DOCSLIB.ORG

Expression of SCCRO in PC and Its Inhibiting Effect on PC Cells and RT-PCR Was Performed As Same Procedure Ml) Polycarbonate Membrane (8 Μm Pore Size)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Expression of SCCRO in PC and Its Inhibiting Effect on PC Cells and RT-PCR Was Performed As Same Procedure Ml) Polycarbonate Membrane (8 Μm Pore Size) European Review for Medical and Pharmacological Sciences 2017; 21: 4283-4291 Clinical significance of SCCRO (DCUN1D1) in prostate cancer and its proliferation- inhibiting effect on Lncap cells Z.-H. ZHANG, J. LI, F. LUO, Y.-S. WANG Department of Urology, Tianjin Union Medical Center, Hongqiao District, Tianjin, China Abstract. – OBJECTIVE: SCCRO/DCUN1D1/ Key Words: DCN1 (squamous cell carcinoma-related onco- Tumor gene, Prostate cancer, RNA, Focal adhesion kinase, Matrix metalloproteinase-2. gene/defective in cullin neddylation 1 domain containing 1/defective in cullin neddylation) is considered as an oncogene, but its role in the prostate cancer (PC) is still not clear. The cur- rent study aims to investigate the expression of Introduction SCCRO in PC tumor tissues, further its clinical significance, and proliferation inhibiting effect Prostate cancer (PC) is the most common can- on PC cells in vitro. cer among males in the Western world, with more PATIENTS AND METHODS: RT-PCR was used than 1.11 million new cases diagnosed in 2012 to detect the expression of SCCRO in PC tis- and 307,000 deaths1,2. The lifetime risk of deve- sue and corresponding adjacent normal tissues 3 from 160 cases, and its relationship with clini- loping PC is 1 in 8 . It is expected that the in- cal pathological characteristics was analyzed. cidence will increase in the coming decades due Small interfering RNA (siRNA) expression plas- to the aging population, which makes it a huge mid targeting SCCRO gene was constructed and healthcare problem. The total economic costs of transferred into PC cell line Lncap. The effect on PC in Europe are estimated to exceed 8.43 bil- proliferation was observed by CCK8 assay, and lion4. Recently, with the economy improvement, its influence on invasion and migration of Lncap the morbidity and mortality of PC have also been cells was studied by Transwell Matrigel assay af- 5,6 ter SCCRO gene was silenced. The expression steadily increased in China . Thus, exploring the of focal adhesion kinase (FAK) and matrix metal- molecular biological mechanism of the occurren- loproteinase-2 (MMP-2) influenced by SCCRO si- ce and development of PC has important clinical lencing were detected by Western blot. significance in the diagnosis, treatment, and pro- RESULTS: mRNA expression of SCCRO pro- gnosis of the disease. tein increased significantly in cancer tissues Squamous cell carcinoma-related oncogene compared to adjacent normal tissue, especially for T3+T4, N+, and III+IV patients (p<0.05). SC- (SCCRO/DCUN1D1) is a new cancer gene, loca- CRO expression was an independent prognostic ted on chromosome 3q26.3, can be used as a tran- 7,8 9-11 factor (p<0.05). After SCCRO gene was knocked scription factor . Studies have indicated that down by siRNA, the SCCRO protein level de- SCCRO plays an important role in the formation creased 78.4% in the siRNA-3 group. By CCK8 of lung cancer, glioma, and cervical cancer. Ove- assay, knocking down SCCRO in Lncap signifi- rexpression of SCCRO is very important in the cantly reduced the cell proliferation, as well as malignant transformation of the tumor, and it is its migration and invasion capability compared to siRNA-control group (p<0.01) by transwell in- associated with poor clinical prognosis. However, vasion and migration assay. The expression of there is still lack of enough information about SC- FAK and MMP-2 also reduced in siRNA-3 group CRO in prostate cancer. In this work, we used RT- compared to siRNA control group (p<0.01). PCR to detect the expression of SCCRO in PC tis- CONCLUSIONS: SCCRO is associated with sues and adjacent tissues respectively, and aim to progression and prognosis of PC. After SCCRO analyze whether its expression is correlated with gene was transferred, the growth of Lncap cells was inhibited, and ability of invasion and mi- prognosis and TNM staging of PC. With an in vi- gration decreased by reducing the expression tro study, we investigated the effect of knocking- of FAK and MMP-2. SCCRO has potential to be- down SCCRO gene by RNAi on the growth, mi- come a new target for the treatment of PC. gration and invasion of Lncap cells, to understand Corresponding Author: Jian Li, MD; e-mail: [email protected] 4283 Z.-H. Zhang, J. Li, F. Luo, Y.-S. Wang the role of SCCRO in the development of PC. We for 1 min (40 cycles). The relative expression of aimed to understand SCCRO regulating pathway; SCCRO was calculated by methods mentioned by 14 the MMP2 and FAK expression change after SC- previous study : F = 2-Δct, Δct =Ct SCCRO – Ct- CRO RNA interference in Lncap cells were te- GAPDH. CT means the number of cycles experienced sted, because a previous paper12 has reported that by the fluorescent signals reached the threshold SCCRO induced invasion involves activation of inside the reactor. The SCCRO primer sequence MMP2 in several kinds of cancer, and FAK is an was following: forward was 5’ GAAGCTGTA- important regulator of MMP213. ACTTGGGGCTG 3’, and the reverse primer was 5’ TCCGCTGACAGATATGCCAA 3’, the pro- duct size was 213bp. The GAPDH primers were Patients and Methods following: forward 5’ GCTCTCTGCTCCTCCT- GTTC’, and reverse 5’ ACGACCAAATCCGTT- Patients and Tumor Samples GACTC’. All the primers were synthesized by life PC patients with complete data in Tianjin technology Inc. (Shanghai, China). Union Medical Center were retrospectively analyzed from January 2008 to November 2016, Vector Construction and 160 patients were taken up in this resear- Three pairs of siRNA specific sequence targe- ch. Tissue from the tumor and normal mucosa 2 ting human SCCRO gene and a pair of non-spe- cm beside tumor were taken into liquid nitrogen cific sequence were designed and synthesized and kept at -80°C. All the patients had not been by GenePharma (Shanghai, China). SCCRO treated with radiotherapy and chemotherapy be- siRNA-1 (forward: 5’-CCCTCAAATTGCTGG- fore the surgery, and postoperative pathological GACA-3’, reverse: 5’-UGUCCCAGCAAU- diagnosis confirmed PC. The data of the patien- UUGAGGG-3’), SCCRO siRNA-2 (forward: ts were shown in Table I. The patients were fol- 5’-GGAATTTGCACGCCCTCAA-3’, reverse: lowed-up every 3 months to investigate the sur- 5’-UUGAGGGCGUGCAAAUU CC-3’), SCCRO vival situation. We obtained the informed consent siRNA3 (forward: 5’-GCAGATGACATGTCTA- from all the patients. This study was approved by ATT-3’, reverse: 5’ -AAUUAGACAUGUCAU- the Ethics Committee of Tianjin Union Medical CUGC-3’), siRNA negative control (forward: Center and was conducted in accordance with the 5’-UUCUCCGAACGUGUCACGU-3’, reverse: provisions of the Declaration of Helsinki, Good 5’-ACGUGACACGUUCGGAGAA-3’). The abo- Clinical Practice guidelines, and local laws and ve RNA was cloned into a psiCHECK-2 vector, regulations. and the sequence correction was confirmed by di- rect gene sequencing. Real-time PCR The total RNA from each prostate tissue and Cell Culture and Transfection corresponding adjacent normal tissue was first- Lncap cells were cultured in Roswell Park ly extracted by the TRIzol reagent (Thermo Fi- Memorial Institute 1640 (RPMI-1640) medium sher Scientific, Waltham, MA, USA), then cDNA (Invitrogen, Carlsbad, CA, USA) with 10% fetal was obtained by Reverse transcription polyme- bovine serum (FBS) (Hyclone, Logan, UT, USA) rase (Toyobo, Tokyo, Japan). Real-time polyme- under the condition of 37°C, 5% CO2 saturation rase chain reaction (RT-PCR) method was used humidity. The experiment was carried out using to measure SCCRO level in each prostate tumor logarithmic growth phase cells. Small interfe- tissues and the corresponding normal tissues. ring RNA (siRNA) was stably transfected with The total volume of RT-PCR reaction system Lncap cells by Lipofectamine 3000 (Invitrogen, (TIANGEN Biotech, Beijing, China) was 20 µl: Carlsbad, CA, USA) for four weeks. Real-time reaction system contained 2× premix reagent 10 PCR and Western blot was used for testing their µl, forward primer 0.4 µl, reverse primer 0.4 µl, knocking down efficiency. Groups were divided cDNA 2 μl and 6.2 µl of distilled deionized water. into siRNA-1, siRNA-2, siRNA-3, siRNA negati- 1 μl 20×SYBR Green I was used as an interca- ve control (siRNA-NC) and blank control. lating dye (TIANGEN Biotech, Beijing, China). The CFX96 Touch™ Real-time PCR Detection Real-time PCR and Western Blot to System (BioRad, Hercules, CA, USA) was used Assess the Knocking-down Efficacy for quantitative measurement with the following After three stable siRNA clones were obtai- conditions: 95°C for 5 min, 95°C for 15 s, 60°C ned, the total RNA was extracted from cells, 4284 Expression of SCCRO in PC and its inhibiting effect on PC cells and RT-PCR was performed as same procedure ml) polycarbonate membrane (8 μm pore size). as above mentioned to assess the efficiency of The lighter side of the polycarbonate membra- siRNA knocking-down, GAPDH and SCCRO ne was precoated with 250 μg/ml matrigel (BD). primer was used. Protein extraction was per- The bottom chambers were filled with 30 μl formed with RIPA lysis buffer (Applygen, Bei- RPMI1640 medium containing 2% bovine serum jing, China), according to the manufacturer’s albumin (BSA) while the top chambers were fil- protocol. Protein concentration was measured led with 50 μl RPMI-1640 serum-free medium using BCA assay (Applygen, Beijing, China). containing 0.2% BSA. 5 × 104 cells per well were The protein samples were boiled for 5 min added to the top chamber, followed by a 15 h in- with buffer and 40 µg total protein was used cubation at 37°C, 5% CO2 incubator. Three inde- for sodium dodecyl sulphate-polyacrylamide pendent experiments were performed with tripli- gel electrophoresis (SDS-PAGE). After that, cate treatment. The cells were fixed in methanol the protein in the gel was electric transferred and stained with hematoxylin.
Load more

Recommended publications
  • Neddylation: a Novel Modulator of the Tumor Microenvironment Lisha Zhou1,2*†, Yanyu Jiang3†, Qin Luo1, Lihui Li1 and Lijun Jia1*
    Zhou et al. Molecular Cancer (2019) 18:77 https://doi.org/10.1186/s12943-019-0979-1 REVIEW Open Access Neddylation: a novel modulator of the tumor microenvironment Lisha Zhou1,2*†, Yanyu Jiang3†, Qin Luo1, Lihui Li1 and Lijun Jia1* Abstract Neddylation, a post-translational modification that adds an ubiquitin-like protein NEDD8 to substrate proteins, modulates many important biological processes, including tumorigenesis. The process of protein neddylation is overactivated in multiple human cancers, providing a sound rationale for its targeting as an attractive anticancer therapeutic strategy, as evidence by the development of NEDD8-activating enzyme (NAE) inhibitor MLN4924 (also known as pevonedistat). Neddylation inhibition by MLN4924 exerts significantly anticancer effects mainly by triggering cell apoptosis, senescence and autophagy. Recently, intensive evidences reveal that inhibition of neddylation pathway, in addition to acting on tumor cells, also influences the functions of multiple important components of the tumor microenvironment (TME), including immune cells, cancer-associated fibroblasts (CAFs), cancer-associated endothelial cells (CAEs) and some factors, all of which are crucial for tumorigenesis. Here, we briefly summarize the latest progresses in this field to clarify the roles of neddylation in the TME, thus highlighting the overall anticancer efficacy of neddylaton inhibition. Keywords: Neddylation, Tumor microenvironment, Tumor-derived factors, Cancer-associated fibroblasts, Cancer- associated endothelial cells, Immune cells Introduction Overall, binding of NEDD8 molecules to target proteins Neddylation is a reversible covalent conjugation of an can affect their stability, subcellular localization, conform- ubiquitin-like molecule NEDD8 (neuronal precursor ation and function [4]. The best-characterized substrates cell-expressed developmentally down-regulated protein of neddylation are the cullin subunits of Cullin-RING li- 8) to a lysine residue of the substrate protein [1, 2].
    [Show full text]
  • Molecular Signatures Differentiate Immune States in Type 1 Diabetes Families
    Page 1 of 65 Diabetes Molecular signatures differentiate immune states in Type 1 diabetes families Yi-Guang Chen1, Susanne M. Cabrera1, Shuang Jia1, Mary L. Kaldunski1, Joanna Kramer1, Sami Cheong2, Rhonda Geoffrey1, Mark F. Roethle1, Jeffrey E. Woodliff3, Carla J. Greenbaum4, Xujing Wang5, and Martin J. Hessner1 1The Max McGee National Research Center for Juvenile Diabetes, Children's Research Institute of Children's Hospital of Wisconsin, and Department of Pediatrics at the Medical College of Wisconsin Milwaukee, WI 53226, USA. 2The Department of Mathematical Sciences, University of Wisconsin-Milwaukee, Milwaukee, WI 53211, USA. 3Flow Cytometry & Cell Separation Facility, Bindley Bioscience Center, Purdue University, West Lafayette, IN 47907, USA. 4Diabetes Research Program, Benaroya Research Institute, Seattle, WA, 98101, USA. 5Systems Biology Center, the National Heart, Lung, and Blood Institute, the National Institutes of Health, Bethesda, MD 20824, USA. Corresponding author: Martin J. Hessner, Ph.D., The Department of Pediatrics, The Medical College of Wisconsin, Milwaukee, WI 53226, USA Tel: 011-1-414-955-4496; Fax: 011-1-414-955-6663; E-mail: [email protected]. Running title: Innate Inflammation in T1D Families Word count: 3999 Number of Tables: 1 Number of Figures: 7 1 For Peer Review Only Diabetes Publish Ahead of Print, published online April 23, 2014 Diabetes Page 2 of 65 ABSTRACT Mechanisms associated with Type 1 diabetes (T1D) development remain incompletely defined. Employing a sensitive array-based bioassay where patient plasma is used to induce transcriptional responses in healthy leukocytes, we previously reported disease-specific, partially IL-1 dependent, signatures associated with pre and recent onset (RO) T1D relative to unrelated healthy controls (uHC).
    [Show full text]
  • Mouse Dcun1d1 Knockout Project (CRISPR/Cas9)
    https://www.alphaknockout.com Mouse Dcun1d1 Knockout Project (CRISPR/Cas9) Objective: To create a Dcun1d1 knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Dcun1d1 gene (NCBI Reference Sequence: NM_001205361 ; Ensembl: ENSMUSG00000027708 ) is located on Mouse chromosome 3. 7 exons are identified, with the ATG start codon in exon 1 and the TAG stop codon in exon 7 (Transcript: ENSMUST00000108182). Exon 2~4 will be selected as target site. Cas9 and gRNA will be co-injected into fertilized eggs for KO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Mice homozygous for a knock-out allele are runted with spleen and lymphoid hypoplasia and decreased mouse embryonic fibroblast proliferation. Males are infertile and exhibit abnormal spermiogenesis. Exon 2 starts from about 0.51% of the coding region. Exon 2~4 covers 66.54% of the coding region. The size of effective KO region: ~4968 bp. The KO region does not have any other known gene. Page 1 of 9 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele 5' gRNA region gRNA region 3' 1 2 3 4 7 Legends Exon of mouse Dcun1d1 Knockout region Page 2 of 9 https://www.alphaknockout.com Overview of the Dot Plot (up) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 2000 bp section upstream of Exon 2 is aligned with itself to determine if there are tandem repeats. No significant tandem repeat is found in the dot plot matrix. So this region is suitable for PCR screening or sequencing analysis.
    [Show full text]
  • Anti-DCUN1D1 Antibody (ARG65153)
    Product datasheet [email protected] ARG65153 Package: 100 μg anti-DCUN1D1 antibody Store at: -20°C Summary Product Description Goat Polyclonal antibody recognizes DCUN1D1 Tested Reactivity Hu Predict Reactivity Ms, Cow Tested Application IHC-P, WB Host Goat Clonality Polyclonal Isotype IgG Target Name DCUN1D1 Antigen Species Human Immunogen C-RPQIAGTKSTT Conjugation Un-conjugated Alternate Names SCRO; RP42; Defective in cullin neddylation protein 1-like protein 1; Squamous cell carcinoma-related oncogene; DCUN1 domain-containing protein 1; SCCRO; DCN1-like protein 1; DCUN1L1; DCNL1; Tes3 Application Instructions Application table Application Dilution IHC-P 5 - 10 µg/ml WB 0.3 - 1 µg/ml Application Note IHC-P: Antigen Retrieval: Steam tissue section in Citrate buffer (pH 6.0). WB: Recommend incubate at RT for 1h. * The dilutions indicate recommended starting dilutions and the optimal dilutions or concentrations should be determined by the scientist. Calculated Mw 30 kDa Properties Form Liquid Purification Purified from goat serum by ammonium sulphate precipitation followed by antigen affinity chromatography using the immunizing peptide. Buffer Tris saline (pH 7.3), 0.02% Sodium azide and 0.5% BSA Preservative 0.02% Sodium azide Stabilizer 0.5% BSA Concentration 0.5 mg/ml www.arigobio.com 1/2 Storage instruction For continuous use, store undiluted antibody at 2-8°C for up to a week. For long-term storage, aliquot and store at -20°C or below. Storage in frost free freezers is not recommended. Avoid repeated freeze/thaw cycles. Suggest spin the vial prior to opening. The antibody solution should be gently mixed before use. Note For laboratory research only, not for drug, diagnostic or other use.
    [Show full text]
  • TXNDC5, a Newly Discovered Disulfide Isomerase with a Key Role in Cell Physiology and Pathology
    Int. J. Mol. Sci. 2014, 15, 23501-23518; doi:10.3390/ijms151223501 OPEN ACCESS International Journal of Molecular Sciences ISSN 1422-0067 www.mdpi.com/journal/ijms Review TXNDC5, a Newly Discovered Disulfide Isomerase with a Key Role in Cell Physiology and Pathology Elena Horna-Terrón 1, Alberto Pradilla-Dieste 1, Cristina Sánchez-de-Diego 1 and Jesús Osada 2,3,* 1 Grado de Biotecnología, Universidad de Zaragoza, Zaragoza E-50013, Spain; E-Mails: [email protected] (E.H.-T.); [email protected] (A.P.-D.); [email protected] (C.S.-D.) 2 Departamento Bioquímica y Biología Molecular y Celular, Facultad de Veterinaria, Instituto de Investigación Sanitaria de Aragón (IIS), Universidad de Zaragoza, Zaragoza E-50013, Spain 3 CIBER de Fisiopatología de la Obesidad y Nutrición, Instituto de Salud Carlos III, Madrid E-28029, Spain * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel.: +34-976-761-644; Fax: +34-976-761-612. External Editor: Johannes Haybaeck Received: 16 September 2014; in revised form: 1 December 2014 / Accepted: 5 December 2014 / Published: 17 December 2014 Abstract: Thioredoxin domain-containing 5 (TXNDC5) is a member of the protein disulfide isomerase family, acting as a chaperone of endoplasmic reticulum under not fully characterized conditions As a result, TXNDC5 interacts with many cell proteins, contributing to their proper folding and correct formation of disulfide bonds through its thioredoxin domains. Moreover, it can also work as an electron transfer reaction, recovering the functional isoform of other protein disulfide isomerases, replacing reduced glutathione in its role. Finally, it also acts as a cellular adapter, interacting with the N-terminal domain of adiponectin receptor.
    [Show full text]
  • Identification of Core Genes Involved in the Progression of Cervical
    International Journal of Molecular Sciences Article Identification of Core Genes Involved in the Progression of Cervical Cancer Using an Integrative mRNA Analysis Marina Dudea-Simon 1, Dan Mihu 1, Alexandru Irimie 2,3, Roxana Cojocneanu 4, Schuyler S. Korban 5, Radu Oprean 6, Cornelia Braicu 4,* and Ioana Berindan-Neagoe 4,7 1 2nd Obstetrics and Gynecology Department, “Iuliu Hatieganu” University of Medicine and Pharmacy, 400012 Cluj-Napoca, Romania; [email protected] (M.D.-S.); [email protected] (D.M.) 2 Department of Surgery, “Prof. Dr. Ion Chiricuta” Oncology Institute, 400015 Cluj-Napoca, Romania; [email protected] 3 Department of Surgical Oncology and Gynecological Oncology, Iuliu Hatieganu University of Medicine and Pharmacy, 400012 Cluj-Napoca, Romania 4 Research Center for Functional Genomics, Biomedicine and Translational Medicine, Iuliu Hatieganu University of Medicine and Pharmacy, 23 Marinescu Street, 400337 Cluj-Napoca, Romania; [email protected] (R.C.); [email protected] (I.B.-N.) 5 Department of Natural and Environmental Sciences, University of Illinois at Urbana-Champaign, Urbana, IL 61801, USA; [email protected] 6 Analytical Chemistry Department, Iuliu Hatieganu University of Medicine and Pharmacy, 4, Louis Pasteur Street, 400349 Cluj-Napoca, Romania; [email protected] 7 Department of Functional Genomics and Experimental Pathology, “Prof. Dr. Ion Chiricu¸tă” Oncology Institute, 34-36 Republicii Street, 400015 Cluj-Napoca, Romania * Correspondence: [email protected] Received: 5 September 2020; Accepted: 1 October 2020; Published: 3 October 2020 Abstract: In spite of being a preventable disease, cervical cancer (CC) remains at high incidence, and it has a significant mortality rate. Although hijacking of the host cellular pathway is fundamental for developing a better understanding of the human papillomavirus (HPV) pathogenesis, a major obstacle is identifying the central molecular targets involved in HPV-driven CC.
    [Show full text]
  • Molecular Targeting and Enhancing Anticancer Efficacy of Oncolytic HSV-1 to Midkine Expressing Tumors
    University of Cincinnati Date: 12/20/2010 I, Arturo R Maldonado , hereby submit this original work as part of the requirements for the degree of Doctor of Philosophy in Developmental Biology. It is entitled: Molecular Targeting and Enhancing Anticancer Efficacy of Oncolytic HSV-1 to Midkine Expressing Tumors Student's name: Arturo R Maldonado This work and its defense approved by: Committee chair: Jeffrey Whitsett Committee member: Timothy Crombleholme, MD Committee member: Dan Wiginton, PhD Committee member: Rhonda Cardin, PhD Committee member: Tim Cripe 1297 Last Printed:1/11/2011 Document Of Defense Form Molecular Targeting and Enhancing Anticancer Efficacy of Oncolytic HSV-1 to Midkine Expressing Tumors A dissertation submitted to the Graduate School of the University of Cincinnati College of Medicine in partial fulfillment of the requirements for the degree of DOCTORATE OF PHILOSOPHY (PH.D.) in the Division of Molecular & Developmental Biology 2010 By Arturo Rafael Maldonado B.A., University of Miami, Coral Gables, Florida June 1993 M.D., New Jersey Medical School, Newark, New Jersey June 1999 Committee Chair: Jeffrey A. Whitsett, M.D. Advisor: Timothy M. Crombleholme, M.D. Timothy P. Cripe, M.D. Ph.D. Dan Wiginton, Ph.D. Rhonda D. Cardin, Ph.D. ABSTRACT Since 1999, cancer has surpassed heart disease as the number one cause of death in the US for people under the age of 85. Malignant Peripheral Nerve Sheath Tumor (MPNST), a common malignancy in patients with Neurofibromatosis, and colorectal cancer are midkine- producing tumors with high mortality rates. In vitro and preclinical xenograft models of MPNST were utilized in this dissertation to study the role of midkine (MDK), a tumor-specific gene over- expressed in these tumors and to test the efficacy of a MDK-transcriptionally targeted oncolytic HSV-1 (oHSV).
    [Show full text]
  • A Potent Small-Molecule Inhibitor of the DCN1-UBC12 Interaction That Selectively Blocks Cullin 3 Neddylation
    ARTICLE DOI: 10.1038/s41467-017-01243-7 OPEN A potent small-molecule inhibitor of the DCN1-UBC12 interaction that selectively blocks cullin 3 neddylation Haibin Zhou1, Jianfeng Lu1, Liu Liu1, Denzil Bernard1, Chao-Yie Yang1, Ester Fernandez-Salas2, Krishnapriya Chinnaswamy3, Stephanie Layton3, Jeanne Stuckey3, Qing Yu6, Weihua Zhou4, Zhenqiang Pan5, Yi Sun4,6 & Shaomeng Wang1,7,8 1234567890 The Cullin-RING E3 ubiquitin ligases (CRLs) regulate homeostasis of ~20% of cellular pro- teins and their activation require neddylation of their cullin subunit. Cullin neddylation is modulated by a scaffolding DCN protein through interactions with both the cullin protein and an E2 enzyme such as UBC12. Here we report the development of DI-591 as a high-affinity, cell-permeable small-molecule inhibitor of the DCN1–UBC12 interaction. DI-591 binds to purified recombinant human DCN1 and DCN2 proteins with Ki values of 10–12 nM, and disrupts the DCN1–UBC12 interaction in cells. Treatment with DI-591 selectively converts cellular cullin 3 into an un-neddylated inactive form with no or minimum effect on other cullin members. Our data firmly establish a previously unrecognized specific role of the DCN1–UBC12 interaction for cellular neddylation of cullin 3. DI-591 is an excellent probe compound to investigate the role of the cullin 3 CRL ligase in biological processes and human diseases. 1 Department of Internal Medicine, University of Michigan, Ann Arbor, Michigan 48109, USA. 2 Department of Pathology, University of Michigan, Ann Arbor, Michigan 48109, USA. 3 Life Sciences Institute, University of Michigan, Ann Arbor, Michigan 48109, USA. 4 Division of Radiation and Cancer Biology, Department of Radiation Oncology, University of Michigan, Ann Arbor, Michigan 48109, USA.
    [Show full text]
  • SOX2 Is an Amplified Lineage- Survival Oncogene in Lung and Esophageal Squamous Cell Carcinomas
    SOX2 is an amplified lineage- survival oncogene in lung and esophageal squamous cell carcinomas The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Bass, Adam J, Hideo Watanabe, Craig H Mermel, Soyoung Yu, Sven Perner, Roel G Verhaak, So Young Kim, et al. 2009. SOX2 Is an Amplified Lineage-Survival Oncogene in Lung and Esophageal Squamous Cell Carcinomas. Nature Genetics 41, no. 11: 1238–1242. doi:10.1038/ng.465. Published Version doi:10.1038/ng.465 Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:32663218 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA HHS Public Access Author manuscript Author Manuscript Author ManuscriptNat Genet Author Manuscript. Author manuscript; Author Manuscript available in PMC 2010 May 01. Published in final edited form as: Nat Genet. 2009 November ; 41(11): 1238–1242. doi:10.1038/ng.465. SOX2 Is an Amplified Lineage Survival Oncogene in Lung and Esophageal Squamous Cell Carcinomas Adam J. Bass1,2,4,5,17, Hideo Watanabe1,4,5,17, Craig H. Mermel1,4,5, Soyoung Yu1,4, Sven Perner6,7, Roel G. Verhaak1,4,5, So Young Kim1,4, Leslie Wardwell1,4, Pablo Tamayo5, Irit Gat-Viks5, Alex H. Ramos1,4,5, Michele S. Woo1,4,5, Barbara A. Weir1,4,5, Gad Getz5, Rameen Beroukhim1,2,4,5, Michael O’Kelly5, Amit Dutt1,4,5, Orit Rozenblatt-Rosen1,4, Piotr Dziunycz1, Justin Komisarof1, Lucian R.
    [Show full text]
  • UNIVERSITY of CALIFORNIA, SAN DIEGO Measuring
    UNIVERSITY OF CALIFORNIA, SAN DIEGO Measuring and Correlating Blood and Brain Gene Expression Levels: Assays, Inbred Mouse Strain Comparisons, and Applications to Human Disease Assessment A dissertation submitted in partial satisfaction of the requirements for the degree of Doctor of Philosophy in Biomedical Sciences by Mary Elizabeth Winn Committee in charge: Professor Nicholas J Schork, Chair Professor Gene Yeo, Co-Chair Professor Eric Courchesne Professor Ron Kuczenski Professor Sanford Shattil 2011 Copyright Mary Elizabeth Winn, 2011 All rights reserved. 2 The dissertation of Mary Elizabeth Winn is approved, and it is acceptable in quality and form for publication on microfilm and electronically: Co-Chair Chair University of California, San Diego 2011 iii DEDICATION To my parents, Dennis E. Winn II and Ann M. Winn, to my siblings, Jessica A. Winn and Stephen J. Winn, and to all who have supported me throughout this journey. iv TABLE OF CONTENTS Signature Page iii Dedication iv Table of Contents v List of Figures viii List of Tables x Acknowledgements xiii Vita xvi Abstract of Dissertation xix Chapter 1 Introduction and Background 1 INTRODUCTION 2 Translational Genomics, Genome-wide Expression Analysis, and Biomarker Discovery 2 Neuropsychiatric Diseases, Tissue Accessibility and Blood-based Gene Expression 4 Mouse Models of Human Disease 5 Microarray Gene Expression Profiling and Globin Reduction 7 Finding and Accessible Surrogate Tissue for Neural Tissue 9 Genetic Background Effect Analysis 11 SPECIFIC AIMS 12 ENUMERATION OF CHAPTERS
    [Show full text]
  • The Human SCCRO Gene Family: Characterization of Its Molecular
    The human SCCRO gene family: human SCCRO characterizationThe of its molecular function in carcinogenesis and role Uitnodiging voor het bijwonen van de openbare verdediging The human SCCRO gene family: van het proefschrift characterization of its molecular function and role in The human SCCRO gene family: characterization of its molecular carcinogenesis function and role in carcinogenesis op woensdag 8 juli 2015 om 09:30 uur in de Queridozaal (Eg-370) Onderwijscentrum, Erasmus MC Dr. Molewaterplein 50 Rotterdam Aansluitend receptie in het Nederlands Architectuur Instituut, Museumpark 25, Rotterdam Claire Bommeljé Breitnerstraat 89a 3015 XD Rotterdam 06-41319657 [email protected] Claire C. Bommeljé Claire Paranimfen Dorine Pauw Claire C. Bommeljé 06-24652441 [email protected] Susanne Gielen Bommelje_Omslagv3.indd 1 30-04-15 10:17 The Human SCCRO Gene Family: Characterization of its molecular function and role in carcinogenesis Claire Cornelia Bommeljé The Human SCCRO Gene Family: Characterization of its molecular function and role in carcinogenesis. The research in this thesis was financially supported by Bekker La Bastide Fonds, Stichting Fundatie van de Vrijvrouwe van Renswoude, Dr. Catherine van Tussenbroek Fonds and Trustfonds Rotterdam. Publication of this thesis was financially supported by: ABN AMRO Bank N.V., ALK-Abello B.V., Atos Medical B.V., ChipSoft B.V., Daleco Pharma B.V., de Nederlandse Vereniging voor KNO-heelkunde en Heelkunde van het Hoofd-Halsgebied, Dos Medical B.V./kno-winkel.nl, Entercare, Erasmus Universiteit Rotterdam, Meda Pharma B.V., Olympus Nederland B.V., Phonak en Specsavers. ISBN: 978-94-6299-109-5 Printed by: Ridderprint BV – www.ridderprint.nl Layout: Ridderprint BV – www.ridderprint.nl © Claire Cornelia Bommeljé.
    [Show full text]
  • Regulation of Glucose Metabolism by P62/SQSTM1 Through Hif1α
    © 2016. Published by The Company of Biologists Ltd | Journal of Cell Science (2016) 129, 817-830 doi:10.1242/jcs.178756 RESEARCH ARTICLE Regulation of glucose metabolism by p62/SQSTM1 through HIF1α Ke Chen1,2,*, Jin Zeng1,2,*, Haibing Xiao1,2, Chunhua Huang3, Junhui Hu1,2, Weimin Yao1,2, Gan Yu1,2, Wei Xiao1,2, Hua Xu1,2,‡ and Zhangqun Ye1,2 ABSTRACT 5q35.3 have been demonstrated in about 70% of ccRCCs The signaling adaptor sequestosome 1 (SQSTM1)/p62 is frequently (Beroukhim et al., 2009; Chen et al., 2009; Hagenkord et al., overexpressed in tumors and plays an important role in the regulation 2011; Shen et al., 2011; Dondeti et al., 2012; Li et al., 2013b). of tumorigenesis. Although great progress has been made, biological Furthermore, the p62 transcript has been mapped to this region (Li roles of p62 and relevant molecular mechanisms responsible for its et al., 2013b). p62 is classically known as a scaffold protein that pro-tumor activity remain largely unknown. Here, we show that p62 participates in regulation of many cellular processes, for example, knockdown reduces cell growth and the expression of glycolytic cell proliferation and growth, malignant transformation, apoptosis, genes in a manner that depends on HIF1α activity in renal cancer inflammation and autophagy (Mathew et al., 2009; Moscat and cells. Knockdown of p62 decreases HIF1α levels and transcriptional Diaz-Meco, 2009, 2011, 2012; Bitto et al., 2014). The best-known activity by regulating mTORC1 activity and NF-κB nuclear function of p62 is in the targeting polyubiquitylated proteins for translocation. Furthermore, p62 interacts directly with the von autophagy-mediated degradation through interaction with ubiquitin Hippel-Lindau (VHL) E3 ligase complex to modulate the stability of and LC3 (Kirkin et al., 2009; Moscat and Diaz-Meco, 2009; Lin κ HIF1α.
    [Show full text]