stained PMN population lose Calcein after induction of secondary necrosis A further staining independent from nucleic acids had been employed to confirm our hypothesis. Calcein-AM is a non-fluorescent, hydrophobic compound that easily permeates viable cells. The hydrolysis of Calcein-AM by intracellular esterases produces Calcein, a hydrophilic, strongly fluorescent compound that is well-retained in the cell’s cytoplasm. We argued that apoptotic PMN should still lose Calcein after heat treatment if they have maintained membrane integrity during ageing. As seen in Figure 13 the aged shrunken Calcein-stained, fixed PMN population still lost Calcein during heat treatment. This data confirms our hypothesis that some of the CLEC9A/DNGR1-binding PMN have still mainted membrane-integrity.

+ heat treatment w/o heat treatment t n u o c

Calcein-FITC

Figure 13: The cells of the shrunken, late apopotitc, Calcein-AM-stained PMN population lose Calcein after induction of secondary necrosis Calcein-AM as further staining independent from nucleic acids had been employed. Freshly isolated PMN were stained with Calcein-AM and incubated overnight. After 24 h in vitro ageing the cells got fixed and heat-necrotized (30 min at 58 °C). The Calcein-FITC MFI of the shrunken PMN population before and after heat treatment is displayed in the histogram above.

57 3 Results

Late apoptotic, CLEC9A/DNGR1 positive PMN have maintained membrane integrity All the data acquired so far seem to point out that some shrunken, late apoptotic CLEC9A/DNGR1 positive PMN have maintained membrane integrity during in vitro ageing. To confirm this, we employed confocal microscopy. In the first experiment in vitro aged PMN were stained with CLEC9A/DNGR1-FITC, fixed with PFA and PI was added. The confocal microscopy analyses (Figure 14) revealed a ring-shaped, membrane staining of aged PMN that did not contain PI. There were a few cells that were positive for PI only and one single cell that was double positive for PI and CLEC9A/DNGR1.

TM CLEC9A-FITC PI CLEC9A-FITC/PI merge

Figure 14: CLEC9A/DNGR1 positive cells show a surface binding to aged PMN Aged, CLEC9A/DNGR1-FITC-stained PMN got fixed and were analysed by confocal microscopy after addition of PI. Transmission microscopy (TM) and confocal microscopy pictures are presented.

To clarify whether these cells were still membrane intact necrosis by heat was induced. To this end, aged PMN were fixed, subjected to heat treatment or left without treatment, stained with CLEC9A/DNGR1-FITC and analysed by confocal microscopy. As seen in Figure 15, aged, fixed PMN that were not heat-necrotized showed a circular surface staining with CLEC9A/DNGR1 (Figure 15a). Upon heat treatment the CLEC9A/DNGR1 signal was no longer restricted to the surfaces of the cells but CLEC9A/DNGR1 penetrated into the cytoplasm (Figure 15b). The same cytoplasm staining pattern resulted when aged PMN were heat-necrotized without fixation and stained afterwards with CLEC9A/DNGR1-FITC (Figure 15c). Employing confocal microscopy it was demonstrated, that CLEC9A/DNGR1 staining pattern of late apoptotic PMN was different from that of heat-necrotized PMN, it changed from surface type to cytoplasmic. This data further confirms our hypothesis that PMN expose CLEC9A ligands before undergoing secondary necrosis.

58 3 Results

a) Fixation, CLEC9A-FITC staining of apototic PMN, no further heat-treatment

b) Fixation, heat-treatment, CLEC9A-FITC staining of necrotic PMN

c) No fixation, heat-treatment, CLEC9A-FITC staining of necrotic PMN

Figure 15: CLEC9A/DNGR1 staining pattern changes from surface type to cytoplasmic after heat treatment After 24 h in vitro ageing PMN got fixed or were left without fixation. After heat treatment (30 min at 58 °C) the cells were stained with CLEC9A/DNGR1-FITC and analysed by confocal microscopy. The different staining patterns for apoptotic and heat-necrotized PMN are displayed.

Figure 16 demonstrates that AxV/PI-staining is not suitable to analyse membrane integrity of ageing PMN, since some of these cells do not anymore contain sufficient amounts of DNA to detect a robust PI signal. PMN aged in vitro for 24 hours were all positive for AxV. The cell population consisted of early apoptotic PI negative, late apoptotic PI negative and also secondary necrotic PI positive cells. All AxV positive PMN showed a circular surface staining. When aged PMN were fixed with PFA, subjected to heat treatment and stained with AxV/PI all cells displayed the same ring- shaped surface staining as apoptotic PMN, but with more cells being PI positive. Some cells were also PI negative. From this data alone one cannot be sure, if the PI negative cells have lost membrane integrity or not. The distinct staining pattern employing the C-type lectin CLEC9A/DNGR1 in confocal microscopy verifies our hypothesis that PMN maintain membrane integrity even in late stages of apoptosis and that cells of this stage do bind CLEC9A/DNGR1.

59 3 Results

TM AxV/PI merge

Aged PMN, fixation, plus AxV/PI

Aged PMN, fixation, 30 min at 58°C, plus AxV/PI

Figure 16: Aged and aged, heat necrotized PMN show a surface binding of AxV PMN aged in vitro for 24 hours got fixed and heat-necrotized. After staining with AxV/PI cells were analysed by confocal microscopy. Transmission microscopy (TM) and confocal microscopy pictures are presented.

CLEC9A/DNGR1 ligand on late apoptotic PMN The ligand of CLEC9A/DNGR1 is present on late apoptotic PMN that are endowed with intact membranes or in necrotic, already PI positive cells. Some experiments were performed to reveal the ligand of CLEC9A/DNGR1 (Figure 17), which is still undefined. The ligand of CLEC9A/DNGR1 was stable at 58 °C, but was sensitive to temperatures above 80 °C. The binding of CLEC9A/DNGR1 to late apoptotic PMN was not influenced by the presence of potential, differently concentrated, competitive inhibitors such as herring sperm DNA (20 and 100 µg/ml), nucleosomes, prepared from viable or apoptotic Jurkat cells (20 and 60 µg/ml), and glycerophosphocholine (GPC, 100 µg/ml). Also pre-treatment of apoptotic PMN with nuclease S7,

Benzonase, DNaseI or 5mM MgCl2 / CaCl2 had no relevant effect on the CLEC9A/DNGR1 binding. Ten to 16 percent more CLEC9A/DNGR1 positive cells were observed after pre-treatment with nuclease S7, Benzonase and DNase I. No Inhibition in binding was observed with any inhibitor or treatment employed.

60 3 Results

1) 2) 3) 4)

100 100 100 100 s l l

e 90 90 90 90 c

e 80 80 80 80 v i t i

s 70 70 70 70 o p 60 60 60 60 C T I 50 50 50 50 F -

A 40 40 40 40 9

C 30 30 30 30 E L

C 20 20 20 20

% 10 10 10 10 0 0 0 0 l l l l d h h h h h e 7 I l 2 h l l h C e °C °C °C m m s e m m m m C °C s 1 8 8 4 8 0 8 4 / / a S s C 4 / / / / 4 P 8 P y r r 5 2 5 8 4 2 g g n e a a 2 g g g g 2 G 5 G l o o r r r µ µ o s C r µ µ µ µ r , , f f in o in in o o 0 0 z a N , o 0 0 o h in C d d f f f e D l 2 f 0 0 f ° e e m d m m d d 2 0 n l d 2 6 2 6 d 4 m g g A 1 e c C e e o o 2 8 0 e 0 5 e e B u g e l l p p e 0 5 a a 3 g 3 , g g N A N M g b b g r 3 n , a , h a a D N a ia ia a a a fo , i h h 4 D v v s s d h m 8 4 2 s s e e e 4 0 r 2 r e e m m g 2 3 fo r fo m m o o a r , fo o o s s fo h d d s s o o 4 e d e o o le le d 2 g e g le le c c e r a g a c c u u g o a u u n n a f n n d e g a

Figure 17: The ligand of CLEC9A/DNGR1 is still undefined PMN were pre-treated e.g. with nucleases or CLEC9A/DNGR1 was pre-incubated with potential, differently concentrated, competitive inhibitors (DNA, nucleosomes from apoptotic (apo) or viable Jurkats (viable) or glycerophosphocholine (GPC)) before the staining procedure. Analysis by flow cytometry was employed to reveal the ligand of CLEC9A/DNGR1 on late apoptotic PMN. The percentage of CLEC9A/DNGR1 positive PMN after different treatments is displayed.

3.4 C-type lectin CLEC4L/DC-SIGN

CLEC4L/DC-SIGN is a C-type lectin which recognizes mannose and mannan structures. We analysed the hypothesis that C-type lectin CLEC4L/DC-SIGN binds to ligands exposed on the surface of late apoptotic cells, since mannose structures are exposed on the latter.

CLEC4L/DC-SIGN binds early and late apoptotic PMN with intact membranes PMN are very special in undergoing apoptosis as they maintain membrane integrity for a very long time. That makes them an important tool for investigating apoptotic cell clearance. In experiments with the C-type lectin CLEC4L/DC-SIGN enhanced interaction between CLEC4L/DC-SIGN overexpressing Raji cells and ageing PMN was observed (Figure 18a). Raji with and without CLEC4L/DC-SIGN overexpression were co-incubated with ageing, CFDA-SE-stained PMN. In all experiments, there were more CFSE positive Raji-CLEC4L/DC-SIGN cells after co-incubation with CFDA-SE-labelled apoptozing PMN compared to Raji without transfection.

61 3 Results a) b) 15 15 * s l l s l e l c e

c e 10 10 v e i t v i

i * t s i o s p o

p E Raji-DC-SIGN S E F 5 S 5 F C Raji-DC-SIGN/mannan

C

%

% Raji Raji/mannan 0 0 0 14 14 t (h) t (h)

Figure 18: CLEC4L/DC-SIGN interaction with apoptozing PMN is inhibited in the presence of mannan a) DiI-stained Raji-CLEC4L/DC-SIGN and Raji cells were co-incubated with CFDA-SE-labelled apoptozing PMN at 37 °C and after 14 h analysed by flow cytometry. The percentage of Raji/Raji- CLEC4L/DC-SIGN cells that have gained CFSE-Fluorescence is displayed. b) The co-incubation of DiI-stained Raji-CLEC4L/DC-SIGN and Raji cells with CFDA-SE-labelled apoptozing PMN was repeated in the presence of mannan. The percentage of CFSE positive Raji/Raji-CLEC4L/DC-SIGN is displayed. (Mean ± SD. * p < 0.05 using the Kruskal-Wallis-Test.)

This could be confirmed by flow cytometry and by fluorescence microscopy (Figure 19). Visualizing the cells by employing fluorescence microscopy no interaction between membrane-labelled Raji cells (red) and ageing CFDA-SE-labelled PMN (green) was to be observed after co-incubation for 29 h. In contrast, red DiI-stained Raji-CLEC4L/DC-SIGN cells and ageing green CFDA-SE-labelled PMN formed big aggregates which appeared yellow in the microscope due to interaction. To clarify whether this interaction was specific the co-incubation of Raji-CLEC4L/DC-SIGN and Raji with apoptozing PMN was repeated in the presence of the CLEC4L/DC-SIGN binding inhibitor mannan. As seen in Figure 18b mannan had no inhibitory effect on Raji cells without CLEC4L/DC-SIGN transfection. However the interaction of Raji- CLEC4L/DC-SIGN cells with apoptozing CFDA-SE-labelled PMN was significantly reduced in the presence of mannan, reflected by a lower amount of CFSE positive Raji-CLEC4L/DC-SIGN cells. The data confirm our hypothesis that C-type lectin CLEC4L/DC-SIGN binds to ligands exposed by late apoptotic cells.

62 3 Results

Raji (red) Raji-DC-SIGN (red) + apoptotic PMN (green) + apoptotic PMN (green)

Figure 19: Strong aggregation of Raji-CLEC4L/DC-SIGN cells with apoptotic PMN DiI-stained Raji-CLEC4L/DC-SIGN and Raji cells (red) were co-incubated with CFDA-SE-labelled apoptozing PMN (green) at 37 °C and after 29 h analysed by fluorescence microscopy. CLEC4L/DC- SIGN dependent aggregation is shown.

CLEC4L/DC-SIGN binds apoptotic blebs with intact membranes Lymphoblasts, activated T cells, are interesting targets to investigate, since they undergo apoptosis and need to be cleared before secondary necrosis. Blebs and apoptotic bodies are an interesting target since they are endowed with intact membranes. For this purpose, lymphoblasts had been generated and stained with CFDA-SE. Apoptosis was induced by UV-B irradiation and the generated CFDA-SE- labelled blebs were isolated the next day. Raji with and without CLEC4L/DC-SIGN- overexpression were co-incubated with these CFDA-SE-labelled blebs and were analysed by flow cytometry. High binding to Raji-CLEC4L/DC-SIGN cells of apoptotic blebs was observed, reflected by a significant increase in FITC MFI employing flow cytometry analysis (Figure 20a). The specificity of this interaction was verified using the CLEC4L/DC-SIGN inhibitor mannan. In the presence of mannan the interaction with FITC-labelled apoptotic blebs after co-incubation with Raji-CLEC4L/DC-SIGN was significantly reduced, reflected by decreased FITC MFI. There was no significant inhibitory effect of mannan on Raji cells without transfection of CLEC4L/DC-SIGN (Figure 20b).

63 3 Results a) * 30 Raji-DC-SIGN 25 * Raji 20

C * T I F

* I 15 F

M * 10 * 5

0 0 2 4 6 8 1012141618 time (h) b) 40 35 30 25

C * T I

F 20

I Raji-DC-SIGN F 15 M Raji-DC-SIGN/mannan 10 Raji 5 Raji/mannan 0 20 time (h)

Figure 20: CLEC4L/DC-SIGN interaction with apoptotic lymphoblast blebs is inhibited in the presence of mannan a) Raji-CLEC4L/DC-SIGN and Raji cells were co-incubated with CFDA-SE-labelled apoptotic lymphoblast blebs at 37 °C and analysed by flow cytometry at different time points. The increase in CFSE MFI of Raji-CLEC4L/DC-SIGN and Raji is displayed. b) The co-incubation of Raji-CLEC4L/DC- SIGN and Raji cells with CFDA-SE-labelled apoptotic lymphoblast blebs was repeated in the presence of mannan. The change in CFSE MFI of Raji/Raji-CLEC4L/DC-SIGN after 20 h co-incubation is displayed. (Mean ± SD. * p < 0.05 using the Kruskal-Wallis-Test.)

64 3 Results

Another technique was employed to confirm CLEC4L/DC-SIGN interaction with apoptotic lymphoblast blebs. Using confocal microscopy the interaction between apoptotic, CFDA-SE-labelled blebs and CD19-PE-labelled Raji-CLEC4L/DC-SIGN could be visualized. The green apoptotic blebs stuck to the surface of Raji- CLEC4L/DC-SIGN. This was not to be observed for Raji without transfection of CLEC4L/DC-SIGN (Figure 21). The data also confirm our hypothesis that C-type lectin CLEC4L/DC-SIGN binds to ligands exposed by late apoptotic cells or, here, apoptotic blebs.

Raji (red) Raji-DC-SIGN (red) + apoptotic blebs (green) + apoptotic blebs (green)

Figure 21: Apoptotic lymphoblast blebs bind to the surface of Raji-CLEC4L/DC-SIGN CD19-stained Raji-CLEC4L/DC-SIGN and Raji cells (red) were co-incubated with CFDA-SE-labelled apoptotic lymphoblast blebs (green) at 37 °C and after 24 h analysed by confocal microscopy. CLEC4L/DC-SIGN dependent binding with apoptotic blebs is shown.

65 3 Results

3.5 C-type lectin CLEC7A/Dectin-1

CLEC7A/Dectin-1 is a ß-glucan receptor and binds zymosan. Zymosan is the major cell wall component of yeasts that is composed protein-carbohydrate complexes such as ß-glucans, mannans, mannoproteins, and . Mannose structures and other carbohydrate structures are exposed on late apoptotic cells. We analysed the hypotheses that the C-type lectin CLEC7A/Dectin-1 recognizes ligands exposed on late apoptotic cells and is involved in their clearance and influences their immunogenicity.

CLEC7A/Dectin-1 overexpressing macrophages associate with dead and dying cells RAW246.7 macrophages with and without CLEC7A/Dectin-1 overexpression were co-incubated with various apoptotic and/or necrotic preys to test the role of CLEC7A/Dectin-1 in recognition and clearance of dead and dying cells. Redox- and pH-stabil labels and inhibitors (CLEC7A/Dectin-1-specific laminarin and not- CLEC7A/Dectin-1-specific mannan) were employed. The quantification was performed by flow cytometry. In all assays performed, a little more accumulation of fluorecence in CLEC7A/Dectin- 1 overexpressing RAW macrophages was to be observed. Figure 22 shows a representative experiment. A significant difference in MFI between RAW and RAW- CLEC7A/Dectin-1 is shown after co-incubation with PI-labelled secondary necrotic PMN (Figure 22a). The specificity of this interaction was demonstrated using the inhibitors mannan and laminarin. No inhibition of the interaction between RAW/RAW- CLEC7A/Dectin-1 and secondary necrotic cells was observed employing non- CLEC7A/Dectin-1-specific mannan (Figure 22b). In the presence of laminarin the accumulation of fluorescence in RAW-CLEC7A/Dectin-1 was reduced. A slight reduction of MFI is also observed in RAW cells without CLEC7A/Dectin-1 overexpression most likely due to the small amounts of endogenous CLEC7A/Dectin- 1.

66 3 Results a)

45 * RAW-Dectin-1 40 RAW 35

I 30 P

I 25 F M 20 15 10 5 0 0 2 4 6 8 t (h) b)

RAW-Dectin-1 RAW Laminarin 45 45 40 40 Mannan 35 ** ** 35 w/o 30 30 I I P 25 P 25 *** *

I I F 20 F 20 M M 15 15 10 10 5 5 0 0 0 5 10 0 5 10 t (h) t (h)

Figure 22: CLEC7A/Dectin-1 interaction with secondary necrotic PMN is inhibited in the presence of laminarin a) RAW-CLEC7A/Dectin-1 and RAW macrophages were co-incubated with PI-labelled secondary necrotic PMN at 37 °C and analysed by flow cytometry at different time points. The increase in PI MFI of RAW-CLEC7A/Dectin-1 and RAW cells is displayed. (* p < 0.05 using the Kruskal-Wallis-Test); b) The co-incubation of RAW-CLEC7A/Dectin-1 and RAW cells with PI-labelled secondary necrotic PMN was repeated in the presence of mannan and laminarin. The change in PI MFI of RAW/RAW- CLEC7A/Dectin-1 is displayed. (* p < 0.05, ** p < 0.01 using the paired Student's t-test.)

67 3 Results

A co-incubation with FITC-labelled, non-degradable latex beads was performed to exclude that the accumulation of fluorescence resulted from different uptake capabilities of RAW and RAW-CLEC7A/Dectin-1. As shown in Figure 23, RAW and RAW-CLEC7A/Dectin-1 both increased their MFI due to the uptake of FITC-labelled beads. No difference between RAW and RAW-CLEC7A/Dectin-1 in the absence or presence of CLEC7A/Dectin-1 specific laminarin employing latex beads was to be observed. The overall uptake capability for both cells did not differ significantly.

45 40 RAW-Dectin-1 35 C RAW-Dectin-1/Laminarin T I 30 F

RAW I

F 25

M RAW/Laminarin 20 15 10 5 0 0 3 20,5 t (h)

Figure 23: No difference in uptake of FITC-labelled latex beads in the presence of CLEC7A/Dectin-1 RAW-CLEC7A/Dectin-1 and RAW macrophages were co-incubated with FITC-labelled, non- degradable latex beads at 37 °C and analysed by flow cytometry at different time points. The increase in FITC MFI of RAW-CLEC7A/Dectin-1 and RAW cells (Mean ± SD) is displayed.

Though no direct binding of mCLEC7A/Dectin-1 Fc-fusion protein to viable, apoptotic or necrotic cells has been observed (Figure 24), the experiments with mCLEC7A/Dectin-1 overexpressing macrophages always displayed difference in fluorescence accumulation after co-incubation of dead and dying cells. The data shown above support the hypothesis that C-type lectin CLEC7A/Dectin-1 is involved in the clearance of late apoptotic cells.

68 3 Results

Freshly isolated PMN Primary necrotic PMN 24 h aged PMN t n u o c

mDectin-1-PE secondary antibody only

mDectin-1 plus secondary antibody

Figure 24: No direct binding of mCLEC7A/Dectin-1 to viable, necrotic or apoptotic PMN Freshly isolated, heat-necrotized (30 min at 58 °C) and aged PMN (aged for 24 h in vitro) were labelled with mCLEC7A/Dectin-1 Fc-fusion protein and a secondary PE-labelled antibody. The histograms of mCLEC7A/Dectin-1 / secondary antibody and secondary antibody only control staining are displayed.

We hypothesize that the recognition of late apoptotic cells is no direct but an adaptor- mediated process, since no direct binding to late apoptotic cells has been observerd. In vivo immunization experiments using WT and CLEC7A/Dectin-1 KO mice should clarify the role of CLEC7A/Dectin-1 in the clearance process.

69 3 Results

CLEC7A/Dectin-1 attenuates the immune response against dying and dead cells – in vivo experiments We wanted to analyse the hypothesis that CLEC7A/Dectin-1 which is involved in the clearance of apoptotic and necrotic cells modulates their immunogenicity and inflammatory potential. To investigate this, SV129 WT and SV129 CLEC7A/Dectin-1 KO mice were immunized (i.p.) and challenged twice with Ringer, freshly isolated, primary necrotic and 24 h aged PMN. PMN were chosen as they are very special according to their apoptosis progress and their long membrane integrity. Fourteen days after the third immunization the feet of the mice were injected subcutaneously with Ringer-control into one foot and with viable PMN into the other one. After 24 h the swelling of the feet was measured and percent swelling was calculated. Further, the blood was drawn and the spleens were collected for further analyses.

Increased DTH response in immunized SV129 CLEC7A/Dectin-1 KO mice The SV129 CLEC7A/Dectin-1 KO mice immunized with viable PMN, primary necrotic PMN and apoptotic PMN showed a higher foot swelling compared to WT mice. This was highly significant for immunization with primary necrotic PMN (Figure 25).

SV129 WT 60 SV129 Dectin-1 KO Mean 50 **

g 40 n i l l e w

s 30

% 20

10

0 Immunized Ringer Freshly Primary 24h aged with: Isolated Necrotic PMN PMN PMN

Figure 25: Increased DTH response in immunized SV129 CLEC7A/Dectin-1 KO mice SV129 WT and CLEC7A/Dectin-1 KO mice were immunized with viable, heat-necrotized, aged human PMN and Ringer’s solution as control. 14 days after the third immunization the feet of the mice were injected subcutaneously with Ringer-control into one foot and with viable PMN into the other one. After 24 h the swelling of the feet was measured and the percent swelling was calculated. The relative % swelling is displayed. (Mean. ** p < 0.01 using the Mann-Whitney U Test) 70 3 Results

Increased number of splenocytes in immunized SV129 CLEC7A/Dectin-1 KO mice During dissection of the mice enlarged spleens in the SV129 CLEC7A/Dectin-1 KO mice were to be observed. The spleens were cut into thirds. Two thirds were snap frozen on nitrogen, then stored at -80 °C and used later for RNA isolation and further cytokine RT PCR. The other third was harvested for MLR. For this, the spleen was prepared and the splenocytes counted. This cell count can be taken as surrogate measurement for splenic cellularity. The relative splenocyte count of CLEC7A/Dectin- 1 KO mice immunized with apoptotic and primary necrotic PMN was highly significantly increased when compared with WT mice (Figure 26). That this result was much biased by an improper distribution of the spleen cell pieces is excluded as the cutting of spleens were done by two persons in parallel. The preparation of the splenocytes for the MLR took much longer than expected. This maybe the explanation for the high variance in the MLR assays which, therefore, cannot be used for any conclusion (data not shown).

SV129 WT SV129 Dectin-1 KO Median

n 300 e ** e

l * p s

e 250 s u o m

/

t 200 n u o c

e 150 t y c o n e

l 100 p s

e v i t 50 a l e R 0 Immunized Freshly Primary 24h aged with: Isolated Necrotic PMN PMN PMN

Figure 26: Increased number of splenocytes in immunized SV129 CLEC7A/Dectin-1 KO SV129 WT and SV129 CLEC7A/Dectin-1 KO mice were immunized with viable, heat-necrotized, aged (apoptotic) human PMN and Ringer’s solution as control. The spleens were collected after mice sacrifice. The number of splenocytes of one third of each spleen was determined and extrapolated to the total number of splenocytes/ spleen. The latter was normalized on Ringer-injected WT and KO mice, presented in the diagram. (Median. * p < 0.05; ** p < 0.01 using the Mann-Whitney U Test.)

71 3 Results

Increased anti-PMN IgG production in SV129 CLEC7A/Dectin-1 KO mice The IgG production against human PMN after immunization with viable, primary necrotic and apoptotic PMN was determined in mice sera obtained after final bleeding after performed immunizations and DTH-reaction. Anti-PMN IgG was determined by ELISA using PMN-lysate-coated plates. The SV129 CLEC7A/Dectin-1 KO mice immunized with viable PMN, primary necrotic PMN and apoptotic PMN showed a higher anti-PMN IgG production compared to WT mice. This was significant for immunization with primary necrotic and aged PMN (Figure 27).

0,8 SV129 WT SV129 Dectin-1 KO * 0,7 Mean * 0,6

0,5 D

O 0,4

0,3

0,2

0,1

Immunized Ringer Freshly Primary 24h aged with: Isolated Necrotic PMN PMN PMN

Figure 27: Increased anti-PMN IgG production in immunized SV129 CLEC7A/Dectin-1 KO mice SV129 WT and SV129 CLEC7A/Dectin-1 KO mice were immunized with viable, heat-necrotized, aged (apoptotic) human PMN and Ringer’s solution as control. The antibody-production against PMN was analysed in the serum, obtained from the final blood draw before sacrifice of the mice. Anti-PMN IgG serum concentrations were determined by ELISA. The data is presented as OD at 450/650 nm. (Mean. * p < 0.05 significance using the Mann-Whitney U Test.)

Cytokine production in mice sera The cytokine production in the mice sera obtained after final bleeding after performed immunizations and DTH-reaction should be determined using FlowCytomix™ Th1/Th2 10plex from Bender. The level of the detected cytokines in the serum was too low to see any differences or to draw any conclusions.

72 3 Results

Cytokine mRNA expressions in spleens From the collected spleens RNA was isolated and the splenocyte cytokine mRNA expression levels were determined by qRT-PCR analysis. Different inflammatory and non-inflammatory cytokines were looked at. Interestingly, absolute values of CLEC7A/Dectin-1 KO mice immunized with Ringer‘s solution were higher compared to Ringer-injected WT mice (Table 9a). When normalized on WT and CLEC7A/Dectin-1 KO mice treated with Ringer‘s solution only, the relative expressions of inflammatory as well as non-inflammatory cytokines of immunized CLEC7A/Dectin-1 KO were below the relative cytokine expressions of CLEC7A/Dectin-1 KO mice treated with Ringer‘s solution only and below immunized WT mice (Table 9b and Figure 28).

Table 9: Real-time qRT-PCR analysis of splenocyte cytokine mRNA expression levels (Relative gene expression normalized on 18S rRNA of SV129 WT and SV129 CLEC7A/Dectin-1 KO mice) a) Mean values presented below with the Ringer-injected WT population as calibrator

mIL-2 mIL-6 mIL-10 mIL-12p35 mIL-12p40 mTNFα WTRinger 0,0 0,0 0,0 0,0 0,0 0,0 WTFreshlyisolatedPMN 0,7 0,8 1,5 0,9 -0,2 1,1 WT Primary necrotic PMN 0,2 -0,5 1,2 0,2 0,1 0,9 WT24hagedPMN 0,2 -0,5 1,1 0,3 -0,6 0,5

KORinger 1,4 0,6 1,4 1,1 1,4 1,0 KO FreshlyisolatedPMN -0,3 -0,8 1,0 0,1 -0,3 0,7 KO Primary necrotic PMN -0,3 -0,4 1,4 -0,1 0,3 0,5 KO24hagedPMN 0,3 0,8 2,1 0,7 0,4 1,1

b) Mean values presented below with Ringer-injected WT and CLEC7A/Dectin-1 KO mice as calibrator

mIL-2 mIL-6 mIL-10 mIL-12p35 mIL-12p40 mTNFα WTRinger 0,0 0,0 0,0 0,0 0,0 0,0 WTFreshlyisolatedPMN 0,7 0,8 1,5 0,9 -0,2 1,1 WT Primary necrotic PMN 0,2 -0,5 1,2 0,2 0,1 0,9 WT24hagedPMN 0,2 -0,5 1,1 0,3 -0,6 0,5

KORinger 0,0 0,0 0,0 0,0 0,0 0,0 KO FreshlyisolatedPMN -1,7 -1,4 -0,4 -1,0 -1,7 -0,3 KO Primary necrotic PMN -1,7 -1,0 -0,1 -1,2 -1,1 -0,5 KO24hagedPMN -1,1 0,2 0,7 -0,4 -1,0 0,1

73 3 Results

mIL-2 mIL-6 mIL-10

5,00 5,00 5,00

4,00 4,00 4,00 ] ] ] ) ) ) 2 2 2 3,00 3,00 3,00 ( ( ( g g g o o o l l l [ [ [ 2,00 2,00 2,00

n n n o o o i i i s s s 1,00 1,00 1,00 s s s e e e r r r p p p 0,00 0 1 2 3 4 5 6 7 8 9 0,00 0 1 2 3 4 5 6 7 8 9 0,00 0 1 2 3 4 5 6 7 8 9 x x x E E E

e e -1,00 e -1,00 -1,00 v v v i i i t t t a a a l l l e e e -2,00 -2,00 -2,00 R R R -3,00 -3,00 -3,00

-4,00 -4,00 -4,00

-5,00 -5,00 -5,00 mIL-12p35 mIL-12p40 mTNFa

5,00 5,00 5,00

4,00 4,00 4,00 ] ] ] ) ) ) 2 2 3,00 2 3,00 3,00 ( ( ( g g g o o o l l l [ [ [ 2,00 2,00 2,00

n n n o o o i i i s s 1,00 s 1,00 1,00 s s s e e e r r r p p 0,00 0 1 2 3 4 5 6 7 8 9 p 0,00 0 1 2 3 4 5 6 7 8 9 0,00 0 1 2 3 4 5 6 7 8 9 x x x E E E

e e -1,00 e -1,00 -1,00 v v v i i i t t t a a a l l l e e e -2,00 -2,00 -2,00 R R R -3,00 -3,00 -3,00

-4,00 -4,00 -4,00

-5,00 -5,00 -5,00

WT ( ), Dectin-1/CLEC7A KO ( ) immunized with:

Ringer Freshly isolated PMN Primary necrotic PMN 24 h aged PMN

Figure 28: Analysis of splenocyte cytokine mRNA expression levels SV129 WT and SV129 CLEC7A/Dectin-1 KO mice were immunized with viable, heat-necrotized, aged (apoptotic) human PMN and Ringer’s solution as control. From the collected spleens RNA was isolated and the splenocyte cytokine mRNA expression levels were determined by qRT-PCR analysis. Relative quantification was performed using the standard curve method. The results for target gene expression were normalized on 18S rRNA as endogenous control, and the mean values of the Ringer- injected mice populations were set as calibrator. The data of relative mRNA expression levels of the cytokines mIL-2, mIL-6, mIL-10, mIL-12p35, mIL-12p40, and mTNFα are shown.

These RT PCR data do not correlate with the increased DTH reaction and anti-PMN IgG production in CLEC7A/Dectin-1 KO mice. The RT-PCR data are hard to be interpreted. Probably the harvest of spleens was not at the optimal time point, e.g. too late after DTH induction. These results are not taken into account in any conclusions. 74 3 Results

CLEC7A attenuates the immune response against dying and dead cells – in vitro experiments In parallel to the in vivo studies, cytokine production assays were performed using generated BMDDC and thioglycollate-elicited macrophages from SV129 WT and CLEC7A/Dectin-1 KO mice. Thioglycollate-elicited macrophages and also BMDDC from SV129 WT and SV129 CLEC7A/Dectin-1 KO mice were co-incubated with apoptotic and secondary necrotic human PMN for 16 and 21 h, respectively. The supernatant was harvested and analysed for cytokine production. Only cytokine levels far above the “blank” were considered. Apoptotic or secondary necrotic cells itself did not elevate cytokine production (Figure 29). Therefore, the influence of apoptotic or secondary necrotic on the LPS-induced cytokine production was examined. To compare WT and CLEC7A/Dectin-1 KO directly, the cytokine production stimulated by LPS only was set to 100 % for WT and CLEC7A/Dectin-1 KO. The difference in percent up-regulation or down-regulation in cytokine production was then analysed.

Co-incubation of activated macrophages of WT and CLEC7A/Dectin-1 KO mice with apoptotic or secondary necrotic PMN lead to different cytokine profiles Isolated thioglycollate-elicited macrophages from SV129 WT and SV129 CLEC7A/Dectin-1 KO mice were co-incubated with 24 h aged or secondary necrotic (aged and heat-necrotized) human PMN in the presence of 10 ng/ml LPS for 16 h. The supernatant was removed and the cytokine production was determined using FlowCytomix™ Th1/Th2 10plex from Bender. The production of the cytokines mGM- CSF, mIFN-gamma, mIL-1α, mIL-2, mIL-4, mIL-5, mIL-6, mIL-10, mIL-17, mTNFα in the supernatant was investigated and those that could be detected are presented.

75 a) Thioglycollate-elicited macrophages mTNFα mIL-6

120 120

n 100 100 o i t c

u 80 80 d o r p 60 60 e n i k o

t 40 40 y c

% 20 20

0 0 0 LPS 0 LPS LPS0LPS 0 LPS 0 LPS LPS0LPS 0 LPS 0 LPS LPS0LPS 0 LPS 0 LPS LPS0LPS Aged S.Nec. Aged S.Nec. Aged S.Nec. Aged S.Nec. PMN PMN PMN PMN PMN PMN PMN PMN

SV129 WT SV129 Dectin-1 KO SV129 WT SV129 Dectin-1 KO

b) BMDDC mTNFα mIL-6 mIL-1α 120 120 160 140 100 100 n o

i 120 t

c 80 80 u 100 d o r

p 60 60 80 e n i 60 k 40 40 o t

y 40 c 20 20

% 20 0 0 0 0 LPS 0 LPS LPS0LPS 0 LPS 0 LPS LPS0LPS 0 LPS 0 LPS LPS0LPS 0 LPS 0 LPS LPS0LPS 0 LPS 0 LPS LPS0LPS 0 LPS 0 LPS LPS0LPS Aged S.Nec. Aged S.Nec. Aged S.Nec. Aged S.Nec. Aged S.Nec. Aged S.Nec. PMN PMN PMN PMN PMN PMN PMN PMN PMN PMN PMN PMN

SV129 WT SV129 Dectin-1 KO SV129 WT SV129 Dectin-1 KO SV129 WT SV129 Dectin-1 KO

Figure 29: No significant effect of apoptotic or secondary necrotic PMN on cytokine profile of macrophages and BMDDC in the abscence of LPS The relative cytokine production of SV129 WT and SV129 CLEC7A/Dectin-1 KO thioglycollate-elicited macrophages or BMDDC after co-incubation with apoptotic (Aged) or secondary necrotic (S. Nec.) PMN normalized to LPS only is presented. 7 6 3 Results mTNFα production Apoptotic and secondary necrotic human PMN significantly down regulated LPS- induced TNFα production of thioglycollate-elicited macrophages of WT and CLEC7A/Dectin-1 KO mice. Secondary necrotic PMN down regulated LPS-induced TNFα production almost to the level without addition of LPS (Figure 30a). The average of cells which were only treated with LPS 10ng/ml was set to 100 % to be able to compare WT and CLEC7A/Dectin-1 KO responses directly. The “relative cytokine production” was normalized to 10 ng/ml LPS only. There were no differences in downregulation of LPS-induced TNFα production between SV129 WT and CLEC7A/Dectin-1 KO macrophages (Figure 30a). mIL-6 production Apoptotic human PMN down regulated LPS-induced IL-6 production of thioglycollate- elicited WT and CLEC7A/Dectin-1 KO macrophages. This was significant for CLEC7A/Dectin-1 KO macrophages Secondary necrotic PMN significantly down regulated LPS-induced IL-6 production almost to the level without addition of LPS in WT and KO macrophages (Figure 30b). When compared directly, the downregulation of LPS-induced mIL-6 production was significantly higher in macrophages of CLEC7A/Dectin-1 KO mice in response to both apoptotic and secondary necrotic human PMN (Figure 30b).

77 3 Results a) mTNFα

** ** ** ** SV129 WT ** ** SV129 Dectin-1 KO 120 120 n n o o i i t t c c 100 100 u u d d o o

r 80 r 80 p p e e n n 60

i 60 i k k o o t t y y 40 40 c c

% % 20 20 0 0 0LPS LPSLPS LPS 0LPS LPS LPS LPS LPS LPS LPS + + + + + + Aged S.Nec. Aged S.Nec. Aged S.Nec. PMN PMN PMN PMN PMN PMN

SV129WT SV129Dectin-1KO b) mIL-6 ** ** ** SV129 WT ** ** SV129 Dectin-1 KO 120 120 n n o o

i i * ** t 100 t c c 100 u u d d o o r r 80 80 p p e e n n i i 60 60 k k o o t t

y 40 y c c 40

% % 20 20

0 0 0 LPS LPSLPS LPS 0 LPS LPS LPS LPS LPS LPS LPS + + + + + + Aged S.Nec. Aged S.Nec. Aged S.Nec. PMN PMN PMN PMN PMN PMN

SV129 WT SV129 Dectin-1 KO

Figure 30: Co-incubation of activated macrophages of WT and CLEC7A/Dectin-1 KO mice with apoptotic or secondary necrotic PMN lead to different cytokine profiles Isolated thioglycollate-elicited macrophages from SV129 WT and SV129 CLEC7A/Dectin-1 KO mice were co-incubated with 24 h aged (Aged) or secondary necrotic (S.Nec.) human PMN in the presence of 10 ng/ml LPS for 16 h. The supernatant was removed and the cytokine production was determined using FlowCytomix™ Th1/Th2 10plex from Bender. The relative cytokine production was normalized to 10 ng/ml LPS only in order to compare WT and CLEC7A/Dectin-1 KO responses directly. The data for a) mTNFα and b) mIL-6 production are presented. (Mean. * p < 0.05; ** p < 0.01 using the Mann- Whitney U Test.)

78 3 Results

Co-incubation of BMDDC of WT and CLEC7A/Dectin-1 KO mice with apoptotic or secondary necrotic PMN lead to different cytokine profiles BMDDC from SV129 WT and CLEC7A/Dectin-1 KO mice were generated and after 9 days co-incubated with 24 h aged apoptotic or secondary necrotic (aged and heat- necrotized) human PMN in the presence of 10 ng/ml LPS and GM-CSF for 21 h. The supernatant was removed and the cytokine production was determined using FlowCytomix™ Th1/Th2 10plex from Bender. The production of the cytokines mGM- CSF, mIFN-gamma, mIL-1α, mIL-2, mIL-4, mIL-5, mIL-6, mIL-10, mIL-17, mTNFα in the supernatant was investigated and those that could be detected are presented below. mTNFα Secondary necrotic PMN significantly down regulated LPS-induced TNFα production in SV129 WT and CLEC7A/Dectin-1 KO BMDDC (Figure 31a). Apoptotic PMN did not have significant effect on the TNFα production. When compared directly no significant differences in LPS-induced TNFα production of SV129 WT and CLEC7A/Dectin-1 KO BMDDC were observed (Figure 31a). mIL-6 Interestingly, secondary necrotic cells upregulated LPS-induced IL-6 production in BMDDC; this was significant for SV129 WT BMDDC (Figure 31b). Apoptotic PMN did not have significant effect on the IL-6 production. No significant differences in IL-6 production between SV129 WT and CLEC7A/Dectin-1 KO BMDDC were measured when compared directly (Figure 31b). mIL-1α Secondary necrotic PMN significantly down regulated IL-1α production in SV129 WT and CLEC7A/Dectin-1 BMDDC (Figure 31c). Apoptotic PMN did not have an effect on the IL-1α production in SV129 WT BMDDC as observed for TNFα and IL-6 already. Interestingly, in CLEC7A/Dectin-1 KO BMDDC apoptotic PMN significantly upregulated IL-1α production. There was a significantly higher IL-1α production in SV129 CLEC7A/Dectin-1 KO BMDDC as compared to WT after co-incubation with apoptotic PMN (Figure 31c).

79 3 Results a) mTNFα * * * * SV129 WT SV129 Dectin-1 KO 120 140 n n o o i i 120 t t 100 c c u u

d d 100 o o

r 80 r p p 80 e e n n

i 60 i k k 60 o o t t y y c c 40

40 % % 20 20

0 0 0LPS LPSLPS LPS 0LPS LPS LPS LPS LPS LPS LPS + + + + + + Aged S.Nec. Aged S.Nec. Aged S.Nec. PMN PMN PMN PMN PMN PMN

SV129 WT SV129 Dectin-1 KO

b) mIL-6

* SV129 WT SV129 Dectin-1 KO 160 * 160 n n o o

i 140 i 140 t t c c u u 120 d d 120 o o r r p p 100 100 e e n n

i i 80 k k 80 o o t t 60 y y

c 60 c 40 % % 40 20 20 0 0 LPS LPS LPS 0LPS LPSLPS LPS 0LPS LPS LPS LPS + + + + + + Aged S.Nec. PMN PMN Aged S.Nec. Aged S.Nec. PMN PMN PMN PMN

SV129 WT SV129 Dectin-1 KO

80 3 Results c) mIL-1α * * * SV129 WT SV129 Dectin-1 KO 200 * * n n 200 o

o 180

i i * t t 180 c c 160 u u

d d 160 o o 140 r r 140 p 120 p e e 120 n n i i k k 100 100 o o t t y y 80 80 c c 60

% 60 % 40 40 20 20 0 0 LPS LPS LPS 0 LPS LPSLPS LPS 0 LPS LPS LPS LPS + + + + + + Aged S.Nec. PMN PMN Aged S.Nec. Aged S.Nec. PMN PMN PMN PMN

SV129 WT SV129 Dectin-1 KO

Figure 31: Co-incubation of BMDDC of WT and CLEC7A/Dectin-1 KO mice with apoptotic or secondary necrotic PMN lead to different cytokine profiles BMDDC from SV129 WT and SV129 CLEC7A/Dectin-1 KO mice were generated and after 9 days co- incubated 24 h aged (Aged) or secondary necrotic (S.Nec.) human PMN in the presence of 10 ng/ml LPS and GM-CSF for 21 h. The supernatant was removed and the cytokine production was determined using FlowCytomix™ Th1/Th2 10plex from Bender. The relative cytokine production was normalized to 10 ng/ml LPS only in order to compare WT and CLEC7A/Dectin-1 KO responses directly. The data for a) mTNFα, b) mIL-6, and c) mIL-1α production are presented. (Mean. * p < 0.05 using the Mann-Whitney U Test.)

The in vivo data involving a stronger DTH reaction, an increased anti-PMN IgG production, enlarged spleens, and an enhanced splenocyte number in SV129 CLEC7A/Dectin-1 KO mice compared to SV129 WT mice, and the in vitro data involving cytokine assays regarding mIL-6 upregulation in SV129 WT mice macrophages in the presence of apoptotic and secondary PMN compared to KO and mIL-1α upregulation in SV129 CLEC7A/Dectin-1 KO mice BMDDC in the presence of apopotic PMN compared to WT support the hypothesis, that CLEC7A/Dectin-1 KO modulates the immunogenicity and inflammatory potential of apoptotic and necrotic cells. Taken together, the in vivo and in vitro results support CLEC7A/Dectin-1 being a negative regulatory lectin for the immunogenicity of apoptotic and primary necrotic cells.

81 4 Discussion

4 Discussion

Apoptotic cell death is linked with a heavily change in the glycosylation pattern of dying cells which is the target for a plethora of sugar-epitope recognizing proteins, like C1q, PTX-3, galectins, SP-A, and, less physiological, plant lectins. The recognition of apoptotic cells and their swift, efficient, and anti-inflammatory clearance is very important. Within this thesis we were interested in the role of various C-type lectin receptors for the recognition, uptake, and/or immunological response against dead and dying cells. Unlike published data we observed, that the C-type lectin CLEC9A/DNGR1 did not only bind to necrotic cells but already to late apopototic PMN endowed with intact membranes. We could verify that PMN are very special according to their apoptosis progress since they maintain membrane integrity even in late stages of apoptosis. Specific binding of C-type lectin CLEC4L/DC-SIGN to apoptotic PMN as wells as to apoptotic blebs from lymphoblast blebs was observed. More importantly, however, we could demonstrate an important role of CLEC7A/Dectin-1 for the uptake and immunological response against dead and dying PMN.

4.1 Lectin binding is a special feature of late apoptotic cells

A change in surface glycosylation of apoptotic cells and the exposure of potential binding sites for lectins have been reported since the early 1980s. Duvall et al. have suggested the presence of lectin-like molecules on the surface of the macrophages, which preferentially recognized apoptosis-induced rather than freshly isolated mouse thymocytes [125]. Carbohydrate cell-surface changes due to the loss of terminal residues (such as N-acetyl neuraminic acid) leaving galactose, N-acetyl- galactosamine, and N-acetyl glucosamine behind on the surface are discussed. Even exposure of incompletely synthesized carbohydrate side-chains as found in the ER and Golgi was proposed [125]. Dini et al. revealed the asialoglycoprotein receptor (ASGP-R) as a lectin-receptor that mediates recognition and clearance of apoptotic cells in the liver [124]. Similar observation was done with Kupffer cells phagocytosing apoptotic rather than viable lymphocytes by means of lectin-like receptors [161]. In all studies presented above the recognition or clearance of apoptotic cells was inhibited

82 4 Discussion for instance in the presence of N-Acetylglucosamine or other sugar cocktails. A recent study using plant lectins Griffonia simplificolia II (GSL II), Narcissus pseudonarcissus (NPn), and Ulex europaeus I (UEA I) (specific for N- acetylglucosamine, mannose, and fucose, respectively) showed an increased time- dependent binding to dying cells [126]. AxV positivity preceded the lectin binding. Taken together lectin binding is a feature of late stages of apoptosis and points out to a heavily altering glycocalyx of dying cells due to the process of apoptosis. The binding of the non-toxic plant lectins NPn and GSL II to viable, early and late apoptotic as well as necrotic cells, was investigated for PMN, PBL, lymphoblasts, and their subcelluar fragments. It was confirmed, that NPn and GSLII preferentially bind to the late apoptotic shrunken PMN, PBL, and lymphoblast population (PI positive cells excluded). More lectin binding sites were exposed on or within heat-necrotized cells. Interestingly, binding of NPn and GSLII to early apoptotic, non-shrunken, but already AxV positive cells in comparison to viable cells did not change or was even decreased. This is in line with studies from Beaver et al., who has reported about an early and strong decrease in Glc-NAc-containing structures associated with the start of apoptosis, before or concurrently with PS exposure [162]. At later stages of apoptosis exposure of Glc-NAc-containing structures increased again. These major changes in the composition of the plasma membrane are explained with certain hydrolysis steps and removal of cell-surface structures followed by final incorporation of internal membranes into the plasma membrane [162]. This report is in line with our observations. The changes of the plasma membranes in early apoptosis may result in lower binding of lectins. In the late stages of apoptosis cells expose high amounts lectin-binding sites again resulting in higher MFI of lectin positive cells. Already proposed by Duvall et al. in 1985 and Beaver et al. in 1999, it was shown only recently that indeed after shrinkage apoptotic cells expose internal membrane- derived epitopes on their plasma membranes [6]. Exposed immature glycoproteins without the protective sialic acid or surface proteins that have lost N-acetyl neuraminic acid-residues play an immense role for the recognition by lectins [6,125]. The C-type lectin CLEC4L/DC-SIGN has also been reported to bind unsialylated Lewis X epitopes with high affinity. Treatment of monocytes with neuraminidase creates unsialylated Lewis X epitopes und thus CLEC4L/DC-SIGN binding sites [163]. Immense role for human C-type lectin receptors for the recognition, clearance and processsing of apoptotic cells is clearly expected.

83 4 Discussion

4.2 C-type lectin CLEC9A/DNGR1 binds late apoptotic PMN endowed with intact membranes

PI staining is widely used to exclude necrotic from viable and apoptotic cells and to verify membrane integrity [164,165]. In vitro cells undergoing apoptosis eventually enter the stage of secondary necrosis finally becoming positive for PI. In own experiments secondary necrosis and thus AxV/PI double positivity is observed within few hours after apoptosis induction by UV-B irradiation of PBL and lymphoblasts. PMN that spontaneously undergo apoptosis in vitro after isolation [166] remain PI negative many hours after isolation. Different groups have measured PI positivity of aged PMN with 8 % PI positive cells after 29 h in vitro ageing [164] and only 11 % PI positive cells of the total PMN population after 48 h ageing [167]. In own experiments similar observations for PMN were made with AxV/PI staining: almost all aged PMN showed AxV positivity and were PI negative/low after ageing for 24 h. When apoptotic PMN were stained with the C-type lectin CLEC9A/DNGR1-FITC, interestingly only aged PMN from the shrunken population were positive for CLEC9A/DNGR1. The CLEC9A/DNGR1 positive fraction was only low positive for PI. It was not clear, if this population was still membrane intact or not since primary necrotic PMN showed a high CLEC9A/DNGR1 binding and a high PI signal. The hypothesis was, if the CLEC9A/DNGR1 positive PMN population still had an intact membrane; it should be possible to increase the PI signal after induction of necrosis by heat. However, there was no or only a minor increase in the PI signal after heat shock. DNA fragmentation is a very important feature occurring during apoptosis, which is only found in cells already positive for AxV binding [168]. Assuming that the shrunken PMN population has already progressed to late stages of apoptosis, the DNA must be strongly degraded leaving hardly any opportunity for PI intercalation and thus resulting in a low PI signal which cannot be increased much further. In conclusion, a nucleic acid labelling such as PI staining was not the appropriate method to characterize late apoptotic PMN. Trypan Blue exclusion is a widely used method to differentiate viable from necrotic cells [168]. Usually the staining is analysed by counting positive and negative Trypan Blue-stained cells using a hemocytometer. We have employed Trypan Blue staining with final analysis by flow cytometry. Aged, CLEC9A/DNGR1 positive PMN did show a low positivity for Trypan Blue. This signal reproducibly doubled after heat shock. By taking in consideration that the CLEC9A/DNGR1 positive PMN fraction is already

84 4 Discussion highly decreased in size leaving less stainable cytoplasm the Trypan Blue signal cannot be increased to the same intensity as early apoptotic, non-shrunken, CLEC9A/DNGR1 negative PMN. A cytoplasm staining employing Calcein-AM showed that shrunken aged Calcein-stained, fixed PMN still lost Calcein during heat treatment, indicating a residual ion selectivity of their plasma membranes before heating. Final analysis employing confocal microscopy clearly showed circular- surface stained CLEC9A/DNGR1 positive PMN indicating membrane integrity. The staining pattern differed completely for heat-necrotized PMN. Necrotized PMN clearly displayed cytoplasm staining of CLEC9A/DNGR1. CLEC9A/DNGR1 recognizes a bunch of necrotic (PI positive) cells. However, CLEC9A/DNGR1 also binds to late stage apoptotic PMN that have still preserved their membrane integrity. PMN are very special in their apoptotic progress. Only for PMN we observed a late apoptosis state with AxV positivity and still membrane integrity. Low PI or Trypan Blue positivity might result from sticking to DNA or cytoplasm epitopes exposed on the cell surface during apoptosis. Sancho et al. has reported that CLEC9A/DNGR1 recognizes a preformed signal that is exposed on necrotic cells [42]. This is true and was verified in own experiments for other cell types except for PMN. The ligand of CLEC9A/DNGR1 is still unknown. There are hints that the ligand(s) is(are) predominantly cytoplasmic, resistant to glycosidase and nuclease treatment but susceptible to the action of proteases, heat and low pH [42]. Sancho et al. concludes that CLEC9A/DNGR1 recognizes an ubiquitous preformed acid-labile protein associated ligand(s) that is normally sequestered in healthy cells, but becomes exposed during necrosis, after loss of membrane integrity [42]. We agree that the CLEC9A/DNGR1 ligand is cytoplasmic that becomes accessible when membrane integrity is lost due to necrosis induction, but which is also exposed on the cell surfaces of PMN during apoptosis. According to own experiments it is probably a protein which is heat stable at about 60 °C and that denaturates above 80°C. Benzonase treatment of PMN slightly increased CLEC9A/DNGR1 positivity, possibly by increasing accessibility. That the ligand is not of nuclear origin is assumed as neither DNA nor nucleosomes inhibit the binding. The results presented above point out that one has to be aware that PI negativity is no evidence for non-necrotic cells since DNA might already be degraded during the course of apoptosis. CLEC9A/DNGR1, however, has clearly demonstrated that PMN

85 4 Discussion indeed maintain membrane integrity over a long time and emphasize their important role in studying apoptotic cell death. CLEC9A/DNGR1 binds not only to necrotic, but already to late apoptotic PMN. This feature could make CLEC9A/DNGR1 an important lectin regarding recognition, clearance and processing of late apoptotic cells. If not cleared on time, CLEC9A/DNGR1 might serve as very last chance for the recognition and clearance of late apoptotic PMN before entering secondary necrosis. Though not required for the uptake of necrotic cell material [42], it might be different for late apoptotic still membrane intact PMN. It is reported that CLEC9A is necessary for efficient cross- presentation of dead-cell-associated antigens by CD8α+ dendritic cells. A role for cross-presentation of altered-self late apoptotic PMN antigens by CD8α+ dendritic cells is likely but remains to be elucidated.

4.3 C-type lectin CLEC4L/DC-SIGN binds apoptotic cells endowed with intact membranes

In co-incubation studies of CLEC4L/DC-SIGN over-expressing Raji cells interaction with CFDA-SE-labelled apoptotic PMN has been observed by increasing MFI FITC of Raji-CLEC4L/DC-SIGN cells employing flow cytometry analysis and by strong aggregation of Raji-CLEC4L/DC-SIGN with dying PMN employing fluorescence microscopy. This interaction could be inhibited with CLEC4L/DC-SIGN specific mannan. Several surface molecules on PMN have been reported to bind CLEC4L/DC-SIGN. CLEC4L/DC-SIGN binds CD11b/CD18 heterodimer Mac-1 [169,170] and carcinoembryonic antigen-related cellular adhesion molecule (CEACAM)1 on neutrophils [171-173] thereby mediating PMN-DC communication. Importantly, all these molcecules contain Lewis X epitopes [173,174], which are unsialylated carbohydrate structures. Lewis X epitopes are rarely expressed on monocytes leading to weak binding by CLEC4L/DC-SIGN [163]. However, enhanced binding of soluble CLEC4L/DC-SIGN to monocytes is observed after neuraminidase treatment when the protective sialic acid is removed [163]. Though ICAM-3 on PMN seems to be a ligand for DC-SIGN (DC-specific ICAM-3 grabbing nonintegrin) it is reported by van Gisbergen et al. that its binding to DC-SIGN is rather low [169]. The group of Bogoevska et al. has investigated different peripheral blood cells and observed DC-SIGN binding only to ICAM-3 from granulocytes [175]. That is not

86 4 Discussion contradictory with van Gisbergen et al., since ICAM-3 also expresses Lewis x residues [175] which are bound by DC-SIGN. However, strong ligands for CLEC4L/DC-SIGN on neutrophils seem to be rather Mac-1 and CEACAM1. This leads to the conclusion, that immature unsialylated proteins exposed on apoptotic cells should be indeed targets for CLEC4L/DC-SIGN and that binding to apoptotic PMN should be stronger than to viable ones. A study with apoptotic neutrophils supports this hypothesis. Down-regulation of CLEC4L/DC-SIGN on DC upon engulfment of apoptotic PMN and the incomplete inhibition of apoptotic cell uptake of DC by a blocking CD209-specific antibody suggest that this receptor may be involved in the engulfment of apoptotic neutrophils [176]. Regarding our observations we suggest, that apoptozing PMN have exposed more unsialylated Lewis X epitopes on their plasma membrane and that they bind CLEC4L/DC-SIGN stronger than viable PMN. Once described as main ligand on T cells for the interaction with CLEC4L/DC-SIGN on DC [19], it seems that other receptors than ICAM-3 must play a role in DC-T-cell- interaction since native ICAM-3 from monocytes, T or B lymphocytes did not bind DC-SIGN [175]. This contradictory is probably due to differences in glycosylation between recombinant [19] and native ICAM-3 glycoprotein [175] employed in the studies. Via ICAM-3 on resting T cells T cell proliferation is induced. This DC-induced proliferation of resting T cells was blocked in the presence of anti-DC-SIGN antibodies [19] indicating that DC-SIGN plays an important role in this initial DC- resting T cell-contact. In contrast, T cell stimulation of activated PHA-IL-2 activated T cells was not inhibited in the presence of anti-DC-SIGN antibodies or ICAM-3 antibodies [19]. It is not clear why interactions between other surface molecules between DC and activated T cell take over. It is reported, that anti-CD3-stimulated PBMCs released soluble ICAM-3 with coincidently ICAM-3 down-regulation from the cell surface [177]. This indicates a minor role for the interaction of CLEC4L/DC-SIGN with ICAM-3 on activated T cells. These reports support our hypothesis that the increased binding of Raji-CLEC4L/DC-SIGN to apoptotic blebs that was inhibited in the presence of CLEC4L/DC-SIGN specific mannan results mainly from exposure of sugar epitopes on the surface of the blebs that were budded from the heavily altered glycocalyx of the plasma membrane of apoptotic activated T cells. As only immunization studies can finally answer the question whether a ligand, an adaptor, or a receptor is involved in the modulation of the post-clearance responses,

87 4 Discussion an immunization of WT and CLEC4L/DC-SIGN KO mice with apoptotic cells would be necessary. Although CLEC4L/DC-SIGN is specifically expressed on human DC, there is no murine homologue with identical expression and glycan specificity [178]. The murine DC subset does not express a murine DC-SIGN equivalent to human DC-SIGN. This makes in vivo evaluation of DC-SIGN related scientific questions and of potential DC-SIGN targeting vaccines very difficult [178]. Recently, a human DC- SIGN transgenic mouse [179] has been generated to investigate DC-SIGN related questions. This model system has been successful to evaluate DC-SIGN targeting vaccines [178]. This mouse model might also be useful for the evalution, whether CLEC4L/DC-SIGN is involved in the uptake and processing of late apoptotic cells and in the modulation of post-clearance responses.

4.4 C-type lectin CLEC7A/Dectin-1 downregulates the response against late apoptotic and primary necrotic cells

CLEC7A/Dectin-1 is a non-classical C-type lectin receptor [34] that predominantly recognizes ß-glucans. It has an ITAM-like motif and therewith mediates transmembrane signalling enabling cellular functions such as fungal binding, uptake, killing, and induction of cytokines and chemokines [34]. Experiments analysing the function of CLEC7A/Dectin-1 usually employ laminarin (soluble glucan polysaccharides), curdlan (a polysaccharide of pure ß(1,3)-linked glucose), or zymosan [180]. Zymosan is an extract derived from the cell wall of Saccharomyces cerevisiae, which is composed of β(1,3)-glucans and β(1,6)-glucans but also contains α-mannans and mannoproteins [181]. Interestingly, the binding of soluble CLEC7A/Dectin-1 to yeast was inhibited by soluble ß-glucan (laminarin), but not by mannan, chitin or other yeast cell wall components [182]. Although CLEC7A/Dectin-1 is not reported to recognize mannose structures, other carbohydrate structures exposed on apoptotic or necrotic cells might be targeted by CLEC7A/Dectin-1. Though no direct binding of fusion protein mCLEC7A/Dectin-1 to apoptotic or necrotic cells was detected in own experiments, differences were observed after co- incubation of RAW246.7 macrophages with and without CLEC7A/Dectin-1 overexpression with fluorescence-labelled apoptotic and necrotic cells. Analyses by flow cytometry always displayed higher fluorescence accumulation in RAW macrophages with CLEC7A/Dectin-1 overexpression. In the presence of

88 4 Discussion

CLEC7A/Dectin-1 specific laminarin, but not CLEC4L/DC-SIGN specific mannan, this interaction could be slightly but significantly inhibited. A difference in uptake, degradation or signalling after phagocytosis of dead and dying cells mediated via CLEC7A/Dectin-1 possibly in co-operation with other co-factors or co-receptors was hypothesized. Supporting investigations were made by Weck et al. An increased binding of hDectin- 1 extracellular domain (ECD) to apoptotic HEK-293 compared to untreated cells was observed [32]. Even the uptake of apoptotic HEK-293 cells by immature monocyte- derived DC was inhibited slightly, more and most in the presence of the ECD of hDectin-1b, zymosan and hDectin-1 specific ß-1,3-glucan polymer curdlan, respectively [32]. In both humans and mice, CLEC7A/Dectin-1 is predominantly expressed on myeloid cells (monocytes/macrophage, dendritic cells and neutrophils). A subset of T cells also expresses CLEC7A/Dectin-1, but at lower levels. [28,33,34]. CLEC7A/Dectin-1 function appears to be similar; however, phagocytes deficient in CLEC7A/Dectin-1 only show defects in cytokine responses, suggesting that other receptors, such as the mannose receptor, are responsible for fungal uptake and killing in humans [33]. Whereas in mice such a defect results in susceptibility to systemic and mucosal candidiasis, humans seem only being susceptible to mucocutaneous, but not systemic, candidiasis [33]. However, it has been reported that hDectin-1 binds to apoptotic cells, facilitates their uptake by DC, and mediates cross-presentation of cell-derived antigens [32]. Different epitopes on fungi and apoptotic cells might foster different functions and signalling via CLEC7A/Dectin-1 receptor. Also serum- or other co-factors as well as co-receptors might be involved in the complex process of dead and dying cell recognition, uptake and further processing. To analyse the role of CLEC7A/Dectin-1 for the processing of late apoptotic and/or necrotic cells in the “in vivo” situation, SV129 WT and SV129 CLEC7A/Dectin-1 KO mice were immunized (i.p.) with viable, primary necrotic or apoptotic PMN. The latter were chosen as they are special according to their apoptosis progress and their long membrane integrity as already shown employing C-type lectin CLEC9A/DNGR1 staining. Immune responses after immunizations were examined analysing the DTH response, splenocyte count and the antibody production in the mice. SV129 CLEC7A/Dectin-1

89 4 Discussion

KO mice immunized with viable, primary necrotic, or apoptotic PMN always showed a higher foot swelling and thus an enhanced T cell mediated immune response compared to WT mice. This was highly significant for primary necrotic PMN. This was in line with the observation of enlarged spleens of immunized CLEC7A/Dectin-1 KO and a significantly increased splenocyte count of CLEC7A/Dectin-1 KO mice immunized with primary necrotic or apoptotic PMN when compared with WT mice. The anti-PMN IgG production in obtained serum from the final blood draw from WT and KO mice was also significantly higher in CLEC7A/Dectin-1 KO mice immunized with primary necrotic and apoptotic PMN when compared with WT mice. Upon immunization with egg white plus CLEC7A/Dectin-1 agonist curdlan of naive C57BL/6 mice, curdlan acted as an adjuvant for TH-17 and TH1 responses and antibody production in vivo [183]. It was demonstrated for the first time that CLEC7A/Dectin-1-mediated signalling can trigger adaptive immune responses via CLEC7A/Dectin-1–Syk–CARD9 independent of the TLRs [183]. Interestingly, in our studies upon immunization with dead and dying cells our results point out to a more inflammatory response in the absence of CLEC7A/Dectin-1. The inflammatory response in CLEC7A/Dectin-1 KO mice is accelerated, which is rather surprising since CLEC7A/Dectin-1 contains an ITAM-like motif. One may speculate that the loss of CLEC7A/Dectin-1 might create a dysregulation in the clearance of dead and dying cells. The cells might enter later stages of apoptosis provoking increased inflammation. If CLEC7A/Dectin-1 is present on the phagocytes, apoptotic cells might be cleared more efficiently provoking less inflammation. In vitro data with CLEC7A/Dectin-1 overexpressing RAW macrophages which accumulate more fluorescence after co-incubation with fluorescence-labelled dead prey also point to a better uptake of CLEC7A/Dectin-1 expressing cells. A co-operation with other phagocytic receptors or other soluble co-factors is possible since murine CLEC7A/Dectin-1 fusion protein on its own did not bind dead or dying cells. In other studies it was demonstrated that dysregulation in clearance indeed shifts anti- inflammatory response to inflammation. It was demonstrated, that the presence of soluble AxV that binds apoptotic and necrotic cells, impairs their clearance by blocking the “eat me signal” PS and increases thereby their immunogenicity. This was clearly seen in AxV KO compaired to WT mice with endogenous AxV. WT mice showed a strong, allogeneic delayed-type hypersensitivity (DTH) reaction, but also

90 4 Discussion the addition of AxV to apoptotic cells prior to their injection into mice increased their immunogenicity significantly [51]. Regarding the various viability conditions of the injected cells there were no significant differences. We argue that the apoptotic cells as well as viable cells became necrotic within mice after injection. Apoptotic cells appear to become secondary necrotic, thereby releasing the same danger signals as the injected heat- induced primary necrotic cells and therefore causing inflammatory response. In parallel performed in vitro studies support the in vivo data. Thioglycollate-elicited macrophages and also BMDDC from WT and CLEC7A/Dectin-1 KO mice were co- incubated with apopototic and secondary necrotic human PMN for 16 and 21 h, respectively. The supernatant was harvested and analysed for cytokine production. Only cytokines levels far above the “blank” were considered. Apoptotic and secondary necrotic cells alone did not have relevant effects on cytokine production of thioglycollate-elicited macrophages and BMDDC as also reported for human monocytes and human monocyte derived macrophages in co-incubation of viable, apoptotic or heat-necrotized PBL [184]. Therefore only the influence on LPS-induced cytokine production was analysed. It is known, that IL-6 and TNFα is secreted by thioglycollate-elicited peritoneal macrophages after LPS-stimulation [185]. In our experiments the overall LPS- induced TNFα-production was decreased by apoptotic and secondary necrotic PMN for WT and CLEC7A/Dectin-1 KO macrophages. That apoptotic cells strongly inhibit the secretion of pro-inflammatory cytokines, such as TNFα, from LPS pre-stimulated macrophages is reported by various groups [44,45,184,186]. Also heat-induced primary necrotic cells have been shown to reduce the production of LPS-induced TNFα-production in monocytes [184], as well as in human monocyted-derived macrophages [51,184]. It is discussed that the engagement of CD36 by necrotic cells might mediate anti-inflammatory clearance like for apoptotic cells [45,184]. Also, once necrotic cells have released their “danger signals” they might be removed without causing inflammation [184]. Thus, it must be considered, that it makes a difference how necrosis is induced either by heat, mechanical stress [51] or other stimuli and how quickly the necrotized cells are employed in the assay, since heat- labile or short-lived danger signals might get lost. The secondary cells employed in the assay where aged followed by heat-necrosis. Danger signals might have been already degraded by ageing and/or destroyed by heat treatment leaving behind cells

91 4 Discussion with surface structures that resemble apoptotic cells leading to clearance without provoking inflammation. When compared directly no difference in TNFα downregulation between WT and CLEC7A/Dectin-1 KO macrophages was to be observed. The overall LPS-induced IL-6 production was also decreased by apoptotic and secondary necrotic PMN for WT and CLEC7A/Dectin-1 KO thioglycollate-elicited macrophages. Cocco et al. also reported about strong inhibition of IL-6 release from LPS-stimulated macrophages in the presence of apoptotic cells [186]. In the presence of heat induced primary necrotic cells an increased IL-6 and TNFα-release from LPS-stimulated macrophages was observed [186]. The secondary PMN employed in our assays might have lost their pro-inflammatory potential already, as discussed above. When compared directly, a significantly higher IL-6 secretion by thioglycollate-elicited macrophages of WT mice in response to apoptotic or secondary necrotic human PMN was determined. Usually IL-6 is regarded as pro-inflammatory, but it is also discussed that its presence may have anti-inflammatory effects and maybe therefore considered an ‘ambivalent cytokine’. IL-6 inhibits the production of the pro- inflammatory cytokines TNFα and IL-1 [187,188] and activates the induction of IL- 1Ra synthesis and the release of soluble TNF receptors [189]. When challenged with fungi, antigen presenting cells engage the yeast and immune responses are activated via several PRR including the TLR and CLEC7A/Dectin-1. Inflammatory cytokine production of TNFα, IL-6 and others is triggered [33]. In our assays it is not clear whether the produced IL-6 has to be regarded as pro- or anti-inflammatory. The answer will rather dependent on the context. The reduction in TNFα production could be just a matter of the presence of apoptotic cells as discussed above. BMDDC are known to secrete cytokines such as TNFα, IL-6, and IL-1α upon LPS stimulation [190]. This was confirmed in own experiments. As already observed for thioglycollate-elicited macrophages co-incubation of BMDDC with apoptotic and secondary necrotic cells also led to a LPS-induced inhibition of TNFα production. Again there was no significant difference between WT and KO. Interestingly, in case of WT mice a significant up-regulation of IL-6 in the presence of secondary necrotic PMN was observed. Again it is not clear if IL-6 acts as pro-inflammatory or as anti- inflammatory cytokine. For IL-1α the inflammatory response in CLEC7A/Dectin-1 KO is rather clear; significantly less IL-1α production was observed in WT BMDDC in response to human apoptotic PMN when compared to CLEC7A/Dectin-1 KO. Here

92 4 Discussion the anti-inflammatory response of apoptotic PMN is overridden by strong inflammatory response in the absence of CLEC7A/Dectin-1 in BMDDC. Released danger signals upon progression to secondary necrosis might result in strong inflammatory response in the absence of CLEC7A/Dectin-1. Huang et al. reported, that a coadministration of yeast glucan particles plus CpG

(TLR9 agonist) or yeast glucan particles plus Pam3CSK4 (TLR2/1 agonist) resulted in CLEC7A/Dectin-1 mediated upregulation of IL-1α and its secretion by BMDDC [191]. In own experiments a coadministration of apoptotic cells plus LPS (TLR4 agonist) led to a rather anti-inflammatory response upon engagement of CLEC7A/Dectin-1. The lack of CLEC7A/Dectin-1 leads to an inflammatory response against apoptotic cells. In contrast to BMDDC, macrophages might be capable of compensating the loss of CLEC7A/Dectin-1 with the help of other phagocytic receptors or adaptor molecules. Taken together, our in vivo and in vitro results strongly support CLEC7A/Dectin-1 being a negative regulatory lectin for the immunogenicity of apoptotic and primary necrotic cells. This is particularly interesting since CLEC7A/Dectin-1 is carrying an ITAM-like motif. However, CLEC7A/Dectin-1 can interact with other MyD88-coupled TLRs (TLR-2, TLR-4, TLR-5, TLR7, TLR-9) [33,36,37]. In response to apoptotic or necrotic cells an interaction with other receptors or co-factors and, thereby, modulating the immune response is likely. However, until now, there is no known mechanism and no explanation, why CLEC7A/Dectin-1 should attenuate the immune response against late apoptotic and necrotic cells; this remains to be explored further. If CLEC7A/Dectin-1 is a negative and immunosuppressive regulator during clearance of dying cells, cellular immune intervention involving CLEC7A/Dectin-1 ligands would be a therapeutic concept in SLE. SLE is linked with clearance deficiency [153,192]. Clearance-deficiency may lead to the accumulation of putative pro-inflammatory nuclear autoantigens [193]. Anti-dsDNA autoantibody-mediated phagocytosis of secondary necrotic cell–derived material (SNEC) by healthy donor–derived monocytes resulted in secretion of inflammatory cytokines, predominantly IL-1ß [194]. An in vivo model of systemic autoimmunity could be employed to confirm the negative regulatory role of CLEC7A/Dectin-1. Here, intraperitoneal injection of the naturally occurring hydrocarbon oil Tetramethylpentadecane (TMPD, commonly known as pristane), induces a chronic inflammation and the accumulation of dying cells in the peritoneal cavity. In consequence, most strains of mice develop an SLE-

93 4 Discussion like disease [195]. According to our hypothesis the course of lupus-like disease linked with the production of autoantibodies and high levels of IFN-I after pristane injection should be accelerated in CLEC7A/Dectin-1 KO mice.

94 5 Concluding remarks

5 Concluding remarks

Our hypotheses, (I) mammalian cells expose neo-epitopes in the late stages of apoptosis that are recognized by several exogenous and endogenous lectins, (II) surface lectins of DC recognize and bind ligands exposed by late apoptotic cells, (III) surface lectins and adaptors are involved in the clearance of late apoptotic or necrotic cells, (IV) lectins, involved in the clearance of apoptotic and necrotic cells, modulate their immunogenicity and inflammatory potential, have been confirmed for the plant lectins NPn and GSL II (I) and for the C-type lectins CLEC9A/DNGR1 (I, II), CLEC4L/DC-SIGN (I, II) and CLEC7A/Dectin-1 (III, IV). In vivo models involving the immunization with apoptotic or necrotic cells of CLEC4L/DC-SIGN transgenic and CLEC9A/DNGR1 KO mice models would be worth to perform to investigate hypothesis (III, IV) for the C-type lectins CLEC4L/DC-SIGN and CLEC9A/DNGR1. Taken together, the data highlight the importance of lectins in the clearance process. Usually apoptotic cells are removed early via PS-dependent recognition mechanisms. However, if apoptotic cells escape clearance their removal via PS- independent recognition mechanisms comes into focus. Altered carbohydrate structures and modified autoantigens are exposed on late apoptotic cells and may serve as targets for soluble lectins, lectin receptors or adaptor molecules. These adaptors and receptors then bridge phagocytes with late apoptotic cells. Several lectin receptors are found on professional macrophages or DC. It is very likely that further surface lectins can influence the clearance of late apoptotic cells and modulate their immunogenicity and inflammatory potential. This thesis points out that the role of C-type lectins in immune stimulation in co-operation with other phagocytic receptors or adaptor molecules requires deeper understanding and encourages further investigation. Their role in clearance and clearance deficiency seems to be more important than assumed yet. C-type lectins may be linked to the clearance deficiency observed in patients with autoimmune diseases such as SLE. If involved in the clearance process of late apopotic cells C-type lectins may either foster or attenuate autoimmune responses and may become thus a therapeutic target in SLE.

95 6 References

6 References

[1] Barondes SH 1988. Bifunctional properties of lectins: lectins redefined. Trends Biochem Sci 13: 480-2. [2] Cambi A, Figdor CG 2003. Dual function of C-type lectin-like receptors in the immune system. Curr Opin Cell Biol 15: 539-46. [3] Lis H, Sharon N 1998. Lectins: Carbohydrate-Specific Proteins That Mediate Cellular Recognition. Chem Rev 98: 637-674. [4] Boyd WC, Shapleigh E 1954. Separation of individuals of any blood group into secretors and non-secretors by use of a plant agglutinin (lectin). Blood 9: 1194-8. [5] Sharon N, Lis H 1972. Lectins: cell-agglutinating and sugar-specific proteins. Science 177: 949-59. [6] Franz S, Herrmann K, Fuhrnrohr B, Sheriff A, Frey B et al. 2007. After shrinkage apoptotic cells expose internal membrane-derived epitopes on their plasma membranes. Cell Death Differ 14: 733-42. [7] Gabius HJ 2009. The Sugar Code: Fundamentals of Glycosciences. WILEY- VCH Verlag GmbH & Co. KGaA, Weinheim, pp. 597. [8] Gabius HJ 2001. Eukaryotic Glycosylation and Lectins: Hardware of the Sugar Code (Glycocode) in Biological Information Transfer Electronic Journal of Pathology and Histology 7: 05. [9] Kilpatrick DC 2002. Animal lectins: a historical introduction and overview. Biochim Biophys Acta 1572: 187-97. [10] Drickamer K, Taylor ME 1993. Biology of animal lectins. Annu Rev Cell Biol 9: 237-64. [11] Zelensky AN, Gready JE 2005. The C-type lectin-like domain superfamily. FEBS J 272: 6179-217. [12] Willment JA, Gordon S, Brown GD 2001. Characterization of the human beta -glucan receptor and its alternatively spliced isoforms. J Biol Chem 276: 43818-23. [13] Drickamer K 1993. Evolution of Ca(2+)-dependent animal lectins. Prog Nucleic Acid Res Mol Biol 45: 207-32. [14] Drickamer K, Fadden AJ 2002. Genomic analysis of C-type lectins. Biochem Soc Symp59-72. [15] Zelensky AN, Gready JE 2004. C-type lectin-like domains in Fugu rubripes. BMC Genomics 5: 51. [16] Figdor CG, van Kooyk Y, Adema GJ 2002. C-type lectin receptors on dendritic cells and Langerhans cells. Nat Rev Immunol 2: 77-84. [17] Drickamer K 1999. C-type lectin-like domains. Curr Opin Struct Biol 9: 585- 90.

96 6 References

[18] Cambi A, Figdor C 2009. Necrosis: C-type lectins sense cell death. Curr Biol 19: R375-8. [19] Geijtenbeek TB, Torensma R, van Vliet SJ, van Duijnhoven GC, Adema GJ et al. 2000. Identification of DC-SIGN, a novel -specific ICAM- 3 receptor that supports primary immune responses. Cell 100: 575-85. [20] Kerrigan AM, Brown GD 2009. C-type lectins and phagocytosis. Immunobiology. [21] Koppel EA, Ludwig IS, Appelmelk BJ, van Kooyk Y, Geijtenbeek TB 2005. Carbohydrate specificities of the murine DC-SIGN homologue mSIGNR1. Immunobiology 210: 195-201. [22] Koppel EA, van Gisbergen KP, Geijtenbeek TB, van Kooyk Y 2005. Distinct functions of DC-SIGN and its homologues L-SIGN (DC-SIGNR) and mSIGNR1 in pathogen recognition and immune regulation. Cell Microbiol 7: 157-65. [23] Geijtenbeek TB, Groot PC, Nolte MA, van Vliet SJ, Gangaram-Panday ST et al. 2002. Marginal zone macrophages express a murine homologue of DC- SIGN that captures blood-borne antigens in vivo. Blood 100: 2908-16. [24] Geijtenbeek TB, Gringhuis SI 2009. Signalling through C-type lectin receptors: shaping immune responses. Nat Rev Immunol 9: 465-79. [25] Gringhuis SI, den Dunnen J, Litjens M, van Het Hof B, van Kooyk Y et al. 2007. C-type lectin DC-SIGN modulates Toll-like receptor signaling via Raf-1 kinase-dependent acetylation of transcription factor NF-kappaB. Immunity 26: 605-16. [26] Geijtenbeek TB, Van Vliet SJ, Koppel EA, Sanchez-Hernandez M, Vandenbroucke-Grauls CM et al. 2003. Mycobacteria target DC-SIGN to suppress dendritic cell function. J Exp Med 197: 7-17. [27] Robinson MJ, Sancho D, Slack EC, LeibundGut-Landmann S, Reis e Sousa C 2006. Myeloid C-type lectins in innate immunity. Nat Immunol 7: 1258-65. [28] Taylor PR, Brown GD, Reid DM, Willment JA, Martinez-Pomares L et al. 2002. The beta-glucan receptor, dectin-1, is predominantly expressed on the surface of cells of the monocyte/macrophage and lineages. J Immunol 169: 3876-82. [29] Willment JA, Marshall AS, Reid DM, Williams DL, Wong SY et al. 2005. The human beta-glucan receptor is widely expressed and functionally equivalent to murine Dectin-1 on primary cells. Eur J Immunol 35: 1539-47. [30] Olynych TJ, Jakeman DL, Marshall JS 2006. Fungal zymosan induces leukotriene production by human mast cells through a dectin-1-dependent mechanism. J Allergy Clin Immunol 118: 837-43. [31] Brown GD, Taylor PR, Reid DM, Willment JA, Williams DL et al. 2002. Dectin-1 is a major beta-glucan receptor on macrophages. J Exp Med 196: 407-12. [32] Weck MM, Appel S, Werth D, Sinzger C, Bringmann A et al. 2008. hDectin- 1 is involved in uptake and cross-presentation of cellular antigens. Blood 111: 4264-72.

97 6 References

[33] Reid DM, Gow NA, Brown GD 2009. Pattern recognition: recent insights from Dectin-1. Curr Opin Immunol 21: 30-7. [34] Brown GD 2006. Dectin-1: a signalling non-TLR pattern-recognition receptor. Nat Rev Immunol 6: 33-43. [35] Ozinsky A, Underhill DM, Fontenot JD, Hajjar AM, Smith KD et al. 2000. The repertoire for pattern recognition of pathogens by the innate immune system is defined by cooperation between toll-like receptors. Proc Natl Acad Sci U S A 97: 13766-71. [36] Dennehy KM, Ferwerda G, Faro-Trindade I, Pyz E, Willment JA et al. 2008. Syk kinase is required for collaborative cytokine production induced through Dectin-1 and Toll-like receptors. Eur J Immunol 38: 500-6. [37] Ferwerda G, Meyer-Wentrup F, Kullberg BJ, Netea MG, Adema GJ 2008. Dectin-1 synergizes with TLR2 and TLR4 for cytokine production in human primary monocytes and macrophages. Cell Microbiol 10: 2058-66. [38] Huysamen C, Willment JA, Dennehy KM, Brown GD 2008. CLEC9A is a novel activation C-type lectin-like receptor expressed on BDCA3+ dendritic cells and a subset of monocytes. J Biol Chem 283: 16693-701. [39] Kerrigan AM, Brown GD 2010. Syk-coupled C-type lectin receptors that mediate cellular activation via single tyrosine based activation motifs. Immunol Rev 234: 335-52. [40] Sancho D, Mourao-Sa D, Joffre OP, Schulz O, Rogers NC et al. 2008. Tumor therapy in mice via antigen targeting to a novel, DC-restricted C-type lectin. J Clin Invest 118: 2098-110. [41] Caminschi I, Proietto AI, Ahmet F, Kitsoulis S, Shin Teh J et al. 2008. The dendritic cell subtype-restricted C-type lectin Clec9A is a target for vaccine enhancement. Blood 112: 3264-73. [42] Sancho D, Joffre OP, Keller AM, Rogers NC, Martinez D et al. 2009. Identification of a dendritic cell receptor that couples sensing of necrosis to immunity. Nature 458: 899-903. [43] Kerr JF, Wyllie AH, Currie AR 1972. Apoptosis: a basic biological phenomenon with wide-ranging implications in tissue kinetics. Br J Cancer 26: 239-57. [44] Fadok VA, Bratton DL, Konowal A, Freed PW, Westcott JY et al. 1998. Macrophages that have ingested apoptotic cells in vitro inhibit proinflammatory cytokine production through autocrine/paracrine mechanisms involving TGF- beta, PGE2, and PAF. J Clin Invest 101: 890-8. [45] Voll RE, Herrmann M, Roth EA, Stach C, Kalden JR et al. 1997. Immunosuppressive effects of apoptotic cells. Nature 390: 350-1. [46] Munoz LE, Lauber K, Schiller M, Manfredi AA, Herrmann M The role of defective clearance of apoptotic cells in systemic autoimmunity. Nat Rev Rheumatol 6: 280-9. [47] Lieberthal W, Levine JS 1996. Mechanisms of apoptosis and its potential role in renal tubular epithelial cell injury. Am J Physiol 271: F477-88.

98 6 References

[48] Wu X, Molinaro C, Johnson N, Casiano CA 2001. Secondary necrosis is a source of proteolytically modified forms of specific intracellular autoantigens: implications for systemic autoimmunity. Arthritis Rheum 44: 2642-52. [49] Gaipl US, Beyer TD, Baumann I, Voll RE, Stach CM et al. 2003. Exposure of anionic phospholipids serves as anti-inflammatory and immunosuppressive signal--implications for antiphospholipid syndrome and systemic lupus erythematosus. Immunobiology 207: 73-81. [50] Gaipl US, Franz S, Voll RE, Sheriff A, Kalden JR et al. 2004. Defects in the disposal of dying cells lead to autoimmunity. Curr Rheumatol Rep 6: 401-7. [51] Munoz LE, Franz S, Pausch F, Furnrohr B, Sheriff A et al. 2007. The influence on the immunomodulatory effects of dying and dead cells of Annexin V. J Leukoc Biol 81: 6-14. [52] Kroemer G, Martin SJ 2005. Caspase-independent cell death. Nat Med 11: 725-30. [53] Galluzzi L, Maiuri MC, Vitale I, Zischka H, Castedo M et al. 2007. Cell death modalities: classification and pathophysiological implications. Cell Death Differ 14: 1237-43. [54] Hsu H, Xiong J, Goeddel DV 1995. The TNF receptor 1-associated protein TRADD signals cell death and NF-kappa B activation. Cell 81: 495-504. [55] Scaffidi C, Fulda S, Srinivasan A, Friesen C, Li F et al. 1998. Two CD95 (APO-1/Fas) signaling pathways. EMBO J 17: 1675-87. [56] Zimmermann KC, Bonzon C, Green DR 2001. The machinery of programmed cell death. Pharmacol Ther 92: 57-70. [57] Lavrik I, Golks A, Krammer PH 2005. Death receptor signaling. J Cell Sci 118: 265-7. [58] Levine AJ 1997. p53, the cellular gatekeeper for growth and division. Cell 88: 323-31. [59] Kulms D, Schwarz T 2000. Molecular mechanisms of UV-induced apoptosis. Photodermatol Photoimmunol Photomed 16: 195-201. [60] Schuler M, Bossy-Wetzel E, Goldstein JC, Fitzgerald P, Green DR 2000. p53 induces apoptosis by caspase activation through mitochondrial cytochrome c release. J Biol Chem 275: 7337-42. [61] Zou H, Li Y, Liu X, Wang X 1999. An APAF-1.cytochrome c multimeric complex is a functional apoptosome that activates procaspase-9. J Biol Chem 274: 11549-56. [62] Acehan D, Jiang X, Morgan DG, Heuser JE, Wang X et al. 2002. Three- dimensional structure of the apoptosome: implications for assembly, procaspase-9 binding, and activation. Mol Cell 9: 423-32. [63] Jiang X, Wang X 2004. Cytochrome C-mediated apoptosis. Annu Rev Biochem 73: 87-106. [64] Li P, Nijhawan D, Budihardjo I, Srinivasula SM, Ahmad M et al. 1997. Cytochrome c and dATP-dependent formation of Apaf-1/caspase-9 complex initiates an apoptotic protease cascade. Cell 91: 479-89.

99 6 References

[65] Orrenius S 2004. Mitochondrial regulation of apoptotic cell death. Toxicol Lett 149: 19-23. [66] Borner C 2003. The Bcl-2 protein family: sensors and checkpoints for life-or- death decisions. Mol Immunol 39: 615-47. [67] Yin C, Knudson CM, Korsmeyer SJ, Van Dyke T 1997. Bax suppresses tumorigenesis and stimulates apoptosis in vivo. Nature 385: 637-40. [68] Miyashita T, Reed JC 1995. Tumor suppressor p53 is a direct transcriptional activator of the human bax gene. Cell 80: 293-9. [69] Nakano K, Vousden KH 2001. PUMA, a novel proapoptotic gene, is induced by p53. Mol Cell 7: 683-94. [70] Oda E, Ohki R, Murasawa H, Nemoto J, Shibue T et al. 2000. Noxa, a BH3- only member of the Bcl-2 family and candidate mediator of p53-induced apoptosis. Science 288: 1053-8. [71] Rao RV, Castro-Obregon S, Frankowski H, Schuler M, Stoka V et al. 2002. Coupling endoplasmic reticulum stress to the cell death program. An Apaf-1- independent intrinsic pathway. J Biol Chem 277: 21836-42. [72] Nakagawa T, Zhu H, Morishima N, Li E, Xu J et al. 2000. Caspase-12 mediates endoplasmic-reticulum-specific apoptosis and cytotoxicity by amyloid-beta. Nature 403: 98-103. [73] Lamkanfi M, Kalai M, Vandenabeele P 2004. Caspase-12: an overview. Cell Death Differ 11: 365-8. [74] Breckenridge DG, Germain M, Mathai JP, Nguyen M, Shore GC 2003. Regulation of apoptosis by endoplasmic reticulum pathways. Oncogene 22: 8608-18. [75] Porter AG, Janicke RU 1999. Emerging roles of caspase-3 in apoptosis. Cell Death Differ 6: 99-104. [76] Bratton SB, MacFarlane M, Cain K, Cohen GM 2000. Protein complexes activate distinct caspase cascades in death receptor and stress-induced apoptosis. Exp Cell Res 256: 27-33. [77] Nicholson DW 1999. Caspase structure, proteolytic substrates, and function during apoptotic cell death. Cell Death Differ 6: 1028-42. [78] Lavastre V, Pelletier M, Saller R, Hostanska K, Girard D 2002. Mechanisms involved in spontaneous and Viscum album agglutinin-I-induced human neutrophil apoptosis: Viscum album agglutinin-I accelerates the loss of antiapoptotic Mcl-1 expression and the degradation of cytoskeletal paxillin and vimentin proteins via caspases. J Immunol 168: 1419-27. [79] Appelt U, Sheriff A, Gaipl US, Kalden JR, Voll RE et al. 2005. Viable, apoptotic and necrotic monocytes expose phosphatidylserine: cooperative binding of the ligand Annexin V to dying but not viable cells and implications for PS-dependent clearance. Cell Death Differ 12: 194-6. [80] Bratton DL, Fadok VA, Richter DA, Kailey JM, Guthrie LA et al. 1997. Appearance of phosphatidylserine on apoptotic cells requires calcium- mediated nonspecific flip-flop and is enhanced by loss of the aminophospholipid translocase. J Biol Chem 272: 26159-65.

100 6 References

[81] Ravichandran KS, Lorenz U 2007. Engulfment of apoptotic cells: signals for a good meal. Nat Rev Immunol 7: 964-74. [82] Enari M, Sakahira H, Yokoyama H, Okawa K, Iwamatsu A et al. 1998. A caspase-activated DNase that degrades DNA during apoptosis, and its inhibitor ICAD. Nature 391: 43-50. [83] Sakahira H, Enari M, Nagata S 1998. Cleavage of CAD inhibitor in CAD activation and DNA degradation during apoptosis. Nature 391: 96-9. [84] Liu X, Zou H, Slaughter C, Wang X 1997. DFF, a heterodimeric protein that functions downstream of caspase-3 to trigger DNA fragmentation during apoptosis. Cell 89: 175-84. [85] Cohen GM, Sun XM, Snowden RT, Dinsdale D, Skilleter DN 1992. Key morphological features of apoptosis may occur in the absence of internucleosomal DNA fragmentation. Biochem J 286 ( Pt 2): 331-4. [86] Coleman ML, Sahai EA, Yeo M, Bosch M, Dewar A et al. 2001. Membrane blebbing during apoptosis results from caspase-mediated activation of ROCK I. Nat Cell Biol 3: 339-45. [87] Lauber K, Blumenthal SG, Waibel M, Wesselborg S 2004. Clearance of apoptotic cells: getting rid of the corpses. Mol Cell 14: 277-87. [88] Lauber K, Bohn E, Krober SM, Xiao YJ, Blumenthal SG et al. 2003. Apoptotic cells induce migration of phagocytes via caspase-3-mediated release of a lipid attraction signal. Cell 113: 717-30. [89] Gude DR, Alvarez SE, Paugh SW, Mitra P, Yu J et al. 2008. Apoptosis induces expression of sphingosine kinase 1 to release sphingosine-1- phosphate as a "come-and-get-me" signal. FASEB J 22: 2629-38. [90] Truman LA, Ford CA, Pasikowska M, Pound JD, Wilkinson SJ et al. 2008. CX3CL1/fractalkine is released from apoptotic lymphocytes to stimulate macrophage chemotaxis. Blood 112: 5026-36. [91] Elliott MR, Chekeni FB, Trampont PC, Lazarowski ER, Kadl A et al. 2009. Nucleotides released by apoptotic cells act as a find-me signal to promote phagocytic clearance. Nature 461: 282-6. [92] Idzko M, Hammad H, van Nimwegen M, Kool M, Willart MA et al. 2007. Extracellular ATP triggers and maintains asthmatic airway inflammation by activating dendritic cells. Nat Med 13: 913-9. [93] Riteau N, Gasse P, Fauconnier L, Gombault A, Couegnat M et al. 2010. Extracellular ATP is a Danger Signal Activating P2X7 Receptor in Lung Inflammation and Fibrosis. Am J Respir Crit Care Med. [94] Chalaris A, Rabe B, Paliga K, Lange H, Laskay T et al. 2007. Apoptosis is a natural stimulus of IL6R shedding and contributes to the proinflammatory trans-signaling function of neutrophils. Blood 110: 1748-55. [95] Munoz LE, Peter C, Herrmann M, Wesselborg S, Lauber K Scent of dying cells: the role of attraction signals in the clearance of apoptotic cells and its immunological consequences. Autoimmun Rev 9: 425-30. [96] Ravichandran KS Find-me and eat-me signals in apoptotic cell clearance: progress and conundrums. J Exp Med 207: 1807-17.

101 6 References

[97] Fadok VA, Voelker DR, Campbell PA, Cohen JJ, Bratton DL et al. 1992. Exposure of phosphatidylserine on the surface of apoptotic lymphocytes triggers specific recognition and removal by macrophages. J Immunol 148: 2207-16. [98] Bratton DL, Henson PM 2008. Apoptotic cell recognition: will the real phosphatidylserine receptor(s) please stand up? Curr Biol 18: R76-9. [99] Miyanishi M, Tada K, Koike M, Uchiyama Y, Kitamura T et al. 2007. Identification of Tim4 as a phosphatidylserine receptor. Nature 450: 435-9. [100] DeKruyff RH, Bu X, Ballesteros A, Santiago C, Chim YL et al. T cell/transmembrane, Ig, and mucin-3 allelic variants differentially recognize phosphatidylserine and mediate phagocytosis of apoptotic cells. J Immunol 184: 1918-30. [101] Kobayashi N, Karisola P, Pena-Cruz V, Dorfman DM, Jinushi M et al. 2007. TIM-1 and TIM-4 glycoproteins bind phosphatidylserine and mediate uptake of apoptotic cells. Immunity 27: 927-40. [102] Park D, Tosello-Trampont AC, Elliott MR, Lu M, Haney LB et al. 2007. BAI1 is an engulfment receptor for apoptotic cells upstream of the ELMO/Dock180/Rac module. Nature 450: 430-4. [103] Park SY, Jung MY, Kim HJ, Lee SJ, Kim SY et al. 2008. Rapid cell corpse clearance by stabilin-2, a membrane phosphatidylserine receptor. Cell Death Differ 15: 192-201. [104] Rigotti A, Acton SL, Krieger M 1995. The class B scavenger receptors SR- BI and CD36 are receptors for anionic phospholipids. J Biol Chem 270: 16221- 4. [105] Sambrano GR, Steinberg D 1995. Recognition of oxidatively damaged and apoptotic cells by an oxidized low density lipoprotein receptor on mouse peritoneal macrophages: role of membrane phosphatidylserine. Proc Natl Acad Sci U S A 92: 1396-400. [106] Ramprasad MP, Terpstra V, Kondratenko N, Quehenberger O, Steinberg D 1996. Cell surface expression of mouse macrosialin and human CD68 and their role as macrophage receptors for oxidized low density lipoprotein. Proc Natl Acad Sci U S A 93: 14833-8. [107] Murphy JE, Tacon D, Tedbury PR, Hadden JM, Knowling S et al. 2006. LOX-1 scavenger receptor mediates calcium-dependent recognition of phosphatidylserine and apoptotic cells. Biochem J 393: 107-15. [108] Oka K, Sawamura T, Kikuta K, Itokawa S, Kume N et al. 1998. Lectin-like oxidized low-density lipoprotein receptor 1 mediates phagocytosis of aged/apoptotic cells in endothelial cells. Proc Natl Acad Sci U S A 95: 9535- 40. [109] Hanayama R, Tanaka M, Miwa K, Shinohara A, Iwamatsu A et al. 2002. Identification of a factor that links apoptotic cells to phagocytes. Nature 417: 182-7. [110] Hanayama R, Tanaka M, Miwa K, Nagata S 2004. Expression of developmental endothelial locus-1 in a subset of macrophages for engulfment of apoptotic cells. J Immunol 172: 3876-82.

102 6 References

[111] Nakano T, Ishimoto Y, Kishino J, Umeda M, Inoue K et al. 1997. Cell adhesion to phosphatidylserine mediated by a product of growth arrest- specific gene 6. J Biol Chem 272: 29411-4. [112] Scott RS, McMahon EJ, Pop SM, Reap EA, Caricchio R et al. 2001. Phagocytosis and clearance of apoptotic cells is mediated by MER. Nature 411: 207-11. [113] Seitz HM, Camenisch TD, Lemke G, Earp HS, Matsushima GK 2007. Macrophages and dendritic cells use different Axl/Mertk/Tyro3 receptors in clearance of apoptotic cells. J Immunol 178: 5635-42. [114] Lemke G, Rothlin CV 2008. Immunobiology of the TAM receptors. Nat Rev Immunol 8: 327-36. [115] Balasubramanian K, Chandra J, Schroit AJ 1997. Immune clearance of phosphatidylserine-expressing cells by phagocytes. The role of beta2- glycoprotein I in macrophage recognition. J Biol Chem 272: 31113-7. [116] Balasubramanian K, Maiti SN, Schroit AJ 2005. Recruitment of beta-2- glycoprotein 1 to cell surfaces in extrinsic and intrinsic apoptosis. Apoptosis 10: 439-46. [117] Abdel-Monem H, Dasgupta SK, Le A, Prakasam A, Thiagarajan P Phagocytosis of platelet microvesicles and beta2- glycoprotein I. Thromb Haemost 104: 335-41. [118] Hamon Y, Broccardo C, Chambenoit O, Luciani MF, Toti F et al. 2000. ABC1 promotes engulfment of apoptotic cells and transbilayer redistribution of phosphatidylserine. Nat Cell Biol 2: 399-406. [119] Borisenko GG, Iverson SL, Ahlberg S, Kagan VE, Fadeel B 2004. Milk fat globule epidermal growth factor 8 (MFG-E8) binds to oxidized phosphatidylserine: implications for macrophage clearance of apoptotic cells. Cell Death Differ 11: 943-5. [120] Fadeel B, Quinn P, Xue D, Kagan V 2007. Fat(al) attraction: oxidized lipids act as "eat-me" signals. HFSP J 1: 225-9. [121] Blume KE, Soeroes S, Waibel M, Keppeler H, Wesselborg S et al. 2009. Cell surface externalization of annexin A1 as a failsafe mechanism preventing inflammatory responses during secondary necrosis. J Immunol 183: 8138-47. [122] Arur S, Uche UE, Rezaul K, Fong M, Scranton V et al. 2003. Annexin I is an endogenous ligand that mediates apoptotic cell engulfment. Dev Cell 4: 587- 98. [123] Moffatt OD, Devitt A, Bell ED, Simmons DL, Gregory CD 1999. Macrophage recognition of ICAM-3 on apoptotic leukocytes. J Immunol 162: 6800-10. [124] Dini L, Autuori F, Lentini A, Oliverio S, Piacentini M 1992. The clearance of apoptotic cells in the liver is mediated by the asialoglycoprotein receptor. FEBS Lett 296: 174-8. [125] Duvall E, Wyllie AH, Morris RG 1985. Macrophage recognition of cells undergoing programmed cell death (apoptosis). Immunology 56: 351-8.

103 6 References

[126] Franz S, Frey B, Sheriff A, Gaipl US, Beer A et al. 2006. Lectins detect changes of the glycosylation status of plasma membrane constituents during late apoptosis. Cytometry A 69: 230-9. [127] Beer A, Andre S, Kaltner H, Lensch M, Franz S et al. 2008. Human galectins as sensors for apoptosis/necrosis-associated surface changes of granulocytes and lymphocytes. Cytometry A 73: 139-47. [128] Chang MK, Binder CJ, Torzewski M, Witztum JL 2002. C-reactive protein binds to both oxidized LDL and apoptotic cells through recognition of a common ligand: Phosphorylcholine of oxidized phospholipids. Proc Natl Acad Sci U S A 99: 13043-8. [129] Manfredi AA, Rovere-Querini P, Bottazzi B, Garlanda C, Mantovani A 2008. Pentraxins, humoral innate immunity and tissue injury. Curr Opin Immunol 20: 538-44. [130] Mold C, Baca R, Du Clos TW 2002. Serum amyloid P component and C- reactive protein opsonize apoptotic cells for phagocytosis through Fcgamma receptors. J Autoimmun 19: 147-54. [131] Malhotra R, Lu J, Holmskov U, Sim RB 1994. Collectins, collectin receptors and the of complement activation. Clin Exp Immunol 97 Suppl 2: 4-9. [132] Matsushita M, Fujita T 2001. Ficolins and the lectin complement pathway. Immunol Rev 180: 78-85. [133] Ogden CA, deCathelineau A, Hoffmann PR, Bratton D, Ghebrehiwet B et al. 2001. C1q and mannose binding lectin engagement of cell surface calreticulin and CD91 initiates macropinocytosis and uptake of apoptotic cells. J Exp Med 194: 781-95. [134] Vandivier RW, Ogden CA, Fadok VA, Hoffmann PR, Brown KK et al. 2002. Role of surfactant proteins A, D, and C1q in the clearance of apoptotic cells in vivo and in vitro: calreticulin and CD91 as a common collectin receptor complex. J Immunol 169: 3978-86. [135] Jensen ML, Honore C, Hummelshoj T, Hansen BE, Madsen HO et al. 2007. Ficolin-2 recognizes DNA and participates in the clearance of dying host cells. Mol Immunol 44: 856-65. [136] Honore C, Hummelshoj T, Hansen BE, Madsen HO, Eggleton P et al. 2007. The innate immune component ficolin 3 (Hakata antigen) mediates the clearance of late apoptotic cells. Arthritis Rheum 56: 1598-607. [137] Hodge S, Hodge G, Jersmann H, Matthews G, Ahern J et al. 2008. Azithromycin improves macrophage phagocytic function and expression of mannose receptor in chronic obstructive pulmonary disease. Am J Respir Crit Care Med 178: 139-48. [138] Peng Y, Kowalewski R, Kim S, Elkon KB 2005. The role of IgM antibodies in the recognition and clearance of apoptotic cells. Mol Immunol 42: 781-7. [139] Poon IK, Hulett MD, Parish CR 2010. Molecular mechanisms of late apoptotic/necrotic cell clearance. Cell Death Differ 17: 381-97.

104 6 References

[140] Casciola-Rosen LA, Anhalt G, Rosen A 1994. Autoantigens targeted in systemic lupus erythematosus are clustered in two populations of surface structures on apoptotic keratinocytes. J Exp Med 179: 1317-30. [141] Stuart LM, Takahashi K, Shi L, Savill J, Ezekowitz RA 2005. Mannose- binding lectin-deficient mice display defective apoptotic cell clearance but no autoimmune phenotype. J Immunol 174: 3220-6. [142] Devitt A, Parker KG, Ogden CA, Oldreive C, Clay MF et al. 2004. Persistence of apoptotic cells without autoimmune disease or inflammation in CD14-/- mice. J Cell Biol 167: 1161-70. [143] Cohen PL, Caricchio R, Abraham V, Camenisch TD, Jennette JC et al. 2002. Delayed apoptotic cell clearance and lupus-like autoimmunity in mice lacking the c-mer membrane tyrosine kinase. J Exp Med 196: 135-40. [144] Lu Q, Lemke G 2001. Homeostatic regulation of the immune system by receptor tyrosine kinases of the Tyro 3 family. Science 293: 306-11. [145] Hanayama R, Tanaka M, Miyasaka K, Aozasa K, Koike M et al. 2004. Autoimmune disease and impaired uptake of apoptotic cells in MFG-E8- deficient mice. Science 304: 1147-50. [146] Botto M, Dell'Agnola C, Bygrave AE, Thompson EM, Cook HT et al. 1998. Homozygous C1q deficiency causes glomerulonephritis associated with multiple apoptotic bodies. Nat Genet 19: 56-9. [147] Cook HT, Botto M 2006. Mechanisms of Disease: the and the pathogenesis of systemic lupus erythematosus. Nat Clin Pract Rheumatol 2: 330-7. [148] Boes M, Schmidt T, Linkemann K, Beaudette BC, Marshak-Rothstein A et al. 2000. Accelerated development of IgG autoantibodies and autoimmune disease in the absence of secreted IgM. Proc Natl Acad Sci U S A 97: 1184-9. [149] Toth B, Garabuczi E, Sarang Z, Vereb G, Vamosi G et al. 2009. Transglutaminase 2 is needed for the formation of an efficient phagocyte portal in macrophages engulfing apoptotic cells. J Immunol 182: 2084-92. [150] A-Gonzalez N, Bensinger SJ, Hong C, Beceiro S, Bradley MN et al. 2009. Apoptotic cells promote their own clearance and immune tolerance through activation of the nuclear receptor LXR. Immunity 31: 245-58. [151] Herrmann M, Voll RE, Zoller OM, Hagenhofer M, Ponner BB et al. 1998. Impaired phagocytosis of apoptotic cell material by monocyte-derived macrophages from patients with systemic lupus erythematosus. Arthritis Rheum 41: 1241-50. [152] Baumann I, Kolowos W, Voll RE, Manger B, Gaipl U et al. 2002. Impaired uptake of apoptotic cells into tingible body macrophages in germinal centers of patients with systemic lupus erythematosus. Arthritis Rheum 46: 191-201. [153] Munoz LE, Janko C, Chaurio RA, Schett G, Gaipl US et al. IgG opsonized nuclear remnants from dead cells cause systemic inflammation in SLE. Autoimmunity 43: 232-5. [154] Beg AA 2002. Endogenous ligands of Toll-like receptors: implications for regulating inflammatory and immune responses. Trends Immunol 23: 509-12.

105 6 References

[155] Seong SY, Matzinger P 2004. Hydrophobicity: an ancient damage-associated molecular pattern that initiates innate immune responses. Nat Rev Immunol 4: 469-78. [156] Rifkin IR, Leadbetter EA, Busconi L, Viglianti G, Marshak-Rothstein A 2005. Toll-like receptors, endogenous ligands, and systemic autoimmune disease. Immunol Rev 204: 27-42. [157] Marshak-Rothstein A 2006. Toll-like receptors in systemic autoimmune disease. Nat Rev Immunol 6: 823-35. [158] Sloane JA, Blitz D, Margolin Z, Vartanian T A clear and present danger: endogenous ligands of Toll-like receptors. Neuromolecular Med 12: 149-63. [159] Brown GD, Herre J, Williams DL, Willment JA, Marshall AS et al. 2003. Dectin-1 mediates the biological effects of beta-glucans. J Exp Med 197: 1119-24. [160] Urbonaviciute V, Furnrohr BG, Meister S, Munoz L, Heyder P et al. 2008. Induction of inflammatory and immune responses by HMGB1-nucleosome complexes: implications for the pathogenesis of SLE. J Exp Med 205: 3007- 18. [161] Falasca L, Bergamini A, Serafino A, Balabaud C, Dini L 1996. Human Kupffer cell recognition and phagocytosis of apoptotic peripheral blood lymphocytes. Exp Cell Res 224: 152-62. [162] Beaver JP, Stoneman CL 1999. Exposure of N-acetylglucosamine decreases early in dexamethasone-induced apoptosis in thymocytes, demonstrated by flow cytometry using and pokeweed . Immunol Cell Biol 77: 224-35. [163] Gijzen K, Broers KM, Beeren IM, Figdor CG, Torensma R 2007. Binding of the adhesion and pathogen receptor DC-SIGN by monocytes is regulated by the density of Lewis X molecules. Mol Immunol 44: 2481-6. [164] Gaipl US, Kuenkele S, Voll RE, Beyer TD, Kolowos W et al. 2001. Complement binding is an early feature of necrotic and a rather late event during apoptotic cell death. Cell Death Differ 8: 327-34. [165] Koller H, Hochegger K, Zlabinger GJ, Lhotta K, Mayer G et al. 2004. Apoptosis of human polymorphonuclear neutrophils accelerated by dialysis membranes via the activation of the complement system. Nephrol Dial Transplant 19: 3104-11. [166] Brach MA, deVos S, Gruss HJ, Herrmann F 1992. Prolongation of survival of human polymorphonuclear neutrophils by granulocyte-macrophage colony- stimulating factor is caused by inhibition of programmed cell death. Blood 80: 2920-4. [167] Sheriff A, Gaipl US, Franz S, Heyder P, Voll RE et al. 2004. Loss of GM1 surface expression precedes annexin V-phycoerythrin binding of neutrophils undergoing spontaneous apoptosis during in vitro aging. Cytometry A 62: 75- 80. [168] Koopman G, Reutelingsperger CP, Kuijten GA, Keehnen RM, Pals ST et al. 1994. Annexin V for flow cytometric detection of phosphatidylserine expression on B cells undergoing apoptosis. Blood 84: 1415-20.

106 6 References

[169] van Gisbergen KP, Sanchez-Hernandez M, Geijtenbeek TB, van Kooyk Y 2005. Neutrophils mediate immune modulation of dendritic cells through glycosylation-dependent interactions between Mac-1 and DC-SIGN. J Exp Med 201: 1281-92. [170] Hedlund S, Persson A, Vujic A, Che KF, Stendahl O et al. Dendritic cell activation by sensing Mycobacterium tuberculosis-induced apoptotic neutrophils via DC-SIGN. Hum Immunol 71: 535-40. [171] van Gisbergen KP, Ludwig IS, Geijtenbeek TB, van Kooyk Y 2005. Interactions of DC-SIGN with Mac-1 and CEACAM1 regulate contact between dendritic cells and neutrophils. FEBS Lett 579: 6159-68. [172] Bogoevska V, Horst A, Klampe B, Lucka L, Wagener C et al. 2006. CEACAM1, an adhesion molecule of human granulocytes, is fucosylated by fucosyltransferase IX and interacts with DC-SIGN of dendritic cells via Lewis x residues. Glycobiology 16: 197-209. [173] Lucka L, Fernando M, Grunow D, Kannicht C, Horst AK et al. 2005. Identification of Lewis x structures of the cell adhesion molecule CEACAM1 from human granulocytes. Glycobiology 15: 87-100. [174] Taylor ME, Drickamer K 2007. Paradigms for glycan-binding receptors in cell adhesion. Curr Opin Cell Biol 19: 572-7. [175] Bogoevska V, Nollau P, Lucka L, Grunow D, Klampe B et al. 2007. DC- SIGN binds ICAM-3 isolated from peripheral human leukocytes through Lewis x residues. Glycobiology 17: 324-33. [176] Majai G, Gogolak P, Ambrus C, Vereb G, Hodrea J et al. 2010. PPAR{gamma} modulated inflammatory response of human dendritic cell subsets to engulfed apoptotic neutrophils. J Leukoc Biol. [177] Pino-Otin MR, Vinas O, de la Fuente MA, Juan M, Font J et al. 1995. Existence of a soluble form of CD50 (intercellular adhesion molecule-3) produced upon human lymphocyte activation. Present in normal human serum and levels are increased in the serum of systemic lupus erythematosus patients. J Immunol 154: 3015-24. [178] Singh SK, Stephani J, Schaefer M, Kalay H, Garcia-Vallejo JJ et al. 2009. Targeting glycan modified OVA to murine DC-SIGN transgenic dendritic cells enhances MHC class I and II presentation. Mol Immunol 47: 164-74. [179] Schaefer M, Reiling N, Fessler C, Stephani J, Taniuchi I et al. 2008. Decreased pathology and prolonged survival of human DC-SIGN transgenic mice during mycobacterial infection. J Immunol 180: 6836-45. [180] Palma AS, Feizi T, Zhang Y, Stoll MS, Lawson AM et al. 2006. Ligands for the beta-glucan receptor, Dectin-1, assigned using "designer" microarrays of oligosaccharide probes (neoglycolipids) generated from glucan polysaccharides. J Biol Chem 281: 5771-9. [181] Gow NA, Netea MG, Munro CA, Ferwerda G, Bates S et al. 2007. Immune recognition of Candida albicans beta-glucan by dectin-1. J Infect Dis 196: 1565-71. [182] Gantner BN, Simmons RM, Underhill DM 2005. Dectin-1 mediates macrophage recognition of Candida albicans yeast but not filaments. EMBO J 24: 1277-86. 107 6 References

[183] LeibundGut-Landmann S, Gross O, Robinson MJ, Osorio F, Slack EC et al. 2007. Syk- and CARD9-dependent coupling of innate immunity to the induction of T helper cells that produce interleukin 17. Nat Immunol 8: 630-8. [184] Bottcher A, Gaipl US, Furnrohr BG, Herrmann M, Girkontaite I et al. 2006. Involvement of phosphatidylserine, alphavbeta3, CD14, CD36, and complement C1q in the phagocytosis of primary necrotic lymphocytes by macrophages. Arthritis Rheum 54: 927-38. [185] Yang YH, Aeberli D, Dacumos A, Xue JR, Morand EF 2009. Annexin-1 regulates macrophage IL-6 and TNF via glucocorticoid-induced leucine zipper. J Immunol 183: 1435-45. [186] Cocco RE, Ucker DS 2001. Distinct modes of macrophage recognition for apoptotic and necrotic cells are not specified exclusively by phosphatidylserine exposure. Mol Biol Cell 12: 919-30. [187] Aderka D, Le JM, Vilcek J 1989. IL-6 inhibits -induced tumor necrosis factor production in cultured human monocytes, U937 cells, and in mice. J Immunol 143: 3517-23. [188] Schindler R, Mancilla J, Endres S, Ghorbani R, Clark SC et al. 1990. Correlations and interactions in the production of interleukin-6 (IL-6), IL-1, and tumor necrosis factor (TNF) in human blood mononuclear cells: IL-6 suppresses IL-1 and TNF. Blood 75: 40-7. [189] Tilg H, Trehu E, Atkins MB, Dinarello CA, Mier JW 1994. Interleukin-6 (IL-6) as an anti-inflammatory cytokine: induction of circulating IL-1 receptor antagonist and soluble tumor necrosis factor receptor p55. Blood 83: 113-8. [190] Langelaar M, Aranzamendi C, Franssen F, Van Der Giessen J, Rutten V et al. 2009. Suppression of dendritic cell maturation by Trichinella spiralis excretory/secretory products. Parasite Immunol 31: 641-5. [191] Huang H, Ostroff GR, Lee CK, Wang JP, Specht CA et al. 2009. Distinct patterns of dendritic cell cytokine release stimulated by fungal beta-glucans and toll-like receptor agonists. Infect Immun 77: 1774-81. [192] Gaipl US, Munoz LE, Grossmayer G, Lauber K, Franz S et al. 2007. Clearance deficiency and systemic lupus erythematosus (SLE). J Autoimmun 28: 114-21. [193] Schulze C, Munoz LE, Franz S, Sarter K, Chaurio RA et al. 2008. Clearance deficiency--a potential link between infections and autoimmunity. Autoimmun Rev 8: 5-8. [194] Munoz LE, Janko C, Grossmayer GE, Frey B, Voll RE et al. 2009. Remnants of secondarily necrotic cells fuel inflammation in systemic lupus erythematosus. Arthritis Rheum 60: 1733-42. [195] Reeves WH, Lee PY, Weinstein JS, Satoh M, Lu L 2009. Induction of autoimmunity by pristane and other naturally occurring hydrocarbons. Trends Immunol 30: 455-64.

108 7 List of abbreviations

7 List of abbreviations

αvβ3 integrin vitronectin receptor β2Gβ1 ß2 glycoprotein 1 ABC1 ATP-binding-cassette transporter 1 ACAMP apoptotic cell-associated molecular pattern Apaf-1 apoptosis protease activating factor 1 APC antigen presenting cell ATP adenosine 5’-tripohosphate AxI Annexin I AxV Annexin V BAI1 brain-specific angiogenesis inhibitor 1 BDCA-2 Blood-Dendritic-Cell-Antigen-2 BSA bovine serum albumin CFDA-SE Carboxyfluorescein diacetate succinimidyl ester CFSE carboxyfluorescein succinimidyl ester CLEC C-type lectin CRD carbohydrate recognition domain CRP C-reactive protein CTLD C-type lectin domain DAMP damage-associated molecular patterns DC dendritic cell DCIR dendritic cell immunoreceptor DC-SIGN DC-Specific Intercellular adhesion molecule-3-Grabbing Non-integrin DEC-205 dendritic and epithelial cells, 205 kDa Del1 developmental endothelial locus-1 DNGR1 DC, NK lectin group receptor-1 dRP S19 dimer of S19 ribosomal protein DTH reaction delayed type hypersensitivity reaction EMAP II endothelial monocyteactivating polypeptide II ER endoplasmatic reticulum FasL Fas ligand FDC follicular dendritic cell FcR Fc receptor FCS fetal calf serum FDC follicular dendritic cell FITC fluorescein isothiocyanate

109 7 List of abbreviations

FL fluorescence FSc forward scatter GalNAc N-Acetylgalactosamine Gas6 growth-arrest specific gene 6 GlcNAc N-acetylglucosamine GPC glycerophosphocholine GSL II Griffonia simplicifolia lectin II HBSS Hank's buffered Salt Solution i.p. intraperitoneal ICAD inhibitor of caspase-activated deoxyribonuclease ICAM-1(-3) intracellular adhesion molecule 1 (-3) IL- interleukin- LOX-1 lectin-like oxLDL receptor-1 LPC lysophosphatidylcholine LPS lipopolysaccharide LSECtin Liver and lymph node sinusoidal endothelial cell C-type lectin L-SIGN Liver/lymph node-specific intercellular adhesion molecule-3-grabbing integrin MBL mannose binding lectin MFG-E8 milk fat globule epidermal growth factor (EGF)-factor 8 MFI mean fluorescence intensity MLR mixed lymphocyte reaction MMR macrophage mannose receptor NPn Narcissus pseudonarcissus lectin OD optical density oxLDL oxidized low-density lipoprotein oxLDLR oxLDL receptor PAMP pathogen-associated molecular pattern PRR pattern recognition receptor PBL peripheral blood lymphocytes PBMC peripheral blood mononuclear cells PBS phosphate buffered saline pDC plasmacytoid DC PFA paraformaldehyde PHA phytohaemagglutinin PI propidium iodide PMN polymorphonuclear cells

110 7 List of abbreviations

PMSF phenylmethylsulfonyl fluoride PS phosphatidylserine PTX3 Pentraxin 3 ROCK Rho-associated protein kinase S1P sphingosine-1-phosphate SAP serum amyloid P SIGNR 1 (-5) specific ICAM-3 grabbing nonintegrin-related 1 (-5) SLE systemic lupus erythematosus SNEC secondary necrotic cell-derived material SP-A SR-BI class B scavenger receptor type I SSc side scatter TAM Tyro3/Axl/Mer TIM T cell, immunoglobulin, mucin domain-containing molecules TLR Toll-like receptor TMB 3,3′,5,5′-tetramethylbenzidine TNFR1 TNF receptor-1 TNFα tumor necrosis factor α TSP-1 thrombospondin-1 TWEEN®20 poly(oxyethylene)x-sorbitane-monolaurate TyrRS tyrosyl-tRNA synthetase UEA I Ulex europaeus lectin I UTP Uridine-5'-triphosphate UV-B Ultra violet light -B

111 8 List of figures

8 List of figures

Figure 1: Structure of three C-type lectins expressed on DC ([16], modified)...... 14 Figure 2: “Find-me” signals involved in the clearance process...... 18 Figure 3: “Eat-me” signals involved in the clearance process...... 21 Figure 4: Schedule of apoptotic cell death...... 25 Figure 5: Detection of morphological changes of viable, dying and dead human PMN, PBL and lymphoblasts by flow cytometry analysis ...... 46 Figure 6: Detection of cell status by flow cytometry analysis employing non-toxic plant lectins...... 48 Figure 7: Increased NPn and GSLII plant lectin binding to late apoptotic PMN, PBL, and lymphoblasts...... 49 Figure 8: CLEC9A/DNGR1 binds only to cells of the shrunken, late apoptotic PMN population...... 51 Figure 9: Aged and necrotized CLEC9A/DNGR1-binding PMN show a low PI signal ...... 53 Figure 10: In situ heated CLEC9A/DNGR1 positive cells slightly increase their PI signal ...... 54 Figure 11: CLEC9A/DNGR1 binding PBL show a high PI signal...... 55 Figure 12: CLEC9A/DNGR1-bound shrunken apoptotic PMN show an increase in Trypan Blue signal after induction of necrosis ...... 56 Figure 13: The cells of the shrunken, late apopotitc, Calcein-AM-stained PMN population lose Calcein after induction of secondary necrosis ...... 57 Figure 14: CLEC9A/DNGR1 positive cells show a surface binding to aged PMN .... 58 Figure 15: CLEC9A/DNGR1 staining pattern changes from surface type to cytoplasmic after heat treatment...... 59 Figure 16: Aged and aged, heat necrotized PMN show a surface binding of AxV.... 60 Figure 17: The ligand of CLEC9A/DNGR1 is still undefined...... 61 Figure 18: CLEC4L/DC-SIGN interaction with apoptozing PMN is inhibited in the presence of mannan...... 62 Figure 19: Strong aggregation of Raji-CLEC4L/DC-SIGN cells with apoptotic PMN 63 Figure 20: CLEC4L/DC-SIGN interaction with apoptotic lymphoblast blebs is inhibited in the presence of mannan ...... 64

112 8 List of figures

Figure 21: Apoptotic lymphoblast blebs bind to the surface of Raji-CLEC4L/DC-SIGN ...... 65 Figure 22: CLEC7A/Dectin-1 interaction with secondary necrotic PMN is inhibited in the presence of laminarin ...... 67 Figure 23: No difference in uptake of FITC-labelled latex beads in the presence of CLEC7A/Dectin-1 ...... 68 Figure 24: No direct binding of mCLEC7A/Dectin-1 to viable, necrotic or apoptotic PMN ...... 69 Figure 25: Increased DTH response in immunized SV129 CLEC7A/Dectin-1 KO mice ...... 70 Figure 26: Increased number of splenocytes in immunized SV129 CLEC7A/Dectin-1 KO ...... 71 Figure 27: Increased anti-PMN IgG production in immunized SV129 CLEC7A/Dectin- 1 KO mice...... 72 Figure 28: Analysis of splenocyte cytokine mRNA expression levels...... 74 Figure 29: No significant effect of apoptotic or secondary necrotic PMN on cytokine profile of macrophages and BMDDC in the abscence of LPS ...... 76 Figure 30: Co-incubation of activated macrophages of WT and CLEC7A/Dectin-1 KO mice with apoptotic or secondary necrotic PMN lead to different cytokine profiles... 78 Figure 31: Co-incubation of BMDDC of WT and CLEC7A/Dectin-1 KO mice with apoptotic or secondary necrotic PMN lead to different cytokine profiles...... 81

113 Acknowledgements

Acknowledgements

Firstly, I want to thank the director of the Medical Clinic 3 in Erlangen, Prof. Dr. Schett, for the opportunity to do my PhD at the Institute for Clinical Immunology, University Erlangen-Nürnberg.

I want to thank Prof. Dr. Martin Herrmann for his supervision, advice and guidance. I want to thank for the interesting and challenging work, for the scientific freedom he gave me, for all the discussions (whether science-related or not) and his never- ending enthusiasm.

I want to thank Prof. Dr. Lars Nitschke and Prof. Dr. Thomas Winkler for supervising this PhD thesis in the Faculty of Science. I thank PD Dr. Reinhard Voll for reviewing my thesis. I want to thank Prof. Dr. Hans-Martin Jäck and Prof. Dr. Alexander Steinkasserer who supported my work with ideas and discussions during the preparation of my PhD thesis as members of my supervising committee.

I am glad that I became a member of the DFG Erlanger Graduiertenkolleg 592. I want to thank the DFG and the leader of the GK592 Prof. Dr. Hans-Martin Jäck not only for funding but for the great education we received in special scientific workshops, for the chance to organize scientific events ourselves, and last but not least for the great opportunity to do some of my PhD work in a lab abroad.

I am very glad and thankful that Prof. Dr. Gordon Brown gave me the opportunity to perform important experiments in his lab, in Aberdeen, Scotland. I want to thank him and all his group members, especially Dr. Delyth Reid and Dr. Ann Kerrigan, for their great help and support throughout my stay.

For the co-operations with Dr. Martin Schiller, Petra Heyder, and Marijo Parcina from Heidelberg and Prof. Dr. Kirsten Lauber from Munich I want to thank. Their know-how in bleb preparation, confocal microscopy and RT-PCR analysis was more than helpful. I also want to thank Prof. Dr. Stefan Pöhlmann for providing special cell lines.

114 Acknowledgements

I want to thank all my colleagues of the group of Martin Herrmann (Christina Janko, Christine Schorn, Daniela Weidner, Karin Heuchemer, Dr. Kerstin Sarter, Kristin Schröder, Dr. Luis Munoz, Matthias Zirngibl, Ricardo Chaurio and Silke Winkler) very much for the great working atmosphere. I am glad for the helpful discussions and overall support for one another. Besides, I especially enjoyed the “Palma-, cake-, ice cream-, and goody-breaks” with you. Furthermore, I want to say thanks for all the support to Dr. Benjamin Frey, former member of our group, and also to Dr. Silke Frey, Dr. Barbara Fürnrohr, Eva Gückel, Dr. Vilma Urbonaviciute, and Daniela Graef, members of the group of PD Dr. Reinhard Voll. I also want to thank the members of the GK592 – this group of people knows how to organize events and how to have fun.

I want to say many thanks to my parents, family and friends for their constant support and belief in me throughout the last years. Finally, I am very thankful to my husband and friend Dr. Christoph Hesse. Without listing what I want to thank you for, I just want to thank you so much for your point of view in all things. It is so restful and encouraging at the same time.

115 Curriculum Vitae

Curriculum Vitae

Personal Information

Name and surname Connie Hesse (née Schulze)

Dateofbirth 09.04.1981

Place of birth Eberwalde-Finow

Nationality German

Address Sepp-Kiene-Straße9,83308Trostberg

Mobile phone +49 176 20 155 516

E-Mail [email protected]

Education

09/2006 – PhD thesis at the Institute of Clinical Immunology, Friedrich- Alexander University Erlangen-Nürnberg. Title: „CLEC7A/Dectin-1 attenuates the immune response against dying and dead cells”

10/2000 – 06/2006 Studies of „Applied Natural Science“ at the “Technische Universität Bergakademie Freiberg“ in Freiberg, Degree: „Diplom Naturwissenschaftlerin“ (Dipl. Nat.) („very good“)

09/1993 – 07/2000 „F.F. Runge Gymnasium“ in Oranienburg: "Abitur" certificate

09/1987 – 08/1993 „Havelschule” in Oranienburg (primary school)

Education abroad

10/2009 – 12/2009 Trainee program (funded by the DFG) in the laboratory of Gordon D. Brown, Institute of Medical Sciences, University of Aberdeen, Aberdeen, UK

09/1997 – 03/1998 Portmarnock Community School, Ireland

116 Curriculum Vitae

Further education

March 2008 Workshop Scientific Writing, Dr. Ruth Willmott, Bioscript, Erlangen

April 2007 Workshop Poster Design, Dr. Ruth Willmott, Bioscript, Erlangen

March 2007 Scientific Poster Design, RRZE, Erlangen

Scholarships

09/2006 – 04/2010 PhD scholarship of the K und R Wucherpfennig-Stiftung

09/2006 – 08/2009 PhD scholarship of the Deutsche Forschungsgemeinschaft (DFG) at the Erlanger Graduiertenkolleg GK592

01/2003 – 06/2006 e-fellows online scholarship of the e-fellows.net career network in Munich

Publications and Reviews

1 Schorn, C., C. Janko, L. Monoz, C. Schulze, M. Strysio, G. Schett, and M. Herrmann. 2009. Sodium and potassium urate crystals differ in their inflammatory potential. Autoimmunity 42(4): 1–3.

2 Sarter, K., S. Andre, H. Kaltner, M. Lensch, C. Schulze, V. Urbonaviciute, G. Schett, M. Herrmann, and H.J. Gabius. 2009. Detection and chromatographic removal of lipopolysaccharide in preparations of multifunctional galectins. Biochem Biophys Res Commun 379:155-159.

3 Schulze, C., L.E. Munoz, S. Franz, K. Sarter, R.A. Chaurio, U.S. Gaipl, and M. Herrmann. 2008. Clearance deficiency--a potential link between infections and autoimmunity. Autoimmun Rev 8:5-8. (Review)

4 Sarter,K., C. Schulze, R. E. Voll, and M. Herrmann. 2008. Role of apoptosis failure in etiopathogenesis of systemic lupus erythematosus and murine lupus. Expert Review of Clinical Immunology 4, 33-42. (Review)

117 Curriculum Vitae

5 Cooke, A., G.F. Ferraccioli, M. Herrmann, L. Romani, C. Schulze, S. Zampieri, and A. Doria. 2008. Induction and protection of autoimmune rheumatic diseases. The role of infections. Clin Exp Rheumatol 26:S1-7. (Review)

6 Beer, A., S. Andre, H. Kaltner, M. Lensch, S. Franz, K. Sarter, C. Schulze, U.S. Gaipl, P. Kern, M. Herrmann, and H.J. Gabius. 2008. Human galectins as sensors for apoptosis/necrosis-associated surface changes of granulocytes and lymphocytes. Cytometry A 73:139-147.

7 Sarter, K., C. Mierke, A. Beer, B. Frey, B. Fürnrohr, C. Schulze, S. Franz. 2007. Sweet Clearance: Involvement of Cell Surface Glycans in the Recognition of Apoptotic Cells. Autoimmunity 40, 345-348.

8 Schulze, C., K. Sarter, and M. Herrmann. 2007. Do we already understand all aspects connecting clearance and autoimmunity? Autoimmunity 40:239-243.

118