Impaired Homeostasis and Phenotypic Abnormalities in Prdx6à/Àmice Lens Epithelial Cells by Reactive Oxygen Species: Increased Expression and Activation of Tgfb

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Cell Death and Differentiation (2005) 12, 734–750 & 2005 Nature Publishing Group All rights reserved 1350-9047/05 $30.00 www.nature.com/cdd Impaired homeostasis and phenotypic abnormalities in Prdx6À/Àmice lens epithelial cells by reactive oxygen species: increased expression and activation of TGFb N Fatma1, E Kubo2, P Sharma1, DR Beier3 and DP Singh*,1 Introduction 1 Department of Ophthalmology, University of Nebraska Medical Center, Reactive oxygen species (ROS) and organic free radicals are Omaha, NE 68198, USA essential metabolic intermediates with important regulatory 2 Department of Ophthalmology, University of Fukui, Fukui, Japan functions. Overproduction of these reactive metabolites or 3 Division of Genetics, Brigham and Women’s Hospital, Harvard Medical School, ROS is implicated in the etiology of a host of degenerative Boston, MA, USA diseases,1 including age-related cataractogenesis. Of the * Corresponding author: DP Singh, Department Ophthalmology, University of various types of oxidative damage, apoptosis, loss of homeo- Nebraska Medical Center, 985540 Nebraska Medical Center, Omaha, NE 68198-5840, USA. Tel: þ 1 402 559 8805; Fax: þ 1 402 559 8808; stasis, and abnormal phenotypic changes are major con- E-mail: [email protected]. tributors to injury. Thus, strict regulation of ROS is vital to maintain cellular integrity and homeostasis. Antioxidants play Received 20.8.04; revised 28.12.04; accepted 14.1.05; published online 01.4.05 a major role in this regard by limiting the overproduction of Edited by S Roy radicals generated by the metabolism or cells under environ- mental stress. The major defense enzymes reported to date are superoxide dismutase (SOD), which converts superoxide radicals to hydrogen peroxide (H2O2), catalase (CAT), Abstract selenium (SE)-dependent glutathione peroxidase (GSHPx), PRDX6, a member of the peroxiredoxins (PRDXs) family, is a glutathione-S-transferase (GST), and the recently defined 2,3 key player in the removal of reactive oxygen species (ROS). rapidly growing family of peroxiredoxins (PRDXs) . These Using targeted inactivation of the Prdx6 gene, we present enzymes reduce peroxides to the corresponding alcohol or water.4–8 The PRDX family displays special features, com- evidence that the corresponding protein offsets the deleter- pared with other existing peroxidases. Specifically, when ious effects of ROS on lens epithelial cells (LECs) and reducing H2O2, PRDX enzymes themselves are oxidized, regulates gene expression by limiting its levels. PRDX6- therefore acting both as peroxidase and co-substrate.9 depleted LECs displayed phenotypic alterations and elevated Recent studies have shown that the active site cysteine of a-smooth muscle actin and big-h3 expression (markers for PRDXs is selectively oxidized to cysteine sulfinic acid, leading cataractogenesis), indistinguishable from transforming to inactivation of peroxidase activity, and the sulfinic form of growth factor b (TGFb)-induced changes. Biochemical assays PRDX is rapidly reduced to the catalytically active thiol disclosed enhanced levels of ROS, as well as high expression form.10,11 It appears that the cell’s ability to reduce protein and activation of TGFb1inPrdx6À/À LECs. A CAT assay sulfinic acid serves as a mechanism to repair damaged revealed transcriptional repression of lens epithelium-derived proteins or represents a new type of cyclic modification growth factor (LEDGF), HSP27, and aB-crystallin promoter regulating the functions of various proteins. PRDXs, thiol-containing peroxidases, are conserved from activities in these cells. A gel mobility shift assay demon- bacteria to mammals.10,12 There are six subgroups of PRDX strated the attenuation of LEDGF binding to heat shock or enzymes (PRDX1–6) in mammals.12–14 These enzymes use stress response elements present in these genes. A supply of redox-active cysteines to reduce peroxides, and are divided À/À PRDX6 toPrdx6 LECs reversed these changes. Based on into two categories, 1-Cys and 2-Cys, based on the number of the above data, we propose a rheostat role for PRDX6 in cysteinyl residues directly involved in catalysis3. The per- regulating gene expression by controlling the ROS level to oxidase reaction is composed of two steps centered around a maintain cellular homeostasis. redox-active cysteine designated ‘peroxidatic cysteine’.15,16 Cell Death and Differentiation (2005) 12, 734–750. The 1-Cys PRDX contains only the peroxidatic cysteine, and 16 doi:10.1038/sj.cdd.4401597 not a resolving cysteine. Based on the presence of one Published online 1 April 2005 conserved redox-active cysteine in the NH2 terminus of PRDX6 (C-47), previously known as antioxidant protein 2 2,3,17–20 Keywords: reactive oxygen species; phenotypic changes; (AOP2) in contrast to two conserved cysteine residues TGFb; LEDGF; apoptosis; oxidative stress; PRDX6; AOP2 in the rest of the PRDX family, the Mouse Genomic Nomenclature Committee (MGNC) and Human Gene No- Abbreviations: AOP2, antioxidant protein 2; LEDGF, lens menclature Committee (HGNC) put this molecule under epithelium-derived growth factor; PRDX, peroxiredoxin; ROS, subgroup 6, now known as PRDX6.12 reactive oxygen species; SDS-PAGE, sodium dodecyl H2O2, a source of oxidative stress, has gained attention sulfate polyacrylamide gel electrophoresis; TGFb, transforming recently due to its role as a cellular signaling factor for various growth factor b; TIE, transforming growth factor b inhibitory cytokines and growth factors, including platelet-derived element growth factor (PDGF), insulin-like growth factor (IGF), Regulatory function of Peroxiredoxin 6 N Fatma et al 735 endothelial-derived growth factor (EGF), tumor necrosis cataractogenesis. PRDX6 abolishes ROS-mediated deleter- factor a (TNF-a), and transforming growth factor b (TGFb). ious effects in LECs, and may therefore have signi- The generation of ROS by these molecules is associated with ficant potential to postpone age-associated degenerative the activation or deactivation and modulation of expression of disorders. several anti-death transcription factors, including lens epi- thelium-derived growth factor (LEDGF).21,22 LEDGF is a survival factor that acts as a transcriptional factor17,23–25 by activating heat shock element (HSE; nGAAn) and a stress- Results related element (STRE; T/AGGGGA/T).17,25,26 Cells over- expressing LEDGF contain elevated levels of PRDX6 protein PRDX6 is highly expressed in murine ocular and mRNA, and survive longer under oxidative and heat lenses, and Prdx6À/À mice lenses display higher stress conditions.17 susceptibility to oxidative stress and abnormal Moreover, earlier studies have demonstrated that TGFb migration of LECs plays a regulatory role in gene transcription, and some genes We reported earlier that PRDX6 is present in ocular lens and comprise TGFb inhibitory elements (TIE).27,28 Our experi- removes intra- and extracellular H O .17 According to a recent ments establish the presence of TIE in the LEDGF promo- 2 2 classification, the PRDX family is comprised of six members ter.29 TGFb inhibits the gene transcription of LEDGF.29 TGFb (PRDX1–6). We initially examined all the members of the is present in ocular media, and various levels of activity have PRDX family in mice lens. PRDX5 and PRDX6 were been reported in the aqueous and vitreous forms in human expressed significantly. Real-time PCR data revealed higher and other species.30–33 Interestingly, an increased level of levels of PRDX6 (Figure 1A). This finding indicates that the H O in aqueous media is reported.34 However, further 2 2 expression of PRDXs may be tissue- or organ-specific. The investigation is required to understand the diverse biological function of PRDX6 appears pivotal, at least in lens, because effects of TGFb and ROS in the eye lens system. TGFb other PRDXs could not inhibit the changes of Prdx6À/À LECs. increases the ROS intracellular content in different cell types, To evaluate the potential roles of PRDX6 in reducing oxidative and some of its action may be mediated by oxidative stress. stress, acting as antioxidant defense, and in signaling, we Recent reports have demonstrated that TGFb increases ROS used Prdx6 knockout mice. Interestingly, lenses from PRDX6- by rapid downregulation of antioxidant genes.35–38 Evidence depleted mice exhibited significant susceptibility to oxidative shows that overexpression of PRDX6 reduces ROS gener- stress and opacity in the superficial cortex following exposure ated in response to growth factors.39,40 To determine the to H O (200 mM) for 44 h (Figure 1B). In addition, the potential role of PRDX6 in reducing oxidative stress and 2 2 histological sections of lenses isolated from Prdx6À/À mice acting as an antioxidant defense in vitro and in vivo, we utilized revealed abnormal cellular localization in the bow region and Prdx6 knockout mice. Cells derived from Prdx6 knockout mice thickening of capsule. Moreover, some epithelial cells were more susceptible to cellular damage, and showed migrated to the region posterior to the equator (Figure 1C, phenotypic changes. Our findings are in agreement with left panel). These findings signify the physiological importance several reports demonstrating the activation of TGFb as a of PRDX6 in lens. Since it is difficult to determine all the result of ROS elevation. 31,32,41,42 The most striking morpho- biochemical and molecular biological parameters in whole logical differences between Prdx6 þ / þ cells and Prdx6À/À lenses, we generated Prdx6À/À LEC lines to specifically cells are accounted for by expression pattern changes identify the roles of PRDX6. Notably, lenses/LECs isolated due to a single gene, Prdx6. The physiological conse- from Prdx6 þ / þ (heterozygous) mice were indistinguishable quences of Prdx6 knockout are notable. LEDGF and from those of wild-type animals. PRDX6 protein expression associated genes are suppressed, indicating that changes was comparable in lenses/LECs of both groups and a similar in lens epithelial cells (LECs) may be associated to dysfunc- finding has been reported by other groups.43 Accordingly, we tion of LEDGF. utilized wild-type mice and homozygous lenses/LECs In the present study, we examine the effects of PRDX6 on throughout the study.
Recommended publications
  • Oxidative Stress Modulates the Expression Pattern of Peroxiredoxin-6 in Peripheral Blood Mononuclear Cells of Asthmatic Patients and Bronchial Epithelial Cells

    Oxidative Stress Modulates the Expression Pattern of Peroxiredoxin-6 in Peripheral Blood Mononuclear Cells of Asthmatic Patients and Bronchial Epithelial Cells

    Allergy Asthma Immunol Res. 2020 May;12(3):523-536 https://doi.org/10.4168/aair.2020.12.3.523 pISSN 2092-7355·eISSN 2092-7363 Original Article Oxidative Stress Modulates the Expression Pattern of Peroxiredoxin-6 in Peripheral Blood Mononuclear Cells of Asthmatic Patients and Bronchial Epithelial Cells Hyun Jae Shim ,1 So-Young Park ,2 Hyouk-Soo Kwon ,1 Woo-Jung Song ,1 Tae-Bum Kim ,1 Keun-Ai Moon ,1 Jun-Pyo Choi ,1 Sin-Jeong Kim ,1 You Sook Cho 1* 1Division of Allergy and Clinical Immunology, Department of Internal Medicine, Asan Medical Center, University of Ulsan College of Medicine, Seoul, Korea 2Division of Pulmonary, Allergy and Critical Care Medicine, Department of Internal Medicine, Konkuk University Medical Center, Seoul, Korea Received: Jul 8, 2019 ABSTRACT Revised: Nov 29, 2019 Accepted: Dec 23, 2019 Purpose: Reduction-oxidation reaction homeostasis is vital for regulating inflammatory Correspondence to conditions and its dysregulation may affect the pathogenesis of chronic airway inflammatory You Sook Cho, MD, PhD diseases such as asthma. Peroxiredoxin-6, an important intracellular anti-oxidant molecule, Division of Allergy and Clinical Immunology, Department of Internal Medicine, Asan is reported to be highly expressed in the airways and lungs. The aim of this study was to Medical Center, University of Ulsan College of analyze the expression pattern of peroxiredoxin-6 in the peripheral blood mononuclear cells Medicine, 88 Olympic-ro 43-gil, Songpa-gu, (PBMCs) of asthmatic patients and in bronchial epithelial cells (BECs). Seoul 05505, Korea. Methods: The expression levels and modifications of peroxiredoxin-6 were evaluated in Tel: +82-2-3010-3285 PBMCs from 22 asthmatic patients.
  • SUPPLEMENTARY DATA Supplementary Figure 1. The

    SUPPLEMENTARY DATA Supplementary Figure 1. The

    SUPPLEMENTARY DATA Supplementary Figure 1. The results of Sirt1 activation in primary cultured TG cells using adenoviral system. GFP expression served as the control (n = 4 per group). Supplementary Figure 2. Two different Sirt1 activators, SRT1720 (0.5 µM or 1 µM ) and RSV (1µM or 10µM), induced the upregulation of Sirt1 in the primary cultured TG cells (n = 4 per group). ©2016 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db15-1283/-/DC1 SUPPLEMENTARY DATA Supplementary Table 1. Primers used in qPCR Gene Name Primer Sequences Product Size (bp) Sirt1 F: tgccatcatgaagccagaga 241 (NM_001159589) R: aacatcgcagtctccaagga NOX4 F: tgtgcctttattgtgcggag 172 (NM_001285833.1) R: gctgatacactggggcaatg Supplementary Table 2. Antibodies used in Western blot or Immunofluorescence Antibody Company Cat. No Isotype Dilution Sirt1 Santa Cruz * sc-15404 Rabbit IgG 1/200 NF200 Sigma** N5389 Mouse IgG 1/500 Tubulin R&D# MAB1195 Mouse IgG 1/500 NOX4 Abcam† Ab133303 Rabbit IgG 1/500 NOX2 Abcam Ab129068 Rabbit IgG 1/500 phospho-AKT CST‡ #4060 Rabbit IgG 1/500 EGFR CST #4267 Rabbit IgG 1/500 Ki67 Santa Cruz sc-7846 Goat IgG 1/500 * Santa Cruz Biotechnology, Santa Cruz, CA, USA ** Sigma aldrich, Shanghai, China # R&D Systems Inc, Minneapolis, MN, USA † Abcam, Inc., Cambridge, MA, USA ‡ Cell Signaling Technology, Inc., Danvers, MA, USA ©2016 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db15-1283/-/DC1 SUPPLEMENTARY DATA Supplementary
  • Role of Peroxiredoxin 6 in Human Melanoma

    Role of Peroxiredoxin 6 in Human Melanoma

    Role of Peroxiredoxin 6 in human melanoma Dissertation zur Erlangung des naturwissenschaftlichen Doktorgrades der Bayerischen Julius-Maximilians-Universität Würzburg vorgelegt von Alexandra Schmitt aus Würzburg Würzburg 2015 Eingereicht am:__________________________ Mitglieder der Promotionskommission: Vorsitzender:____________________________ Gutachter:______________________________ Gutachter:______________________________ Tag des Promotionskolloquiums:___________________ Doktorurkunde ausgehändigt am:___________________ Eidesstattliche Erklärung Gemäß §4, Abs. 3, Ziff. 3, 5 und 8 der Promotionsordnung der Fakultät für Biologie der Bayerischen Julius-Maximilians-Universität Würzburg Hiermit erkläre ich ehrenwörtlich, dass ich die vorliegende Dissertation selbständig angefertigt und keine anderen als die angegebenen Quellen und Hilfsmittel verwendet habe. Ich erkläre weiterhin, dass die vorliegende Dissertation weder in gleicher, noch in ähnlicher Form bereits in einem anderen Prüfungsverfahren vorgelegen hat. Weiterhin erkläre ich, dass ich außer den mit dem Zulassungsantrag urkundlich vorgelegten Graden keine weiteren akademischen Grade erworben oder zu erwerben versucht habe. Würzburg, Januar 2015 ______________________________________ Alexandra Schmitt Table of contents 1. Abstract ................................................................................................................. 1 2. Zusammenfassung ............................................................................................... 3 3. Introduction ..........................................................................................................
  • GPX4 at the Crossroads of Lipid Homeostasis and Ferroptosis Giovanni C

    GPX4 at the Crossroads of Lipid Homeostasis and Ferroptosis Giovanni C

    REVIEW GPX4 www.proteomics-journal.com GPX4 at the Crossroads of Lipid Homeostasis and Ferroptosis Giovanni C. Forcina and Scott J. Dixon* formation of toxic radicals (e.g., R-O•).[5] Oxygen is necessary for aerobic metabolism but can cause the harmful The eight mammalian GPX proteins fall oxidation of lipids and other macromolecules. Oxidation of cholesterol and into three clades based on amino acid phospholipids containing polyunsaturated fatty acyl chains can lead to lipid sequence similarity: GPX1 and GPX2; peroxidation, membrane damage, and cell death. Lipid hydroperoxides are key GPX3, GPX5, and GPX6; and GPX4, GPX7, and GPX8.[6] GPX1–4 and 6 (in intermediates in the process of lipid peroxidation. The lipid hydroperoxidase humans) are selenoproteins that contain glutathione peroxidase 4 (GPX4) converts lipid hydroperoxides to lipid an essential selenocysteine in the enzyme + alcohols, and this process prevents the iron (Fe2 )-dependent formation of active site, while GPX5, 6 (in mouse and toxic lipid reactive oxygen species (ROS). Inhibition of GPX4 function leads to rats), 7, and 8 use an active site cysteine lipid peroxidation and can result in the induction of ferroptosis, an instead. Unlike other family members, GPX4 (PHGPx) can act as a phospholipid iron-dependent, non-apoptotic form of cell death. This review describes the hydroperoxidase to reduce lipid perox- formation of reactive lipid species, the function of GPX4 in preventing ides to lipid alcohols.[7,8] Thus,GPX4ac- oxidative lipid damage, and the link between GPX4 dysfunction, lipid tivity is essential to maintain lipid home- oxidation, and the induction of ferroptosis. ostasis in the cell, prevent the accumula- tion of toxic lipid ROS and thereby block the onset of an oxidative, iron-dependent, non-apoptotic mode of cell death termed 1.
  • PRDX1 and PRDX6 Are Repressed in Papillary Thyroid Carcinomas Via BRAF V600E-Dependent and -Independent Mechanisms

    PRDX1 and PRDX6 Are Repressed in Papillary Thyroid Carcinomas Via BRAF V600E-Dependent and -Independent Mechanisms

    548 INTERNATIONAL JOURNAL OF ONCOLOGY 44: 548-556, 2014 PRDX1 and PRDX6 are repressed in papillary thyroid carcinomas via BRAF V600E-dependent and -independent mechanisms ARIANNA NICOLUSSI1*, SONIA D'INZEO1*, GABRIELLA MINCIONE4,5, AMELIA BUFFONE2, MARIA CARMELA DI MARCANTONIO4, ROBERTO COTELLESE4, ANNADOMENICA CICHELLA4, CARLO CAPALBO2, CIRA DI GIOIA3, FRANCESCO NARDI3, GIUSEPPE GIANNINI2 and ANNA COPPA1 Departments of 1Experimental Medicine, 2Molecular Medicine, 3Radiological, Oncological and Pathological Sciences, Sapienza University of Rome, Rome; 4Department of Experimental and Clinical Sciences, 5Center of Excellence on Aging, Ce.S.I., ‘G. d'Annunzio’ University Foundation, Chieti-Pescara, Italy Received September 18, 2013; Accepted November 6, 2013 DOI: 10.3892/ijo.2013.2208 Abstract. Many clinical studies highlight the dichotomous Introduction role of PRDXs in human cancers, where they can exhibit strong tumor-suppressive or tumor-promoting functions. In recent years, several studies have linked oxidative stress Recent evidence suggests that lower expression of PRDXs (OS) to thyroid cancer (1-3). The thyroid gland itself gener- correlates with cancer progression in colorectal cancer (CRC) ates reactive radical molecules, through the process of iodine or in esophageal squamous carcinoma. In the thyroid, increased metabolism and thyroid hormone synthesis. During this process, levels of PRDX1 has been described in follicular adenomas TSH stimulates H2O2 production, which is the substrate of and carcinomas, as well as in thyroiditis, while reduced levels thyroperoxidase (TPO) on the apical membrane of the thyroid of PRDX6 has been found in follicular adenomas. We studied follicular cells (4). Therefore, thyrocytes need protective the expression of PRDX1 and PRDX6, in a series of thyroid mechanisms that limit the oxidative damage of H2O2 produc- tissue samples, covering different thyroid diseases, including tion by catalase, gluthatione peroxidases and peroxiredoxins 13 papillary thyroid carcinomas (PTCs).
  • Reactive Oxygen Species and Protein Modifications in Spermatozoa

    Reactive Oxygen Species and Protein Modifications in Spermatozoa

    Biology of Reproduction, 2017, 97(4), 577–585 doi:10.1093/biolre/iox104 Review Advance Access Publication Date: 13 September 2017 Review Reactive oxygen species and protein modifications in spermatozoa† ∗ Cristian O’Flaherty1,2,3, and David Matsushita-Fournier2,3 Downloaded from https://academic.oup.com/biolreprod/article/97/4/577/4157784 by guest on 01 October 2021 1Department of Surgery (Urology Division), McGill University, Montreal,´ Quebec,´ Canada; 2Pharmacology and Therapeutics, Faculty of Medicine, McGill University, Montreal,´ Quebec,´ Canada and 3The Research Institute, McGill University Health Centre, Montreal,´ Quebec,´ Canada ∗Correspondence: The Research Insitute, McGill University Health Centre, room EM03212, 1001 Decarie Boulevard, Montreal,´ QC H4A 3J1, Canada. Fax: +514-933-4149; E-mail: cristian.ofl[email protected] †Grant support: This work was supported by a grant from the Canadian Institutes of Health Research (MOP 133661 to C.O.). CO is the recipient of the Chercher Boursier Junior 2 salary award from the Fonds de la Recherche en SanteduQu´ ebec´ (33158). Received 2 June 2017; Revised 1 August 2017; Accepted 11 September 2017 Abstract Cellular response to reactive oxygen species (ROS) includes both reversible redox signaling and irreversible nonenzymatic reactions which depend on the nature and concentration of the ROS involved. Changes in thiol/disulfide pairs affect protein conformation, enzymatic activity, ligand binding, and protein–protein interactions. During spermatogenesis and epididymal maturation, there are ROS-dependent modifications of the sperm chromatin and flagellar proteins.The sperma- tozoon is regulated by redox mechanisms to acquire fertilizing ability. For this purpose, controlled amounts of ROS are necessary to assure sperm activation (motility and capacitation).
  • Peroxiredoxins: Guardians Against Oxidative Stress and Modulators of Peroxide Signaling

    Peroxiredoxins: Guardians Against Oxidative Stress and Modulators of Peroxide Signaling

    Peroxiredoxins: Guardians Against Oxidative Stress and Modulators of Peroxide Signaling Perkins, A., Nelson, K. J., Parsonage, D., Poole, L. B., & Karplus, P. A. (2015). Peroxiredoxins: guardians against oxidative stress and modulators of peroxide signaling. Trends in Biochemical Sciences, 40(8), 435-445. doi:10.1016/j.tibs.2015.05.001 10.1016/j.tibs.2015.05.001 Elsevier Accepted Manuscript http://cdss.library.oregonstate.edu/sa-termsofuse Revised Manuscript clean Click here to download Manuscript: Peroxiredoxin-TiBS-revised-4-25-15-clean.docx 1 2 3 4 5 6 7 8 9 Peroxiredoxins: Guardians Against Oxidative Stress and Modulators of 10 11 12 Peroxide Signaling 13 14 15 16 17 18 19 1 2 2 2 20 Arden Perkins, Kimberly J. Nelson, Derek Parsonage, Leslie B. Poole * 21 22 23 and P. Andrew Karplus1* 24 25 26 27 28 29 30 31 1 Department of Biochemistry and Biophysics, Oregon State University, Corvallis, Oregon 97333 32 33 34 2 Department of Biochemistry, Wake Forest School of Medicine, Winston-Salem, North Carolina 27157 35 36 37 38 39 40 41 *To whom correspondence should be addressed: 42 43 44 L.B. Poole, ph: 336-716-6711, fax: 336-713-1283, email: [email protected] 45 46 47 P.A. Karplus, ph: 541-737-3200, fax: 541- 737-0481, email: [email protected] 48 49 50 51 52 53 54 55 Keywords: antioxidant enzyme, peroxidase, redox signaling, antioxidant defense 56 57 58 59 60 61 62 63 64 65 1 2 3 4 5 6 7 8 9 Abstract 10 11 12 13 Peroxiredoxins (Prxs) are a ubiquitous family of cysteine-dependent peroxidase enzymes that play dominant 14 15 16 roles in regulating peroxide levels within cells.
  • Molecular Profiling of Innate Immune Response Mechanisms in Ventilator-Associated 2 Pneumonia

    Molecular Profiling of Innate Immune Response Mechanisms in Ventilator-Associated 2 Pneumonia

    bioRxiv preprint doi: https://doi.org/10.1101/2020.01.08.899294; this version posted January 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Title: Molecular profiling of innate immune response mechanisms in ventilator-associated 2 pneumonia 3 Authors: Khyatiben V. Pathak1*, Marissa I. McGilvrey1*, Charles K. Hu3, Krystine Garcia- 4 Mansfield1, Karen Lewandoski2, Zahra Eftekhari4, Yate-Ching Yuan5, Frederic Zenhausern2,3,6, 5 Emmanuel Menashi3, Patrick Pirrotte1 6 *These authors contributed equally to this work 7 Affiliations: 8 1. Collaborative Center for Translational Mass Spectrometry, Translational Genomics Research 9 Institute, Phoenix, Arizona 85004 10 2. Translational Genomics Research Institute, Phoenix, Arizona 85004 11 3. HonorHealth Clinical Research Institute, Scottsdale, Arizona 85258 12 4. Applied AI and Data Science, City of Hope Medical Center, Duarte, California 91010 13 5. Center for Informatics, City of Hope Medical Center, Duarte, California 91010 14 6. Center for Applied NanoBioscience and Medicine, University of Arizona, Phoenix, Arizona 15 85004 16 Corresponding author: 17 Dr. Patrick Pirrotte 18 Collaborative Center for Translational Mass Spectrometry 19 Translational Genomics Research Institute 20 445 North 5th Street, Phoenix, AZ, 85004 21 Tel: 602-343-8454; 22 [[email protected]] 23 Running Title: Innate immune response in ventilator-associated pneumonia 24 Key words: ventilator-associated pneumonia; endotracheal aspirate; proteome, metabolome; 25 neutrophil degranulation 26 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.01.08.899294; this version posted January 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder.
  • Oxidative Stress in Thyroid Carcinomas: Biological and Clinical Significance

    Oxidative Stress in Thyroid Carcinomas: Biological and Clinical Significance

    26 3 Endocrine-Related R Ameziane El Hassani et al. Oxidative stress in thyroid 26:3 R131–R143 Cancer carcinomas REVIEW Oxidative stress in thyroid carcinomas: biological and clinical significance Rabii Ameziane El Hassani1, Camille Buffet2, Sophie Leboulleux3 and Corinne Dupuy2 1Laboratory of Biology of Human Pathologies ‘BioPatH’, Faculty of Sciences, Mohammed V University of Rabat, Rabat, Morocco 2UMR 8200 CNRS, Gustave Roussy and Paris Sud University, Villejuif, France 3Department of Nuclear Medicine and Endocrine Oncology, Gustave Roussy and Paris Sud University, Villejuif, France Correspondence should be addressed to C Dupuy: [email protected] Abstract At physiological concentrations, reactive oxygen species (ROS), including superoxide Key Words anions and H2O2, are considered as second messengers that play key roles in cellular f thyroid functions, such as proliferation, gene expression, host defence and hormone synthesis. f oxidative stress However, when they are at supraphysiological levels, ROS are considered potent DNA- f genetic instability damaging agents. Their increase induces oxidative stress, which can initiate and maintain f NADPH oxidase genomic instability. The thyroid gland represents a good model for studying the impact f dedifferentiation of oxidative stress on genomic instability. Indeed, one particularity of this organ is that follicular thyroid cells synthesise thyroid hormones through a complex mechanism that requires H2O2. Because of their detection in thyroid adenomas and in early cell transformation, both oxidative stress and DNA damage are believed to be neoplasia- preceding events in thyroid cells. Oxidative DNA damage is, in addition, detected in the advanced stages of thyroid cancer, suggesting that oxidative lesions of DNA also contribute to the maintenance of genomic instability during the subsequent phases of tumourigenesis.
  • The Role of Peroxiredoxin 6 in Cell Signaling

    The Role of Peroxiredoxin 6 in Cell Signaling

    antioxidants Review The Role of Peroxiredoxin 6 in Cell Signaling José A. Arevalo and José Pablo Vázquez-Medina * Department of Integrative Biology, University of California, Berkeley, CA, 94705, USA; [email protected] * Correspondence: [email protected]; Tel.: +1-510-664-5063 Received: 7 November 2018; Accepted: 20 November 2018; Published: 24 November 2018 Abstract: Peroxiredoxin 6 (Prdx6, 1-cys peroxiredoxin) is a unique member of the peroxiredoxin family that, in contrast to other mammalian peroxiredoxins, lacks a resolving cysteine and uses glutathione and π glutathione S-transferase to complete its catalytic cycle. Prdx6 is also the only peroxiredoxin capable of reducing phospholipid hydroperoxides through its glutathione peroxidase (Gpx) activity. In addition to its peroxidase activity, Prdx6 expresses acidic calcium-independent phospholipase A2 (aiPLA2) and lysophosphatidylcholine acyl transferase (LPCAT) activities in separate catalytic sites. Prdx6 plays crucial roles in lung phospholipid metabolism, lipid peroxidation repair, and inflammatory signaling. Here, we review how the distinct activities of Prdx6 are regulated during physiological and pathological conditions, in addition to the role of Prdx6 in cellular signaling and disease. Keywords: glutathione peroxidase; phospholipase A2; inflammation; lipid peroxidation; NADPH (nicotinamide adenine dinucleotide phosphate) oxidase; phospholipid hydroperoxide 1. Introduction Peroxiredoxins are a ubiquitous family of highly conserved enzymes that share a catalytic mechanism in which a redox-active (peroxidatic) cysteine residue in the active site is oxidized by a peroxide [1]. In peroxiredoxins 1–5 (2-cys peroxiredoxins), the resulting sulfenic acid then reacts with another (resolving) cysteine residue, forming a disulfide that is subsequently reduced by an appropriate electron donor to complete a catalytic cycle [2,3].
  • Peroxiredoxin 6 Knockout Aggravates Cecal Ligation and Puncture-Induced

    Peroxiredoxin 6 Knockout Aggravates Cecal Ligation and Puncture-Induced

    International Immunopharmacology 68 (2019) 252–258 Contents lists available at ScienceDirect International Immunopharmacology journal homepage: www.elsevier.com/locate/intimp Peroxiredoxin 6 knockout aggravates cecal ligation and puncture-induced acute lung injury T ⁎ Xiaocen Wanga,1, Xiaojing Anb,1, Xun Wanga,c,1, Xianglin Hua, Jing Bia, Ling Tonga, Dong Yanga, , Yuanlin Songa, Chunxue Baia a Department of Pulmonary Medicine, Zhongshan Hospital of Fudan University, Shanghai, PR China b Post-Doctoral Research Station, Zhongshan Hospital of Fudan University, Shanghai, PR China c Department of Pulmonary and Critical Care Medicine, The Affiliated Wuxi No. 2 People's Hospital of Nanjing Medical University, Jiangsu, PR China ARTICLE INFO ABSTRACT Keywords: Background: The aim of present study was to investigate the effects and mechanisms of peroxiredoxin (Prdx) 6 on Acute lung injury (ALI) cecal ligation and puncture (CLP) induced acute lung injury (ALI) in mice. Cecal ligation and puncture (CLP) Methods: The cecal of male Prdx 6 knockout and wildtype C57BL/6J mice were ligated and perforated. Stool was Peroxiredoxin (Prdx) 6 extruded to ensure wound patency. Two hours, 4 h, 8 h and 16 h after stimulation, the morphology, wet/dry Oxidative stress ratio, protein concentration in bronchial alveolar lavage fluid (BALF) were measured to evaluate lung injury. Inflammation Myeloperoxidase (MPO) activity, hydrogen peroxide (H2O2), malondialdehyde (MDA), total superoxide dis- mutase (SOD), xanthine oxidase (XOD), CuZn-SOD, total anti-oxidative capability (TAOC), glutathione perox- idase (GSH-PX), catalase (CAT) in lungs were measured by assay kits. The mRNA expression of lung tumor necrosis factor (TNF-α), interleukin (IL)-1β, and matrix metalloproteinases (MMP) 2 and 9 were tested by real- time RT-PCR.
  • Redox Biology 14 (2018) 41–46

    Redox Biology 14 (2018) 41–46

    Redox Biology 14 (2018) 41–46 Contents lists available at ScienceDirect Redox Biology journal homepage: www.elsevier.com/locate/redox Research Paper Peroxiredoxin 6 phospholipid hydroperoxidase activity in the repair of MARK peroxidized cell membranes ⁎ Aron B. Fisher , Jose P. Vasquez-Medina, Chandra Dodia, Elena M. Sorokina, Jian-Qin Tao, Sheldon I. Feinstein Institute for Environmental Medicine, Department of Physiology, Perelman School of Medicine of the University of Pennsylvania, Philadelphia, PA 19104, USA ARTICLE INFO ABSTRACT Keywords: Although lipid peroxidation associated with oxidative stress can result in cellular death, sub-lethal lipid per- Lipid peroxidation oxidation can gradually resolve with return to the pre-exposure state. We have shown that resolution of lipid Oxidant stress peroxidation is greatly delayed in lungs or cells that are null for peroxiredoxin 6 (Prdx6) and that both the Hyperoxia phospholipase A2 and the GSH peroxidase activities of Prdx6 are required for a maximal rate of recovery. Like Endothelial cells other peroxiredoxins, Prdx6 can reduce H O and short chain hydroperoxides, but in addition can directly Perfused lung 2 2 reduce phospholipid hydroperoxides. This study evaluated the relative role of these two different peroxidase Histidine mutation activities of Prdx6 in the repair of peroxidized cell membranes. The His26 residue in Prdx6 is an important component of the binding site for phospholipids. Thus, we evaluated the lungs from H26A-Prdx6 expressing mice and generated H26A-Prdx6 expressing pulmonary microvascular endothelial cells (PMVEC) by lentiviral infec- tion of Prdx6 null cells to compare with wild type in the repair of lipid peroxidation. Isolated lungs and PMVEC were exposed to tert-butyl hydroperoxide and mice were exposed to hyperoxia (> 95% O2).