Expression of Mouse LSP1/S37 Isoforms S37 Is Expressed in Embryonic Mesenchymal Cells

Total Page:16

File Type:pdf, Size:1020Kb

Expression of Mouse LSP1/S37 Isoforms S37 Is Expressed in Embryonic Mesenchymal Cells Journal of Cell Science 107, 3591-3600 (1994) 3591 Printed in Great Britain © The Company of Biologists Limited 1994 Expression of mouse LSP1/S37 isoforms S37 is expressed in embryonic mesenchymal cells V. L. Misener1, C.-c. Hui2, I. A. Malapitan1, M.-E. Ittel1, A. L. Joyner2,3 and J. Jongstra1,* 1The Arthritis Centre-Research Unit, The Toronto Hospital Research Institute and Department of Immunology, University of Toronto, Toronto, Ontario, Canada 2Division of Molecular and Developmental Biology, Samuel Lunenfeld Research Institute, Mount Sinai Hospital, Toronto, Ontario, Canada 3Department of Molecular and Medical Genetics, University of Toronto, Toronto, Ontario, Canada *Author for correspondence at: Toronto Western Hospital, Room 13-419, 399 Bathurst Street, Toronto, Ontario, M5T 2S8 Canada SUMMARY Mouse LSP1 is a 330 amino acid intracellular F-actin 18 bp encoding the 6 amino acids HLIRHQ of the acidic binding protein expressed in lymphocytes and domain. Therefore, the Lsp1 gene encodes four protein macrophages but not in non-hematopoietic tissues. A 328 isoforms: full-length LSP1 and S37 proteins, designated amino acid LSP1-related protein, designated S37, is LSP1-I and S37-I and the same proteins without the expressed in murine bone marrow stromal cells, in fibro- HLIRHQ sequence, designated LSP1-II and S37-II. By in blasts, and in a myocyte cell line. The two proteins differ situ hybridization analysis we show that the S37 isoforms only at their N termini, the first 23 amino acid residues of are expressed in mesenchymal tissue, but not in adjacent LSP1 being replaced by 21 different residues in S37. The epithelial tissue, of several developing organs during mouse presence of different amino termini suggests that the LSP1 embryogenesis. This, together with our finding that S37 is and S37 proteins are encoded by transcripts arising an F-actin binding protein, suggests that S37 is a cytoskele- through alternative exon splicing. Here we report the tal protein of mesenchymal cells, which may play a role in genomic organization of the Lsp1 gene and show that the mesenchyme-induced epithelial differentiation during distinct N termini of LSP1 and S37 are encoded by two organogenesis. alternatively used exons, each containing a translational start codon. We also demonstrate that alternative 3′ acceptor sites are used in the splicing of exon 5. This results Key words: LSP1, S37, gene structure, expression, embryonic in LSP1 and S37 transcripts that either do or do not contain mesenchyme, F-actin binding INTRODUCTION detergent-insoluble residue after lysis of B-lymphoma cells or normal spleen cells with the non-ionic detergent NP-40 Mouse LSP1 (Jongstra et al., 1988a), also designated pp52 (Jongstra-Bilen et al., 1992; M.-E. Ittel, unpublished). Fur- (Gimble et al., 1993), is a 330 amino acid intracellular phos- thermore, we showed that upon treatment of B-lymphoma cell phoprotein expressed in normal B-cells and transformed B-cell lines with anti-immunoglobulin (Ig) antibody to induce lines, in normal T-cells and non-transformed functional T-cell capping of membrane Ig molecules, the intracellular LSP1 lines, but not in transformed T-cell lines (Jongstra et al., 1988a; protein aggregates directly underneath the clusters of Klein et al., 1989). Human LSP1 has a similar expression membrane IgM (Klein et al., 1990). These results suggest that pattern (Jongstra et al., 1988a) and, in addition, has been found LSP1 protein is associated with the cytoskeleton. Our finding to be expressed in human neutrophils (Howard et al., 1994). A that mouse LSP1 protein binds to filamentous actin (F-actin) comparison of the mouse and human LSP1 cDNA sequences with a Kd of 0.2 µM, but does not bind to globular actin (G- predicts that the LSP1 proteins have a two-domain structure actin) suggests that LSP1 protein associates with the cytoskele- with an amino-terminal domain rich in acidic residues and a ton by binding directly to the F-actin-containing microfila- carboxy-terminal domain rich in basic residues. The basic ments. We also showed that both F-actin binding in vitro and domains of the mouse and human LSP1 proteins are 85% cytoskeletal binding in vivo occur through the conserved basic identical, suggesting that the basic domain of LSP1 is of par- domain (Jongstra-Bilen et al., 1992). ticular importance for LSP1 function (Jongstra-Bilen et al., Mouse LSP1 protein is encoded by a 1.6 kb mRNA tran- 1990). script expressed in lymphoid cells, lymphoma cell lines Intracellular fractionation studies showed that a significant (Jongstra et al., 1988a; Klein et al., 1989) and transformed fraction of the intracellular LSP1 protein associates with the macrophage cell lines (this paper). Expression is undetectable 3592 V. L. Misener and others in several other myeloid cell types tested, including peripheral Bilen et al., 1992), except that polymerization reactions were done at blood granulocytes, erythroleukemia cell lines and the masto- room temperature for 1 hour and contained 4 µM G-actin (from rabbit cytoma cell line P815. In addition, expression of mouse LSP1 skeletal muscle, a gift from Dr P. A. Janmey, Brigham and Women’s RNA is not detected in a variety of non-hematopoietic tissues Hospital, Boston) and 2 µM recombinant protein. such as adult liver, brain and kidney (Jongstra et al., 1988a). Oligonucleotides Recently, an LSP1-related cDNA designated S37, was isolated from the murine bone marrow stromal cell line BMS2. These Sequences of oligonucleotides used in this study are given below. Nucleotides represented in upper case letters correspond to either cells express a 2 kb RNA transcript that hybridizes with the sense or anti-sense Lsp1 sequences. Those in lower case letters are LSP1 cDNA and which is also detected in the fibroblast cell nonhomologous sequences, incorporating restriction sites designed to lines NIH3T3 and L-cells, and in the myocyte cell line G7 facilitate the subcloning of amplified fragments: (Gimble et al., 1993). The nucleotide sequence of the stromal A1 (sense): 5′-ATGGCGGAGGCTGCCATCGATCCCAGA-3′; cell-derived S37 clone predicts that it encodes a 328 amino A2 (anti-sense): 5′-aggtcgaCAGCTCAACGGTGTCTTCTA-3′; acid protein that is identical to the LSP1 protein expressed in A17 (sense): 5′-CCTGCAGCATGAATGGCCCCGCACTCC-3′; lymphocytes and macrophages, except that the 23 amino- JJ24 (sense): 5′-aggtcgacAACAGAGGTGCTGGGCCAGA-3′; terminal residues of LSP1 are replaced by a different amino JJ25 (anti-sense): 5′-aggtcgaCTCAGCAGCTTCTCCAGGC-3′; terminus of 21 amino acid residues in S37. JJ53 (sense): 5′-agggatccAGAGAAACACCAGGAGCC-3′; The F-actin binding property and the cytoskeletal localiza- JJ54 (anti-sense): 5′-aggtcgacCCTTCGCTGTCTTCTGCA-3′. tion of LSP1 protein led us to suggest that this protein is involved in the proper functioning of the immune system, in RNA isolation and northern blot analysis which it is uniquely expressed, through its involvement in Isolation of poly(A)+ RNA from mouse embryos and isolation of total cytoskeleton-dependent aspects of biological processes such as cytoplasmic RNA from cell lines, were carried out as described signal transduction, cellular adhesion or cell motility. As a (Jongstra et al, 1988b; Chomczynski and Sacchi, 1987; Kingston, 1987). Samples of poly(A)+ RNA (10 µg) or of total cytoplasmic prelude to generating an LSP1-deficient mouse strain by RNA (10 µg) were subjected to agarose/formaldehyde gel elec- targeted disruption of the Lsp1 gene in embryonic stem cells, trophoresis, transferred to nitrocellulose and hybridized with 32P- we determined the genomic organization of the Lsp1 gene and labelled DNA probes (Jongstra et al., 1988b). investigated its expression in the developing mouse embryo. The genomic organization of the Lsp1 gene demonstrates that In situ hybridization analysis the different N termini of the LSP1 and S37 proteins are In situ hybridization analysis of fixed and acetylated mouse embryo encoded by separate exons. Further isoform diversity is created sections with the full-length LSP1 probe was carried out essentially by alternative splicing of exon 5, which encodes amino acid as described (Hui and Joyner, 1993). In experiments using the S37- residues in the acidic domain. In addition, we extend the specific Emb 5′ probe the hybridization and wash conditions were findings of previous expression studies (Jongstra et al., 1988a; modified as described below. The Emb 5′ probe contains 106 bp of ′ Klein et al., 1989), and show that transcripts encoding LSP1 5 untranslated sequence and 62 bp of N-terminal coding sequence of are expressed in macrophage cell lines and that transcripts S37 RNA. Sense and anti-sense RNA probes were prepared by in vitro transcription of DNA templates in the cloning vector pBluescript II encoding S37 are expressed in certain mesenchymal tissues KS(+), using either T3 or T7 RNA polymerase. The Emb 5′ probe during mouse embryonic development. was hybridized overnight at 50°C. Modified post-hybridization washes were as follows: slides were immersed at 65°C for 10 minutes in washing buffer (50% formamide, 2× SSC, 0.1% β-mercap- MATERIALS AND METHODS toethanol), rinsed three times (10 minutes each) at 37°C in NTE (0.5 M NaCl, 10 mM Tris-HCl, 5 mM EDTA, pH 7.5), treated for 30 Cell lines minutes at 37°C with 20 µg/ml RNase A in NTE, and immersed for The macrophage cell lines J774A.1 and IC-21 were purchased form a further 15 minutes in NTE. Slides were then washed sequentially in the ATCC and cultured according to the instructions provided. B- washing buffer at 65°C for 5 minutes, 2× SSC at 37°C for 10 minutes lymphoma cell lines BAL17 and WEHI-231 were obtained from M. and 0.1× SSC at 37°C for 10 minutes, followed by dehydration. Slides M. Davis, Stanford University. The T-lymphoma cell line BW5147 were coated with Kodak NTB 2 emulsion and exposed at 4°C for 4- was obtained from N.
Recommended publications
  • Aberrant Methylation Underlies Insulin Gene Expression in Human Insulinoma
    ARTICLE https://doi.org/10.1038/s41467-020-18839-1 OPEN Aberrant methylation underlies insulin gene expression in human insulinoma Esra Karakose1,6, Huan Wang 2,6, William Inabnet1, Rajesh V. Thakker 3, Steven Libutti4, Gustavo Fernandez-Ranvier 1, Hyunsuk Suh1, Mark Stevenson 3, Yayoi Kinoshita1, Michael Donovan1, Yevgeniy Antipin1,2, Yan Li5, Xiaoxiao Liu 5, Fulai Jin 5, Peng Wang 1, Andrew Uzilov 1,2, ✉ Carmen Argmann 1, Eric E. Schadt 1,2, Andrew F. Stewart 1,7 , Donald K. Scott 1,7 & Luca Lambertini 1,6 1234567890():,; Human insulinomas are rare, benign, slowly proliferating, insulin-producing beta cell tumors that provide a molecular “recipe” or “roadmap” for pathways that control human beta cell regeneration. An earlier study revealed abnormal methylation in the imprinted p15.5-p15.4 region of chromosome 11, known to be abnormally methylated in another disorder of expanded beta cell mass and function: the focal variant of congenital hyperinsulinism. Here, we compare deep DNA methylome sequencing on 19 human insulinomas, and five sets of normal beta cells. We find a remarkably consistent, abnormal methylation pattern in insu- linomas. The findings suggest that abnormal insulin (INS) promoter methylation and altered transcription factor expression create alternative drivers of INS expression, replacing cano- nical PDX1-driven beta cell specification with a pathological, looping, distal enhancer-based form of transcriptional regulation. Finally, NFaT transcription factors, rather than the cano- nical PDX1 enhancer complex, are predicted to drive INS transactivation. 1 From the Diabetes Obesity and Metabolism Institute, The Department of Surgery, The Department of Pathology, The Department of Genetics and Genomics Sciences and The Institute for Genomics and Multiscale Biology, The Icahn School of Medicine at Mount Sinai, New York, NY 10029, USA.
    [Show full text]
  • Analysis of Gene Expression Data for Gene Ontology
    ANALYSIS OF GENE EXPRESSION DATA FOR GENE ONTOLOGY BASED PROTEIN FUNCTION PREDICTION A Thesis Presented to The Graduate Faculty of The University of Akron In Partial Fulfillment of the Requirements for the Degree Master of Science Robert Daniel Macholan May 2011 ANALYSIS OF GENE EXPRESSION DATA FOR GENE ONTOLOGY BASED PROTEIN FUNCTION PREDICTION Robert Daniel Macholan Thesis Approved: Accepted: _______________________________ _______________________________ Advisor Department Chair Dr. Zhong-Hui Duan Dr. Chien-Chung Chan _______________________________ _______________________________ Committee Member Dean of the College Dr. Chien-Chung Chan Dr. Chand K. Midha _______________________________ _______________________________ Committee Member Dean of the Graduate School Dr. Yingcai Xiao Dr. George R. Newkome _______________________________ Date ii ABSTRACT A tremendous increase in genomic data has encouraged biologists to turn to bioinformatics in order to assist in its interpretation and processing. One of the present challenges that need to be overcome in order to understand this data more completely is the development of a reliable method to accurately predict the function of a protein from its genomic information. This study focuses on developing an effective algorithm for protein function prediction. The algorithm is based on proteins that have similar expression patterns. The similarity of the expression data is determined using a novel measure, the slope matrix. The slope matrix introduces a normalized method for the comparison of expression levels throughout a proteome. The algorithm is tested using real microarray gene expression data. Their functions are characterized using gene ontology annotations. The results of the case study indicate the protein function prediction algorithm developed is comparable to the prediction algorithms that are based on the annotations of homologous proteins.
    [Show full text]
  • Original Article Correlation Between LSP1 Polymorphisms and the Susceptibility to Breast Cancer
    Int J Clin Exp Pathol 2015;8(5):5798-5802 www.ijcep.com /ISSN:1936-2625/IJCEP0005835 Original Article Correlation between LSP1 polymorphisms and the susceptibility to breast cancer Hai Chen, Xiaodong Qi, Ping Qiu, Jiali Zhao Department of Galactophore, The General Hospital of Beijing Military Command, Beijing, China Received January 12, 2015; Accepted March 16, 2015; Epub May 1, 2015; Published May 15, 2015 Abstract: Objective: The present study aimed at assessing the relationship between Leukocyte-specific protein 1 gene (LSP1) polymorphisms (rs569550 and rs592373) and the pathogenesis of breast cancer (BC). Methods: 70 BC patients and 72 healthy subjects were enrolled in the study. Rs569550 and rs592373 polymorphisms were genotyped by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). Odds ratio (OR) with 95% confidence interval (CI) were calculated by the chi-squared test to assess the relationship between LSP1 polymorphisms and BC risk. Linkage disequilibrium (LD) and haplotypes were also analyzed by HaploView software. Results: Genotype distribution of the control was in accordance with Hardy-Weinberg equilibrium (HWE). The homo- zygous genotype TT and T allele of rs569550 could significantly increase the risk of BC (TT vs. GG: OR=3.17, 95% CI=1.23-8.91; T vs. G: OR=1.63, 95% CI=1.01-2.64). For rs592373, mutation homozygous genotype CC and C allele were significantly associated with BC susceptibility (CC vs. TT: OR=4.45, 95% CI=1.38-14.8; C vs. T: OR=1.70, 95% CI=1.03-2.81). LD and haplotypes analysis of rs569550 and rs592373 polymorphisms showed that T-C haplotype was a risk factor for BC (T-C vs.
    [Show full text]
  • Meta-Analysis of Nasopharyngeal Carcinoma
    BMC Genomics BioMed Central Research article Open Access Meta-analysis of nasopharyngeal carcinoma microarray data explores mechanism of EBV-regulated neoplastic transformation Xia Chen†1,2, Shuang Liang†1, WenLing Zheng1,3, ZhiJun Liao1, Tao Shang1 and WenLi Ma*1 Address: 1Institute of Genetic Engineering, Southern Medical University, Guangzhou, PR China, 2Xiangya Pingkuang associated hospital, Pingxiang, Jiangxi, PR China and 3Southern Genomics Research Center, Guangzhou, Guangdong, PR China Email: Xia Chen - [email protected]; Shuang Liang - [email protected]; WenLing Zheng - [email protected]; ZhiJun Liao - [email protected]; Tao Shang - [email protected]; WenLi Ma* - [email protected] * Corresponding author †Equal contributors Published: 7 July 2008 Received: 16 February 2008 Accepted: 7 July 2008 BMC Genomics 2008, 9:322 doi:10.1186/1471-2164-9-322 This article is available from: http://www.biomedcentral.com/1471-2164/9/322 © 2008 Chen et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Background: Epstein-Barr virus (EBV) presumably plays an important role in the pathogenesis of nasopharyngeal carcinoma (NPC), but the molecular mechanism of EBV-dependent neoplastic transformation is not well understood. The combination of bioinformatics with evidences from biological experiments paved a new way to gain more insights into the molecular mechanism of cancer. Results: We profiled gene expression using a meta-analysis approach. Two sets of meta-genes were obtained. Meta-A genes were identified by finding those commonly activated/deactivated upon EBV infection/reactivation.
    [Show full text]
  • LSP1-Myosin1e Bi-Molecular Complex Regulates Focal Adhesion Dynamics
    bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.963991; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. LSP1-myosin1e bi-molecular complex regulates focal adhesion dynamics and cell migration Katja Schäringer1*, Sebastian Maxeiner1*, Carmen Schalla1, Stephan Rütten2, Martin Zenke1 and Antonio Sechi1 1Institute of Biomedical Engineering, Dept. of Cell Biology, RWTH Aachen University, Pauwelsstrasse, 30, D-52074 Aachen, Germany 2Electron Microscopy Facility, Institute of Pathology, RWTH Aachen University, Pauwelsstrasse, 30, D-52074 Aachen, Germany *equal contribution Corresponding author: Email: [email protected] Telephone: +49 241 8085248 Running head: LSP1-myosin1e complex regulates cell migration. Keywords: Actin cytoskeleton remodelling, focal adhesions, cell motility, macrophages. 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.963991; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Several cytoskeleton-associated proteins and signalling pathways work in concert to regulate actin cytoskeleton remodelling, cell adhesion and migration. We have recently demonstrated that the bi-molecular complex between the leukocyte-specific protein 1 (LSP1) and myosin1e controls actin cytoskeleton remodelling during phagocytosis. In this study, we show that LSP1 down regulation severely impairs cell migration, lamellipodia formation and focal adhesion dynamics in macrophages. Inhibition of the interaction between LSP1 and myosin1e also impairs these processes resulting in poorly motile cells, which are characterised by few and small lamellipodia.
    [Show full text]
  • Anti-LSP1 Antibody (ARG55377)
    Product datasheet [email protected] ARG55377 Package: 50 μl anti-LSP1 antibody Store at: -20°C Summary Product Description Rabbit Polyclonal antibody recognizes LSP1 Tested Reactivity Hu Tested Application WB Host Rabbit Clonality Polyclonal Isotype IgG Target Name LSP1 Antigen Species Human Immunogen Synthetic peptide corresponding to aa. 121-149 of Human LSP1. Conjugation Un-conjugated Alternate Names Lymphocyte-specific protein 1; pp52; 52 kDa phosphoprotein; 47 kDa actin-binding protein; WP34; Lymphocyte-specific antigen WP34 Application Instructions Application table Application Dilution WB 1:1000 Application Note * The dilutions indicate recommended starting dilutions and the optimal dilutions or concentrations should be determined by the scientist. Positive Control Daudi Calculated Mw 37 kDa Properties Form Liquid Purification Affinity purification with immunogen. Buffer PBS (without Mg2+ and Ca2+, pH 7.4), 150mM NaCl, 0.02% Sodium azide and 50% Glycerol Preservative 0.02% Sodium azide Stabilizer 50% Glycerol Storage instruction For continuous use, store undiluted antibody at 2-8°C for up to a week. For long-term storage, aliquot and store at -20°C. Storage in frost free freezers is not recommended. Avoid repeated freeze/thaw cycles. Suggest spin the vial prior to opening. The antibody solution should be gently mixed before use. Note For laboratory research only, not for drug, diagnostic or other use. www.arigobio.com 1/2 Bioinformation Database links GeneID: 4046 Human Swiss-port # P33241 Human Gene Symbol LSP1 Gene Full Name lymphocyte-specific protein 1 Background This gene encodes an intracellular F-actin binding protein. The protein is expressed in lymphocytes, neutrophils, macrophages, and endothelium and may regulate neutrophil motility, adhesion to fibrinogen matrix proteins, and transendothelial migration.
    [Show full text]
  • Integrative Differential Expression and Gene Set Enrichment Analysis Using Summary Statistics for Scrna-Seq Studies
    ARTICLE https://doi.org/10.1038/s41467-020-15298-6 OPEN Integrative differential expression and gene set enrichment analysis using summary statistics for scRNA-seq studies ✉ Ying Ma 1,7, Shiquan Sun 1,7, Xuequn Shang2, Evan T. Keller 3, Mengjie Chen 4,5 & Xiang Zhou 1,6 Differential expression (DE) analysis and gene set enrichment (GSE) analysis are commonly applied in single cell RNA sequencing (scRNA-seq) studies. Here, we develop an integrative 1234567890():,; and scalable computational method, iDEA, to perform joint DE and GSE analysis through a hierarchical Bayesian framework. By integrating DE and GSE analyses, iDEA can improve the power and consistency of DE analysis and the accuracy of GSE analysis. Importantly, iDEA uses only DE summary statistics as input, enabling effective data modeling through com- plementing and pairing with various existing DE methods. We illustrate the benefits of iDEA with extensive simulations. We also apply iDEA to analyze three scRNA-seq data sets, where iDEA achieves up to five-fold power gain over existing GSE methods and up to 64% power gain over existing DE methods. The power gain brought by iDEA allows us to identify many pathways that would not be identified by existing approaches in these data. 1 Department of Biostatistics, University of Michigan, Ann Arbor, MI 48109, USA. 2 School of Computer Science, Northwestern Polytechnical University, Xi’an, Shaanxi 710072, P.R. China. 3 Department of Urology, University of Michigan, Ann Arbor, MI 48109, USA. 4 Department of Human Genetics, University of Chicago, Chicago, IL 60637, USA. 5 Section of Genetic Medicine, Department of Medicine, University of Chicago, Chicago, IL 60637, USA.
    [Show full text]
  • Transcriptome-Wide Profiling of Cerebral Cavernous Malformations
    www.nature.com/scientificreports OPEN Transcriptome-wide Profling of Cerebral Cavernous Malformations Patients Reveal Important Long noncoding RNA molecular signatures Santhilal Subhash 2,8, Norman Kalmbach3, Florian Wegner4, Susanne Petri4, Torsten Glomb5, Oliver Dittrich-Breiholz5, Caiquan Huang1, Kiran Kumar Bali6, Wolfram S. Kunz7, Amir Samii1, Helmut Bertalanfy1, Chandrasekhar Kanduri2* & Souvik Kar1,8* Cerebral cavernous malformations (CCMs) are low-fow vascular malformations in the brain associated with recurrent hemorrhage and seizures. The current treatment of CCMs relies solely on surgical intervention. Henceforth, alternative non-invasive therapies are urgently needed to help prevent subsequent hemorrhagic episodes. Long non-coding RNAs (lncRNAs) belong to the class of non-coding RNAs and are known to regulate gene transcription and involved in chromatin remodeling via various mechanism. Despite accumulating evidence demonstrating the role of lncRNAs in cerebrovascular disorders, their identifcation in CCMs pathology remains unknown. The objective of the current study was to identify lncRNAs associated with CCMs pathogenesis using patient cohorts having 10 CCM patients and 4 controls from brain. Executing next generation sequencing, we performed whole transcriptome sequencing (RNA-seq) analysis and identifed 1,967 lncRNAs and 4,928 protein coding genes (PCGs) to be diferentially expressed in CCMs patients. Among these, we selected top 6 diferentially expressed lncRNAs each having signifcant correlative expression with more than 100 diferentially expressed PCGs. The diferential expression status of the top lncRNAs, SMIM25 and LBX2-AS1 in CCMs was further confrmed by qRT-PCR analysis. Additionally, gene set enrichment analysis of correlated PCGs revealed critical pathways related to vascular signaling and important biological processes relevant to CCMs pathophysiology.
    [Show full text]
  • Impact of a Diet and Activity Health Promotion Intervention on Regional
    Hibler et al. Clinical Epigenetics (2019) 11:133 https://doi.org/10.1186/s13148-019-0707-0 RESEARCH Open Access Impact of a diet and activity health promotion intervention on regional patterns of DNA methylation Elizabeth Hibler1* , Lei Huang2, Jorge Andrade2,3 and Bonnie Spring1 Abstract Background: Studies demonstrate the impact of diet and physical activity on epigenetic biomarkers, specifically DNA methylation. However, no intervention studies have examined the combined impact of dietary and activity changes on the blood epigenome. The objective of this study was to examine the impact of the Make Better Choices 2 (MBC2) healthy diet and activity intervention on patterns of epigenome-wide DNA methylation. The MBC2 study was a 9-month randomized controlled trial among adults aged 18–65 with non-optimal levels of health behaviors. The study compared three 12-week interventions to (1) simultaneously increase exercise and fruit/ vegetable intake, while decreasing sedentary leisure screen time; (2) sequentially increase fruit/vegetable intake and decrease leisure screen time first, then increase exercise; (3) increase sleep and decrease stress (control). We collected blood samples at baseline, 3 and 9 months, and measured DNA methylation using the Illumina EPIC (850 k) BeadChip. We examined region-based differential methylation patterns using linear regression models with the false discovery rate of 0.05. We also conducted pathway analysis using gene ontology (GO), KEGG, and IPA canonical pathway databases. Results: We found no differences between the MBC2 population (n = 340) and the subsample with DNA methylation measured (n = 68) on baseline characteristics or the impact of the intervention on behavior change.
    [Show full text]
  • A Systems Genomics Approach to Uncover Patient-Specific Pathogenic Pathways and Proteins in a Complex Disease
    bioRxiv preprint doi: https://doi.org/10.1101/692269; this version posted July 4, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. A systems genomics approach to uncover patient-specific pathogenic pathways and proteins in a complex disease 1,2,3,4,§ 5,§ 1,4,6,§ 4,7 Johanne Brooks ,​ Dezso Modos ,​ Padhmanand Sudhakar ,​ David Fazekas ,​ Azedine ​ ​ ​ ​ 5 8 4 1,4 6,9 Zoufir ,​ Orsolya Kapuy ,​ Mate Szalay-Beko ,​ Matthew Madgwick ,​ Bram Verstockt ,​ Lindsay ​ ​ ​ ​ ​ 1,2 1,2,3 3 10 6,9 Hall Alastair​ Watson ,​ Mark Tremelling ,​ Miles Parkes ,​ Severine Vermeire ,​ Andreas ​ ​ ​ ​ ​ 5 1,2,* 1,4,* Bender ,​ Simon R. Carding ,​ Tamas Korcsmaros ​ ​ ​ 1 Gut Health and Microbes Programme, The Quadram Institute Bioscience, Norwich Research Park, Norwich, UK 2 ​ Norwich Medical School, University of East Anglia, Norwich, UK 3 ​ Department of Gastroenterology, Norfolk and Norwich University Hospitals, Norwich, UK 4 ​ Earlham Institute, Norwich Research Park, Norwich, UK 5 Centre​ for Molecular Science Informatics, Department of Chemistry, University of Cambridge, Cambridge, UK 6 ​ KU Leuven, Department of Chronic diseases, Metabolism and Ageing, Leuven, Belgium 7 ​ Department of Genetics, Eötvös Loránd University, Budapest, Hungary 8 Department​ of Medical Chemistry, Molecular Biology and Pathobiochemistry, Semmelweis University, Budapest, Hungary 9 University​ Hospitals Leuven, Department of Gastroenterology and Hepatology, KU Leuven, Leuven, Belgium 10 Inflammatory​ Bowel Disease Research Group, Addenbrooke's Hospital, University of Cambridge, Cambridge, UK. § ​ equal contribution * ​ joint corresponding authors bioRxiv preprint doi: https://doi.org/10.1101/692269; this version posted July 4, 2019.
    [Show full text]
  • LSP1 (NM 001242932) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG234186 LSP1 (NM_001242932) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: LSP1 (NM_001242932) Human Tagged ORF Clone Tag: TurboGFP Symbol: LSP1 Synonyms: pp52; WP34 Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 LSP1 (NM_001242932) Human Tagged ORF Clone – RG234186 ORF Nucleotide >RG234186 representing NM_001242932 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCTCCGATCTGGTCCCCACCTGGCAGGGTCTCCGGCTGTCACCTGAGTTCAGGACCAGCACCAGGAT CTGCAGTGGGCCCCTGGCTGGGCACACCTCATCCCAGCCTCCCCCTACCCCTGGCCCCCCATAAGCCTCC TCCTCCTGGGCTTCCAGGCTCTGCTGGTCAGACCTCCCTCCCTGCCCAACGGGAATGTGTTTTCCCAGGG GACGCTGCTGTCCACCAGGAGCTCTGTGGCCTGGGATTTGAGGAGTGCCTGGGGTCAATCCCCCAGGCTC ACCAGTGCTACTTAACAAATGGGCCCAAGAGAAGGAAGTGCAGCCCCCGGAGGAGGGGCAGAGCCCCTGC CTGGCTGTGCGGTGGCTCACCCCCTTGTCACCAGGGGCTCGGCCATGAGCATCCGTCCAGCGGGCCCAGC ACCAACTGCAGCCCCAGGCCCACTGCTCAGTGGAGCGTGGAGGACGAGGAGGAGGCCGTCCACGAGCAAT GCCAGCATGAGAGAGACAGGCAGCTTCAGGCCCAGGACGAGGAGGGAGGCGGCCATGTCCCCGAGCGGCC GAAGCAGGAGATGCTCCTCAGCCTGAAGCCCTCGGAGGCCCCTGAACTGGATGAGGACGAGGGCTTTGGC
    [Show full text]
  • Transcriptional Recapitulation and Subversion Of
    Open Access Research2007KaiseretVolume al. 8, Issue 7, Article R131 Transcriptional recapitulation and subversion of embryonic colon comment development by mouse colon tumor models and human colon cancer Sergio Kaiser¤*, Young-Kyu Park¤†, Jeffrey L Franklin†, Richard B Halberg‡, Ming Yu§, Walter J Jessen*, Johannes Freudenberg*, Xiaodi Chen‡, Kevin Haigis¶, Anil G Jegga*, Sue Kong*, Bhuvaneswari Sakthivel*, Huan Xu*, Timothy Reichling¥, Mohammad Azhar#, Gregory P Boivin**, reviews Reade B Roberts§, Anika C Bissahoyo§, Fausto Gonzales††, Greg C Bloom††, Steven Eschrich††, Scott L Carter‡‡, Jeremy E Aronow*, John Kleimeyer*, Michael Kleimeyer*, Vivek Ramaswamy*, Stephen H Settle†, Braden Boone†, Shawn Levy†, Jonathan M Graff§§, Thomas Doetschman#, Joanna Groden¥, William F Dove‡, David W Threadgill§, Timothy J Yeatman††, reports Robert J Coffey Jr† and Bruce J Aronow* Addresses: *Biomedical Informatics, Cincinnati Children's Hospital Medical Center, Cincinnati, OH 45229, USA. †Departments of Medicine, and Cell and Developmental Biology, Vanderbilt University and Department of Veterans Affairs Medical Center, Nashville, TN 37232, USA. ‡McArdle Laboratory for Cancer Research, University of Wisconsin, Madison, WI 53706, USA. §Department of Genetics and Lineberger Cancer Center, University of North Carolina, Chapel Hill, NC 27599, USA. ¶Molecular Pathology Unit and Center for Cancer Research, Massachusetts deposited research General Hospital, Charlestown, MA 02129, USA. ¥Division of Human Cancer Genetics, The Ohio State University College of Medicine, Columbus, Ohio 43210-2207, USA. #Institute for Collaborative BioResearch, University of Arizona, Tucson, AZ 85721-0036, USA. **University of Cincinnati, Department of Pathology and Laboratory Medicine, Cincinnati, OH 45267, USA. ††H Lee Moffitt Cancer Center and Research Institute, Tampa, FL 33612, USA. ‡‡Children's Hospital Informatics Program at the Harvard-MIT Division of Health Sciences and Technology (CHIP@HST), Harvard Medical School, Boston, Massachusetts 02115, USA.
    [Show full text]