Green Tea Extract Protects Against Diethylnitrosamine-Mediated Liver Injury and Cell Proliferation by Attenuating STAT3 and Inos

Home , Polyphenol oxidase

Green tea extract protects against diethylnitrosamine-mediated liver injury and cell proliferation by attenuating STAT3 and iNOS

expression in high fat-induced obese mice with nonalcoholic

steatohepatitis

THESIS

Presented in Partial Fulfillment of the Requirements for the Degree Master of Science in the Graduate School of The Ohio State University

Joshua B. Kim

Graduate Program in Human Nutrition

The Ohio State University

2017

Master's Examination Committee:

Richard S. Bruno, Ph.D., R.D., Advisor

Amanda Bird, Ph.D.

Ouliana Ziouzenkova, Ph.D.

Copyrighted by

Joshua B. Kim

2017

Abstract

Nonalcoholic steatohepatitis (NASH) increases hepatocellular carcinoma (HCC) risk by increasing inflammation and oncogenesis. Antiinflammatory activities of green tea extract (GTE) protect against dietary high-fat (HF)-induced NASH. I hypothesized that antiinflammatory and anti-oncogenic activities of GTE during

NASH would also prevent diethylnitrosamine (DEN)-induced development towards HCC. Male C57BL/6J mice (4 wk old) were fed a HF diet devoid of, or supplemented with, GTE at 2% (w/w) and received once weekly intraperitoneal injections of saline vehicle or DEN (60 mg/kg; 5 and 7 wk old) until 25 wk old.

Gross pathological observation indicated no tumors, as expected. GTE protected against obesity-associated parameters, histological and biochemical evidence of

NASH, and hepatic TNFα and MCP-1 expression in both saline- and DEN- injected mice (P<0.05). GTE attenuated serum alanine aminotransferase (ALT) activity, hepatic malondialdehyde (MDA), hepatic iNOS and survivin mRNA expression, signal transducer and activator of transcription 3 (STAT3), and hepatocyte proliferating cell nuclear antigen (PCNA) otherwise exacerbated by

DEN. Hepatic GSTP protein expression increased in mice fed GTE. Serum ALT was correlated (r = 0.71-0.83; P<0.0001) with MDA, iNOS, STAT3, survivin and

PCNA. iNOS correlated with PCNA, STAT3 (r = 0.64-0.65; P<0.05) and survivin ii

(r = 0.66; P<0.0001), suggesting that iNOS-induced inflammation regulates liver injury and oncogenic cell proliferation. GTE lowers NASH- and DEN-mediated

HCC risk by increasing GSTP and attenuating iNOS-mediated liver injury and survivin-mediated cell proliferation.

iii

Acknowledgments

I would like to express my sincerest gratitude towards my advisor Dr.

Richard Bruno. He allowed me to enter his lab with very limited research experience and provided me many opportunities to learn not only research skills, but many life skills as well. His passion for research and passion for his students’ growth has affected me in the best of ways. He challenged me academically and always encouraged the best in me by providing mentorship and friendship. He aided me in many abstracts, posters and oral presentations during my years as a master’s student. This research could not have been done without our collaborators Dr. Jennifer Thomas-Ahner and Dr. Steven Clinton and I would like to thank them for sharing their time and extensive knowledge and expertise.

I would also like to sincerely thank my other committee members, Dr.

Amanda Bird and Dr. Ouliana Ziouzenkova for the time, care and advice they had given me. Dr. Bird’s passion for research, expertise and kindness was greatly encouraging especially during experiments and data analysis. During times of uncertainty, Dr. Ziouzenkova provided insight and outlook on my research and my potential future career. Both committee members truly care about students and it was a privilege to learn under their guidance.

I would like to thank my colleagues Dr. Jinhui Li, Joshua McDonald,

Geoffrey Sasaki, Dr. Priyankar Dey and Dr. Chureeporn Chitchumroonchokchai for helping me with my experiments and giving me guidance. I would especially like to thank Jinhui, Joshua, Geoff and Priyankar for their unwavering support, mentorship and friendship that was invaluable to my master’s study. I am also grateful for other professors including Dr. Martha Belury, Dr. Ahmed Yousef and

Dr. En Huang for their support and suggestions through my academic career.

I would like to thank the organizations that contributed financially to support my education and research: College of Education and Human Ecology

(EHE) and travel awards from EHE and the Department of Human Sciences.

I am also extremely grateful for the support and guidance that members of the Korean Church of Columbus and my family brought during this time. I would like to especially thank Hailey Kim, Ben Lee, Pastor Isaac Surh, Hannah Surh,

Esther Yoon, Caleb Chun and Jakob Han. Each played an integral role to my growth and success. I would like to thank my father Dr. Jin-Gab Kim, my mother

Yoon Kim, and my two sisters Kristen and Danielle Kim for the immense encouragement and support during both highs and lows.

Lastly, I would like to give everything that I have gained from these past two years to God the Father, God the Son and God the Holy Spirit. The

v opportunities they gave me and the unconditional love they showed me will forever be recorded in history that transcends time.

Vita

2008 ...... Dublin Scioto High School

2013 ...... B.S. Biology, The Ohio State University

2013 to present ...... Graduate Teaching Associate,

Department of Human sciences, The

Ohio State University

Publications

Li J, Sapper TN, Mah E, Moller MV, Kim JB, Chitchumroonchokchai C,

McDonald JK, Bruno RS. Green tea extract treatment reduces NFκB activation in mice with diet-induced nonalcoholic steatohepatitis by lowering TNFR1 and TLR4 expression and ligand availability. J Nutr Biochem. 2017 March;41:34-41

Fields of Study

Major Field: Human Nutrition

vii

Table of Contents

Abstract ...... ii Acknowledgments ...... iv Vita ...... vii Publications ...... vii Fields of Study ...... vii Table of Contents ...... viii List of Abbreviations ...... x List of Tables ...... xii List of Figures ...... xiii Chapter 1: INTRODUCTION ...... 1 Chapter 2: REVIEW OF LITERATURE ...... 3 2.1. NAFLD is a risk factor for hepatocellular carcinoma ...... 3 2.2. Etiology Of NASH-induced HCC ...... 4 2.2.1. Metabolic imbalance and the ―two-hit‖ mechanism of NASH ...... 4 2.2.2. Fibrosis and Cirrhosis ...... 6 2.2.3. Pre-malignancy ...... 8 2.3. Signaling in Liver Cancer ...... 9 2.3.1. Pro-inflammatory Signaling in HCC ...... 9 2.3.2. STAT3 pathway...... 12 2.4. Diethylnitrosamine ...... 13 2.5. Models of HCC ...... 16 2.5.1. Using mouse as a model system ...... 16 2.5.2. DEN in mice models ...... 18 2.6. Prevention of NAFLD-induced HCC ...... 20 2.7. Green Tea ...... 20 2.7.1. Bioavailability ...... 21 2.7.2. NAFLD prevention ...... 22 2.7.3. Anti-inflammatory and anti-cancerous effects ...... 23 2.8. Conclusion ...... 24 Chapter 3: MATERIALS AND METHODS ...... 28 3.1. Study design ...... 28 3.2. Hepatic lipids ...... 29 3.3. Liver injury ...... 31 3.4. Hepatic steatosis, fibrosis and NAS score ...... 31 3.5. Cell proliferation ...... 32 3.6. Lipid peroxidation ...... 34 viii

3.7. Total STAT3 and GSTP protein expression ...... 35 3.8. STAT3-oncogenic and NFκB-proinflammatory mRNA expression ...... 36 3.9. Statistical analysis ...... 37 Chapter 4: RESULTS ...... 40 4.1. GTE decreases growth rate regardless of DEN administration without affecting food intake...... 40 4.2. GTE decreases histological and biochemical parameters associated with NASH regardless of DEN administration in livers without tumors...... 41 4.3. GTE increases hepatic GSTP protein expression regardless of DEN administration...... 43 4.4. GTE lowers hepatic NFκB-mediated pro-inflammatory mRNA expression regardless of DEN administration ...... 44 4.5. GTE attenuates hepatic STAT3 protein and survivin mRNA expression otherwise increased by DEN administration ...... 45 4.6. GTE attenuates hepatic cell proliferation regardless of DEN administration...... 46 Chapter 5: DISCUSSION ...... 55 5.1. Summary ...... 55 5.2. Model System of NASH and DEN-mediated HCC ...... 55 5.3. GTE protects against NASH-associated HCC risk by attenuating obesity 58 5.4 GTE prevents HCC-risk by attenuating NASH ...... 59 5.4.1 GTE lowers NASH-associated HCC risk by attenuating lipid peroxidation ...... 60 5.4.2 GTE lowers NASH-associated HCC risk by attenuating NFκB-mediated inflammation ...... 62 5.4.3. GTE lowers NASH-associated HCC risk by attenuating liver injury ... 63 5.4.4. GTE lowers NASH-associated HCC risk by attenuating cell proliferation ...... 66 5.5. Strengths and weaknesses ...... 69 5.6. Significance and implications ...... 70 5.7. Conclusion ...... 71 References ...... 73

List of Abbreviations

ALT alanine aminotransferase BMI body mass index BW body weight CPT1 carnitine palmitoyltransferase I CYP cytochrome P450 DEN diethylnitrosamine DMN dimethylnitrosamine EC epicatechin ECG epicatechin gallate EGC epigallocatechin EGCG epigallocatechin gallate EGF epidermal growth factor EGFR epidermal growth factor receptor FAS fatty acid synthase FFA free fatty acid gp130 glycoprotein 130 GST glutathione S-transferase GSTP glutathione S-transferase pi form GTE green tea extract HCA hepatocellular adenoma HCC hepatocellular carcinoma HFD high-fat diet HNE trans-4-hydroxy-2-nonenal HPRT hypoxanthine-guanine phosphoribosyltransferase HSC hepatic stellate cells HSL hormone sensitive lipase IκB inhibitor of NFκB IKK IκB kinase IL-1 interleukin-1 IL-1R interleukin-1 receptor IL-6 interleukin-6 IL-6R interleukin-6 receptor iNOS inducible nitric oxide synthase JAK2 janus kinase 2 LFD low-fat diet LPS lipopolysaccharide x

MCP-1 monocyte chemoattractant protein-1 MDA malondialdehyde NAFLD nonalcoholic fatty liver disease NASH nonalcoholic steatohepatitis NFκB nuclear factor kappa-light-chain-enhancer of activate B cells Nrf2 nuclear factor E2-related factor 2 PCNA proliferating cell nuclear antigen ROS reactive oxygen species RT-PCR real-time quantitative polymerase chain reaction SREBP-1c sterol regulatory element-binding protein 1 STAT3 signal transducer and activator of transcription 3 TGF-β transforming growth factor beta 1 TLR2 toll-like receptor 2 TLR4 toll-like receptor 4 TNFR tumor necrosis factor receptor TNFα tumor necrosis factor alpha TP tea polyphenols VLDL very low density lipoprotein

List of Tables

Table 1. Composition of experimental diets...... 38

Table 2. Primers used for RT-PCR gene expression studies...... 39

Table 3. Dietary intake, body composition and liver lipids of mice fed a high-fat diet containing GTE at 0 or 2% and administered diethylnitrosamine or saline. . 47

Table 4. Correlations between liver injury and cell proliferation-associated risk factors of HCC...... 54

xii

List of Figures

Figure 1. Progression of NAFLD leads to the upregulation of NFkB and STAT3 which increases chance for HCC development...... 26

Figure 2. The major catechins found in green tea (Camellia sinensis)...... 27

Figure 3. Histological evaluation of livers in mice fed a high-fat diet containing GTE at 0 or 2% and administered diethylnitrosamine or saline...... 48

Figure 4. Serum ALT and hepatic MDA in mice fed a high-fat diet containing GTE at 0 or 2% and administered diethylnitrosamine or saline...... 49

Figure 5. Hepatic total GSTP protein expression level in mice fed a high-fat diet containing GTE at 0 or 2% and administered diethylnitrosamine or saline...... 50

Figure 6. Hepatic pro-inflammatory gene expression levels in mice fed a high-fat diet containing GTE at 0 or 2% and administered diethylnitrosamine or saline. . 51

Figure 7. Hepatic STAT3 protein and c-Fos and survivin mRNA expression level in mice fed a high-fat diet containing GTE at 0 or 2% and administered diethylnitrosamine or saline...... 52

Figure 8. Proportion of hepatic PCNA+ cells in mice fed a high-fat diet containing GTE at 0 or 2% and administered diethylnitrosamine or saline...... 53

xiii

Chapter 1: INTRODUCTION

The incidence of hepatocellular carcinoma (HCC) has increased dramatically because of its close association with obesity, diabetes, and nonalcoholic fatty liver disease (NAFLD), which have all increased in prevalence over the past several decades. NAFLD is a complex disorder that progresses in severity from relatively benign steatosis, to nonalcoholic steatohepatitis (NASH), to fibrosis, and then to cirrhosis (1). The US alone has an estimated 77.5 million individuals with NAFLD (2). In those who develop cirrhosis, 2.4% to 12.8% advance to HCC (3, 4). This, combined with other liver diseases such as hepatitis

C and alcoholic liver disease, results in ~700,000 cases of HCC diagnosed annually worldwide and contributes to the global trends of HCC being the 3rd most prevalent form of cancer (5, 6). NAFLD, obesity and diabetes induce excess reactive oxygen species (ROS) generation, leading to oxidative stress and inflammation. Oxidative stress and inflammation trigger lipid peroxidation, oxidation of DNA, and dysfunction to proteins that regulate cellular repair and proliferation (1). Evidence shows that nuclear factor kappa-light-chain-enhancer of activated B cells (NFkB) and signal transducer and activator of transcription 3

(STAT3) are considered proto-oncogenes during HCC development because they upregulate inflammation, apoptosis, cell proliferation and angiogenesis (7).

These two transcription factors are activated in obese rodent models (8,

9). Epidemiological and experimental studies support the anti-oxidative, antiinflammatory and anti-cancerous effects of green tea extract (GTE) in the liver

(10-12). Studies have shown that GTE can attenuate lipogenic, ROS, and inflammatory effects of NAFLD progression (9). Diethlynitrosamine (DEN) is a carcinogen that is considered to be an initiator of HCC and causes poor prognosis similar to HCC patients (13). The extent to which GTE attenuates

DEN-exacerbated NFkB and STAT3-related pathways in a high-fat diet (HFD)- fed mice study has yet to be studied. I hypothesized that hepatoprotective activities of GTE during NASH would also prevent DEN-induced progression towards HCC. The aims were to determine the protective effects of GTE against

NASH, NASH-associated inflammation, and STAT3-mediated pro-oncogenic pathways regardless of DEN.

Chapter 2: REVIEW OF LITERATURE

2.1. NAFLD is a risk factor for hepatocellular carcinoma

NAFLD is a multistage disorder that presents initially with steatosis.

Steatotic livers are characterized by greater than 5-10% (w/w) hepatic fat accumulation and are subsequently vulnerable to advancing step-wise in severity to NASH, fibrosis and cirrhosis (1). NASH presents with symptoms, specifically lipid accumulation and inflammation, similar to alcoholic steatohepatitis.

However, instead of alcohol, it is due to overnutrition. Obesity increases the risk for NASH (2). Data shows that an estimated half a billion of the population worldwide are considered obese (14) with a body mass index (BMI) of 30 kg/m2 or higher. Global epidemiological evidence shows that approximately 81% of

NASH patients are obese (2). NAFLD is also associated with diabetes, insulin resistance and hyperlipidemia. The majority of those with NAFLD are asymptomatic, but some patients have reported fatigue, upper abdominal pain and biopsies that show hepatomegaly (15, 16).

Obesity elevates the risk for NASH by increasing the chance of the ―first- hit‖ which is hepatic steatosis. A cross-sectional, observational study was conducted using ultrasonography to indicate whether there was steatosis among

healthy, obese and heavy drinking participants. Compared to the healthy participants, there was a 4.6-fold increase in steatosis among obese participants

(17). A 16-year prospective study (n ≈ 900,000 participants) indicated approximately a 4.5-fold and a 1.7 increase in HCC mortality in obese males and obese females, respectively, having a BMI of 35-39.9 kg/m2 compared to lean individuals (18.5-24.9 kg/m2) (18). HCC due to obesity-associated NASH is on the rise and awareness and preventative measures need to be taken against

NASH (19).

2.2. Etiology Of NASH-induced HCC

2.2.1. Metabolic imbalance and the “two-hit” mechanism of NASH

The etiology of NASH-induced HCC starts with overnutrition which causes obesity and insulin resistance (Figure 1). Insulin resistance along with increased energy intakes result in an imbalance in fat uptake, lipogenesis, oxidation and export of lipids (15). Hyperinsulinemia enhances hepatic glucose accumulation through increased glycogenolysis in cytosol and decreased glucose usage by the liver (20). Insulin resistance also increases triglyceride lipolysis in adipose tissue because increased insulin normally has an inhibitory effect on the phosphorylation of hormone sensitive lipase (HSL) (15). Increased HSL cleaves free fatty acids (FFA) from its triglyceride and thus increases FFA in the serum, which fluxes into the liver.

In the liver, FFA undergoes esterification into triglycerides and are then transported out of the liver in very low density lipoproteins (VLDL) (20). FFA also undergoes β-oxidation in the mitochondria. However, hyperinsulinemia increases both transcription and activation of protein sterol regulatory element-binding protein 1c (SREBP-1c) (21, 22). SREBP-1c transcribes lipogenic genes and as a result, increases fatty acid synthesis in the cytosol. Acetyl coenzyme A carboxylase is transcribed by of SREBP-1c, which converts acetyl coenzyme A to malonyl coenzyme A. Malonyl coenzyme A is further converted to FFA by other SREBP-1c transcribed lipogenic proteins such as fatty acid synthase

(FAS). This causes FFA storage to be prioritized over β-oxidation via inhibition of carnitine palmitoyl transferase 1 (CPT1), which is a protein responsible for transport of FFA into the mitochondria for oxidation (1, 4). Imbalanced triglyceride production, triglyceride storage and decreased FFA oxidation in mitochondria result in vesicular lipid droplets in the liver. Excess fat accumulation or simple steatosis is considered the ―first-hit‖.

The ―second-hit‖ occurs through production of ROS attributed to several sources: i) increased FA oxidation in peroxisomes and ER due to accumulation of FA in cytosol, ii) mitochondrial dysfunction, iii) ω-oxidation by CYP450 enzymes such as CYP2E1 (20, 23). Polyunsaturated fatty acids are especially oxidizable because of their unsaturated carbon bonds. As the number of double bonds increase, the rate of peroxidation greatly increases. Although ROS have relatively short half-lives, when ROS such as hydroxyl radical oxidizes

5 polyunsaturated fatty acids such as those in the lipid membrane, oxidized lipids and by-products such as aldehydes like trans-4-hydroxy-2-nonenal (HNE) and malondialdehyde (MDA) are formed. HNE and MDA are able to diffuse into intracellular and extracellular areas even in other cells. The aldehydes then bind to protein or DNA and form adducts which can cause damage to organelle function and potentially cell death (24).

Another result of increased oxidative stress is increased activation of

NFκB. Increased tumor necrosis factor alpha (TNFα) from adipocytes also activates NFκB. TNFα binds to hepatocytes via tumor necrosis factor receptor

(TNFR) and a cascade occurs which activates NFκB which is involved in inflammation, cell survival and apoptosis (7). NFκB transcribes genes for inflammatory cytokines and growth factor molecules such as TNFα, interleukin

(IL)-1, -6 (IL-1), (IL-6), inducible nitric oxide synthase (iNOS) and monocyte chemoattractant protein 1 (MCP-1) (7, 25). Increased oxidative damage and inflammation are considered the ―second-hit‖.

2.2.2. Fibrosis and Cirrhosis

Liver injury due to NASH can lead to increased cell proliferation, fibrosis and cirrhosis. IL-6 from NFκB transcription binds to IL-6 receptor (IL-6R) and activates hepatic stellate cells (HSC). HSC’s transcribes transforming growth factor β (TGF-β1) which bind to TGF-β receptor on HSC and initiate the cascade to produce collagen (26). Chronic activation of HSC results in continual collagen

6 deposition which leads to fibrosis (27). Epidermal growth factor (EGF) and IL-6 are also released by immune cells, bind to the epidermal growth factor receptor

(EGFR) and IL-6 receptor (IL-6R) respectively and initiate a cascade that activates the oncogenic transcription factor STAT3. STAT3 is known for increasing signaling for hepatocyte proliferation and survival (27).

In acute situations, hepatocellular ROS from mitochondria, macrophages, peroxisomes and the endoplasmic reticulum are neutralized effectively by antioxidants in the liver. However, in chronic situations such as NAFLD, these balances are skewed and constant ROS production leads to greater lipid peroxidation, oxidative stress and cell death, fibrosis, and inflammation. This leads to increased DNA and protein damage and increases risk for the liver to enter a premalignant stage and eventually HCC if preventative measures are not taken (28).

The constant positive feedback of inflammation, ROS, cell death, increased hepatocyte proliferation and fibrosis will lead to cirrhosis. Cirrhosis is characterized by decreased regenerative capacity of the liver, fibrous tissue and destruction of liver cells (29). In patients, hepatocyte proliferation decreases as severity of cirrhosis increases. The combination of decreased hepatocyte proliferation and telomere dysfunction increases the chance of HCC development

(28). Telomeres are part of the chromosome which protects the chromosome from deleterious effects such as DNA damage and chromosome fusions (30).

Every time cells divide, the telomeres on their chromosomes shorten and

7 eventually will reach a length that no longer protects DNA from having DNA breaks and will result in activation of DNA damage signals, cell-cycle arrest, senescence or apoptosis (28, 30). As normal hepatocytes cease to proliferate due to DNA checkpoint activations, mutated cells with deleted cell cycle checkpoints can proliferate. Cirrhosis also further activates stellate cells which cause overall increase in production of cytokines, growth factors and oxidative stress in the liver which increases chances for more mutations favoring uninhibited cell proliferation. Collectively, chronic liver injury by NASH can lead to increased cell proliferation, fibrosis and cirrhosis, which leads to higher chance of

DNA mutations.

2.2.3. Pre-malignancy

Once enough genetic alterations occur due to DNA damage or chromosome damage, hepatocytes can become genetically mutated and are called atypical cells. Pre-malignancy is defined anywhere from atypical cells to tumors within the organ (31). Malignant cancer occurs when a tumor metastasizes. In relation to HCC, two major forms of benign neoplasms exist: hepatocellular adenoma (HCA) and dysplastic foci/nodules (32). HCA is associated with non-cirrhotic liver whereas dysplastic foci/nodules occur in a cirrhotic liver. HCA appears similar to normal liver tissue but has the possibility of showing pseudo-glandular structure, cell have increased size due to increased intracellular glycogen or fat accumulation. Dysplastic foci/nodules are

8 distinguishable from the surrounding liver cells by their irregular shape, cytoplasm levels and nuclear size. These are considered progenitors to HCC

(33). As genetic alterations occur, hepatocytes can develop into HCA or dysplastic foci which can eventually develop into HCC.

2.3. Signaling in Liver Cancer

Two transcription factor pathways that are attributed to HCC development are: NFκB, which is a major transcription factor of pro-inflammatory cytokines and wound-healing responses (34) and STAT3, which is considered a proto- oncogene due to its ability to transcribe genes involved in tumor proliferation, survival, angiogenesis and cancer-promoting inflammatory mediators (33).

Examining these two transcription factor pathways can aid in targets to lower

HCC risk.

2.3.1. Pro-inflammatory Signaling in HCC

NFκB is considered a major transcription factor for pro-inflammatory cytokines and thus chronic activation can lead to increased risk for HCC (34, 35).

The NFκB pathway is initiated by pro-inflammatory signaling including TNFα, interleukin-1 (IL-1), and lipopolysaccharides (LPS) (34). TNFα and IL-1 are released by Kupffer cells and neutrophils (36) whereas LPS translocates across the intestinal membrane into the hepatic portal system (34). Each binds to their respective receptors: TNFR, IL-1 receptor (IL-1R) and LPS to Toll-like receptor 4

(TLR4). These receptors are expressed ubiquitously in hepatocytes, HSC, epithelial and endothelial cells. Inhibitor of NFκB (IκB) is bound to NFκB in the cytosol. Once the cascade is initiated by the aforementioned ligands, IκB is phosphorylated by IκB kinase (IKK) which releases NFκB. NFκB translocates to the nucleus and transcribes genes involved in transformation, proliferation, angiogenesis and inflammation; all which are risk factors for cancer (34, 37).

The pro-carcinogenic contribution of NFκB is demonstrated in a mouse model that spontaneously develops cholestatic hepatitis, which then progresses to HCC. The mice had NFκB activation inhibited due to an inducible IκB transgene, resulting in decreased tumor development (38). An inflammatory HCC mouse model, overexpressing lymphotoxin α and β, further supports that NFκB has pro-carcinogenic functions. The scientists developed mice with overexpressed α and β lymphotoxin and had IKK deletion. These mice were devoid of HCC as compared to mice that only expressed lymphotoxin α and β, which suggests the importance of the NFκB pathway in HCC development (39).

In NASH patients, NFκB is several folds higher in activation levels compared to the control group representing the general population (40). This gives support that NFκB may be a contributing factor to development of HCC in NAFLD patients and not simply inflammation models only. Sprague-Dawley rats at 8 wk of age injected with 30 mg/kg BW of DEN support this hypothesis. The rats were fed a control diet (35% energy from fat) or a HFD (71% energy from fat) until 14 wk of age. The HFD group had significantly higher incidence and multiplicity

10 glutathione S-transferase pi form (GSTP) positive foci; which is considered a precancerous marker (41). The HFD group also had higher hepatic TNFα mRNA and nuclear NFκB protein compared to the control diet group. This supports that

NFκB signaling is activated to a greater extent in rodents with NASH and that the

NFκB pathway contributes to early DEN-initiated HCC development.

TNFα is a key activator of NFκB and HCC development (34). Prolonged

TNFα signaling has been associated with cancer development due to increasing inflammation, ROS production, and mitochondrial dysfunction (42). TNFα in hepatocytes increases mitochondria-derived ROS and lipid peroxidation. These increase membrane permeability through upregulation of uncoupling protein 2 which is known to increase more ROS (43). Uncoupling proteins decrease membrane potential in the mitochondria through flow of electrons into the mitochondrial matrix. However, this can lead to oxygen interacting with electrons to form superoxide radicals (44). To support that TNFα signaling is an important contributor of HCC development, C57BL/6J mice and TNFR1 knockout mice were fed either a LFD or HFD (60% of calories derived from fat) and injected at 2 weeks of age with 25 mg/kg BW of DEN. All the mice were sacrificed at 36 weeks of age. WT mice fed a HFD showed higher tumor multiplicity and size compared to the LFD WT group. There was also no difference between the

TNFR1 knockout mice fed either LFD or HFD. This supports that obesity exacerbates TNFα signaling pathway, and that TNFα contributes to the development of HCC (8).

2.3.2. STAT3 pathway

STAT3 is considered a proto-oncogene due to its ability to transcribe genes involved in tumor proliferation, survival, angiogenesis and cancer- promoting inflammatory mediators (27). The key cytokine that initiates the STAT3 pathway is IL-6 (45). IL-6 is a cytokine that is involved in biological activities in inflammation, oncogenesis, immune regulation and hematopoiesis. It is produced by monocytes, macrophages, T cells, endothelial cells and fibroblasts when

NFκB is stimulated (46). The IL-6 pathway is initiated when IL-6 binds to the IL-

6R. IL-6R can be in a soluble form which proceeds to attach to endothelial cells once activated by IL-6. The rest of the cascade follows the same path as the membrane-bound form. The membrane-bound form is expressed on cell surfaces of hepatocytes, Kupffer cells and HSC. Once IL-6 binds to IL-6R, the IL-

6/IL-6R complex recruits the transmembrane protein known as glycoprotein 130

(gp130). Gp130 dimerizes with another gp130 in the cytosol which leads to activation of tyrosine kinase janus kinase 2 (JAK2) which then phosphorylates

STAT3. STAT3 forms a homodimer which then proceeds to translocate into the nucleus where it transcribes genes related to myeloid cell proliferation, obesity, inflammation and other responses (47, 48).

Data supports that STAT3 alone is able initiate cell proliferation and transformation if consistently active in nude mice (49). More evidence to support that the STAT3 pathway contributes toward HCC is through C57BL/6J mice and

IL-6 knock-out mice administered 25 mg/kg BW of DEN at 14 days of age. At 8 months of age, the mice were sacrificed and the C57BL/6J mice had multiple tumors while the IL-6 knockout mice had no evidence of tumors (45). This supports that the STAT3 pathway, which is initiated by IL-6, contributes to HCC development.

Another study not only supports that STAT3 contributes to HCC development, but also that obesity exacerbates HCC through increased STAT3 activation (8). C57BL/6J mice and IL-6 knockout mice were fed either a low-fat diet (LFD) (12% of calories derived from fat) or HFD (59% of calories derived from fat) and were given a single injection at 2 weeks of age with 25 mg/kg BW of DEN. All the mice were sacrificed at 36 weeks of age. There was a significant decrease in tumor size and quantity in the IL-6 knock-out mice when comparing to the C57BL/6J groups. C57BL/6J mice fed a HFD had higher tumor count and size compared to mice fed a LFD (8). Phosphorylation of STAT3 was also measured in the C57BL/6J mice only, and the HFD mice showed increased

STAT3 activation compared to the LFD mice. These data not only support that chronically activated STAT3 pathway increases HCC development, but also provides insight that obesity plays a key role in increased STAT3 activation and tumor growth.

2.4. Diethylnitrosamine

DEN is a carcinogenic compound composed of a nitroso group and amino group. Nitrosamines were first indicated as a liver injury-inducing compound in a study where guinea pigs, rabbits, dogs, albino rats and mice were injected with or chronically fed varying doses of dimethylnitrosamine (DMN) (50). Histological observations indicated necrosis for acute injections above 20 mg/kg BW. and both necrosis and fibrosis with chronic feeding of 100 ppm and above (50).

Studies show that DEN induced necrosis and initiated tumors through preneoplastic and neoplastic lesions (51). A study in B6C3F1 mice administered a single weekly i.p. injection of 45 mg/kg BW. DEN at 6-8 wk of age and then at

10-12 wk of age, showed preneoplastic lesions (52). Evidence of preneoplastic lesions suggests that mild DEN administration during non-infant stage of mice can lead to HCC development.

DEN, like other xenobiotic substances are metabolized by a superfamily of enzymes called cytochrome P450 (CYP) which oxidize endogenous metabolites and exogenous chemicals. DEN is oxidized by alpha-hydroxylation resulting in ethyldiazohydroxide ion intermediates and acetaldehyde. Aldehydes bind to protein or DNA and form adducts which can cause damage to organelle function and therefore cell death. The ethyl group from the ethyldiazohydroxide ion intermediate binds to form DNA adducts such as N7-ethylguanine and O6- ethylguanine. Once DNA is adducted, the DNA is considered mutated and can cause cells to incorrectly replicate. This increases the risk of atypical cells proliferating and developing into cancer (53, 54). DEN administration also

14 increases hydrogen peroxide and superoxide anions which are a byproduct of

DEN when metabolized by CYP enzymes (55) and therefore increases oxidative stress. Specifically, CYP2E1 is known for oxidation of low molecular weight and lipophilic compounds (56) and for its ability to oxidize DEN.

DEN exposure has been shown to develop HCC through a CYP2E1- dependent pathway. CYP2E1-null mice and WT mice were treated with a single i.p. injection of 10mg/kg BW of DEN and sacrificed at 24 and 36 weeks. The 24 week old CYP2E1-null mice had no tumor incidences compared to the WT. 36 week old CYP2E1-null mice had no multiple HCC in the liver compared to the

WT group which had a mean of 3.6. Tumor incidence was 65.4% in CYP2E1-null mice compared to the 100% in WT. This data supports that DEN is activated through a CYP2E1-dependent pathway. However due to the fact that there was still tumor incidence, there are likely other enzymes activating DEN as well (57).

An in vitro study using male DBA/2N mice (6 wk old) and human liver microsomes further supports other CYP450 enzymes also metabolize DEN. DEN metabolization activity by CYP2E1 and CYP2A5 was assessed by inhibiting said enzymes with respective antibodies, incubating the microsomes in two different concentrations of DEN (0.4 mM and 4 mM) and then measuring acetaldehyde formation. Though there was a correlation between inhibition of both CYP2E1 and CYP2A5 and acetaldehyde formation at 0.4 mM of DEN, there was substantial variability in acetaldehyde formation by CYP2A5 in human microsomes (58). CYP2E1 hepatic mRNA expression is increased by a HFD

(59). Male Wistar rats were given either a LFD diet or a HFD (60% fat) for 24 weeks starting at 16 weeks of age, which resulted in a significant increase in

CYP2E1 mRNA expression in the HFD group compared to the LFD.

DEN in combination with a HFD exacerbates tumor development (8). 14- day old C57BL/6J mice were injected with 25mg/kg of DEN and fed either a LFD or a HFD (60% of calories were fat derived) in order to examine the combined effects of DEN and a HFD on HCC. Mice fed a HFD showed earlier signs of tumors, over a three-fold increase in tumor count, and nearly a two-fold increase in tumor size. This supports that obesity through a HFD accelerates and enhances DEN-induced HCC. Conclusively, DEN initiates HCC development and in combination with a HFD results in earlier signs of HCC.

2.5. Models of HCC

Mechanisms for HCC are not fully understood and due to poor prognosis, models examining early to middle stages of HCC development are needed to establish effective treatment regimens. Currently, there is no established pre- cancer model for NASH and DEN-induced HCC. An ideal NASH and DEN- induced pre-cancer model should be able to develop to HCC at a high percentage rate and within a short time in order to save time and costs.

2.5.1. Using mouse as a model system

The reason for mouse models is due to physiological and genetic similarities between rodents and humans and because of lifespan and breeding capacity. Mice models are favorable due to availability of gene targeting methods and also utilization of xenograft implantation (60). Steatosis has been successfully induced in C57BL/6J mice using a HFD consisting of 60% of energy from fat (primarily as lard) (9). Evidence for steatosis was diagnosed through histology and hepatic triglyceride, liver injury increased serum amino alanine transferase, and lipid peroxidation increased hepatic MDA. The 12 wk old mice were fed a HF diet for 8 weeks resulting in an increase in the markers (9). In regard to cancer induction via chemicals, there are two major types of carcinogenic compounds: those that change DNA structure or those that promote or enhance tumor formation (60). The two most commonly utilized models for

NASH- and DEN-mediated HCC are C57BL/6J mice and C57BL/6J-db/db

(db/db) mice due to C57BL/6J mice having susceptibility to obesity and db/db mice expressing obesity as one of its phenotypes. There is variability between different mice; for example, C3H/He mice are already predisposed to tumor sensitivity due to increased susceptibility of point mutations in specific proto- oncogenes such as the ras subfamily which are responsible for GTPase function

(61, 62). These variations are suggested to be due to methylation of certain genes, which can possibly alter susceptibility to DNA adduction from DEN (63,

64).

2.5.2. DEN in mice models

Development of HCC via DEN is dependent on age, sex, dose, frequency of dose and strain. Younger mice develop HCC at a much faster rate because high hepatocyte proliferation rates (65). In terms of sex differences, male mice have higher incidence of tumors when injected with DEN and is most likely due to inhibitory effect of estrogen and stimulating effect of testosterone (66).

Frequency of DEN administration alone vastly varies the development of

HCC. Short term administration of 75 mg/kg BW for 3 weeks followed by

100mg/kg BW another 3 weeks led to 64% tumor incidence after 32 wk of age

(67). This is compared to the broad range of 45 to 104 weeks range depending on various doses of single administration (68-70). Long-term weekly administration of 35 mg/kg BW DEN leads to HCC in a mere 20-35 weeks (71) in female mice, suggesting that male mice would have an even earlier incidence of tumors.

Obesity is a contributor to accelerating and exacerbating HCC development. C57BL/6J mice were fed a HFD and injected at 2 weeks of age with 25 mg/kg BW of DEN. At 30 wk of age, all mice had HCC compared to 0% in

HFD with no DEN (72). This is further supported by Park et al when comparing a

LFD to a HFD in C57BL/6J mice injected at 2 weeks of age with 25 mg/kg BW of

DEN (8). The HFD group when sacrificed at 45 weeks of age showed a much higher number of tumors compared to the LFD group. There is no adequate comparison of the HCC rate between the two commonly used obese models,

18 db/db mice and C57BL6J fed a HFD, as it is shown that C57BL/KsJ-db/db mice start developing HCC with injection of 25mg/kg BW at 2wk old around week 24

(73). Due to early sacrifice in these studies, it is difficult to hypothesize whether

100% HCC would develop in the next 6 weeks for all the mice. However, both

C57BL6J fed a HFD and C57BL/KsJ-db/db mice with 2 week of age 25mg/kg

DEN injection is shown to develop HCC faster than other HCC models.

A HF-choline deficient diet with an injection of 25 mg/kg of DEN at 3 weeks of age showed an even faster response with 100% HCC in all mice at 24 weeks of age (74). However, it is important to note that choline deficiency actually decreases hyperinsulinemia and improves glucose tolerance in C57BL6J mice fed either HFD or HF with choline (75). This may result in non- representative data which cannot be applied to NASH-induced HCC patients. In regards to age, 2 weeks is significant because it is the infant stage and a weaning process is required, however 5 weeks of age and above dramatically increases the amount and/or frequency required for DEN administration in order to initiate HCC (76).

Though consistency and reproducibility of post-weaning varies, the benefits of establishing post-weaning protocol are essential. Several studies have shown that pre-weaning protocols enable limited heterogeneity of lesions, mainly basophilic, while post-weaning protocols show both basophilic and eosinophilic tumors in mice (77). Genetic and physical variety is important in order to prevent funneling of data interpretation to one set of tumors. Through

19 this review, literature supports that C57BL/6J mice fed a HFD, injected with DEN during post-weaning, is a good candidate for establishing a NASH pre-cancer model that takes into account time, cost and translation into HCC patients.

2.6. Prevention of NAFLD-induced HCC

Cancer prevention is divided into three categories: ―primary prevention‖ to prevent exposure to risk factors, ―secondary prevention‖ to prevent cancer development in patients with risk factors, and ―tertiary prevention‖ to prevent cancer recurrence, but not the risk factor (78). NAFLD is a risk factor for HCC development and thus primary and secondary prevention methods will be explored.

2.7. Green Tea

Green tea or the plant known as Camellia sinensis is a beverage commonly served in Asia which first originated in China and Southeast Asia and has a rich cultural history (79). It is considered a functional food that has antioxidant effects and is considered to have preventative effects against cardiovascular disease, insulin resistance and possibly cancer. It even shows involvement with weight loss (80).

The variation of processing results in three major groups of tea types: black, oolong and green tea (11). Another possible fourth tea from the Camellia sinensis is white tea, which is defined by the Chinese as a tea derived from a

20 sub-species, while other countries define it by leaf plucking standards and by minimal processing (81). Processing involves withering, steaming, rolling, drying and a final firing. Black tea once harvested will undergo a fermentation before drying and steaming where oxidation of polyphenols occurs either by polyphenol oxidase or microorganisms respectively. Oolong is a partial fermentation process while green tea undergoes drying and steaming in order to break down polyphenol oxidase which can otherwise breakdown important bioactive compounds in green tea such as catechins (11).

The composition of green tea primarily is composed of proteins for enzymatic function of the plant (~15%), fiber (~26%) and phenolic compounds

(30%) (82). The remaining ~29% of compounds are amino acids, carbohydrates, lipids, pigments and minerals. Among the phenolic compounds, the major source that green tea is known for is its catechins (flavan-3-ols) (Figure 2), which are under a group of phenol derivatives called flavonoids. It is also important to note green consists of other compounds such as caffeine (3-6% dry wt/wt) and flavanol glycosides (~2-3% wt/wt). The main catechins of interest are epigallocatechin-3-gallate (EGCG), which composes approximately 59% of total catechins, (-)-epigallocatechin (EGC) at 19%, (-)-epicatechin-3-gallte (ECG) at

13.6% and (-)epicatechin (EC) at 6.4%.

2.7.1. Bioavailability

The catechins from green tea undergo multiple processes during digestion and absorption. Catechins are conjugated to a more hydrophilic form in the small intestine by enzymes such as catechol-O-methyltransferase, sulfotransferases and UDP-glucuronosyltransferases (80). The catechins can be further biotransformed through methylation, glucuronidation, sulfation and ring-fission metabolism by phase II enzymes in the liver. The peak concentration of catechins after green tea consumption is around 2-4 hours (11, 80, 82) . Due to the low oral bioavailability of green tea, drinking ≥5-10 cups of green tea a day is associated with more consistent health benefits (11, 83, 84) .

2.7.2. NAFLD prevention

Green tea is able to ameliorate effects in both the ―first- and second-hit‖ of

NASH (11). In a cross-sectional study, consuming ≥5-10 green tea was associated with a significant decrease in total cholesterol and triglyceride concentrations in the serum, even in those who smoked or had alcohol consumption (84). C57BL/6J mice fed a HFD with 2% GTE w/w, had attenuated obesity and insulin resistance compared with mice only fed a HFD (85). The mice fed a HFD with 2% GTE also had attenuated final body weight, hepatic total lipid, hepatic triglyceride, and serum insulin. The study also showed that GTE decreases lipogenic genes such as SREBP-1c and that it was Nrf2 independent.

Overall, the study supports that GTE protects against the ―first-hit‖ of NASH.

In the same mouse study (85), mice that were fed the 2% GTE showed significant reduction in these levels of hepatic MDA, serum ALT, steatosis, ballooning and inflammation compared to the HFD group supporting the protective effect against the ―second-hit‖ by GTE. This is further supported by other studies involving both genetic and diet-induced obese models (9, 86, 87) .

Evidence also supports GTE exerting antioxidant activity by increasing hepatic glutathione (87), NADPH:quinone oxidoreductase-1 mRNA (86), and increasing enzymatic activities of Nrf2-dependent endogenous antioxidant defenses such as superoxide dismutase, catalase, glutathione peroxidase, and glutathione-S- transferase (GST) (88).

2.7.3. Anti-inflammatory and anti-cancerous effects

GTE has been shown to decrease NFκB activation and NFκB-mediated pro-inflammatory genes (9). GTE has also shown to decrease inflammatory cytokines such as IL-6 and the upstream signaling related molecules like TLR4 and Toll-like receptor 2 (TLR2) (89, 90). Another study with DEN treatment and green tea showed that in C57BL/KSJ-db/db mice there was a significant decrease of hepatic IL-6 mRNA expression levels in the DEN treated groups.

Hepatic protein expressions of STAT3 and phospho-STAT3 were shown to decrease via treatment of green tea in both DEN-administered and non- administered groups (8) indicating the possible combative nature of green tea against overexpressed cell proliferation, angiogenesis and cell survival.

GTE has also been shown to reduce CYP2E1 protein expression in microsomes of Kunming mice that were injected for two days with low, medium or high levels of tea polyphenols (TP) and on the third day were sacrificed for their liver microsomes. The medium and high levels of TP treatment showed significant reduction in CYP2E1 protein levels (91). However in regards to

CYP2E1 expression levels in a HFD, a study using 16 weeks old Wistar rats put into groups of LF (10% energy from fat), HF (60% energy from fat) and HF+GTE with either 1% GTE or 2%GTE for 8 weeks resulted in an increase in CYP2E1 expression in a HFD compared to LF, but no significant different between HF and

HF+GTE groups indicating that it is possible that 2%GTE is not enough to illicit a decrease in CYP2E1 in vivo when mice are fed a HF diet (59). These studies show that overall, green tea exerts potential preventative effects against HCC through metabolic rebalance, anti-oxidative effects and anti-inflammatory effects.

2.8. Conclusion

Due to increased rates of obesity and diabetes, NAFLD is a major health concern which can further develop into HCC. The major associations of NAFLD are lipid accumulation, oxidative stress and inflammation resulting in not only cell death but damage to DNA and proteins. DEN is a carcinogen which increases oxidative stress and DNA damage and mimics HCC events. Evidence suggests possible hepatoprotective effects of green tea against HCC development in a

NASH- and DEN-mediated mouse model. The central hypothesis of this thesis is

24 that hepatoprotective activities of GTE (30% catechins) during diet-induced

NASH would also prevent DEN-induced progression towards HCC. The effects of

DEN on histological and biochemical parameters associated with NASH, inflammation and the STAT3 pro-oncogenic pathway will be examined. The extent to which GTE prevents HCC development by prevention of NFκB and

STAT3 pathway activation will be measured. The findings of this hypothesis can not only find novel evidence for GTE as a preventative measure against diet- and

DEN-mediated HCC, but establish a DEN-administered mouse model with diet- induced NASH.

Figure 1. Progression of NAFLD leads to the upregulation of NFkB and STAT3 which increases chance for HCC development.

Figure 2. The major catechins found in green tea (Camellia sinensis).

Chapter 3: MATERIALS AND METHODS

3.1. Study design

The protocol for this study was approved by the Institutional Animal Care and Use Committee (2012A00000156) at The Ohio State University. Male

C57BL/6J mice (4 wk old; n = 40) were purchased from The Jackson Laboratory

(Bar Harbor, ME) and were fed a diet containing 60% of energy from fat that was devoid of, or supplemented with, GTE at 2% (w/w; Table 1). After one week, the mice received once weekly intraperitoneal injections of saline vehicle or DEN (60 mg/kg BW; 5 wk and 7 wk) resulting in the 4 groups: mice devoid of GTE administered saline (SAL), mice devoid of GTE administered DEN (DN), mice supplemented with GTE administered saline (GTE+SAL), and mice supplemented with GTE administered DEN (GTE+DN).

The mice were sacrificed at 25 wk old prior to assessing NASH, inflammation, and oncogenic responses. During sacrifice, blood was collected from the retro-orbital sinus, centrifuged and frozen in liquid nitrogen and stored at

-80°C. Tissues were excised, rinsed in phosphate-buffered saline, blotted, and frozen in liquid nitrogen and stored at -80°C. A portion of the central hepatic lobe was stored in RNAlater (Invitrogen, Carlsbad, CA) according to manufacturer’s

instructions to preserve RNA. Powdered GTE was provided by Unilever

BestFoods (Englewood Cliffs, NJ) and contained 30% total catechins (48% epigallocatechin gallate, 31% epigallocatechin, 13% epicatechin gallate, 8% epicatechin) as verified by HPLC-UV (92).

Body weight and food intake were recorded twice weekly. The HFD was purchased from Research Diets (New Brunswick, NJ) and formulated with 2% powdered GTE. Prior work in the Bruno Lab shows that 8 wk of a HFD fat-diet

(60%) induces NASH in rodents (59, 87). GTE at 2% is consistent with epidemiological studies suggesting that green tea (≥10 servings/d) lowers the risk of liver injury (84). A single weekly injection of DEN (i.p. 75 mg/kg BW) for four weeks develops altered hepatocellular foci in C57BL/6J mice (93).

In this thesis, mice injected with single weekly DEN injections at 4 and 5 wk (i.p. 75 mg/kg BW), were required to be euthanized by a veterinarian due to the mice being hunched over and unresponsive. The dose regiment was adjusted to the single weekly DEN injections of 60 mg/kg BW at 5 and 7 wk, which represents a medium between the dosing regimen by Kushida et al (93) and the dosing regimen of a single DEN injection (i.p. 30 mg/kg BW) in 8 wk old

Sprague-Dawley rats fed a HFD (41).

3.2. Hepatic lipids

Hepatic total lipid was gravimetrically determined proceeding overnight extraction in 2:1 chloroform:methanol as described (92). The extract was then

29 solubilized in 1% Triton X-100:chloroform (MP Biomedicals; Santa Ana, CA;

Fisher Scientific; Waltham, MA) and evaporated under nitrogen gas. The lipids from the extract were then resuspended in water in order to measure hepatic triglyceride and cholesterol using the spectrophotometric kits, Triglyceride

Reagent Set (#T5432-01) and Cholesterol Reagent Set (#C7510-01), respectively (Pointe Scientific; Canton, MI). The resuspended lipids were then measured using a Synergy H1 Hybrid microplate reader (BioTek; Winooski, VT).

The principle of the triglyceride assay is that triglycerides are hydrolyzed by lipase resulting in glycerol and FFA. Glycerol and ATP is converted to glycerol-1-phosphate and ADP by glycerol kinase. Glycerol-1-phosphate is oxidized by glycerol phosphate oxidase to yield hydrogen peroxide. Hydrogen peroxide in the presence of 4-aminophenazone and chlorophenol, and peroxidase produces quinoneimine (red dye). The intensity of the red color which absorbs at 500 nm is directly proportional to the concentration of triglyceride in the sample.

The principle of the cholesterol assay is that cholesterol esters are enzymatically hydrolyzed by cholesterol esterase resulting in cholesterol and

FFA. Cholesterol is then oxidized by cholesterol oxidase to cholesterol-3-one and hydrogen peroxide. The hydrogen peroxide in the presence of 4-aminoanitpyrine, phenol, and peroxidase produces a quinoneimine. The intensity of the red color which absorbs at 500 nm is directly proportional to the concentration of total cholesterol in the sample.

3.3. Liver injury

Serum alanine aminotransferase (ALT) activity was measured using the spectrophotometric clinical assay, Liquid ALT Reagent Set (#A7526-01, Pointe

Scientific, Canton, MI). In brief, working reagent was prepared using reagent 1 and reagent 2 at a ratio of 5:1 and contained L-alanine α-ketoglutaric acid, lactate dehydrogenase, NADH, buffer, sodium azide and stabilizers. The microplate was pre-heated to 37 °C and then sample and working reagent were added

(sample:working reagent is 1:10) one row at a time and read after 1 minute at

340 nm. Each row of samples was read by the microplate reader for once every minute for the following 5 minutes. The principal of the assay is that ALT catalyzes L-alanine and α-ketoglutarate which results in pyruvate and L- glutamate. Lactate dehydrogenase catalyzes the reduction of pyruvate and the oxidation of NADH to NAD. The resulting rate of decrease in absorbance is directly proportional to ALT activity. Calculations were based on standardization of NADH millimolar absorptivity which is 6.22 mM at 340 nm resulting in IU/L.

3.4. Hepatic steatosis, fibrosis and NAS score

During sacrifice, a portion of the liver was fixed in 10% buffered formalin

(Fisher Scientific; Waltham, MA). Paraffin-embedded sections (4-5 μm) were stained with hematoxylin and eosin. Images were captured using an IX50 microscope (Olympus, Tokyo, Japan) from 10 microscopic fields (200x magnification) to assess NASH using established histologic criteria that evaluate

31 the presence and severity of steatosis, hepatocellular ballooning, and lobular inflammation (94). Steatosis score ranges from 0-3: 0 for no fatty hepatocytes, grade 1 for fatty hepatocytes occupying <33% of the hepatic parenchyma, grade

2 for fatty hepatocytes occupying 33-66% of the hepatic parenchyma, and grade

3 for fatty hepatocytes occupying >66% of the hepatic parenchyma. For hepatocellular ballooning, grade 0 represents no ballooning, grade 1 for few ballooned cells, and grade 2 for predominant ballooning. Hepatic inflammation depends on presence of inflammatory infiltrates in lobular regions: grade 0 for none, grade 1 for <2 foci/field, grade 2 for 2-4 foci/field, or grade 3 for >4 foci/field.

The NAFLD activity score (NAS) was calculated by summing up the scores of steatosis, hepatocellular ballooning and lobular inflammation (0-8) and is used to grade the severity of NASH as described (95). Slides were prepared using Masson’s trichrome stain by Comparative Pathology & Mouse Phenotyping

Shared Resource (The Ohio State University) and 5 microscopic fields per sample group (80x magnification) were analyzed to determine severity of fibrosis, which is dependent on the location of collagen deposition near specific sinusoids in the liver (blue color). Fibrosis ranges from 0-4: stage 0 for no fibrosis, stage 1 for zone 3 perisinusoidal fibrosis, stage 2 for stage 1 plus portal/periportal fibrosis, stage 3 for stage 2 plus bridging fibrosis and stage 4 for cirrhosis.

3.5. Cell proliferation

Hepatocyte proliferation was semi-quantified by counting the number of proliferating cell nuclear antigen (PCNA)-positive foci per 100 cells in a given field. In brief, paraffin-embedded sections (5 μm) were baked at 60 C for 20 min and then deparaffinized 3x for 5 min each using XDewax (Biogenex; Fremont,

CA). Slides were washed in 200 proof ethanol 2x for 5 min each and Super

Sensitive Wash Buffer (Biogenex; Fremont, CA) 1x for 5 min. Antigen retrieval was performed by incubating sections at 105 C for 20 min with EZAR1 antigen retrieval reagent (#HX0031, Biogenex; Fremont, CA) and washed 3x for 30 sec each. Endogenous peroxides were quenched with the 10 min Peroxidase Block

(#HX0026, Biogenex; Fremont, CA) incubation and washed 2x for 30 sec each.

Slides were incubated with Power Block (HX0083, Biogenex; Fremont,

CA) for 5 min and immediately incubated with primary antibody anti-PCNA

(#M087901-2, Agilent; Santa Clara, CA) at 1:1600 dilution with Common

Antibody Diluent (Biogenex; Fremont, CA) for 60 min at 30 C. After a 2x wash for

20 sec each, slides were incubated for 30 min at 30 C with anti-mouse polymer

HRP secondary antibody (#K4007, Agilent; Santa Clara, CA). Slides were then washed 2x for 20 sec each. Slides were incubated with diaminobenzidine working solution (#HX0029, Biogenex; Fremont, CA) for 10 min to visualize the staining followed by 2 rinses in deionized water and a 3x wash for 1 min each.

Nuclei were counterstained with haematoxylin (#HX0030, Biogenex; Fremont,

CA) for 3 min and washed 2x for 1 min each and rinsed 3x in deionized water.

Tissues were dehydrated with 100% ethanol and dried before mounting

33 coverslips with Xmount (#HX0035, Biogenex; Fremont, CA). PCNA-positive hepatocytes (dark brown nucleus) per 100 hepatocytes were quantified from 4 fields per sample group.

3.6. Lipid peroxidation

Hepatic MDA is a biomarker of lipid peroxidation, and is used to assess oxidative damage (96). Hepatic MDA was extracted and measured by HPLC-FL as described (87) with minor modifications. First, 10 mg of liver were homogenized in 100 μL tissue cell lysis buffer (Gold Technology; Old Forge, PA) containing 5 mM DL-dithiothreitol (Sigma-Aldrich; St. Louis, MO), 5 mM EDTA disodium salt, and protease and phosphatase inhibitor cocktail (Thermo

Scientific; Waltham, MA). After centrifugation (14,000 x g, 4 °C, 60 min), supernatant was saponified using sodium hydroxide (1N), then acidified using trichloroacetic acid (TCA) (10% w/v), and subsequently derivatized using 2- thiobarbituric acid (TBA; 0.6% w/v) (30 min, 95 °C), and then extracted using butanol. The extract was injected on a Shimadzu spectrophotometer (Columbia,

MD) equipped with fluorescence detector set to 532/553 nm

(excitation/emission). HPLC separation was performed at 1 mL/min on a

Phenomenex Luna C18 (250 x 4.6 mm, 5 μm; Phenomenex, Torrance, CA) using

50:50 methanol and phosphate buffer (pH 6.5). MDA was normalized to hepatic protein, which was determined by Pierce BCA kit (Thermo Scientific; Waltham,

MA).

3.7. Total STAT3 and GSTP protein expression

Total hepatic STAT3 (85 kDa) and GSTP (23 kDa) were measured by

Western blotting using whole cell protein liver extract. The whole cell protein liver extract was extracted using a Pierce T-PER kit containing Halt Protease and

Phosphatase Inhibitor Cocktail (Thermo Scientific; Waltham, MA) according to the manufacturer’s instructions. In brief, protein concentration from extract was quantified by Pierce BCA kit (Thermo Scientific; Waltham, MA). Protein extract samples were diluted to concentrations of 10 ug/uL and 20 ug/uL in order to quantify STAT3 and GSTP, respectively, and were denatured using a water bath at 95 C for 5 min. Samples underwent separation on a 12% SDS-polyacrylamide gel for 2 hr at 120 volts, and then underwent transferring to nitrocellulose membranes for 2 hr and 30 min at 80 volts. β–actin (42 kDa, #4967, Cell

Signaling Technology, Beverly, MA) was used as a loading control.

Blocking for target proteins was prepared by 5% (w/v) nonfat dry milk in

Tris-buffered saline containing 0.1% Tween-20. Blots were probed with either

STAT3 antibody (#9139S) diluted in 1:500 5% (w/v) nonfat dry milk in Tris- buffered saline containing 0.1% Tween-20 overnight at 4°C, or GSTP antibody

(#3369S) diluted in 1:250 5% (w/v) nonfat dry milk in Tris-buffered saline containing 0.1% Tween-20 overnight at 4°C (Cell Signaling Technology, Beverly,

MA). They were then blotted against β-actin that was diluted 1:1000 in Tris- buffered saline containing 0.1% Tween-20 at 4°C. After washing in Tris-buffered saline containing 0.1% Tween-20, the blots were incubated with a horseradish

35 peroxidase-conjugated secondary antibody (SC-2056, Santa Cruz

Biotechnology; Dallas, TX) at 1:5000 dilution in Tris-buffered saline containing

0.1% Tween-20 for STAT3, GSTP and β-actin. Once incubated, the blots were washed with Tris-buffered saline containing 0.1% Tween-20 by gentle agitation.

Once washed, the blots were imaged by Odyssey Fc in order to detect fluorescence (Li-cor, Lincoln, NE).

3.8. STAT3-oncogenic and NFκB-proinflammatory mRNA expression

Hepatic mRNA expression of NFκB-proinflammatory genes, iNOS, MCP-

1, and TNFα (25) were determined by real-time quantitative polymerase chain reaction (RT-PCR). Hepatic mRNA expression of STAT3-mediated genes c-fos and survivin (97) were also determined using RT-PCR. Gene expression was quantified relative to hypoxanthine-guanine phosphoribosyltransferase (HPRT) using the 2−ΔΔCT method (98). Primer sequences were determined using Primer-

BLAST database online. Primers were then purchased from Sigma-Aldrich (St.

Louis, MO; Table 2).

Total RNA was extracted from approximately 50 mg tissue using TRIzol reagent (Invitrogen, Carlsbad, CA) according to manufacturer’s instructions. In brief, liver tissue was homogenized in TRIzol and incubated at room temperature for 5 minutes. Chloroform was added and incubated at room temperature for 2-3 minutes and then centrifuged at 12,000 g for 15 minutes at 4˚C in order to split aqueous and organic phases. Aqueous phase was transferred into a new tube

36 and isopropanol was added, incubated at room temperature for 10 minutes and centrifuged at 12,000 g for 10 minutes at 4˚C in order to separate RNA from solution. Supernatant was poured out, ethanol was added, samples were vortexed briefly and centrifuged at 7,500 g for 5 min at 4˚C. Supernatant is removed and RNA is re-suspended in RNase-free deionized water.

Extracted RNA concentration was quantified by detecting ultraviolet absorbance peaks using a Shimadzu Biospec-nano (Columbia, MD). RNA was transcribed to cDNA using iscript RT-PCR reverse transcription kit (Bio-rad;

Hercules, CA). RT-PCR was measured using a SYBR Green PCR Kit (Bio-rad;

Hercules, CA) and C1000 Touch Thermo-cycler (Bio-rad; Hercules, CA).

3.9. Statistical analysis

Data (means ± SEM) were analyzed by one-way ANOVA using GraphPad

Prism (Version 6; La Jolla, CA). Newman-Keuls post-test was used to assess group mean differences. Bartlett’s test was used to assess equal variances for each study variable and log transformation was performed to restore equal variance whenever applicable. Spearman correlation (rs) analysis was performed to define pairwise relations for discrete variables, whereas Pearson correlation

(rp) analysis was performed to evaluate associations between continuous variables. All analyses are considered statistically significant at p<0.05.

Table 1. Composition of experimental diets.

HFD1 HFD + 2% GTE Fat, % of energy (kcal) 60.0 60.0 Protein, % of energy (kcal) 20.0 20.0 Carbohydrate, % of energy (kcal) 20.0 20.0 Energy (kcal/g) 5.2 5.1 Casein (g) 200.0 200.0 L-Cysteine (g) 3.0 3.0 Maltodextrin (g) 125.0 125.0 Sucrose (g) 68.8 68.8 Cellulose (g) 50 50 Lard (g) 245.0 245.0 Soybean oil (g) 25.0 25.0 Mineral mix2 (g) 10.0 10.0 Dicalcium phosphate (g) 13 13 Calcium Carbonate (g) 5.5 5.5 Potassium Citrate, 1 H2O (g) 16.5 16.5 Food, drug & cosmetic yellow dye #5 0.0 0.05 Vitamin mix3 (g) 10.0 10.0 Choline bitartrate (g) 2.0 2.0 GTE (g) 0.0 15.8 Total (g) 773.9 789.6

1HFD (no. D12492) were purchased from Research Diet (New Brunswick, NJ). 2Mineral mix adds the following components (per g mineral mix): sodium chloride, 259 mg; magnesium oxide, 41.9 mg; magnesium sulfate, 257.6 mg; chromium K sulfate, 1.925 mg; cupric carbonate, 1.05 mg; sodium fluoride, 0.2 mg; potassium iodate, 0.035 mg; ferric citrate, 21 mg; manganous carbonate, 12.25 mg; ammonium molybdate, 0.3 mg; sodium selenite, 0.035 mg; zinc carbonate, 5.6 mg. 3Vitamin mix adds the following components (per g vitamin mix): retinyl acetate, 0.8 mg; cholecalciferol, 1.0 mg; DL-α-tocopheryl acetate, 10.0 mg; menadione sodium bisulfite, 0.05 mg; biotin, 0.02 mg; cyanocobalamin, 1 μg; folic acid, 0.2 mg; nicotinic acid 3 mg; calcium pantothenate, 1.6 mg; pyridoxine-HCl, 0.7 mg; riboflavin, 0.6 mg; thiamin HCl, 0.6 mg.

Table 2. Primers used for RT-PCR gene expression studies.

Gene Forward (5’ to 3’) Reverse (5’ to 3’)

HPRT GCTGGTGAAAAGGACCTCT CACAGGACTAGAACACCTGC

iNOS TTCTGTGCTGTCCCAGTGAG TGAAGAAAACCCCTTGTGCT

TNFα CTCCAGGCGGTGCCTATG GGGCCATAGAACTGATGAGAGG

MCP-1 TGATCCCAATGAGTAGGCTGGAG ATGTCTGGACCCATTCCTTCTTG

c-Fos CCTTCGGATTCTCCGTTTTCT TGGTGAAGACCGTGTCAGGA

Survivin ATCCACTGCCCTCCGAGAA CTTGGCTCTCTGTCTGTCCAGTT

All primer sequences are for mice. Abbreviations: HPRT, hypoxanthine-guanine phosphoribosyl transferase; iNOS, inducible nitric oxide synthase; TNFα, tumor necrosis factor alpha; MCP-1, monocyte chemoattractant protein-1; c-Fos, 5Proto-oncogene c-Fos.

Chapter 4: RESULTS

4.1. GTE decreases growth rate regardless of DEN administration without affecting food intake.

Growth rate-related parameters were measured to evaluate the effects of

GTE and DEN on obesity. There was no significant difference in food intake among all groups (Table 3). Final body mass in DN was no different from that of

SAL (P>0.05). Final body mass was approximately 30% less in GTE+SAL and

GTE+DN compared with DN and SAL (P<0.05). No difference was observed between GTE+SAL and GTE+DN (P>0.05).

Total adipose mass in DN was not significantly different from that of SAL

(P>0.05). However, GTE lowered adiposity by 55% in GTE+SAL and GTE+DN

(P<0.05) without any difference between groups (P>0.05).

Liver mass in DN was decreased by approximately 25% compared with

SAL (P<0.05). Liver mass was 50% lower in GTE+SAL and GTE+DN compared with SAL. Liver mass was 35% lower in GTE+SAL and GTE+DN compared with

DN (P<0.05). Liver mass did not differ between GTE+SAL and GTE+DN

(P>0.05).

Growth rate was measured in order to examine body mass in a time- dependent manner (Table 3). Growth rate in DN was not significantly different

from that of SAL (P>0.05). The growth rate in GTE+SAL and GTE+DN was ~50% slower compared with SAL. Growth rate was ~45% slower in

GTE+SAL and GTE+DN compared with DN (P<0.05). There was no significant change in growth rate between GTE+SAL and GTE+DN (P>0.05). Collectively, data indicate that GTE prevents obesity regardless of DEN administration.

4.2. GTE decreases histological and biochemical parameters associated with NASH regardless of DEN administration in livers without tumors.

Histological and biochemical analysis was performed on livers to evaluate the effects of GTE and DEN on parameters of NASH and to observe for tumors.

Neither gross pathology nor histology indicated tumor development in any of the treatment groups. SAL and DN exhibited symptoms of severe NASH with high scores for steatosis and ballooning (Figure 1). Steatosis and ballooning in DN were not significantly different compared with SAL (P>0.05). However, steatosis and ballooning in GTE+SAL and GTE+DN were significantly lowered compared with SAL and DN (P<0.05). There was no significant change between GTE+SAL and GTE+DN (P>0.05).

Fibrosis score was higher in DN compared with SAL and GTE+SAL

(P<0.05). Fibrosis score was lower in GTE+DN compared with DN (P<0.05).

Fibrosis score was not significantly different in SAL compared with GTE+SAL and GTE+DN (P>0.05). There was also no significant difference in fibrosis scores between GTE+SAL and GTE+DN (P>0.05).

There was no significant difference between SAL and DN (P>0.05). GTE lowered NAS in GTE+SAL and GTE+DN (P<0.05), without significant difference between groups (P>0.05). NAS is significantly correlated with growth rate, final body mass, adipose mass and liver mass (r = 0.70-0.81; P<0.0001).

No significant difference in total hepatic lipid was observed between SAL and DN (P>0.05) (Table 3). GTE attenuated total hepatic lipid by more than 50% in GTE+SAL and GTE+DN (P<0.05) without significant different between groups

(P>0.05). Hepatic triglyceride was ~70% and ~60% lower in GTE+SAL and

GTE+DN, respectively, compared with the SAL (P<0.05). Hepatic triglyceride was ~65% and ~55% lower in GTE+SAL and GTE+DN total hepatic triglyceride, respectively, compared with DN (P<0.05). There was no significant difference between GTE+DN and GTE+SAL for hepatic triglyceride (P>0.05).

Hepatic cholesterol was ~45% lower in DN compared with the SAL

(P<0.05). The GTE+SAL and GTE+DN groups had approximately 65% and 70% lower hepatic cholesterol, respectively, compared with the SAL (P<0.05). Hepatic cholesterol was ~40% and ~50% lower in GTE+SAL and GTE+DN, respectively, compared with DN (P<0.05). There was no significant difference between the

GTE+SAL and GTE+DN groups (P>0.05). NAS was significantly correlated with total hepatic lipid and hepatic triglyceride (r = 0.77-0.78; P<0.0001) and hepatic triglyceride was significantly correlated with total hepatic lipid (r = 0.85;

P<0.0001). Growth rate was significantly correlated with total hepatic lipids and hepatic triglyceride (r = 0.83-0.84; P<0.0001). Total adipose mass was

42 significantly correlated with total hepatic lipids and hepatic triglyceride (r = 0.62-

0.80; P<0.0001). Collectively, data indicate that GTE prevents NASH by attenuating hepatic lipids regardless of DEN administration.

Serum ALT and hepatic MDA were examined to corroborate the protective effect of GTE against NASH (Figure 2). Serum ALT was approximately ~30% higher in DN compared with SAL (P<0.05). Serum ALT was approximately ~70% lower in GTE+SAL and GTE+DN compared with SAL and approximately ~80% lower in GTE+SAL and GTE+DN compared with DN (P<0.05). No significant difference was observed between the GTE+SAL and GTE+DN (P>0.05).

Hepatic MDA was ~50% higher in DN compared with SAL (P<0.05).

Hepatic MDA was ~17% lower in GTE+DN and GTE+SAL compared with SAL, and ~47% lower in GTE+DN and GTE+SAL compared with DN (P<0.05). There was no significant difference between GTE+DN and GTE+SAL (P>0.05). Serum

ALT was significantly correlated with hepatic MDA (r = 0.75; P<0.0001). NAS was significantly correlated with serum ALT (r = 0.80; P<0.0001). Collectively, these findings support that GTE attenuates liver injury and lipid peroxidation regardless of increases by DEN.

4.3. GTE increases hepatic GSTP protein expression regardless of DEN administration.

GSTP protein expression was assessed to determine the potential anti- oxidative and anti-oncogenic effects of GTE against NASH- and DEN-mediated

HCC risk. GSTP protein expression in DN is not significantly different from that of

SAL (P>0.05) (Figure 3). GSTP protein expression was ~3-times higher in

GTE+SAL and GTE+DN compared with SAL and DN (P<0.05). No difference was observed between GTE+SAL and GTE+DN groups (P>0.05). GSTP inversely correlates with NAS (r = -0.68; P<0.0001), serum ALT (r = -0.65;

P<0.0001) and hepatic MDA (r = -0.50; P<0.003). Data suggest that GTE exerts a protective effect against DEN and ROS by increasing GSTP.

4.4. GTE lowers hepatic NFκB-mediated pro-inflammatory mRNA expression regardless of DEN administration

NFκB-mediated pro-inflammatory mRNA expression was measured to examine the interactive effects of DEN and GTE during NASH in relation to HCC risk (Figure 4). TNFα mRNA expression in DN was not significantly different from that of SAL (P>0.05), whereas TNFα expression in GTE+SAL and GTE+DN was

2-times lower compared with SAL and DN (P<0.05). Similarly, MCP-1 mRNA expression level in DN was not significantly different from that of SAL (P>0.05), whereas MCP-1 expression in GTE+SAL and GTE+DN was 3-times lower compared with SAL and DN (P<0.05). However, iNOS mRNA expression in DN was ~30% higher compared with SAL (P<0.05). iNOS mRNA expression levels in

GTE+SAL and GTE+DN was ~40% lower compared with SAL (P<0.05) and was

~2.2-times lower in GTE+SAL and GTE+DN compared with DN. iNOS is correlated with serum ALT (r = 0.74; P<0.0001), hepatic MDA (r = 0.66;

P<0.0001) and NAS (r = 0.58; P<0.0006). iNOS inversely correlates with GSTP (r

= -0.58, P<0.001) (Table 4).

4.5. GTE attenuates hepatic STAT3 protein and survivin mRNA expression otherwise increased by DEN administration

Total STAT3 protein expression and downstream mRNA expression of survivin and c-Fos were measured in order to examine the interactive effects of

DEN and GTE on cell proliferation, cell survival and HCC risk (Figure 5). Total

STAT3 protein expression in DN was ~20% higher compared with SAL (P<0.05).

Total STAT3 protein expression in GTE+SAL and GTE+DN was ~25% lower compared with SAL (P<0.05) and ~40% lower in GTE+SAL and GTE+DN compared with DN.

Hepatic survivin mRNA expression was ~30% higher in DN compared with the SAL (P<0.05). Survivin mRNA expression in GTE+SAL and GTE+DN was

~55% and ~30% lower, respectively, compared with SAL (P<0.05). Survivin mRNA expression in GTE+SAL and GTE+DN was ~65% and ~50% lower, respectively, compared with DN (P<0.05). There was no significant difference in

STAT3 and survivin expression between the GTE+SAL and GTE+DN (P>0.05).

There was no significant difference in c-Fos mRNA expression level between all groups (P>0.05). Total STAT3 correlates with iNOS, survivin, serum

ALT and hepatic MDA (r = 0.64-0.77; P<0.002), while survivin correlates with iNOS (r = 0.63; P<0.002) and with serum ALT and NAS (r = 0.71-0.77;

P<0.0001) (Table 4). GSTP inversely correlates with STAT3 (r = -0.54, P<0.006) and survivin (r = -0.53, P<0.003). Collectively, anti-oncogenic properties of GTE attenuate HCC risk by mitigating STAT3 and survivin, which are associated with liver injury and iNOS. Collectively, data suggest that STAT3 influences iNOS- associated liver injury.

4.6. GTE attenuates hepatic cell proliferation regardless of DEN administration.

PCNA was examined to determine the interactive effects of GTE and DEN on cell proliferation. The proportion of PCNA+ hepatic cells in DN was ~20% greater compared with SAL (P<0.05) (Figure 6). The proportion of PCNA+ hepatic cells in GTE+SAL was ~45% and ~55% less compared with SAL and

DN, respectively (P<0.05). The proportion of PCNA+ hepatic cells in GTE+DN was ~35% and ~45% less compared with SAL and DN, respectively (P<0.05).

The proportion of PCNA+ hepatic cells in GTE+DN groups was ~45% less compared with GTE+SAL (P<0.05). Corroborating these findings were observations that the proportion of hepatic PCNA+ cells correlates with total

STAT3, iNOS, survivin, serum ALT, NAS and hepatic MDA (r = 0.65-0.83;

P<0.0001) (Table 4). Hepatic PCNA+ cells inversely correlates with GSTP (r = -

0.57, P<0.0006) Collectively, data suggest that GTE-mediated attenuation of

STAT3 plays a key role in attenuation of liver injury and cell proliferation.

Table 3. Dietary intake, body composition and liver lipids of mice fed a high-fat diet containing GTE at 0 or 2% and administered diethylnitrosamine or saline. SAL GTE + SAL DN GTE + DN P-value Dietary intake (g/day)1 2.5 ± 0.1 2.3 ± 0.1 2.4 ± 0.1 2.2 ± 0.1 >0.05 Initial body mass (g)2 19.5 ± 0.3 19.7 ± 0.3 19.8 ± 0.3 19.3 ± 0.4 >0.05 Final body mass (g) 47.9 ± 0.7a 35.2 ± 1.0b 44.6 ± 1.7a 32.1 ± 0.9b <0.0001 Liver mass (g) 2.1 ± 0.1a 1.1 ± 0.0c 1.6 ± 0.1b 1.0 ± 0.0c <0.0001 Growth rate (mg body mass/day) 229.4 ± 10.5a 124.7 ± 7.4b 205.7 ± 7.8a 105.0 ± 5.2b <0.0001 Total adipose mass (g)3 8.7 ± 0.4a 5.0 ± 0.4b 8.6 ± 0.7a 3.9 ± 0.4b <0.0001 Total hepatic lipid (mg/g liver) 267.3 ± 17.8a 84.0 ± 5.4b 236.9 ± 19.4a 110.2 ± 6.0b <0.0001 Hepatic triglyceride (μmol/g liver) 80.6 ± 4.7a 43.7 ± 2.5b 71.2 ± 3.7a 34.8 ± 1.4b <0.0001 Hepatic cholesterol (μmol/g liver) 62.4 ± 4.5a 21.8 ± 0.7c 35.3 ± 3.0b 17.4 ± 0.5c <0.0001

1Dietary intake was calculated by dividing total difference of intake by the number of days past between 47 intake recording and then dividing by the number of mice per cage 2Initial body mass represents the body mass of mice prior to injection or DEN or Saline 3Total adipose mass represents the sum of subcutaneous, epididymal, retroperitoneal and mesenteric fat 4Data are means ± S.E.M., n=10 in each group. Data were analyzed by one-way ANOVA with Newman– Keuls post‐test to assess group mean differences. Means in a row not sharing a common letter are significantly different, P< 0.05 Abbreviations: SAL, saline; GTE, green tea extract; DN, diethylnitrosamine.

[Type a 47

SAL GTE + SAL DN GTE + DN Steatosis (score of 0-3) 2.8 ± 0.1a 0.1 ± 0.1b 2.7 ± 0.2a 0.3 ± 0.1b Ballooning (score of 0-2) 2.0 ± 0.0a 0.9 ± 0.1b 1.9 ± 0.1a 1.0 ± 0.0b Inflammation (score of 0-3) 0.6 ± 0.1 0.7 ± 0.1 0.7 ± 0.1 0.8 ± 0.1 Fibrosis (score of 0-4) 1.4 ± 0.2b 1.4 ± 0.1b 2.1 ± 0.1a 1.7 ± 0.1b NAS (score of 0-8) 5.5 ± 0.2a 1.6 ± 0.2b 5.3 ± 0.2a 2.0 ± 0.1b

Figure 3. Histological evaluation of livers in mice fed a high-fat diet containing GTE at 0 or 2% and administered diethylnitrosamine or saline.

A) Representative H&E-stained liver sections (original magnification 200x) from mice injected with saline or DEN and supplemented with or without 2% GTE. Sections were scored for steatosis, ballooning and inflammation (n=10 mice/group; mean ± SEM). B) Representative Masson’s trichrome stained liver sections. B) Sections were scored for severity of fibrosis. NAS score was calculated by the sum of the scores for steatosis, ballooning and inflammation. Means not sharing a common superscript are significantly different, P<0.05. Abbreviations: NAS, Nonalcoholic fatty liver disease activity score; SAL, saline; GTE, green tea extract; DN, diethylnitrosamine.

Figure 4. Serum ALT and hepatic MDA in mice fed a high-fat diet containing GTE at 0 or 2% and administered diethylnitrosamine or saline.

A) Serum alanine aminotransferase (ALT) activity was measured using a spectrophotometric clinical assay (Pointe Scientific, Canton, MI) B) Hepatic MDA was measured by HPLC-FL following incubation of liver homogenates with thiobarbituric acid and extraction with butanol. Data (means ± SEM, n = 10 mice per group) were analyzed by one-way ANOVA with Newman-Keuls post‐test to assess group mean differences. Groups without a common letter are significantly different (P<0.05). Abbreviations: ALT, alanine aminotransferase; MDA, malondialdehyde; SAL, saline; GTE, green tea extract; DN, diethylnitrosamine.

Figure 5. Hepatic total GSTP protein expression level in mice fed a high-fat diet containing GTE at 0 or 2% and administered diethylnitrosamine or saline.

Representative Western blot of GSTP and the loading control β-actin. Quantitative densitometry analysis of target protein accumulation in total cellular extracts. Data (means ± SEM, n = 10 mice per group) were analyzed by one-way ANOVA with Newman-Keuls post‐test to assess group mean differences. Groups without a common letter are significantly different (P<0.05). Abbreviations: GSTP, glutathione s-transferase pi form; SAL, saline; GTE, green tea extract; DN, diethylnitrosamine.

Figure 6. Hepatic pro-inflammatory gene expression levels in mice fed a high-fat diet containing GTE at 0 or 2% and administered diethylnitrosamine or saline.

RNA was isolated using Trizol and reverse transcribed for RT-PCR analysis using the primers described in table 5.1. Data (means ± SEM, n = 10 mice per group) were analyzed by one-way ANOVA with Newman-Keuls post‐test to assess group mean differences. Groups without a common letter are significantly different (P<0.05). Abbreviations: TNFα, tumor necrosis factor α; MCP-1, monocyte chemoattractant protein-1; iNOS, inducible nitric oxide synthase; SAL, saline; GTE, green tea extract; DN, diethylnitrosamine.

Figure 7. Hepatic STAT3 protein and c-Fos and survivin mRNA expression level in mice fed a high-fat diet containing GTE at 0 or 2% and administered diethylnitrosamine or saline.

A) Representative Western blot of STAT3 and the loading control β-actin. Quantitative densitometry analysis of target protein accumulation in total cellular extracts. B) RNA was isolated using Trizol and reverse transcribed for RT-PCR analysis using the primers described in table 5.1. Data (means ± SEM, n = 10 mice per group) were analyzed by one-way ANOVA with Newman-Keuls post‐ test to assess group mean differences. Groups without a common letter are significantly different (P<0.05). Abbreviations: STAT3, Signal transducer and activator of transcription 3; c-Fos, Proto-oncogene c-Fos; SAL, saline; GTE, green tea extract; DN, diethylnitrosamine.

Figure 8. Proportion of hepatic PCNA+ cells in mice fed a high-fat diet containing GTE at 0 or 2% and administered diethylnitrosamine or saline.

A) Representative slides for PCNA+ liver sections B) Hepatocyte proliferation is semi-quantified by proliferating cell nuclear antigen (PCNA)-positive foci from 3-4 fields (original magnification 200x) per sample group and are counted per 100 hepatocytes and averaged. Data (means ± SEM, n = 10 mice per group) were analyzed by one-way ANOVA with Newman-Keuls post‐test to assess group mean differences. Groups without a common letter are significantly different (P<0.05). Abbreviations: PCNA, proliferating cell nuclear antigen; SAL, saline; GTE, green tea extract; DN, diethylnitrosamine.

Table 4. Correlations between liver injury and cell proliferation-associated risk factors of HCC.

NAS MDA ALT GSTP iNOS PCNA STAT3 NAS - MDA 0.51 - (0.001) ALT 0.80 0.75 - (0.0001) (0.0001) GSTP -0.68 -0.50 -0.65 -

(0.0001) (0.003) (0.0001) iNOS 0.58 0.66 0.74 -0.58 - (0.0006) (0.0001) (0.0001) (0.001) [Type a 54

PCNA 0.78 0.73 0.83 -0.57 0.65 - (0.0001) (0.0001) (0.0001) (0.0006) (0.0001) STAT3 0.72 0.75 0.77 -0.54 0.64 0.79 - (0.0001) (0.0001) (0.0001) (0.006) (0.002) (0.0001) Survivin 0.77 0.53 0.71 -0.53 0.66 0.83 0.63 (0.0001) (0.002) (0.0001) (0.003) (0.0001) (0.0001) (0.002)

Pearson and Spearman correlation analysis were used to determine statistically significant relationships between variables. P<0.05 was considered statistically significant. Abbreviations: NAS, nonalcoholic fatty liver disease activity score, ALT, alanine aminotransferase; GSTP, glutathione s-transferase pi form; iNOS, inducible nitric oxide synthase; STAT3, signal transducer and activator of transcription 3; PCNA, proliferating cell nuclear antigen. Chapter 5: DISCUSSION

5.1. Summary

This thesis demonstrates that hepatoprotective activities of GTE during diet-induced NASH also prevented DEN-induced progression towards HCC.

Consistent with the hypothesis, GTE lowered NASH-associated HCC risk by attenuating obesity and histological parameters of NASH regardless of DEN administration. GTE lowered NASH-associated HCC risk by attenuating biochemical parameters of NASH otherwise increased by DEN. GTE most likely attenuated liver injury by attenuating lipid peroxidation, NFκB-mediated proinflammatory cytokines and STAT3-mediated increases in iNOS. GTE most likely mitigates cell proliferation by attenuating pro-oncogenic STAT3-mediated iNOS, survivin and PCNA. Collectively, these findings support that GTE- mediated decreases in NASH-associated liver injury and cell proliferation lower

HCC risk by attenuating obesity, lipid peroxidation, NFκB-mediated inflammation, and STAT3-mediated cell proliferation regardless of DEN administration.

5.2. Model System of NASH and DEN-mediated HCC

An important factor for this thesis was to have a mouse model that represented HCC development from NASH. In this thesis, a HFD and DEN were used to not only accelerate HCC development, but reflect symptoms of a NASH-

HCC patient, which are increased body mass, insulin resistance, inflammation and fibrosis (74, 99). There are different diets in combination with DEN which induces NASH-HCC including Western diet, choline-deficient diet, high- saturated-fat (10% lard oil, 2% cholesterol w/w) and the HFD (60% kcal) (74,

100, 101). Db/db mice are also commonly used in combination with DEN to illicit

NASH-HCC symptoms (10, 73). Rats fed a HFD in combination with DEN can also reflect symptoms of a NASH-HCC patients such as Zucker and Sprague-

Dawley rats (41, 102). It is important to note that there is no significant difference in how DEN is bioactivated by mice and rats in vitro (103), suggesting that these two species can be compared in regards to DEN administration.

A key endpoint of most NASH-HCC models is the tumor development. In this thesis, gross pathological observation indicated a lack of hepatic tumors in all mice. Unlike most NASH-HCC models that focus on hepatic lesions, my model focuses on examining HCC risks in unaltered hepatic tissue. Tumors have different mutations resulting in overexpression or underexpression of genes that do not reflect normal hepatocytes (104). In my model, the lack of tumors is most likely attributed to the lack of total weekly injections of DEN in adolescent rodents when compared with other murine models with NASH. For example, one study administered single weekly i.p. injections of DEN (45 mg/kw BW) in adolescent

B6C3F1 mice from weeks 6-8 and then weeks 10-12 (100). The mice were sacrificed at 36 wk and all mice developed premalignant lesions. None of the sacrificed mice in my thesis developed observable premalignant lesions at 25 wk of age. When compared with strains such as C3H and B6C3F1, C57BL/6J mice are considered more resistant to full tumor development most likely due to genetic differences in tumor suppressor genes (61, 105). This results in a larger window to determine a NASH-HCC development model. Another factor is the age of DEN administration. The majority of models including the C57BL/6J strain are administered DEN during the infant stage (2 wk or 3 wk) (72, 73) resulting in development of tumors by time of sacrifice around 25 wk.

Rather than tumor development, my model focuses on cell proliferation which is a major risk factor during HCC development (35). Increased PCNA+ hepatocytes in cirrhotic patients is associated with increased HCC incidence and was considered to be a reliable predictor of HCC development in patients with cirrhosis (106). Sprague-Dawley rats given an i.p. injection of DEN (30 mg/kg

BW) and fed a liquid HFD (60% kcal) for 6 weeks exhibited GSTP+ hepatocytes which is an indicator for premalignant cells and had higher PCNA+ cells compared to mice only injected DEN (41), suggesting that a HFD with DEN is enough to induce NASH-associated HCC development. Collectively, the lack of tumors, but increase in cell proliferation is appropriate for a model focusing on

HCC development and NASH-associated HCC risk.

Aside from the focus on cell proliferation as a risk for HCC, my model in comparison with similar NASH- and DEN-mediated HCC models, reflects increased growth rate, severity of NASH, increased inflammation and most likely insulin resistance (9) and fibrosis (107). Administration of DEN during the infant stage results in a significant rise in inflammatory cytokines (8, 107), while mice administered DEN starting from 5 wk require larger and more frequent doses of

DEN in order to exhibit significant rises in these parameters (100). Another consideration is that DEN, if given at a higher dosage, can inhibit growth rate (50).

Regardless of administration levels of DEN, majority of NASH- and DEN- mediated HCC models develop the symptoms of a NASH-HCC patient. The similarities with other established models indicate that my model is an adequate representation of a patient with NASH progressing towards HCC.

5.3. GTE protects against NASH-associated HCC risk by attenuating obesity

Obesity is associated with increased HCC occurrence and mortality (108,

109). Increased growth rate, body mass, adipose mass, liver mass, hepatic lipids and hepatic triglyceride are observed in obese NASH models (8, 9). GTE protects against obesity-associated HCC risk by attenuating growth rate, final body mass, adipose mass, liver mass, hepatic lipids and hepatic triglyceride.

Indeed, obese models administered GTE exhibit attenuated obesity-associated parameters and HCC development (10, 110). Green tea attenuates obesity-

58 related parameters most likely by attenuating intestinal lipid absorption (111) and thereby preventing hepatic lipid accumulation and adiposity, while DEN does not significantly increase these parameters (107, 112). Green tea most likely prevents lipid absorption by inhibiting pancreatic lipase (113), pancreatic lipase

A(2) (114) and increasing the size of lipid emulsions in the small intestine (115).

NAS is correlated with adipose tissue, body weight, hepatic weight, liver weight, hepatic triglycerides, hepatic lipids suggesting that green tea protects against

NASH-associated HCC risk by attenuating increases in adiposity and hepatic lipid accumulation.

5.4 GTE prevents HCC-risk by attenuating NASH

GTE protects against NASH as expected (9), regardless of DEN administration (10, 110). DEN administration does not increase steatosis or NAS

(72, 73), however EGCG improves NAS (10, 110) in rodent models with NASH and DEN administration. Lack of change in NAS due to DEN administration is most likely due to bioactivation of DEN forming adducts and inducing lipid peroxidation (116, 117), , rather than affecting hepatic TG accumulation (107,

112). Indeed, C57BL/6J mice fed a HFD and injected with DEN (i.p. 5 mg/kw

BW) at 3 wk exhibited elevated serum lipid peroxidation compared with

C57BL/6J mice fed a HFD and injected with olive oil as a control (107).

5.4.1 GTE lowers NASH-associated HCC risk by attenuating lipid peroxidation

Liver injury is associated with HCC (118, 119). GTE protects against HCC development by increasing GSTP. GSTP is a member of the glutathione S- transferase supergene family (120, 121). These enzymes are normally associated with detoxification of xenobiotic and lipid-oxidized compounds (122,

123). Eight-week-old, male and female wild-type and GSTP-null mice were given a single i.p. dose of benzo[a]pyrene, 3-methylcholanthrene, or urethane at 200 mg/kg, 100 mg/kg, and 10 mg/mouse, respectively (124). Control mice received equivalent doses of the tricaprylin vehicle only. All mice were sacrificed five months later. Regardless of which carcinogen was injected, GSTP-null mice exhibited higher counts of tumors in the lung, indicating the protective effect of

GSTP against cancer development.

In this thesis, GSTP protein expression was significantly higher in mice fed

GTE regardless of DEN administration and is exerting a protective effect against

HCC development by attenuating lipid peroxidation. Green tea has been suggested to have an influence on GSTP activity (125). Healthy participants underwent a 4 week washout period before measuring baseline levels of GST.

They were then given Polyphenon E (800 mg EGCG) once a day on an empty stomach for 4 weeks. Blood samples were then collected for post-intervention

GST assessment. Lymphocyte lysates in patients fed Polyphenon E had higher

GSTP activity compared to baseline. Statistical significance was only applicable

60 in lowest tertile or those considered to have ―low‖ detoxification capacity.

Comparatively, GST mu in lymphocytes and GST alpha in plasma had no significant difference in activity regardless of Polyphenon E supplementation.

This suggests that each GST isozyme is differentially induced by green tea catechins.

A HFD has also been indicated to influence the expression of GSTP (126).

C57BL/6J male mice fed a HFD for 8 weeks (60% energy from fat) had lower mRNA expression of GSTP compared mice fed a control diet (10% energy from fat). 1% GTE increases total GST activity in ob/ob mice (88). GSTP-silenced human colon cancer cells re-expressed GSTP when treated with green tea polyphenols (127). EGCG can activate Nrf2 (9), which is a transcription factor for

GSTP (128), suggesting that GSTP expression is elevated by GTE. GSTP protein expression was inversely correlated with NAS, hepatic MDA and serum

ALT, suggesting the protective effect against NASH-associated liver injury. GSTP has been suggested to combat against apoptosis by scavenging the formation of lipid-peroxide-modified DNA in human colon cancer cells (129), indicating the possibility that GSTP may also play a similar role in the liver. This thesis is the first to examine GSTP protein expression, serum ALT and hepatic MDA and the effects of DEN and GTE in a NASH- and DEN-mediated mouse model.

Collectively, GTE attenuates NASH-associated HCC risk by increasing GSTP, thereby attenuating lipid peroxidation otherwise increased by DEN.

5.4.2 GTE lowers NASH-associated HCC risk by attenuating NFκB-mediated inflammation

Chronic inflammation is a risk factor for HCC (34). NFκB and the downstream targets TNFα, MCP-1 and iNOS are lower in mice fed a HFD with 2%

GTE compared with mice just fed a HFD (9). It is suggested that GTE protects against hepatic NFκB-mediated inflammation in a TLR4- and TNFR-dependent manner (9) most likely by decreasing TNFα expression and TNFR1 expression in adipose and the liver (9, 88) and by decreasing hepatic MyD88 protein expression (9). Db/db mice given 40 ppm of DEN in tap water for 2 wk and 0.1%

EGCG in tap water ad libitum exhibited significantly less TNFα compared to mice given just 40 ppm of DEN in tap water ad libitum, indicating that green tea protects against DEN-mediated increases in the NFκB-mediated pathway.

NFκB and TNFα are elevated in mouse models with NASH administered

DEN (i.p. 25 mg/kg BW) at 2 wk (72) or administered DEN (40 ppm for 2 wk) at 5 wk (10). Also, C57BL/6J mice administered DEN (i.p. 25 mg/kw BW) expressed higher protein concentrations of hepatic MCP-1 (130). However, adult B6C3F1 mice administered single weekly i.p. injections of DEN (45 mg/kw BW) from weeks 6-8 and then weeks 10-12 (100) exhibited a lack of increase in TNF α expression which better reflects my study. The difference in expression may be due to the age at which DEN is administered. Most studies administer DEN during the infant stage (2-3 wk) (8, 72, 73, 107), while Chen et al. administered

DEN starting from 6 wk (100). The mice administered DEN starting from 6 wk

62 required more dosage and a higher number of doses in order to develop tumors compared with mice administered DEN at 2 wk. Collectively, this suggests that a lack increase in TNFα and MCP-1 in my model may be due to age of administration, dose and frequency.

The lack of change in TNFα and MCP-1 due to DEN administration in my model suggests that increases in iNOS, lipid peroxidation and liver injury by DEN is not solely in an NFκB-mediated manner. Similar levels of iNOS, lipid peroxidation and liver injury in GTE+SAL and GTE+DN, suggest that GTE also protects against these parameters separately from a TNFR- and TLR4- dependent manner. Collectively, GTE is able to attenuate NASH-associated HCC risk by attenuating NFκB-mediated inflammation regardless of DEN administration.

5.4.3. GTE lowers NASH-associated HCC risk by attenuating liver injury

In this thesis, hepatic MDA and serum ALT were elevated due to DEN administration. C57BL/6J mice fed a HFD and injected with DEN (i.p. 5 mg/kw

BW) at 3 wk had elevated serum lipid peroxidation, but not hepatic MDA, when compared with C57BL/6J mice fed a HFD and injected with olive oil as a control

(107). Another study involving db/db mice administered DEN (i.p. 25 mg/kg BW at 2 wk old) exhibited no group difference in serum ALT in those administered

DEN compared to the control group (112).

In contrast, Sprague Dawley rats administered DEN (oral gavage 10 mg/kg/d) fed a chow diet consisting of 10% lard oil had higher serum ALT compared to those administered DEN (oral gavage 10 mg/kg/d) and fed a chow diet (101). C57BL/6J mice administered DEN (i.p. 100 mg/kg BW) at 5 wk and then again at 6 wk (i.p. 50 mg/kg BW), exhibited higher serum ALT levels compared with mice administered no DEN (131). Collectively, significant increase in serum ALT by DEN administration in my model is most likely due to higher dosage and frequency compared with studies exhibiting no difference due to

DEN administration. To corroborate this hypothesis, 16 wk old C57BL/6J mice administered DEN (i.p. 100 mg/kw BW) had significantly higher levels of serum

ALT at 12 days after DEN administration in HFD fed C57BL/6J mice (8).

Liver tissue, including non-tumor tissue from patients with poor HCC prognosis, exhibited upregulated iNOS protein expression, suggesting that iNOS plays a key role in HCC development (132). iNOS expression in tumor-specific tissue is positively correlated with tumor proliferation, genomic instability, microvascularity and was negatively correlated with apoptosis (133). However, iNOS mRNA expression from tumor-specific tissue did not correlate with tumor stage or tumor differentiation (134), suggesting that iNOS plays a role during the

HCC development stage rather than HCC progression and metastasis.

Elevated levels of iNOS increases risk for HCC most likely by increasing liver injury (135, 136). iNOS is associated with liver injury because large quantities of nitric oxide increases the chance for peroxynitrite formation (137).

Peroxynitrite formation results in liver injury because it has a high affinity for oxidizing sulfhydryls such as cysteine and thiol groups and is kinetically more reactive than hydrogen peroxide (135). In this thesis, liver injury and iNOS expression are attenuated by GTE regardless of DEN administration. This is corroborated by iNOS being correlated with serum ALT, hepatic MDA and NAS. iNOS knockout mice given concanavalin A (inducer of severe liver injury by upregulation of inflammatory cytokines) exhibited significantly reduced plasma

ALT compared to WT mice given concanavalin A, indicating the key role iNOS plays in inflammatory-mediated liver injury. Like TNFα and MCP-1, GTE attenuates iNOS in an NFκB-mediated manner (9). STAT3 is considered downstream of NFκB (8). However, GTE-mediated decreases of iNOS due to

DEN administration is most likely due to a EGFR/STAT3 dependent manner

(138).

EGFR is associated with HCC development (139). Male Wistar rats given an i.p. injection of DEN (50 mg/kg BW) once a week for 12 weeks and given an

EGFR-inhibitor, exhibited a lower liver tumor count compared to rats given only the injections of DEN (140). Increase in hydrogen peroxide or DEN administration has been suggested to result in autophosphorylation of EGFR, resulting in constitutive activation of the pathway (141, 142), . EGFR/STAT3 complex can transcriptionally activate iNOS in vitro (143). Evidence that iNOS is downstream of STAT3 is further corroborated by the observation that iNOS is positively correlated with STAT3 in this thesis. EGCG inhibits EGFR activation in

65 cervical cells and HCC colon cancer cell lines suggesting that GTE may also inhibit EGFR activation in the liver (138, 144).

DEN administration increases STAT3 protein expression in mouse models with NASH (8, 10). Aside from NFκB-mediated responses to DEN, upregulation of hepatic interferon gamma by DEN (145) most likely upregulates STAT3 protein expression (146). Upregulation of STAT3 thereby increases liver injury by way of iNOS in a NASH model. Polyphenon E inhibited activation for interferon gamma transcription in vitro and STAT3 transcription (146). Inhibition of EGFR and

STAT3 in breast carcinoma cells by EGCG further supports that iNOS may be attenuated by an EGFR/STAT3-dependent pathway (147).

Chronic liver injury results in fibrosis (148) and is observed in studies involving HFD or db/db mice administered DEN (107, 149). Fibrosis is affected by dosage and frequency (101, 150). Inhibition of EGFR results in attenuation of fibrosis and cell proliferation (151), suggesting that GTE attenuates fibrosis in an

EGFR/STAT3-dependent manner. Collectively, GTE may be lowering HCC risk by attenuating liver injury in an NFκB and EGFR/STAT3-dependent manner.

5.4.4. GTE lowers NASH-associated HCC risk by attenuating cell proliferation

Aside from iNOS, two other downstream targets of the pro-oncogenic transcription factor STAT3 are survivin and c-Fos. Survivin inhibits apoptosis most likely by forming complexes with apoptotic proteins such as caspase-9

(152) and aids in proliferation by maintain intracellular structure such as spindle microtubules during mitosis (153). C-Fos binds with c-jun to form the transcription factor complex activator protein-1, which then transcribes genes that increase cell proliferation such as cyclin D1 and cyclin-dependent kinases (154).

Cyclin D1 and cyclin-dependent kinases cause the transition of a cell from growth phase 1 to the synthesis phase of the cell cycle (154). C-Fos is highly expressed in tumor tissue of Chinese HCC patients (155). Mice without c-Fos expression had significantly less hepatic cell damage, immune cell infiltrates and hepatocyte alterations when administered DEN (156). In this thesis, there were no significant changes in c-Fos mRNA expression by GTE or DEN. B6CF31 mice administered different doses of DEN (i.p. 3, 9, 27 or 80 mg/kw BW) and sacrificed a month later exhibited no significant changes in c-Fos mRNA expression compared to control mice. AKR (mice strain prone to leukemia) mice given 100 ppm DEN in tap water for 120 days also exhibited no changes in c-Fos (157). C-Fos most likely plays a role in HCC progression rather than HCC development as it is detected in DEN-induced rat liver cell carcinomas (158), while it is lowly expressed in altered hepatocellular foci. EGCG inhibits DNA binding activity of activator protein-1 (159). Collectively, GTE may not be attenuating cell proliferation directly in a c-Fos-dependent manner.

Alternatively, survivin mRNA expression reflects similar trends to total

STAT3 and iNOS. Survivin mRNA is strongly correlated with cell proliferation and inversely correlated with apoptotic index in hepatic tumor tissue from patients

67 with HCC (134). DEN increases survivin mRNA expression in vitro (160).

Survivin mRNA expression is down-regulated in breast cancer cells by tea polyphenols (160). Survivin expression is increased when there is an increase in both human epidermal growth factor receptor 2 and EGFR in breast cancer cells, suggesting that inhibition of EGFR alone can lower survivin expression (161).

Collectively, GTE may be attenuating survivin-associated cell proliferation in an

EGFR/STAT3-dependent manner. The combination of lower STAT3 expression and inhibition of EGFR by EGCG most likely plays a key role in the attenuation of

DEN-exacerbated iNOS and survivin mRNA expression.

Cell proliferation is a risk factor for HCC (35). GTE protects against the pro-oncogenic cell proliferation regardless of DEN exacerbation. Male C57BL/6J mice fed a HFD (60% kcal) and given an i.p. injection of DEN (5 mg/kw BW) in

100μL olive oil at 3 weeks of age had higher PCNA+ cells compared to mice that were only injected with 100μL of olive oil and given a control diet (10% kcal)

(107), indicating that both a HFD and DEN increase cell proliferation. PCNA is expressed during the synthesis phase of the cell cycle (162). Cyclin D1 is regulated by STAT3 (163), and both cyclin D1 and PCNA expression are correlated with STAT3 expression in the liver (163, 164), suggesting that STAT3 may be regulating PCNA by regulating cyclin D1 expression. Green tea exerts anti-cell proliferative effects in in vitro studies in liver cancer cell lines (165).

EGCG inhibits cell proliferation in vitro by an EGFR-dependent manner (138).

PCNA+ hepatocytes are significantly correlated with NAS, iNOS mRNA

68 expression, survivin mRNA expression and STAT3 protein expression.

Collectively, GTE may be attenuating cell proliferation by both NFκB and

EGFR/STAT3-mediated pathways.

5.5. Strengths and weaknesses

A strength of this thesis is that it is the first to provide a NASH- and DEN- mediated mouse model that examines the independent and interactive effects of

DEN and GTE during HCC development. The model adequately represents the characteristics of a NASH patient progressing towards HCC. Another strength of this study is that the dosage in my model is not enough to cause lower body weight or growth rate compared to the control. Lean mice given single weekly injections of DEN (75 mg/kg BW) for four weeks resulted in significantly lower body weight compared with the control, which was unlike lean mice administered the same frequency but lower dosages of DEN (50 or 25 mg/kg BW). 100% of mice fed a HFD and administered DEN at 16 wk (i.p. 100 mg/kg BW) died compared with no deaths in lean mice administered DEN at 16 wk (i.p. 100 mg/kg BW). Both loss in weight and death is most likely due to the oxidative and necrotic stress that DEN puts on the animals (50). My study suggests that administration of DEN (i.p. 60 mg/kg BW) at 5 wk and 7 wk does not cause enough stress on the mice to significantly lower body weight and growth rate, which better represents an obese patient with NASH. Another strength of this thesis is that my model indicates that there are likely two different pathways in

69 which GTE combats against NASH- and DEN-mediated HCC development.

Majority of studies have only focused on NFκB-mediated increases in STAT3 tumorigenesis and progression (8, 10, 166).

Insulin resistance measurement could have given stronger insight on the interactive effects of DEN and GTE during obesity-associated HCC development; however, C57BL/6J mice fed a HFD (60% kcal) and supplemented with 2% GTE have attenuated insulin resistance (9) compared with mice fed only a HFD.

Another weakness is that IL-6 was not measured. IL-6 is a downstream pro- inflammatory cytokine of NFκB (25) and is considered a key activator of STAT3 in models with NASH (8). IL-6 expression could further corroborate the evidence that DEN administration is mediated partially by an EGFR/STAT3-dependent mechanism. Further research could be conducted on serum levels of growth factors such as transforming growth factor alpha and EGF which are also considered upstream of EGFR and may give better insight to mechanisms of

DEN and how far upstream does GTE attenuate DEN-mediated oxidative stress and DNA damage.

5.6. Significance and implications

The outcomes of these are significant because they provide basis for a model that represents HCC development in patients with NASH. The outcomes further highlight the role of NASH in HCC development and the protective effect

GTE is able to exert to combat against obesity and NASH. The outcomes also

70 support the existing literature on the significance of STAT3-mediated HCC development. Additionally, these findings support the likelihood that aside from

NFκB-mediated pro-inflammatory signaling, the EGFR/STAT3-mediated pathway plays a role in the regulation of STAT3 during HCC development.

Humans are exposed to carcinogens such as nitrosamines on a regular basis by usage of cosmetics (167) and consumption of burnt or cured foods (168) and evidence that GTE is able to attenuate carcinogen specific stressors on the body supports clinical application of GTE in combatting NASH and NASH-derived

HCC. Survivin inhibition may also be a viable therapy method in those with high risk for HCC or those with HCC as survivin inhibition has been observed to induce apoptosis of HCC cells (169).

GTE may also be a more effective form of prevention or treatment against

HCC rather than EGCG alone due to possible synergistic effects by multiple catechins and less toxicity (170). Overall, evidence that GTE is able to attenuate all symptoms of a NASH-HCC patient, along with protecting against liver injury and cell proliferation, highlights the effective nature of GTE against HCC development in patients with NASH.

5.7. Conclusion

GTE when supplemented in a preventive manner is able to protect against

HCC development in diet-induced NASH. The antiinflammatory and anti- oncogenic properties of GTE are able to protect against diet- and DEN-induced

71 liver injury and cell proliferation by attenuating NFκB-mediated inflammation and

STAT3-mediated iNOS and survivin. This thesis provides further evidence that consistent consumption of dietary GTE is able to attenuate diet-induced NASH and thereby reduce HCC risk. The study will be the first to identify the potential protective effects of GTE on pro-inflammatory and pro-oncogenic pathways during HCC development in a DEN-administered mouse model with diet-induced

NASH.

References

1. Neuschwander-Tetri BA, Caldwell SH. Nonalcoholic steatohepatitis: summary of an AASLD Single Topic Conference. Hepatology. 2003 May;37:1202-19.

2. Younossi ZM, Koenig AB, Abdelatif D, Fazel Y, Henry L, Wymer M. Global epidemiology of nonalcoholic fatty liver disease-Meta-analytic assessment of prevalence, incidence, and outcomes. Hepatology. 2016 Jul;64:73-84.

3. White DL, Kanwal F, El-Serag HB. Non-Alcoholic Fatty Liver Disease and Hepatocellular Cancer: A Systematic Review. Clin Gastroenterol Hepatol. 2012 Dec;10:1342-59 e2.

4. Adams LA, Lindor KD. Nonalcoholic Fatty Liver Disease. AEP Annals of Epidemiology. 2007;17:863-9.

5. Ferlay J, Shin HR, Bray F, Forman D, Mathers C, Parkin DM. Estimates of worldwide burden of cancer in 2008: GLOBOCAN 2008. Int J Cancer. 2010 Dec 15;127:2893-917.

6. Bosetti C, Turati F, La Vecchia C. Hepatocellular carcinoma epidemiology. Best practice & research Clinical gastroenterology. 2014;28:753-70.

7. He G, Karin M. NF-kappaB and STAT3 - key players in liver inflammation and cancer. Cell Res. 2011 Jan;21:159-68.

8. Park EJ, Lee JH, Yu GY, He G, Ali SR, Holzer RG, Osterreicher CH, Takahashi H, Karin M. Dietary and genetic obesity promote liver inflammation and tumorigenesis by enhancing IL-6 and TNF expression. Cell. 2010;140:197- 208.

9. Li J, Sapper TN, Mah E, Moller MV, Kim JB, Chitchumroonchokchai C, McDonald JD, Bruno RS. Green tea extract treatment reduces NFkappaB activation in mice with diet-induced nonalcoholic steatohepatitis by lowering TNFR1 and TLR4 expression and ligand availability. J Nutr Biochem. 2016 Dec 21;41:34-41.

10. Masterjohn C, Bruno RS. Therapeutic potential of green tea in nonalcoholic fatty liver disease. Nutr Rev. 2012 Jan;70:41-56.

11. Li Y, Chang SC, Goldstein BY, Scheider WL, Cai L, You NCY, Tarleton HP, Ding B, Zhao J, et al. Green tea consumption, inflammation and the risk of primary hepatocellular carcinoma in a Chinese population. Cancer Epidemiol. 2011 Aug;35:362-8.

12. Tolba R, Kraus T, Liedtke C, Schwarz M, Weiskirchen R. Diethylnitrosamine (DEN)-induced carcinogenic liver injury in mice. Lab Anim. 2015 Apr;49:59-69.

13. Finucane MM, Stevens GA, Cowan MJ, Danaei G, Lin JK, Paciorek CJ, Singh GM, Gutierrez HR, Lu Y, et al. Re: National, regional, and global trends in body-mass index since 1980: Systematic analysis of health examination surveys and epidemiological studies with 960 country-years and 9.1 million participants. J Urol Journal of Urology. 2011;186:1982-3.

14. Tolman KG, Dalpiaz AS. Treatment of non-alcoholic fatty liver disease. Ther Clin Risk Manag. 2007 Dec;3:1153-63.

15. Powell EE, Cooksley WG, Hanson R, Searle J, Halliday JW, Powell LW. The natural history of nonalcoholic steatohepatitis: a follow-up study of forty-two patients for up to 21 years. Hepatology. 1990 Jan;11:74-80.

16. Bellentani S, Saccoccio G, Masutti F, CrocÃ¨ LS, Brandi G, Sasso F, Cristanini G, Tiribelli C. Prevalence of and risk factors for hepatic steatosis in Northern Italy. Annals of internal medicine. 2000;132:112-7.

17. Calle EE, Rodriguez C, Walker-Thurmond K, Thun MJ. Overweight, obesity, and mortality from cancer in a prospectively studied cohort of U.S. adults. The New England journal of medicine. 2003;348:1625-38.

18. Loomba R, Sanyal AJ. The global NAFLD epidemic. Nat Rev Gastroenterol Hepatol. 2013 Nov;10:686-90.

19. Browning JD, Horton JD. Molecular mediators of hepatic steatosis and liver injury. J Clin Invest. 2004 Jul;114:147-52.

20. Shimomura I, Bashmakov Y, Horton JD. Increased levels of nuclear SREBP-1c associated with fatty livers in two mouse models of diabetes mellitus. J Biol Chem. 1999 Oct 15;274:30028-32.

21. Boden G, Salehi S, Cheung P, Homko C, Song W, Loveland-Jones C, Jayarajan S. Comparison of In Vivo Effects of Insulin on SREBP-1c Activation and INSIG-1/2 in Rat Liver and Human and Rat Adipose Tissue. Obesity (Silver Spring). 2013 Jun;21:1208-14.

22. Robertson G, Leclercq I, Farrell GC. Nonalcoholic steatosis and steatohepatitis. II. Cytochrome P-450 enzymes and oxidative stress. Am J Physiol Gastrointest Liver Physiol. 2001 Nov;281:G1135-9.

23. Esterbauer H, Schaur RJ, Zollner H. Chemistry and biochemistry of 4- hydroxynonenal, malonaldehyde and related aldehydes. Free Radic Biol Med. 1991;11:81-128.

24. Zhong Z, Wen Z, Darnell JE, Jr. Stat3: a STAT family member activated by tyrosine phosphorylation in response to epidermal growth factor and interleukin-6. Science. 1994 Apr 01;264:95-8.

25. Lewindon PJ, Pereira TN, Hoskins AC, Bridle KR, Williamson RM, Shepherd RW, Ramm GA. The Role of Hepatic Stellate Cells and Transforming Growth Factor-β1 in Cystic Fibrosis Liver Disease. Am J Pathol; 2002. p. 1705- 15.

26. Yu H, Pardoll D, Jove R. STATs in cancer inflammation and immunity: a leading role for STAT3. Nature reviews Cancer. 2009;9:798-809.

27. El-Serag HB, Rudolph KL. Hepatocellular carcinoma: epidemiology and molecular carcinogenesis. Gastroenterology. 2007 Jun;132:2557-76.

28. Sanyal AJ, Yoon SK, Lencioni R. The etiology of hepatocellular carcinoma and consequences for treatment. Oncologist. 2010;15 Suppl 4:14-22.

29. O’Sullivan RJ, Karlseder J. Telomeres: protecting chromosomes against genome instability. Nat Rev Mol Cell Biol. 2010 Mar;11:171-81.

30. Le Bail B, Bernard PH, Carles J, Balabaud C, Bioulac-Sage P. Prevalence of liver cell dysplasia and association with HCC in a series of 100 cirrhotic liver explants. J Hepatol. 1997 Nov;27:835-42.

31. Goodman ZD. Neoplasms of the liver. Modern pathology : an official journal of the United States and Canadian Academy of Pathology, Inc. 2007;20:49-60.

32. Schlageter M, Terracciano LM, D'Angelo S, Sorrentino P. Histopathology of hepatocellular carcinoma. World journal of gastroenterology. 2014;20:15955- 64

33. Luedde T, Schwabe RF. NF-κB in the liver—linking injury, fibrosis and hepatocellular carcinoma. Nat Rev Gastroenterol Hepatol. 2011 Feb;8:108-18.

34. Hanahan D, Weinberg RA. Hallmarks of cancer: the next generation. Cell. 2011 Mar 4;144:646-74.

35. Tsutsui H, Cai X, Hayashi S. Interleukin-1 Family Cytokines in Liver Diseases. Mediators Inflamm. 2015;2015:630265.

36. Lawrence T. The nuclear factor NF-kappaB pathway in inflammation. Cold Spring Harb Perspect Biol. 2009 Dec;1:a001651.

37. Pikarsky E, Porat RM, Stein I, Abramovitch R, Amit S, Kasem S, Gutkovich-Pyest E, Urieli-Shoval S, Galun E, Ben-Neriah Y. NF-kappaB functions as a tumour promoter in inflammation-associated cancer. Nature. 2004;431:461-6.

38. Haybaeck J, Zeller N, Wolf MJ, Weber A, Wagner U, do Kurrer MO, Bremer J, Iezzi G, Graf R, et al. A lymphotoxin-driven pathway to hepatocellular carcinoma. Cancer Cell. 2009 Oct 6;16:295-308.

39. Ribeiro PS, Cortez-Pinto H, Sola S, Castro RE, Ramalho RM, Baptista A, Moura MC, Camilo ME, Rodrigues CM. Hepatocyte apoptosis, expression of death receptors, and activation of NF-kappaB in the liver of nonalcoholic and alcoholic steatohepatitis patients. Am J Gastroenterol. 2004 Sep;99:1708-17.

40. Wang Y, Ausman LM, Greenberg AS, Russell RM, Wang XD. Nonalcoholic steatohepatitis induced by a high-fat diet promotes diethylnitrosamine-initiated early hepatocarcinogenesis in rats. Int J Cancer. 2009 Feb 01;124:540-6.

41. Jang MK, Kim HS, Chung YH. Clinical aspects of tumor necrosis factor- alpha signaling in hepatocellular carcinoma. Curr Pharm Des. 2014;20:2799-808.

42. Cortez-Pinto H, Yang SQ, Lin HZ, Costa S, Hwang CS, Lane MD, Bagby G, Diehl AM. Bacterial lipopolysaccharide induces uncoupling protein-2 expression in hepatocytes by a tumor necrosis factor-alpha-dependent mechanism. Biochem Biophys Res Commun. 1998 Oct 09;251:313-9.

43. Valko M, Leibfritz D, Moncol J, Cronin MT, Mazur M, Telser J. Free radicals and antioxidants in normal physiological functions and human disease. Int J Biochem Cell Biol. 2007;39:44-84.

44. Naugler WE, Sakurai T, Kim S, Maeda S, Kim K, Elsharkawy AM, Karin M. Gender disparity in liver cancer due to sex differences in MyD88-dependent IL-6 production. Science (New York, NY). 2007;317:121-4.

45. Napetschnig J, Wu H. Molecular Basis of NF-B Signaling. Annual Review of Biophysics. 2013;42.

46. Zhang Y, Zhou B, Deng B, Zhang F, Wu J, Wang Y, Le Y, Zhai Q. Amyloid-b induces hepatic insulin resistance in vivo via JAK2. Diabetes. 2013;62:1159-66.

47. Yu H, Lee H, Herrmann A, Buettner R, Jove R. Revisiting STAT3 signalling in cancer: new and unexpected biological functions. Nature Reviews Cancer. 2014;14.

48. Yu H, Jove R. The STATs of cancer new molecular targets come of age. Nat Rev Cancer Nature Reviews Cancer. 2004;4:97-105.

49. Barnes JM, Magee PN. Some toxic properties of dimethylnitrosamine. British journal of industrial medicine. 1954;11:167-74.

50. Goldfarb S, Pugh TD, Koen H, He YZ. Preneoplastic and neoplastic progression during hepatocarcinogenesis in mice injected with diethylnitrosamine in infancy. Environ Health Perspect. 1983 Apr;50:149-61.

51. Zhang CL, Zeng T, Zhao XL, Xie KQ. Garlic oil attenuated nitrosodiethylamine-induced hepatocarcinogenesis by modulating the metabolic activation and detoxification enzymes. International journal of biological sciences. 2013;9:237-45.

52. Magee PN, Lee KY. EXPERIMENTAL TOXIC LIVER INJURY BY SOME NITROSAMINES*. NYAS Annals of the New York Academy of Sciences. 1963;104:916-25.

53. Verna L, Whysner J, Williams GM. N-nitrosodiethylamine mechanistic data and risk assessment: bioactivation, DNA-adduct formation, mutagenicity, and tumor initiation. Pharmacology & therapeutics. 1996;71:1-2.

54. Lewis DF, Bird MG, Dickins M, Lake BG, Eddershaw PJ, Tarbit MH, Goldfarb PS. Molecular modelling of human CYP2E1 by homology with the CYP102 haemoprotein domain: investigation of the interactions of substrates and inhibitors within the putative active site of the human CYP2E1 isoform. Xenobiotica; the fate of foreign compounds in biological systems. 2000;30:1-25.

55. Kang JS, Wanibuchi H, Morimura K, Gonzalez FJ, Fukushima S. Role of CYP2E1 in diethylnitrosamine-induced hepatocarcinogenesis in vivo. Cancer research. 2007;67:11141-6.

56. Camus A-M, Geneste O, Honkakoski P, BÃ©rÃ©ziat J-C, Henderson CJ, Wolf RC, Bartsch H, Lang MA. High variability of nitrosamine metabolism among individuals: Role of cytochromes P450 2A6 and 2E1 in the dealkylation of N-nitrosodimethylamine and N-nitrosodiethylamine in mice and humans. MC Molecular Carcinogenesis. 1993;7:268-75.

57. Chung MY, Mah E, Masterjohn C, Noh SK, Park HJ, Clark RM, Park YK, Lee JY, Bruno RS. Green Tea Lowers Hepatic COX-2 and Prostaglandin E2 in Rats with Dietary Fat-Induced Nonalcoholic Steatohepatitis. J Med Food. 2015 Jun;18:648-55.

58. Heindryckx F, Colle I, Van Vlierberghe H. Experimental mouse models for hepatocellular carcinoma research. Int J Exp Pathol. 2009 Aug;90:367-86.

59. Buchmann A, Bauer-Hofmann R, Mahr J, Drinkwater NR, Luz A, Schwarz M. Mutational activation of the c-Ha-ras gene in liver tumors of different rodent strains: correlation with susceptibility to hepatocarcinogenesis. Proc Natl Acad Sci U S A. 1991 Feb 01;88:911-5.

60. Rajalingam K, Schreck R, Rapp UR, Albert S. Ras oncogenes and their downstream targets. Biochim Biophys Acta. 2007 Aug;1773:1177-95.

61. Drinkwater NR, Ginsler JJ. Genetic control of hepatocarcinogenesis in C57BL/6J and C3H/HeJ inbred mice. Carcinogenesis. 1986 Oct;7:1701-7.

62. Bird AP, Wolffe AP. Methylation-induced repression--belts, braces, and chromatin. Cell. 1999 Nov 24;99:451-4.

63. Vesselinovitch SD, Mihailovich N. Kinetics of diethylnitrosamine hepatocarcinogenesis in the infant mouse. Cancer Res. 1983 Sep;43:4253-9.

64. Nakatani T, Roy G, Fujimoto N, Asahara T, Ito A. Sex hormone dependency of diethylnitrosamine-induced liver tumors in mice and chemoprevention by leuprorelin. Jpn J Cancer Res. 2001 Mar;92:249-56.

65. Shiota G, Harada K, Ishida M, Tomie Y, Okubo M, Katayama S, Ito H, Kawasaki H. Inhibition of hepatocellular carcinoma by glycyrrhizin in diethylnitrosamine-treated mice. Carcinogenesis. 1999 Jan;20:59-63.

66. Hacker HJ, Mtiro H, Bannasch P, Vesselinovitch SD. Histochemical profile of mouse hepatocellular adenomas and carcinomas induced by a single dose of diethylnitrosamine. Cancer Res. 1991 Apr 01;51:1952-8.

67. Frey S, Buchmann A, Bursch W, Schulte-Hermann R, Schwarz M. Suppression of apoptosis in C3H mouse liver tumors by activated Ha-ras oncogene. Carcinogenesis. 2000 Feb;21:161-6.

68. Chen B, Liu L, Castonguay A, Maronpot RR, Anderson MW, You M. Dose- dependent ras mutation spectra in N-nitrosodiethylamine induced mouse liver tumors and 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone induced mouse lung tumors. Carcinogenesis. 1993 Aug;14:1603-8.

69. Finnberg N, Stenius U, Hogberg J. Heterozygous p53-deficient (+/-) mice develop fewer p53-negative preneoplastic focal liver lesions in response to treatment with diethylnitrosamine than do wild-type (+/+) mice. Cancer Lett. 2004 Apr 30;207:149-55.

70. Ip BC, Hu KQ, Liu C, Smith DE, Obin MS, Ausman LM, Wang XD. Lycopene metabolite, apo-10'-lycopenoic acid, inhibits diethylnitrosamine- initiated, high fat diet-promoted hepatic inflammation and tumorigenesis in mice. Cancer Prev Res (Phila). 2013 Dec;6:1304-16.

71. Ohno T, Shimizu M, Shirakami Y, Baba A, Kochi T, Kubota M, Tsurumi H, Tanaka T, Moriwaki H. Metformin suppresses diethylnitrosamine-induced liver tumorigenesis in obese and diabetic C57BL/KsJ-+Leprdb/+Leprdb mice. PLoS One. 2015;10:e0124081.

72. Kishida N, Matsuda S, Itano O, Shinoda M, Kitago M, Yagi H, Abe Y, Hibi T, Masugi Y, et al. Development of a novel mouse model of hepatocellular carcinoma with nonalcoholic steatohepatitis using a high-fat, choline-deficient diet and intraperitoneal injection of diethylnitrosamine. BMC Gastroenterol. 2016;16:61.

73. Raubenheimer PJ, Nyirenda MJ, Walker BR. A choline-deficient diet exacerbates fatty liver but attenuates insulin resistance and glucose intolerance in mice fed a high-fat diet. Diabetes. 2006 Jul;55:2015-20.

74. Shirakami Y, Gottesman ME, Blaner WS. Diethylnitrosamine-induced hepatocarcinogenesis is suppressed in lecithin:retinol acyltransferase-deficient mice primarily through retinoid actions immediately after carcinogen administration. Carcinogenesis. 2012 Feb;33:268-74.

75. Lee GH. Paradoxical effects of phenobarbital on mouse hepatocarcinogenesis. Toxicol Pathol. 2000 Mar-Apr;28:215-25.

76. Hoshida Y, Fuchs BC, Tanabe KK. Prevention of hepatocellular carcinoma: potential targets, experimental models, and clinical challenges. Curr Cancer Drug Targets. 2012 Nov 1;12:1129-59.

77. Balentine DA, Wiseman SA, Bouwens LC. The chemistry of tea flavonoids. Crit Rev Food Sci Nutr. 1997 Dec;37:693-704.

78. Del Rio D, Calani L, Cordero C, Salvatore S, Pellegrini N, Brighenti F. Bioavailability and catabolism of green tea flavan-3-ols in humans. Nutrition. 2010 Nov-Dec;26:1110-6.

79. Hilal. Characterisation of white tea – Comparison to green and black tea | SpringerLink. ournal für Verbraucherschutz und Lebensmittelsicherheit. 2007;2:414-21.

80. Cabrera C, Artacho R, Gimenez R. Beneficial effects of green tea--a review. J Am Coll Nutr. 2006 Apr;25:79-99.

81. Ui A, Kuriyama S, Kakizaki M, Sone T, Nakaya N, Ohmori-Matsuda K, Hozawa A, Nishino Y, Tsuji I. Green tea consumption and the risk of liver cancer in Japan: the Ohsaki Cohort study. Cancer Causes Control. 2009 Dec;20:1939- 45.

82. Imai K, Nakachi K. Cross sectional study of effects of drinking green tea on cardiovascular and liver diseases. BMJ (Clinical research ed). 1995;310:693-6.

83. Li J, Sapper TN, Mah E, Rudraiah S, Schill KE, Chitchumroonchokchai C, Moller MV, McDonald JD, Rohrer PR, et al. Green tea extract provides extensive Nrf2-independent protection against lipid accumulation and NFB pro- inflammatory responses during nonalcoholic steatohepatitis in mice fed a high-fat diet. Molecular nutrition & food research. 2016;60:858-70.

84. Chung MY, Park HJ, Manautou JE, Koo SI, Bruno RS. Green tea extract protects against nonalcoholic steatohepatitis in ob/ob mice by decreasing oxidative and nitrative stress responses induced by proinflammatory enzymes. J Nutr Biochem. 2012 Apr;23:361-7.

85. Park HJ, Lee JY, Chung MY, Park YK, Bower AM, Koo SI, Giardina C, Bruno RS. Green tea extract suppresses NFkappaB activation and inflammatory responses in diet-induced obese rats with nonalcoholic steatohepatitis. J Nutr. 2012 Jan;142:57-63.

86. Hong Byun E, Fujimura Y, Yamada K, Tachibana H. TLR4 signaling inhibitory pathway induced by green tea polyphenol epigallocatechin-3-gallate through 67-kDa laminin receptor. Journal of immunology (Baltimore, Md : 1950). 2010;185:33-45.

87. Byun E-H, Omura T, Yamada K, Tachibana H. Green tea polyphenol epigallocatechin-3-gallate inhibits TLR2 signaling induced by peptidoglycan through the polyphenol sensing molecule 67-kDa laminin receptor. FEB2 FEBS Letters. 2011;585:814-20.

88. Chen X, Sun CK, Han GZ, Peng JY, Li Y, Liu YX, Lv YY, Liu KX, Zhou Q, Sun HJ. Protective effect of tea polyphenols against paracetamol-induced hepatotoxicity in mice is significanly correlated with cytochrome P450 suppression. World J Gastroenterol World Journal of Gastroenterology. 2009;15:1829-35.

89. Bruno RS, Dugan CE, Smyth JA, DiNatale DA, Koo SI. Green tea extract protects leptin-deficient, spontaneously obese mice from hepatic steatosis and injury. J Nutr. 2008 Feb;138:323-31.

90. Kushida M, Kamendulis LM, Peat TJ, Klaunig JE. Dose-related induction of hepatic preneoplastic lesions by diethylnitrosamine in C57BL/6 mice. Toxicol Pathol. 2011 Aug;39:776-86.

91. Brunt EM, Kleiner DE, Wilson LA, Belt P, Neuschwander-Tetri BA. Nonalcoholic fatty liver disease (NAFLD) activity score and the histopathologic diagnosis in NAFLD: distinct clinicopathologic meanings. Hepatology. 2011 Mar;53:810-20.

92. Kleiner DE, Brunt EM, Van Natta M, Behling C, Contos MJ, Cummings OW, Ferrell LD, Liu YC, Torbenson MS, et al. Design and validation of a histological scoring system for nonalcoholic fatty liver disease. Hepatology. 2005 Jun;41:1313-21.

93. Requena JR, Fu MX, Ahmed MU, Jenkins AJ, Lyons TJ, Thorpe SR. Lipoxidation products as biomarkers of oxidative damage to proteins during lipid peroxidation reactions. Nephrol Dial Transplant. 1996;11 Suppl 5:48-53.

94. Pahl HL. Activators and target genes of Rel/NF-kappaB transcription factors. Oncogene. 1999 Nov 22;18:6853-66.

95. Carpenter RL, Lo HW. STAT3 Target Genes Relevant to Human Cancers. Cancers (Basel). 2014 Apr 16;6:897-925.

96. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001 Dec;25:402-8.

97. Nakagawa H. Recent advances in mouse models of obesity- and nonalcoholic steatohepatitis-associated hepatocarcinogenesis. World J Hepatol. 2015 Aug 18;7:2110-8.

98. Chen YJ, Wallig MA, Jeffery EH. Dietary Broccoli Lessens Development of Fatty Liver and Liver Cancer in Mice Given Diethylnitrosamine and Fed a Western or Control Diet. J Nutr. 2016 Mar;146:542-50.

99. Duan XY, Pan Q, Yan SY, Ding WJ, Fan JG, Qiao L. High-saturate-fat diet delays initiation of diethylnitrosamine-induced hepatocellular carcinoma. BMC Gastroenterol. 2014 Nov 20;14:195.

100. Shimizu M, Sakai H, Shirakami Y, Yasuda Y, Kubota M, Terakura D, Baba A, Ohno T, Hara Y, et al. Preventive effects of (-)-epigallocatechin gallate on diethylnitrosamine-induced liver tumorigenesis in obese and diabetic C57BL/KsJ- db/db Mice. Cancer prevention research (Philadelphia, Pa). 2011;4:396-403.

101. Ishizaki S, Nishiyama M, Hagiwara A. Long-term Branched Chain Amino Acid Supplementation Ameliorates Diethylnitrosamine-induced Liver Glutathione S-transferase-p Positivity in Zucker Fatty Rats. J Clin Exp Hepatol; 2013. p. 192- 7.

102. Sirianni SR, Huang CC. Comparison of S9 fractions from rats, mice, and Chinese hamsters to metabolize dimethylnitrosamine and diethylnitrosamine to intermediates that induce sister-chromatid exchanges in V79 cells. Mutat Res. 1987 May;188:7-11.

103. Tahmasebi Birgani M, Carloni V. Tumor Microenvironment, a Paradigm in Hepatocellular Carcinoma Progression and Therapy. Int J Mol Sci. 2017 Feb 14;18.

104. Maronpot RR. Biological Basis of Differential Susceptibility to Hepatocarcinogenesis among Mouse Strains*. J Toxicol Pathol; 2009. p. 11-33.

105. Donato MF, Arosio E, Del Ninno E, Ronchi G, Lampertico P, Morabito A, Balestrieri MR, Colombo M. High rates of hepatocellular carcinoma in cirrhotic patients with high liver cell proliferative activity. Hepatology. 2001 Sep;34:523-8.

106. Thompson KJ, Swan RZ, Walling TL, Iannitti DA, McKillop IH, Sindram D. Obesity, but not ethanol, promotes tumor incidence and progression in a mouse model of hepatocellular carcinoma in vivo. Surg Endosc. 2013 Aug;27:2782-91.

107. Chen Y, Wang X, Wang J, Yan Z, Luo J. Excess body weight and the risk of primary liver cancer: an updated meta-analysis of prospective studies. Eur J Cancer. 2012 Sep;48:2137-45.

108. Caldwell SH, Crespo DM, Kang HS, Al-Osaimi AM. Obesity and hepatocellular carcinoma. Gastroenterology. 2004 Nov;127:S97-103.

109. Sumi T, Shirakami Y, Shimizu M, Kochi T, Ohno T, Kubota M, Shiraki M, Tsurumi H, Tanaka T, Moriwaki H. (-)-Epigallocatechin-3-gallate suppresses hepatic preneoplastic lesions developed in a novel rat model of non-alcoholic steatohepatitis. Springerplus. 2013;2.

110. Bose M, Lambert JD, Ju J, Reuhl KR, Shapses SA, Yang CS. The major green tea polyphenol, (-)-epigallocatechin-3-gallate, inhibits obesity, metabolic syndrome, and fatty liver disease in high-fat-fed mice. The Journal of nutrition. 2008;138:1677-83.

111. Ohno T, Shimizu M, Shirakami Y, Miyazaki T, Ideta T, Kochi T, Kubota M, Sakai H, Tanaka T, Moriwaki H. Preventive effects of astaxanthin on diethylnitrosamine-induced liver tumorigenesis in C57/BL/KsJ-db/db obese mice. Hepatol Res. 2016 Mar;46:E201-9.

112. Juhel C, Armand M, Pafumi Y, Rosier C, Vandermander J, Lairon D. Green tea extract (AR25) inhibits lipolysis of triglycerides in gastric and duodenal medium in vitro. J Nutr Biochem. 2000 Jan;11:45-51.

113. Wang S, Noh SK, Koo SI. Green tea catechins inhibit pancreatic phospholipase A(2) and intestinal absorption of lipids in ovariectomized rats. J Nutr Biochem. 2006 Jul;17:492-8.

114. Shishikura Y, Khokhar S, Murray BS. Effects of tea polyphenols on emulsification of olive oil in a small intestine model system. J Agric Food Chem. 2006 Mar 08;54:1906-13.

115. Maeda S, Kamata H, Luo JL, Leffert H, Karin M. IKKbeta couples hepatocyte death to cytokine-driven compensatory proliferation that promotes chemical hepatocarcinogenesis. Cell. 2005 Jul 01;121:977-90.

116. Dyroff MC, Richardson FC, Popp JA, Bedell MA, Swenberg JA. Correlation of O4-ethyldeoxythymidine accumulation, hepatic initiation and hepatocellular carcinoma induction in rats continuously administered diethylnitrosamine. Carcinogenesis. 1986 Feb;7:241-6.

117. Ishiguro S, Inoue M, Tanaka Y, Mizokami M, Iwasaki M, Tsugane S. Serum aminotransferase level and the risk of hepatocellular carcinoma: a population-based cohort study in Japan. Eur J Cancer Prev. 2009 Feb;18:26-32.

118. Baffy G, Brunt EM, Caldwell SH. Hepatocellular carcinoma in nonalcoholic fatty liver disease: an emerging menace. J Hepatol. 2012 Jun;56:1384- 91.

119. Mannervik B, Alin P, Guthenberg C, Jensson H, Tahir MK, Warholm M, Jörnvall H. Identification of three classes of cytosolic glutathione transferase common to several mammalian species: correlation between structural data and enzymatic properties. Proc Natl Acad Sci U S A. 1985 Nov;82:7202-6.

120. Tsuda H, Fukushima S, Wanibuchi H, Morimura K, Nakae D, Imaida K, Tatematsu M, Hirose M, Wakabayashi K, Moore MA. Value of GST-P positive preneoplastic hepatic foci in dose-response studies of hepatocarcinogenesis: evidence for practical thresholds with both genotoxic and nongenotoxic carcinogens. A review of recent work. Toxicol Pathol. 2003 Jan-Feb;31:80-6.

121. Jancova P, Anzenbacher P, Anzenbacherova E. Phase II drug metabolizing enzymes. Biomed Pap Med Fac Univ Palacky Olomouc Czech Repub. 2010 Jun;154:103-16.

122. Alin P, Danielson UH, Mannervik B. 4-Hydroxyalk-2-enals are substrates for glutathione transferase. FEBS Lett. 1985 Jan 07;179:267-70.

123. Ritchie KJ, Henderson CJ, Wang XJ, Vassieva O, Carrie D, Farmer PB, Gaskell M, Park K, Wolf CR. Glutathione transferase pi plays a critical role in the development of lung carcinogenesis following exposure to tobacco-related carcinogens and urethane. Cancer Res. 2007 Oct 01;67:9248-57.

124. Chow HH, Hakim IA, Vining DR, Crowell JA, Tome ME, Ranger-Moore J, Cordova CA, Mikhael DM, Briehl MM, Alberts DS. Modulation of human glutathione s-transferases by polyphenon e intervention. Cancer Epidemiol Biomarkers Prev. 2007 Aug;16:1662-6.

125. Kirpich IA, Gobejishvili LN, Bon Homme M, Waigel S, Cave M, Arteel G, Barve SS, McClain CJ, Deaciuc IV. Integrated hepatic transcriptome and proteome analysis of mice with high-fat diet-induced nonalcoholic fatty liver disease. J Nutr Biochem. 2011 Jan;22:38-45.

126. Park HJ, DiNatale DA, Chung MY, Park YK, Lee JY, Koo SI, O'Connor M, Manautou JE, Bruno RS. Green tea extract attenuates hepatic steatosis by decreasing adipose lipogenesis and enhancing hepatic antioxidant defenses in ob/ob mice. J Nutr Biochem. 2011 Apr;22:393-400.

127. Pandey M, Shukla S, Gupta S. Promoter demethylation and chromatin remodeling by green tea polyphenols leads to re-expression of GSTP1 in human prostate cancer cells. Int J Cancer. 2010 Jun 01;126:2520-33.

128. Bartolini D, Commodi J, Piroddi M, Incipini L, Sancineto L, Santi C, Galli F. Glutathione S-transferase pi expression regulates the Nrf2-dependent response to hormetic diselenides. Free Radic Biol Med. 2015 Nov;88:466-80.

129. Kamada K, Goto S, Okunaga T, Ihara Y, Tsuji K, Kawai Y, Uchida K, Osawa T, Matsuo T, et al. Nuclear glutathione S-transferase pi prevents apoptosis by reducing the oxidative stress-induced formation of exocyclic DNA products. Free Radic Biol Med. 2004 Dec 01;37:1875-84.

130. Schneider C, Teufel A, Yevsa T, Staib F, Hohmeyer A, Walenda G, Zimmermann HW, Vucur M, Huss S, et al. Adaptive immunity suppresses formation and progression of diethylnitrosamine-induced liver cancer. Gut. 2012 Dec;61:1733-43.

131. Yi X, Long L, Yang C, Lu Y, Cheng M. Maotai Ameliorates Diethylnitrosamine-Initiated Hepatocellular Carcinoma Formation in Mice. PLoS One; 2014.

132. Rahman MA, Dhar DK, Yamaguchi E, Maruyama S, Sato T, Hayashi H, Ono T, Yamanoi A, Kohno H, Nagasue N. Coexpression of inducible nitric oxide synthase and COX-2 in hepatocellular carcinoma and surrounding liver: possible involvement of COX-2 in the angiogenesis of hepatitis C virus-positive cases. Clin Cancer Res. 2001 May;7:1325-32.

133. Calvisi DF, Pinna F, Ladu S, Pellegrino R, Muroni MR, Simile MM, Frau M, Tomasi ML, De Miglio MR, et al. Aberrant iNOS signaling is under genetic control in rodent liver cancer and potentially prognostic for the human disease. Carcinogenesis. 2008 Aug;29:1639-47.

134. Ikeguchi M, Ueta T, Yamane Y, Hirooka Y, Kaibara N. Inducible nitric oxide synthase and survivin messenger RNA expression in hepatocellular carcinoma. Clin Cancer Res. 2002 Oct;8:3131-6.

135. Radi R, Beckman JS, Bush KM, Freeman BA. Peroxynitrite oxidation of sulfhydryls. The cytotoxic potential of superoxide and nitric oxide. J Biol Chem. 1991 Mar 05;266:4244-50.

136. Blough NV, Zafiriou OC. Reaction of superoxide with nitric oxide to form peroxonitrite in alkaline aqueous solution. Inorganic Chemistry. 1985 May 1, 2002;24:3502-4.

137. Shimizu M, Deguchi A, Lim JT, Moriwaki H, Kopelovich L, Weinstein IB. (- )-Epigallocatechin gallate and polyphenon E inhibit growth and activation of the epidermal growth factor receptor and human epidermal growth factor receptor-2 signaling pathways in human colon cancer cells. Clin Cancer Res. 2005 Apr 01;11:2735-46.

138. Harada K, Shiota G, Kawasaki H. Transforming growth factor-alpha and epidermal growth factor receptor in chronic liver disease and hepatocellular carcinoma. Liver. 1999 Aug;19:318-25.

139. Schiffer E, Housset C, Cacheux W, Wendum D, Desbois-Mouthon C, Rey C, Clergue F, Poupon R, Barbu V, Rosmorduc O. Gefitinib, an EGFR inhibitor, prevents hepatocellular carcinoma development in the rat liver with cirrhosis. Hepatology. 2005 Feb;41:307-14.

140. Meves A, Stock SN, Beyerle A, Pittelkow MR, Peus D. H(2)O(2) mediates oxidative stress-induced epidermal growth factor receptor phosphorylation. Toxicol Lett. 2001 Jul 06;122:205-14.

141. Carr BI, Roitman A, Hwang DL, Barseghian G, Lev-Ran A. Effects of diethylnitrosamine on hepatic receptor binding and autophosphorylation of epidermal growth factor and insulin in rats. J Natl Cancer Inst. 1986 Jul;77:219- 25.

142. Lo HW, Hsu SC, Ali-Seyed M, Gunduz M, Xia W, Wei Y, Bartholomeusz G, Shih JY, Hung MC. Nuclear interaction of EGFR and STAT3 in the activation of the iNOS/NO pathway. Cancer Cell. 2005 Jun;7:575-89.

143. Sah JF, Balasubramanian S, Eckert RL, Rorke EA. Epigallocatechin-3- gallate inhibits epidermal growth factor receptor signaling pathway. Evidence for direct inhibition of ERK1/2 and AKT kinases. J Biol Chem. 2004 Mar 26;279:12755-62.

144. Matsuda M, Nakamoto Y, Suzuki S, Kurata T, Kaneko S. Interferon- gamma-mediated hepatocarcinogenesis in mice treated with diethylnitrosamine. Lab Invest. 2005 May;85:655-63.

145. Leong H, Mathur PS, Greene GL. Green tea catechins inhibit angiogenesis through suppression of STAT3 activation. Breast Cancer Res Treat. 2009 Oct;117:505-15.

146. Masuda M, Suzui M, Lim JT, Deguchi A, Soh JW, Weinstein IB. Epigallocatechin-3-gallate decreases VEGF production in head and neck and breast carcinoma cells by inhibiting EGFR-related pathways of signal transduction. J Exp Ther Oncol. 2002 Nov-Dec;2:350-9.

147. Chin JL, Pavlides M, Moolla A, Ryan JD. Non-invasive Markers of Liver Fibrosis: Adjuncts or Alternatives to Liver Biopsy? Front Pharmacol. 2016;7.

148. Iwasa J, Shimizu M, Shiraki M, Shirakami Y, Sakai H, Terakura Y, Takai K, Tsurumi H, Tanaka T, Moriwaki H. Dietary supplementation with branched-chain amino acids suppresses diethylnitrosamine-induced liver tumorigenesis in obese and diabetic C57BL/KsJ-db/db mice. Cancer Sci. 2010 Feb;101:460-7.

149. Fuchs BC, Hoshida Y, Fujii T, Wei L, Yamada S, Lauwers GY, McGinn CM, DePeralta DK, Chen X, et al. Epidermal growth factor receptor inhibition attenuates liver fibrosis and development of hepatocellular carcinoma. Hepatology. 2014 Apr;59:1577-90.

150. O'Connor DS, Grossman D, Plescia J, Li F, Zhang H, Villa A, Tognin S, Marchisio PC, Altieri DC. Regulation of apoptosis at cell division by p34cdc2 phosphorylation of survivin. Proc Natl Acad Sci U S A. 2000 Nov 21;97:13103-7.

151. Altieri DC. Validating survivin as a cancer therapeutic target. Nat Rev Cancer. 2003 Jan;3:46-54.

152. Shaulian E, Karin M. AP-1 as a regulator of cell life and death. Nat Cell Biol. 2002 May;4:E131-6.

153. Yuen MF, Wu PC, Lai VC, Lau JY, Lai CL. Expression of c-Myc, c-Fos, and c-jun in hepatocellular carcinoma. Cancer. 2001 Jan 01;91:106-12.

154. Bakiri L, Hamacher R, Grana O, Guio-Carrion A, Campos-Olivas R, Martinez L, Dienes HP, Thomsen MK, Hasenfuss SC, Wagner EF. Liver carcinogenesis by FOS-dependent inflammation and cholesterol dysregulation. J Exp Med. 2017 May 01;214:1387-409.

155. Giri RK, Das BR. Differential expression of c-jun and c-myc in N-nitroso diethylamine-induced hepatic oncogenesis in AKR mice. Cancer Lett. 1996 Dec 03;109:121-7.

156. Deguchi T, Pitot HC. Expression of c-myc in altered hepatic foci induced in rats by various single doses of diethylnitrosamine and promotion by 0.05% phenobarbital. Mol Carcinog. 1995 Nov;14:152-9.

157. Dong Z, Ma W, Huang C, Yang CS. Inhibition of tumor promoter-induced activator protein 1 activation and cell transformation by tea polyphenols, (-)- epigallocatechin gallate, and theaflavins. Cancer Res. 1997 Oct 01;57:4414-9.

158. Min L, Ji Y, Bakiri L, Qiu Z, Cen J, Chen X, Chen L, Scheuch H, Zheng H, et al. Liver cancer initiation is controlled by AP-1 through SIRT6-dependent inhibition of survivin. Nat Cell Biol. 2012 Nov;14:1203-11.

159. Asanuma H, Torigoe T, Kamiguchi K, Hirohashi Y, Ohmura T, Hirata K, Sato M, Sato N. Survivin expression is regulated by coexpression of human epidermal growth factor receptor 2 and epidermal growth factor receptor via phosphatidylinositol 3-kinase/AKT signaling pathway in breast cancer cells. Cancer Res. 2005 Dec 01;65:11018-25.

160. Kelman Z. PCNA: structure, functions and interactions. Oncogene. 1997 Feb 13;14:629-40.

161. Leslie K, Lang C, Devgan G, Azare J, Berishaj M, Gerald W, Kim YB, Paz K, Darnell JE, et al. Cyclin D1 is transcriptionally regulated by and required for transformation by activated signal transducer and activator of transcription 3. Cancer Res. 2006 Mar 01;66:2544-52.

162. Starkel P, Saeger CD, Leclercq I, Horsmans Y. Role of signal transducer and activator of transcription 3 in liver fibrosis progression in chronic hepatitis C- infected patients. Lab Invest. 2007 Feb;87:173-81.

163. Shimizu M, Shirakami Y, Sakai H, Kubota M, Kochi T, Ideta T, Miyazaki T, Moriwaki H. Chemopreventive Potential of Green Tea Catechins in Hepatocellular Carcinoma. Int J Mol Sci. 2015;16:6124-39.

164. Ip BC, Liu C, Smith DE, Ausman LM, Wang XD. High-refined- carbohydrate and high-fat diets induce comparable hepatic tumorigenesis in male mice. J Nutr. 2014 May;144:647-53.

165. Ho JL, Wisneski HH, Yates RL. High pressure liquid chromatographic- thermal energy determination of N-nitrosodiethanolamine in cosmetics. J Assoc Off Anal Chem. 1981 Jul;64:800-4.

166. Scanlan RA. Formation and occurrence of nitrosamines in food. Cancer Res. 1983 May;43:2435s-40s.

167. Zhao X, Ogunwobi OO, Liu C. Survivin Inhibition Is Critical for Bcl-2 Inhibitor-Induced Apoptosis in Hepatocellular Carcinoma Cells. PLoS One. 2011;6.

168. Bode AM, Dong Z. Epigallocatechin 3-Gallate and Green Tea Catechins: United They Work, Divided They Fail. Cancer Prev Res (Phila). 2009 Jun;2:514-7.