DOCSLIB.ORG

Chemotaxis Role in Neutrophil Polarization and Leukocyte-Specific

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Chemotaxis Role in Neutrophil Polarization and Leukocyte-Specific Modulation of Mac-1 (CD11b/CD18)-Mediated Adhesion by the Leukocyte-Specific Protein 1 Is Key to Its Role in Neutrophil Polarization and This information is current as Chemotaxis of September 26, 2021. Chunjie Wang, Hisayoshi Hayashi, Rene Harrison, Basil Chiu, Jason R. Chan, Hanne L. Ostergaard, Robert D. Inman, Jan Jongstra, Myron I. Cybulsky and Jenny Jongstra-Bilen J Immunol 2002; 169:415-423; ; Downloaded from doi: 10.4049/jimmunol.169.1.415 http://www.jimmunol.org/content/169/1/415 http://www.jimmunol.org/ References This article cites 74 articles, 37 of which you can access for free at: http://www.jimmunol.org/content/169/1/415.full#ref-list-1 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists by guest on September 26, 2021 • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2002 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Modulation of Mac-1 (CD11b/CD18)-Mediated Adhesion by the Leukocyte-Specific Protein 1 Is Key to Its Role in Neutrophil Polarization and Chemotaxis1 Chunjie Wang,*‡†† Hisayoshi Hayashi,§** Rene Harrison,§** Basil Chiu,*‡ Jason R. Chan,†¶ Hanne L. Ostergaard,‡‡ Robert D. Inman,*‡ʈ Jan Jongstra,*‡ Myron I. Cybulsky,†¶ and Jenny Jongstra-Bilen2*‡ Leukocyte-specific protein 1 (LSP1) is an intracellular filamentous-actin binding protein which modulates cell motility. The cellular process in which LSP1 functions to regulate motility is not yet identified. In this study, we show that LSP1 negatively regulates fMLP-induced polarization and chemotaxis of neutrophils through its function on adhesion via specific integrins. Using LSP1-deficient (Lsp1؊/؊) mice, we show increased neutrophil migration into mouse knee joints during zymosan-induced acute Downloaded from inflammation, an inflammatory model in which the number of resident synoviocytes are not affected by LSP1-deficiency. In vitro chemotaxis experiments performed by time-lapse videomicroscopy showed that purified Lsp1؊/؊ bone-marrow neutrophils exhibit an increased migration rate toward a gradient of fMLP as compared with wild-type neutrophils. This difference was observed when cells migrated on fibrinogen, but not fibronectin, suggesting a role for LSP1 in modulating neutrophil adhesion by specific integrins. LSP1 is also a negative regulator of fMLP-induced adhesion to fibrinogen or ICAM-1, but not to ICAM-2, VCAM-1, http://www.jimmunol.org/ or fibronectin. These results suggest that LSP1 regulates the function of Mac-1 (CD11b/CD18), which binds only to fibrinogen and ICAM-1 among the substrates we tested. fMLP-induced filamentous actin polarization is also increased in the absence of LSP1 when cells were layered on fibrinogen, but not on fibronectin. Our findings suggest that the increased neutrophil recruitment in ,Lsp1؊/؊ mice during acute inflammation derives from the negative regulatory role of LSP1 on neutrophil adhesion, polarization and migration via specific integrins, such as Mac-1, which mediate neutrophil responses to chemotactic stimuli. The Journal of Immunology, 2002, 169: 415–423. eutrophils are among the first leukocytes to reach an toid arthritis or inflammatory bowel disease, uncontrolled accumu- inflammatory site and initiate host-defense against lations of neutrophils yield aberrantly elevated levels of inflam- by guest on September 26, 2021 N pathogens. Activated neutrophils are able to fight infec- matory compounds which become major contributors to tissue tion effectively, together with monocytes and resident tissue mac- damage (2, 3). Thus, regulation of neutrophil recruitment into in- rophages, by phagocytosis of microorganisms, or by secreting sev- flammatory sites and their clearance are critical processes assuring eral potent inflammatory compounds such as radical oxygen effective host defense without tissue injury. intermediates, proteases, or peroxidases. The importance of neu- The emigration of circulating neutrophils from blood to in- trophil function in innate immunity is best evidenced by several flamed tissue is a complex process dependent upon the coordina- human neutrophil dysfunctions whereby defects in neutrophil mi- tion of many cellular functions that culminate in directed cell gration or anti-inflammatory activity is the cause for severe sus- movement (4–6). Adhesion receptors are key to several of these ceptibility to bacterial infections and defective wound healing (1). processes. Transendothelial migration is initiated by neutrophil In contrast, during chronic inflammatory diseases such as rheuma- rolling mediated by the selectin family of adhesion receptors. Roll- ing neutrophils arrest on endothelium and undergo firm adhesion, *Cellular and Molecular Biology Division, Toronto Western Research Institute, and characterized by spreading and the formation of focal adhesion- †Toronto General Research Institute, University Health Network, Toronto, Canada; like structures mediated by integrin receptors. Integrins are het- Departments of ‡Immunology, §Biochemistry, ¶Laboratory Medicine and Pathobiol- ʈ erodimeric transmembrane proteins consisting of noncovalently ogy, and Medicine, University of Toronto, Toronto, Canada; **Cell Biology Pro- †† ␣ ␤ ␤ gram, Hospital for Sick Children, Toronto, Canada; Department of Pathology, The bound - and -chains (7). In neutrophils, the 1 integrins com- Fourth Military Medical University, Xi’an, China; and ‡‡Department of Immunology, prise a common ␤-chain (CD29) and distinct ␣-chains (CD49) (8, University of Alberta, Edmonton, Canada ␤ ␤ 9). The 2 family of integrins share their -chain (CD18) with Received for publication October 23, 2001. Accepted for publication April 29, 2002. ␣ ␤ distinct -chains (CD11). The importance of the 2 integrins in The costs of publication of this article were defrayed in part by the payment of page adhesion and transmigration is evident by the analysis of patients charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. with leukocyte adhesion deficiency type I syndrome which results 1 This work was supported with funds from the University of Toronto Arthritis Center from mutations in CD18 that lead to severe deficiency of the of Excellence (to J.J.-B., J.J., and R.I.), National Cancer Institute of Canada (to J.J. CD11/CD18 integrins and profound reduction in neutrophil re- and J.J.-B.), and Canadian Institutes of Health Research Grant MT-14151 (to M.C.); ␤ by Postdoctoral Fellowship Awards from the University of Toronto Arthritis Center cruitment during inflammation (10). The 2 integrins are critical of Excellence (to C.W.), Canadian Arthritis Network (to H.H.), Sick Children Re- for firm adhesion of rolling neutrophils on vascular surfaces and search Training Competition (to R.H.); and by a Heart and Stroke Foundation of ␣ ␤ transendothelial migration (11, 12). LFA-1 ( L 2, CD11a/CD18) Canada Research Traineeship (to J.C.). ␣ ␤ ␤ and Mac-1 ( M 2, CD11b/CD18) are the most abundant 2 inte- 2 Address correspondence and reprint requests to Dr. Jenny Jongstra-Bilen, Toronto Western Hospital, Main Pavilion, Room 13-312A, 399 Bathurst Street, Toronto, On- grins on neutrophils. Although these integrins share ICAM-1 as a tario M5T 2S8, Canada. E-mail address: [email protected] ligand, the regulation of their surface expression and their function Copyright © 2002 by The American Association of Immunologists, Inc. 0022-1767/02/$02.00 416 LSP1 REGULATES NEUTROPHIL ADHESION AND CHEMOTAXIS during neutrophil migration appear distinct. Neutrophil activation F-actin bundles branching into hair-like cell surface projections results in significant up-regulation of surface Mac-1 levels, but not and impaired motility (41, 42). LFA-1 (13). Although the importance of both integrin receptors in In this paper, we evaluated the in vivo role for LSP1 in regu- firm adhesion of neutrophils to ICAM-1 or to endothelial surfaces lating neutrophil influx to acute inflammation in the joint and in- was demonstrated, the role of Mac-1 in recruitment of neutrophils vestigated the requirement for LSP1 in various processes which into inflammatory sites is not completely understood. Although a culminate in fMLP-induced neutrophil motility with a long-term number of studies showed inhibition of neutrophil migration by goal of elucidating the mechanism(s) by which LSP1 functions as Mac-1 blocking Abs, LFA-1 appeared to play a more important a negative regulator of neutrophil migration during inflammation. role than Mac-1 in recruitment to inflammatory sites (13–15). In- terestingly, increased accumulation of neutrophils was found at Materials and Methods inflammatory sites in Mac-1-deficient mice which correlated with Mice their increased survival (16). Thus, distinct or additional roles for Ϫ Ϫ 129/SvJ mice (wt and Lsp1 / ) were bred and housed in microisolators in Mac-1 have been demonstrated as compared with LFA-1
Load more

Recommended publications
  • Aberrant Methylation Underlies Insulin Gene Expression in Human Insulinoma
    ARTICLE https://doi.org/10.1038/s41467-020-18839-1 OPEN Aberrant methylation underlies insulin gene expression in human insulinoma Esra Karakose1,6, Huan Wang 2,6, William Inabnet1, Rajesh V. Thakker 3, Steven Libutti4, Gustavo Fernandez-Ranvier 1, Hyunsuk Suh1, Mark Stevenson 3, Yayoi Kinoshita1, Michael Donovan1, Yevgeniy Antipin1,2, Yan Li5, Xiaoxiao Liu 5, Fulai Jin 5, Peng Wang 1, Andrew Uzilov 1,2, ✉ Carmen Argmann 1, Eric E. Schadt 1,2, Andrew F. Stewart 1,7 , Donald K. Scott 1,7 & Luca Lambertini 1,6 1234567890():,; Human insulinomas are rare, benign, slowly proliferating, insulin-producing beta cell tumors that provide a molecular “recipe” or “roadmap” for pathways that control human beta cell regeneration. An earlier study revealed abnormal methylation in the imprinted p15.5-p15.4 region of chromosome 11, known to be abnormally methylated in another disorder of expanded beta cell mass and function: the focal variant of congenital hyperinsulinism. Here, we compare deep DNA methylome sequencing on 19 human insulinomas, and five sets of normal beta cells. We find a remarkably consistent, abnormal methylation pattern in insu- linomas. The findings suggest that abnormal insulin (INS) promoter methylation and altered transcription factor expression create alternative drivers of INS expression, replacing cano- nical PDX1-driven beta cell specification with a pathological, looping, distal enhancer-based form of transcriptional regulation. Finally, NFaT transcription factors, rather than the cano- nical PDX1 enhancer complex, are predicted to drive INS transactivation. 1 From the Diabetes Obesity and Metabolism Institute, The Department of Surgery, The Department of Pathology, The Department of Genetics and Genomics Sciences and The Institute for Genomics and Multiscale Biology, The Icahn School of Medicine at Mount Sinai, New York, NY 10029, USA.
    [Show full text]
  • Analysis of Gene Expression Data for Gene Ontology
    ANALYSIS OF GENE EXPRESSION DATA FOR GENE ONTOLOGY BASED PROTEIN FUNCTION PREDICTION A Thesis Presented to The Graduate Faculty of The University of Akron In Partial Fulfillment of the Requirements for the Degree Master of Science Robert Daniel Macholan May 2011 ANALYSIS OF GENE EXPRESSION DATA FOR GENE ONTOLOGY BASED PROTEIN FUNCTION PREDICTION Robert Daniel Macholan Thesis Approved: Accepted: _______________________________ _______________________________ Advisor Department Chair Dr. Zhong-Hui Duan Dr. Chien-Chung Chan _______________________________ _______________________________ Committee Member Dean of the College Dr. Chien-Chung Chan Dr. Chand K. Midha _______________________________ _______________________________ Committee Member Dean of the Graduate School Dr. Yingcai Xiao Dr. George R. Newkome _______________________________ Date ii ABSTRACT A tremendous increase in genomic data has encouraged biologists to turn to bioinformatics in order to assist in its interpretation and processing. One of the present challenges that need to be overcome in order to understand this data more completely is the development of a reliable method to accurately predict the function of a protein from its genomic information. This study focuses on developing an effective algorithm for protein function prediction. The algorithm is based on proteins that have similar expression patterns. The similarity of the expression data is determined using a novel measure, the slope matrix. The slope matrix introduces a normalized method for the comparison of expression levels throughout a proteome. The algorithm is tested using real microarray gene expression data. Their functions are characterized using gene ontology annotations. The results of the case study indicate the protein function prediction algorithm developed is comparable to the prediction algorithms that are based on the annotations of homologous proteins.
    [Show full text]
  • Original Article Correlation Between LSP1 Polymorphisms and the Susceptibility to Breast Cancer
    Int J Clin Exp Pathol 2015;8(5):5798-5802 www.ijcep.com /ISSN:1936-2625/IJCEP0005835 Original Article Correlation between LSP1 polymorphisms and the susceptibility to breast cancer Hai Chen, Xiaodong Qi, Ping Qiu, Jiali Zhao Department of Galactophore, The General Hospital of Beijing Military Command, Beijing, China Received January 12, 2015; Accepted March 16, 2015; Epub May 1, 2015; Published May 15, 2015 Abstract: Objective: The present study aimed at assessing the relationship between Leukocyte-specific protein 1 gene (LSP1) polymorphisms (rs569550 and rs592373) and the pathogenesis of breast cancer (BC). Methods: 70 BC patients and 72 healthy subjects were enrolled in the study. Rs569550 and rs592373 polymorphisms were genotyped by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). Odds ratio (OR) with 95% confidence interval (CI) were calculated by the chi-squared test to assess the relationship between LSP1 polymorphisms and BC risk. Linkage disequilibrium (LD) and haplotypes were also analyzed by HaploView software. Results: Genotype distribution of the control was in accordance with Hardy-Weinberg equilibrium (HWE). The homo- zygous genotype TT and T allele of rs569550 could significantly increase the risk of BC (TT vs. GG: OR=3.17, 95% CI=1.23-8.91; T vs. G: OR=1.63, 95% CI=1.01-2.64). For rs592373, mutation homozygous genotype CC and C allele were significantly associated with BC susceptibility (CC vs. TT: OR=4.45, 95% CI=1.38-14.8; C vs. T: OR=1.70, 95% CI=1.03-2.81). LD and haplotypes analysis of rs569550 and rs592373 polymorphisms showed that T-C haplotype was a risk factor for BC (T-C vs.
    [Show full text]
  • Meta-Analysis of Nasopharyngeal Carcinoma
    BMC Genomics BioMed Central Research article Open Access Meta-analysis of nasopharyngeal carcinoma microarray data explores mechanism of EBV-regulated neoplastic transformation Xia Chen†1,2, Shuang Liang†1, WenLing Zheng1,3, ZhiJun Liao1, Tao Shang1 and WenLi Ma*1 Address: 1Institute of Genetic Engineering, Southern Medical University, Guangzhou, PR China, 2Xiangya Pingkuang associated hospital, Pingxiang, Jiangxi, PR China and 3Southern Genomics Research Center, Guangzhou, Guangdong, PR China Email: Xia Chen - [email protected]; Shuang Liang - [email protected]; WenLing Zheng - [email protected]; ZhiJun Liao - [email protected]; Tao Shang - [email protected]; WenLi Ma* - [email protected] * Corresponding author †Equal contributors Published: 7 July 2008 Received: 16 February 2008 Accepted: 7 July 2008 BMC Genomics 2008, 9:322 doi:10.1186/1471-2164-9-322 This article is available from: http://www.biomedcentral.com/1471-2164/9/322 © 2008 Chen et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Background: Epstein-Barr virus (EBV) presumably plays an important role in the pathogenesis of nasopharyngeal carcinoma (NPC), but the molecular mechanism of EBV-dependent neoplastic transformation is not well understood. The combination of bioinformatics with evidences from biological experiments paved a new way to gain more insights into the molecular mechanism of cancer. Results: We profiled gene expression using a meta-analysis approach. Two sets of meta-genes were obtained. Meta-A genes were identified by finding those commonly activated/deactivated upon EBV infection/reactivation.
    [Show full text]
  • LSP1-Myosin1e Bi-Molecular Complex Regulates Focal Adhesion Dynamics
    bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.963991; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. LSP1-myosin1e bi-molecular complex regulates focal adhesion dynamics and cell migration Katja Schäringer1*, Sebastian Maxeiner1*, Carmen Schalla1, Stephan Rütten2, Martin Zenke1 and Antonio Sechi1 1Institute of Biomedical Engineering, Dept. of Cell Biology, RWTH Aachen University, Pauwelsstrasse, 30, D-52074 Aachen, Germany 2Electron Microscopy Facility, Institute of Pathology, RWTH Aachen University, Pauwelsstrasse, 30, D-52074 Aachen, Germany *equal contribution Corresponding author: Email: [email protected] Telephone: +49 241 8085248 Running head: LSP1-myosin1e complex regulates cell migration. Keywords: Actin cytoskeleton remodelling, focal adhesions, cell motility, macrophages. 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.963991; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Several cytoskeleton-associated proteins and signalling pathways work in concert to regulate actin cytoskeleton remodelling, cell adhesion and migration. We have recently demonstrated that the bi-molecular complex between the leukocyte-specific protein 1 (LSP1) and myosin1e controls actin cytoskeleton remodelling during phagocytosis. In this study, we show that LSP1 down regulation severely impairs cell migration, lamellipodia formation and focal adhesion dynamics in macrophages. Inhibition of the interaction between LSP1 and myosin1e also impairs these processes resulting in poorly motile cells, which are characterised by few and small lamellipodia.
    [Show full text]
  • Anti-LSP1 Antibody (ARG55377)
    Product datasheet [email protected] ARG55377 Package: 50 μl anti-LSP1 antibody Store at: -20°C Summary Product Description Rabbit Polyclonal antibody recognizes LSP1 Tested Reactivity Hu Tested Application WB Host Rabbit Clonality Polyclonal Isotype IgG Target Name LSP1 Antigen Species Human Immunogen Synthetic peptide corresponding to aa. 121-149 of Human LSP1. Conjugation Un-conjugated Alternate Names Lymphocyte-specific protein 1; pp52; 52 kDa phosphoprotein; 47 kDa actin-binding protein; WP34; Lymphocyte-specific antigen WP34 Application Instructions Application table Application Dilution WB 1:1000 Application Note * The dilutions indicate recommended starting dilutions and the optimal dilutions or concentrations should be determined by the scientist. Positive Control Daudi Calculated Mw 37 kDa Properties Form Liquid Purification Affinity purification with immunogen. Buffer PBS (without Mg2+ and Ca2+, pH 7.4), 150mM NaCl, 0.02% Sodium azide and 50% Glycerol Preservative 0.02% Sodium azide Stabilizer 50% Glycerol Storage instruction For continuous use, store undiluted antibody at 2-8°C for up to a week. For long-term storage, aliquot and store at -20°C. Storage in frost free freezers is not recommended. Avoid repeated freeze/thaw cycles. Suggest spin the vial prior to opening. The antibody solution should be gently mixed before use. Note For laboratory research only, not for drug, diagnostic or other use. www.arigobio.com 1/2 Bioinformation Database links GeneID: 4046 Human Swiss-port # P33241 Human Gene Symbol LSP1 Gene Full Name lymphocyte-specific protein 1 Background This gene encodes an intracellular F-actin binding protein. The protein is expressed in lymphocytes, neutrophils, macrophages, and endothelium and may regulate neutrophil motility, adhesion to fibrinogen matrix proteins, and transendothelial migration.
    [Show full text]
  • Expression of Mouse LSP1/S37 Isoforms S37 Is Expressed in Embryonic Mesenchymal Cells
    Journal of Cell Science 107, 3591-3600 (1994) 3591 Printed in Great Britain © The Company of Biologists Limited 1994 Expression of mouse LSP1/S37 isoforms S37 is expressed in embryonic mesenchymal cells V. L. Misener1, C.-c. Hui2, I. A. Malapitan1, M.-E. Ittel1, A. L. Joyner2,3 and J. Jongstra1,* 1The Arthritis Centre-Research Unit, The Toronto Hospital Research Institute and Department of Immunology, University of Toronto, Toronto, Ontario, Canada 2Division of Molecular and Developmental Biology, Samuel Lunenfeld Research Institute, Mount Sinai Hospital, Toronto, Ontario, Canada 3Department of Molecular and Medical Genetics, University of Toronto, Toronto, Ontario, Canada *Author for correspondence at: Toronto Western Hospital, Room 13-419, 399 Bathurst Street, Toronto, Ontario, M5T 2S8 Canada SUMMARY Mouse LSP1 is a 330 amino acid intracellular F-actin 18 bp encoding the 6 amino acids HLIRHQ of the acidic binding protein expressed in lymphocytes and domain. Therefore, the Lsp1 gene encodes four protein macrophages but not in non-hematopoietic tissues. A 328 isoforms: full-length LSP1 and S37 proteins, designated amino acid LSP1-related protein, designated S37, is LSP1-I and S37-I and the same proteins without the expressed in murine bone marrow stromal cells, in fibro- HLIRHQ sequence, designated LSP1-II and S37-II. By in blasts, and in a myocyte cell line. The two proteins differ situ hybridization analysis we show that the S37 isoforms only at their N termini, the first 23 amino acid residues of are expressed in mesenchymal tissue, but not in adjacent LSP1 being replaced by 21 different residues in S37. The epithelial tissue, of several developing organs during mouse presence of different amino termini suggests that the LSP1 embryogenesis.
    [Show full text]
  • Integrative Differential Expression and Gene Set Enrichment Analysis Using Summary Statistics for Scrna-Seq Studies
    ARTICLE https://doi.org/10.1038/s41467-020-15298-6 OPEN Integrative differential expression and gene set enrichment analysis using summary statistics for scRNA-seq studies ✉ Ying Ma 1,7, Shiquan Sun 1,7, Xuequn Shang2, Evan T. Keller 3, Mengjie Chen 4,5 & Xiang Zhou 1,6 Differential expression (DE) analysis and gene set enrichment (GSE) analysis are commonly applied in single cell RNA sequencing (scRNA-seq) studies. Here, we develop an integrative 1234567890():,; and scalable computational method, iDEA, to perform joint DE and GSE analysis through a hierarchical Bayesian framework. By integrating DE and GSE analyses, iDEA can improve the power and consistency of DE analysis and the accuracy of GSE analysis. Importantly, iDEA uses only DE summary statistics as input, enabling effective data modeling through com- plementing and pairing with various existing DE methods. We illustrate the benefits of iDEA with extensive simulations. We also apply iDEA to analyze three scRNA-seq data sets, where iDEA achieves up to five-fold power gain over existing GSE methods and up to 64% power gain over existing DE methods. The power gain brought by iDEA allows us to identify many pathways that would not be identified by existing approaches in these data. 1 Department of Biostatistics, University of Michigan, Ann Arbor, MI 48109, USA. 2 School of Computer Science, Northwestern Polytechnical University, Xi’an, Shaanxi 710072, P.R. China. 3 Department of Urology, University of Michigan, Ann Arbor, MI 48109, USA. 4 Department of Human Genetics, University of Chicago, Chicago, IL 60637, USA. 5 Section of Genetic Medicine, Department of Medicine, University of Chicago, Chicago, IL 60637, USA.
    [Show full text]
  • Transcriptome-Wide Profiling of Cerebral Cavernous Malformations
    www.nature.com/scientificreports OPEN Transcriptome-wide Profling of Cerebral Cavernous Malformations Patients Reveal Important Long noncoding RNA molecular signatures Santhilal Subhash 2,8, Norman Kalmbach3, Florian Wegner4, Susanne Petri4, Torsten Glomb5, Oliver Dittrich-Breiholz5, Caiquan Huang1, Kiran Kumar Bali6, Wolfram S. Kunz7, Amir Samii1, Helmut Bertalanfy1, Chandrasekhar Kanduri2* & Souvik Kar1,8* Cerebral cavernous malformations (CCMs) are low-fow vascular malformations in the brain associated with recurrent hemorrhage and seizures. The current treatment of CCMs relies solely on surgical intervention. Henceforth, alternative non-invasive therapies are urgently needed to help prevent subsequent hemorrhagic episodes. Long non-coding RNAs (lncRNAs) belong to the class of non-coding RNAs and are known to regulate gene transcription and involved in chromatin remodeling via various mechanism. Despite accumulating evidence demonstrating the role of lncRNAs in cerebrovascular disorders, their identifcation in CCMs pathology remains unknown. The objective of the current study was to identify lncRNAs associated with CCMs pathogenesis using patient cohorts having 10 CCM patients and 4 controls from brain. Executing next generation sequencing, we performed whole transcriptome sequencing (RNA-seq) analysis and identifed 1,967 lncRNAs and 4,928 protein coding genes (PCGs) to be diferentially expressed in CCMs patients. Among these, we selected top 6 diferentially expressed lncRNAs each having signifcant correlative expression with more than 100 diferentially expressed PCGs. The diferential expression status of the top lncRNAs, SMIM25 and LBX2-AS1 in CCMs was further confrmed by qRT-PCR analysis. Additionally, gene set enrichment analysis of correlated PCGs revealed critical pathways related to vascular signaling and important biological processes relevant to CCMs pathophysiology.
    [Show full text]
  • Impact of a Diet and Activity Health Promotion Intervention on Regional
    Hibler et al. Clinical Epigenetics (2019) 11:133 https://doi.org/10.1186/s13148-019-0707-0 RESEARCH Open Access Impact of a diet and activity health promotion intervention on regional patterns of DNA methylation Elizabeth Hibler1* , Lei Huang2, Jorge Andrade2,3 and Bonnie Spring1 Abstract Background: Studies demonstrate the impact of diet and physical activity on epigenetic biomarkers, specifically DNA methylation. However, no intervention studies have examined the combined impact of dietary and activity changes on the blood epigenome. The objective of this study was to examine the impact of the Make Better Choices 2 (MBC2) healthy diet and activity intervention on patterns of epigenome-wide DNA methylation. The MBC2 study was a 9-month randomized controlled trial among adults aged 18–65 with non-optimal levels of health behaviors. The study compared three 12-week interventions to (1) simultaneously increase exercise and fruit/ vegetable intake, while decreasing sedentary leisure screen time; (2) sequentially increase fruit/vegetable intake and decrease leisure screen time first, then increase exercise; (3) increase sleep and decrease stress (control). We collected blood samples at baseline, 3 and 9 months, and measured DNA methylation using the Illumina EPIC (850 k) BeadChip. We examined region-based differential methylation patterns using linear regression models with the false discovery rate of 0.05. We also conducted pathway analysis using gene ontology (GO), KEGG, and IPA canonical pathway databases. Results: We found no differences between the MBC2 population (n = 340) and the subsample with DNA methylation measured (n = 68) on baseline characteristics or the impact of the intervention on behavior change.
    [Show full text]
  • A Systems Genomics Approach to Uncover Patient-Specific Pathogenic Pathways and Proteins in a Complex Disease
    bioRxiv preprint doi: https://doi.org/10.1101/692269; this version posted July 4, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. A systems genomics approach to uncover patient-specific pathogenic pathways and proteins in a complex disease 1,2,3,4,§ 5,§ 1,4,6,§ 4,7 Johanne Brooks ,​ Dezso Modos ,​ Padhmanand Sudhakar ,​ David Fazekas ,​ Azedine ​ ​ ​ ​ 5 8 4 1,4 6,9 Zoufir ,​ Orsolya Kapuy ,​ Mate Szalay-Beko ,​ Matthew Madgwick ,​ Bram Verstockt ,​ Lindsay ​ ​ ​ ​ ​ 1,2 1,2,3 3 10 6,9 Hall Alastair​ Watson ,​ Mark Tremelling ,​ Miles Parkes ,​ Severine Vermeire ,​ Andreas ​ ​ ​ ​ ​ 5 1,2,* 1,4,* Bender ,​ Simon R. Carding ,​ Tamas Korcsmaros ​ ​ ​ 1 Gut Health and Microbes Programme, The Quadram Institute Bioscience, Norwich Research Park, Norwich, UK 2 ​ Norwich Medical School, University of East Anglia, Norwich, UK 3 ​ Department of Gastroenterology, Norfolk and Norwich University Hospitals, Norwich, UK 4 ​ Earlham Institute, Norwich Research Park, Norwich, UK 5 Centre​ for Molecular Science Informatics, Department of Chemistry, University of Cambridge, Cambridge, UK 6 ​ KU Leuven, Department of Chronic diseases, Metabolism and Ageing, Leuven, Belgium 7 ​ Department of Genetics, Eötvös Loránd University, Budapest, Hungary 8 Department​ of Medical Chemistry, Molecular Biology and Pathobiochemistry, Semmelweis University, Budapest, Hungary 9 University​ Hospitals Leuven, Department of Gastroenterology and Hepatology, KU Leuven, Leuven, Belgium 10 Inflammatory​ Bowel Disease Research Group, Addenbrooke's Hospital, University of Cambridge, Cambridge, UK. § ​ equal contribution * ​ joint corresponding authors bioRxiv preprint doi: https://doi.org/10.1101/692269; this version posted July 4, 2019.
    [Show full text]
  • LSP1 (NM 001242932) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG234186 LSP1 (NM_001242932) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: LSP1 (NM_001242932) Human Tagged ORF Clone Tag: TurboGFP Symbol: LSP1 Synonyms: pp52; WP34 Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 LSP1 (NM_001242932) Human Tagged ORF Clone – RG234186 ORF Nucleotide >RG234186 representing NM_001242932 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCTCCGATCTGGTCCCCACCTGGCAGGGTCTCCGGCTGTCACCTGAGTTCAGGACCAGCACCAGGAT CTGCAGTGGGCCCCTGGCTGGGCACACCTCATCCCAGCCTCCCCCTACCCCTGGCCCCCCATAAGCCTCC TCCTCCTGGGCTTCCAGGCTCTGCTGGTCAGACCTCCCTCCCTGCCCAACGGGAATGTGTTTTCCCAGGG GACGCTGCTGTCCACCAGGAGCTCTGTGGCCTGGGATTTGAGGAGTGCCTGGGGTCAATCCCCCAGGCTC ACCAGTGCTACTTAACAAATGGGCCCAAGAGAAGGAAGTGCAGCCCCCGGAGGAGGGGCAGAGCCCCTGC CTGGCTGTGCGGTGGCTCACCCCCTTGTCACCAGGGGCTCGGCCATGAGCATCCGTCCAGCGGGCCCAGC ACCAACTGCAGCCCCAGGCCCACTGCTCAGTGGAGCGTGGAGGACGAGGAGGAGGCCGTCCACGAGCAAT GCCAGCATGAGAGAGACAGGCAGCTTCAGGCCCAGGACGAGGAGGGAGGCGGCCATGTCCCCGAGCGGCC GAAGCAGGAGATGCTCCTCAGCCTGAAGCCCTCGGAGGCCCCTGAACTGGATGAGGACGAGGGCTTTGGC
    [Show full text]