European Review for Medical and Pharmacological Sciences 2017; 21: 4283-4291 Clinical significance of SCCRO (DCUN1D1) in prostate cancer and its proliferation- inhibiting effect on Lncap cells Z.-H. ZHANG, J. LI, F. LUO, Y.-S. WANG Department of Urology, Tianjin Union Medical Center, Hongqiao District, Tianjin, China Abstract. – OBJECTIVE: SCCRO/DCUN1D1/ Key Words: DCN1 (squamous cell carcinoma-related onco- Tumor gene, Prostate cancer, RNA, Focal adhesion kinase, Matrix metalloproteinase-2. gene/defective in cullin neddylation 1 domain containing 1/defective in cullin neddylation) is considered as an oncogene, but its role in the prostate cancer (PC) is still not clear. The cur- rent study aims to investigate the expression of Introduction SCCRO in PC tumor tissues, further its clinical significance, and proliferation inhibiting effect Prostate cancer (PC) is the most common can- on PC cells in vitro. cer among males in the Western world, with more PATIENTS AND METHODS: RT-PCR was used than 1.11 million new cases diagnosed in 2012 to detect the expression of SCCRO in PC tis- and 307,000 deaths1,2. The lifetime risk of deve- sue and corresponding adjacent normal tissues 3 from 160 cases, and its relationship with clini- loping PC is 1 in 8 . It is expected that the in- cal pathological characteristics was analyzed. cidence will increase in the coming decades due Small interfering RNA (siRNA) expression plas- to the aging population, which makes it a huge mid targeting SCCRO gene was constructed and healthcare problem. The total economic costs of transferred into PC cell line Lncap. The effect on PC in Europe are estimated to exceed 8.43 bil- proliferation was observed by CCK8 assay, and lion4. Recently, with the economy improvement, its influence on invasion and migration of Lncap the morbidity and mortality of PC have also been cells was studied by Transwell Matrigel assay af- 5,6 ter SCCRO gene was silenced. The expression steadily increased in China . Thus, exploring the of focal adhesion kinase (FAK) and matrix metal- molecular biological mechanism of the occurren- loproteinase-2 (MMP-2) influenced by SCCRO si- ce and development of PC has important clinical lencing were detected by Western blot. significance in the diagnosis, treatment, and pro- RESULTS: mRNA expression of SCCRO pro- gnosis of the disease. tein increased significantly in cancer tissues Squamous cell carcinoma-related oncogene compared to adjacent normal tissue, especially for T3+T4, N+, and III+IV patients (p<0.05). SC- (SCCRO/DCUN1D1) is a new cancer gene, loca- CRO expression was an independent prognostic ted on chromosome 3q26.3, can be used as a tran- 7,8 9-11 factor (p<0.05). After SCCRO gene was knocked scription factor . Studies have indicated that down by siRNA, the SCCRO protein level de- SCCRO plays an important role in the formation creased 78.4% in the siRNA-3 group. By CCK8 of lung cancer, glioma, and cervical cancer. Ove- assay, knocking down SCCRO in Lncap signifi- rexpression of SCCRO is very important in the cantly reduced the cell proliferation, as well as malignant transformation of the tumor, and it is its migration and invasion capability compared to siRNA-control group (p<0.01) by transwell in- associated with poor clinical prognosis. However, vasion and migration assay. The expression of there is still lack of enough information about SC- FAK and MMP-2 also reduced in siRNA-3 group CRO in prostate cancer. In this work, we used RT- compared to siRNA control group (p<0.01). PCR to detect the expression of SCCRO in PC tis- CONCLUSIONS: SCCRO is associated with sues and adjacent tissues respectively, and aim to progression and prognosis of PC. After SCCRO analyze whether its expression is correlated with gene was transferred, the growth of Lncap cells was inhibited, and ability of invasion and mi- prognosis and TNM staging of PC. With an in vi- gration decreased by reducing the expression tro study, we investigated the effect of knocking- of FAK and MMP-2. SCCRO has potential to be- down SCCRO gene by RNAi on the growth, mi- come a new target for the treatment of PC. gration and invasion of Lncap cells, to understand Corresponding Author: Jian Li, MD; e-mail: [email protected] 4283 Z.-H. Zhang, J. Li, F. Luo, Y.-S. Wang the role of SCCRO in the development of PC. We for 1 min (40 cycles). The relative expression of aimed to understand SCCRO regulating pathway; SCCRO was calculated by methods mentioned by 14 the MMP2 and FAK expression change after SC- previous study : F = 2-Δct, Δct =Ct SCCRO – Ct- CRO RNA interference in Lncap cells were te- GAPDH. CT means the number of cycles experienced sted, because a previous paper12 has reported that by the fluorescent signals reached the threshold SCCRO induced invasion involves activation of inside the reactor. The SCCRO primer sequence MMP2 in several kinds of cancer, and FAK is an was following: forward was 5’ GAAGCTGTA- important regulator of MMP213. ACTTGGGGCTG 3’, and the reverse primer was 5’ TCCGCTGACAGATATGCCAA 3’, the pro- duct size was 213bp. The GAPDH primers were Patients and Methods following: forward 5’ GCTCTCTGCTCCTCCT- GTTC’, and reverse 5’ ACGACCAAATCCGTT- Patients and Tumor Samples GACTC’. All the primers were synthesized by life PC patients with complete data in Tianjin technology Inc. (Shanghai, China). Union Medical Center were retrospectively analyzed from January 2008 to November 2016, Vector Construction and 160 patients were taken up in this resear- Three pairs of siRNA specific sequence targe- ch. Tissue from the tumor and normal mucosa 2 ting human SCCRO gene and a pair of non-spe- cm beside tumor were taken into liquid nitrogen cific sequence were designed and synthesized and kept at -80°C. All the patients had not been by GenePharma (Shanghai, China). SCCRO treated with radiotherapy and chemotherapy be- siRNA-1 (forward: 5’-CCCTCAAATTGCTGG- fore the surgery, and postoperative pathological GACA-3’, reverse: 5’-UGUCCCAGCAAU- diagnosis confirmed PC. The data of the patien- UUGAGGG-3’), SCCRO siRNA-2 (forward: ts were shown in Table I. The patients were fol- 5’-GGAATTTGCACGCCCTCAA-3’, reverse: lowed-up every 3 months to investigate the sur- 5’-UUGAGGGCGUGCAAAUU CC-3’), SCCRO vival situation. We obtained the informed consent siRNA3 (forward: 5’-GCAGATGACATGTCTA- from all the patients. This study was approved by ATT-3’, reverse: 5’ -AAUUAGACAUGUCAU- the Ethics Committee of Tianjin Union Medical CUGC-3’), siRNA negative control (forward: Center and was conducted in accordance with the 5’-UUCUCCGAACGUGUCACGU-3’, reverse: provisions of the Declaration of Helsinki, Good 5’-ACGUGACACGUUCGGAGAA-3’). The abo- Clinical Practice guidelines, and local laws and ve RNA was cloned into a psiCHECK-2 vector, regulations. and the sequence correction was confirmed by di- rect gene sequencing. Real-time PCR The total RNA from each prostate tissue and Cell Culture and Transfection corresponding adjacent normal tissue was first- Lncap cells were cultured in Roswell Park ly extracted by the TRIzol reagent (Thermo Fi- Memorial Institute 1640 (RPMI-1640) medium sher Scientific, Waltham, MA, USA), then cDNA (Invitrogen, Carlsbad, CA, USA) with 10% fetal was obtained by Reverse transcription polyme- bovine serum (FBS) (Hyclone, Logan, UT, USA) rase (Toyobo, Tokyo, Japan). Real-time polyme- under the condition of 37°C, 5% CO2 saturation rase chain reaction (RT-PCR) method was used humidity. The experiment was carried out using to measure SCCRO level in each prostate tumor logarithmic growth phase cells. Small interfe- tissues and the corresponding normal tissues. ring RNA (siRNA) was stably transfected with The total volume of RT-PCR reaction system Lncap cells by Lipofectamine 3000 (Invitrogen, (TIANGEN Biotech, Beijing, China) was 20 µl: Carlsbad, CA, USA) for four weeks. Real-time reaction system contained 2× premix reagent 10 PCR and Western blot was used for testing their µl, forward primer 0.4 µl, reverse primer 0.4 µl, knocking down efficiency. Groups were divided cDNA 2 μl and 6.2 µl of distilled deionized water. into siRNA-1, siRNA-2, siRNA-3, siRNA negati- 1 μl 20×SYBR Green I was used as an interca- ve control (siRNA-NC) and blank control. lating dye (TIANGEN Biotech, Beijing, China). The CFX96 Touch™ Real-time PCR Detection Real-time PCR and Western Blot to System (BioRad, Hercules, CA, USA) was used Assess the Knocking-down Efficacy for quantitative measurement with the following After three stable siRNA clones were obtai- conditions: 95°C for 5 min, 95°C for 15 s, 60°C ned, the total RNA was extracted from cells, 4284 Expression of SCCRO in PC and its inhibiting effect on PC cells and RT-PCR was performed as same procedure ml) polycarbonate membrane (8 μm pore size). as above mentioned to assess the efficiency of The lighter side of the polycarbonate membra- siRNA knocking-down, GAPDH and SCCRO ne was precoated with 250 μg/ml matrigel (BD). primer was used. Protein extraction was per- The bottom chambers were filled with 30 μl formed with RIPA lysis buffer (Applygen, Bei- RPMI1640 medium containing 2% bovine serum jing, China), according to the manufacturer’s albumin (BSA) while the top chambers were fil- protocol. Protein concentration was measured led with 50 μl RPMI-1640 serum-free medium using BCA assay (Applygen, Beijing, China). containing 0.2% BSA. 5 × 104 cells per well were The protein samples were boiled for 5 min added to the top chamber, followed by a 15 h in- with buffer and 40 µg total protein was used cubation at 37°C, 5% CO2 incubator. Three inde- for sodium dodecyl sulphate-polyacrylamide pendent experiments were performed with tripli- gel electrophoresis (SDS-PAGE). After that, cate treatment. The cells were fixed in methanol the protein in the gel was electric transferred and stained with hematoxylin.