Assessment of Antibiotic Resistance in Probiotic Strain Lactobacillus Brevis KB290

Name /food/72-07-44 08/24/2009 07:39AM Plate # 0-Composite pg 1923 # 1

1923

Journal of Food Protection, Vol. 72, No. 9, 2009, Pages 1923–1929 Copyright ᮊ, International Association for Food Protection

Assessment of Antibiotic Resistance in Probiotic Strain Lactobacillus brevis KB290

MASANORI FUKAO,1* HARUYOSHI TOMITA,2 TAKAFUMI YAKABE,1 TAKAHIRO NOMURA,2 YASUYOSHI IKE,2 AND NOBUHIRO YAJIMA1

1Probiotics Research Department, Research Institute, Kagome Company, Limited, 17 Nishitomiyama, Nasushiobara, Tochigi, 329-2762, Japan; and 2Department of Bacteriology, Gunma University Graduate School of Medicine, 3-39-22 Showa, Maebashi, Gunma, 371-8511, Japan Downloaded from http://meridian.allenpress.com/jfp/article-pdf/72/9/1923/1681776/0362-028x-72_9_1923.pdf by guest on 25 September 2021 MS 09-060: Received 6 February 2009/Accepted 14 March 2009

ABSTRACT

Our purpose was to investigate the safety of the probiotic strain Lactobacillus brevis KB290. The European Qualified Presumption of Safety (QPS) evaluation approach was applied to the strain. We determined the strain’s antibiotic resistance, verified it at the genetic level, and determined whether it could be transferred to intestinal microflora. Of 14 antibiotics tested, 11 showed MICs within the limits of the QPS criteria. However, the L. brevis KB290 MICs of ciprofloxacin (a fluoroquinolone), tetracycline, and vancomycin were two, four, and eight times, respectively, the breakpoint MICs suggested by the European Scientific Committee on Animal Nutrition, and the MIC of tetracycline was eight times the breakpoint MIC suggested by the European Scientific Panel on Additives and Products or Substances Used in Animal Feed. Using analysis of gapped-genome sequences, we found no known transferable determinants for tetracycline or vancomycin resistance, and we found no mutations in the quinolone resistance–determining regions of the genes encoding GyrA or ParC for ciprofloxacin resistance associated with insertion sequences, integrons, or transposons. These data were confirmed by using PCR primers specific for the respective genes. We assessed the transferability of the resistance traits in conjugation experiments with enterococci and obtained no transconjugants, strongly suggesting that the resistance traits were not transferable. This study demonstrated that the antibiotic resistance observed in L. brevis KB290 was due not to dedicated mechanisms but to intrinsic resistance. According to the QPS criteria, these results provide safety assurance for the ongoing use of L. brevis KB290 as a probiotic.

Many microbial species have probiotic properties, but has been used since 1993 in fermented food products and those most commonly used are lactic acid bacteria (LAB). as a freeze-dried powder in Japan. L. brevis KB290 displays LAB have a long history of safe use in the production and unique properties. After oral administration, it enhances consumption of fermented foods and beverages (8, 30, 40, alpha interferon production and natural killer cell activity 47). Over recent decades, as awareness of the beneficial (27). effects of probiotics in promoting gut and general health L. brevis KB290 was isolated from suguki, a traditional has grown, the development and consumption of probiotic Japanese pickle. Plant-derived LAB are genetically similar foods has increased worldwide (38). Thus, it is essential to to milk-derived strains, but they show additional useful investigate thoroughly the safety of LAB strains used in characteristics. For example, plant-derived streptococci probiotic products (7, 40). demonstrate a greater tolerance to stress than do milk-de- When probiotic LAB enter the intestines, they interact rived strains (45) and can ferment a wider range of carbo- with the native microbiota, and gene transfer can occur (4, hydrate sources (35). 32, 42). Recent reports have described the prevalence and In this study, we determined the MICs for L. brevis mechanisms of antibiotic resistance transfer in commensal KB290 of a range of antibiotics, investigated the genes re- bacteria, such as LAB isolated from food (9, 19, 21, 22, sponsible for low-level antibiotic resistance, and examined 49). In the European Union, any probiotic added to food- the conjugative transferability of the low-level resistance. stuffs must comply with the Qualified Presumption of Safe- MATERIALS AND METHODS ty (QPS) concept (16). The European Scientific Committee on Animal Nutrition (SCAN) and the European Scientific Bacterial strains and growth medium. Table 1 lists the Panel on Additives and Products or Substances Used in strains used in this study. We cultured lactobacilli on deMan Ro- Animal Feed (FEEDAP) recommended that the absence of gosa Sharpe medium (Oxoid, Ltd., Basingstoke, UK) or Mueller- Hinton (MH) medium (Difco, Becton Dickinson, Sparks, MD) transferable resistance genes should be a prerequisite for supplemented with 1.0% horse blood, and cultured enterococci approval. SCAN and FEEDAP provide explicit details for and staphylococci on brain heart infusion (Difco, Becton Dick- the screening of strains for the absence of transferable re- inson) or MH medium, also supplemented with 1.0% horse blood. sistance genes (17, 18). We grew L. brevis and Lactobacillus plantarum at 30ЊC and all Lactobacillus brevis KB290 is a probiotic strain that other strains at 37ЊC.

* Author for correspondence. Tel: ϩ81-287-36-2935; Fax: ϩ81-287-39- Antibiotic susceptibility testing and MIC determination. 1038; E-mail: Masanori࿞[email protected]. We determined antibiotic MICs according to NCCLS (now CLSI) Name /food/72-07-44 08/24/2009 07:39AM Plate # 0-Composite pg 1924 # 2

1924 FUKAO ET AL. J. Food Prot., Vol. 72, No. 9

TABLE 1. Bacterial strains used in this study Straina Relative properties (plasmid)b Reference

Lactobacillus brevis KB290 This study L. plantarum LMG21684 tet(M), erm (B) 20 L. plantarum LMG21687 tet(M) 20 L. rhamnosus GG (ATCC 53103) 44 Enterococcus faecalis ATCC 29212 34 E. faecalis JH2SS Derivative of JH2; Emr, Strr, Spcr, (pIP501) 23 E. faecalis FA2-2 Derivative of JH2; Fusr, Rifr, plasmid free 23 E. faecalis BM4147 vanA (pIP816) 29 E. faecalis V583 vanB 39

Staphylococcus aureus ATCC 29213 34 Downloaded from http://meridian.allenpress.com/jfp/article-pdf/72/9/1923/1681776/0362-028x-72_9_1923.pdf by guest on 25 September 2021

a LMG, Bacteria Collection of the Laboratory of Microbiology, University of Ghent; ATCC, American Type Culture Collection. b Emr, erythromycin resistant; Strr, streptomycin resistant; Spcr, spectinomycin resistant; Fusr, fusidic acid resistant; Rifr, rifampin resistant.

Approved Standard M7-A4 (34), which defines MIC as the min- L. brevis KB290 genome, which contained several plasmids, was imum concentration of antibiotic needed for total inhibition of sequenced to a depth of 35ϫ and assembled by the 454 Newbler bacterial growth after incubation for 48 h. Overnight cultures of de novo assembler to 109 contigs per genome. We compared nu- the strains grown on MH broth supplemented with 1.0% horse cleotide sequences by using the Basic Local Alignment Search blood were diluted 100 times with fresh broth. Five microliters Tool (BLAST) (2), and determined the nucleotide sequence of the (about 5 ϫ 103 to 5 ϫ 104 cells) of each dilution was transferred highly conserved quinolone resistance-determining region to MH agar plates supplemented with 1.0% horse blood contain- (QRDR) of the gyrA and parC genes as well as the vancomycin ing ampicillin, streptomycin, kanamycin, gentamicin, chloram- resistance–related genes. All the sequences reported here have phenicol, tetracycline, erythromycin, quinupristin-dalfopristin, been deposited in the DNA Data Bank of Japan, the European vancomycin, trimethoprim, linezolid, rifampin, clindamycin (Sig- Molecular Biology Laboratory, and the GenBank nucleotide se- ma, St. Louis, MO), or ciprofloxacin (MP Biomedicals, Illkirch, quence databases under accession numbers AB462548, France). Table 2 lists the MIC breakpoints suggested for Lacto- AB462549, AB462550, AB462551, and AB462552. bacillus by SCAN (17) and FEEDAP (18). We considered MICs higher than both of the suggested breakpoints as evidence of re- Detection of antibiotic resistance genes. We isolated ge- sistance (17, 18). nomic DNA from overnight Lactobacillus cultures by using IS- OPLANT (Nippon Gene, Tokyo, Japan) according to the manu- DNA sequencing, genome assembly, and coding sequence facturer’s protocol. We determined the presence of the following prediction. The Dragon Genomics Center, Takara Bio, Inc., using types of antibiotic resistance genes by PCR: tetracycline genes a 454 Life Sciences GS-20 sequencer, carried out the DNA se- encoding ribosomal protection proteins [tet(M), tet(O), tet(S), and quencing, genome assembly, and coding sequence prediction pro- tet(W)], genes encoding tetracycline efflux pumps [tet(K) and cedures necessary for draft sequencing of the whole genome. The tet(L)], and genes encoding glycopeptide resistance proteins (vanA, vanB, vanD, vanE, and vanG). We performed PCR by using TaKaRa Taq polymerase (Takara Bio, Shiga, Japan), a Ther- TABLE 2. MICs for Lactobacillus brevis KB290 and breakpoint mal Cycler Model 9600 (PerkinElmer, Waltham, MA), and the MICs for Lactobacillus primer sets listed in Table 3.

MICs for Conjugation experiments. We examined the transferability Lactobacillus brevis Breakpoint MICs for of antibiotic resistance from L. brevis KB290 to Enterococcus Antibiotic KB290 (␮g/ml) Lactobacillusa faecalis by filter mating, as follows. We grew donor and recipient Ampicillin 1 2/4 strains in nonselective broth medium to the mid-exponential phase ␮ Streptomycin 2 16/64 of growth (approximately 7 h), added the donor culture (100 l) ␮ Kanamycin 1 32/64 to the recipient culture (100 l), and filtered the mixture through ␮ Gentamicin Յ0.125 1/16 a sterile, mixed-cellulose ester filter (0.45 m; MF-Millipore Chloramphenicol 4 16/4 membrane filter, HAWP 02500, Millipore, Bedford, MA) by using Tetracycline 64 16/8 Swinnex filter holders (SX00 025 00, Millipore). We incubated Erythromycin Յ0.125 4/1 the filter overnight on brain heart infusion agar at optimal growth Quinupristin/dalfopristin 0.5 4/4 conditions for the recipient strain, washed the bacteria from the Vancomycin 32 4/NRb filters with 1 ml of brain heart infusion broth, and spread dilutions ␮ Trimethoprim Յ0.125 32/NR of the mating mixtures onto agar plates containing 10 g/ml tet- ␮ ␮ ␮ Ciprofloxacin 8 4/NR racycline, 8 g/ml vancomycin, 4 g/ml ciprofloxacin, 50 g/ml ␮ Linezolid 1 4/NR rifampin (Sigma), or 32 g/ml fusidic acid (Sigma), and incubated Rifampin 0.5 32/NR them for 48 h. We expressed transfer frequencies as the number Clindamycin 0.5 NR/1 of transconjugants per donor cell. We selected for transconjugants on agar plates containing 4 ␮g/ml ciprofloxacin, 10 ␮g/ml tetra- a Suggested by SCAN (17) and FEEDAP (18). cycline, or 8 ␮g/ml vancomycin, and for counter-selection of the b NR, not required. donor strain, 12.5 ␮g/ml rifampin and fusidic acid. For positive Name /food/72-07-44 08/24/2009 07:39AM Plate # 0-Composite pg 1925 # 3

J. Food Prot., Vol. 72, No. 9 ANTIBIOTIC RESISTANCE OF L. BREVIS KB290 1925

TABLE 3. PCR primers and conditions used in this study Target Amplicon Refer- gene Primer pair (5Ј→3Ј) PCR conditions size (bp) ence Positive control

vanA VanA1: GGGAAAACGACAATTGC 94ЊC for 1 min 25 cycles 732 14 E. faecalis VanA2: GTACAATGCGGCGTTA 50ЊC for 1 min BM4147 72ЊC for 2 min vanB VanB N3.1: TCCCCGGATAGGAAAACGCA 94ЊC for 1 min 25 cycles 522 14 E. faecalis V583 VanB N4.1: GATGCGG11GATACCGTGGC 50ЊC for 1 min 72ЊC for 2 min vanD ED1: TGTGGGATGCGATATTCAA 94ЊC for 1 min 30 cycles 500 13 None ED2: TGCAGCCAAGTATCCGGTAA 54ЊC for 1 min 72ЊC for 2 min Downloaded from http://meridian.allenpress.com/jfp/article-pdf/72/9/1923/1681776/0362-028x-72_9_1923.pdf by guest on 25 September 2021 vanE EE1: TGTGGTATCGGAGCTGCAG 94ЊC for 1 min 30 cycles 430 13 None EE2: ATAGTTTAGCTGGTAAC 54ЊC for 1 min 72ЊC for 2 min vanG EG1: CGGCATCCGCTGTTTTTGA 94ЊC for 1 min 30 cycles 941 13 None EG2: GAACGATAGACCAATGCCTT 54ЊC for 1 min 72ЊC for 2 min tet(M) DI: GAYACNCCNGGNCAYRTNGAYTT 94ЊC for 1 min 30 cycles 1,513 20 L. plantarum TetM-R: CACCGAGCAGGGATTTCTCCAC 55ЊC for 1 min LMG21684 72ЊC for 2 min tet(O) TetO-FW 1: AATGAAGATTCCGACAATTT 94ЊC for 1 min 30 cycles 781 20 None TetO-RV 1: CTCATGCGTTGTAGTATTCCA 55ЊC for 1 min 72ЊC for 2 min tet(S) TetS-FW: GAAAGCTTACTATACAGTAGC 94ЊC for 1 min 30 cycles 169 3 None TetS-RV: AGGAGTATCTACAATATTTAC 50ЊC for 1 min 72ЊC for 2 min tet(W) TetW-FW: GAGAGCCTGCTATATGCCAGC 94ЊC for 1 min 30 cycles 168 3 None TetW-RV: GGGCGTATCCACAATGTTAAC 64ЊC for 1 min 72ЊC for 2 min tet(K) TetK-FW 1: TTATGGTGGTTGTAGCTAGAAA 94ЊC for 1 min 30 cycles 348 20 None TetK-RV 1: AAAGGGTTAGAAACTCTTGAAA 55ЊC for 1 min 72ЊC for 2 min tet(L) TetL-FW 3: GTMGTTGCGCGCTATATTCC 94ЊC for 1 min 30 cycles 696 20 None TetL-RV 3: GTGAAMGRWAGCCCACCTAA 55ЊC for 1 min 72ЊC for 2 min

controls, we tested the transferability of erythromycin resistance ysis of the predicted open reading frames by BLAST from L. plantarum LMG21684 and E. faecalis JH2SS (pIP501 against the protein and nucleotide databases revealed no Em) and of tetracycline resistance from L. plantarum LMG2 1684 open reading frames of reported transferable resistance de- and 1687. For the negative control, we tested the transferability terminants in connection with insertion sequences, inte- of the intrinsic vancomycin resistance of Lactobacillus rhamnosus grons, or transposons for tetracycline or vancomycin. These GG. data were confirmed by using PCR primers specific for the RESULTS respective genes. PCR analysis showed that L. brevis KB290 did not give rise to the expected products for any Antibiotic susceptibility testing and MIC determi- of the transferable tetracycline or vancomycin resistance de- nations. Table 2 reports MICs of 14 antibiotics and tenta- terminants (Table 3), indicating that the strain did not en- tive breakpoint values. Of the 14 antibiotics tested, the code them. We did find chromosomally encoded vanco- MICs of only three—vancomycin, tetracycline, and cipro- mycin resistance–related genes that were not organized in floxacin—exceeded the breakpoint values for Lactobacil- an operon structure and had no flanking insertion sequenc- lus. Reference strains E. faecalis ATCC 29212 and Staph- es, integrons, or transposons. The genes showed a high de- ylococcus aureus ATCC 29213 fit the NCCLS criteria (data gree of similarity at the amino acid identity level with L. not shown) and were used to provide a MIC quality control plantarum intrinsic resistance genes, D-Ala-D-Lac ligase range (34). (70% amino acid identity), D-Lac dehydrogenase (64% Detection of antibiotic resistance genes. We used the amino acid identity), and D-Ala-D-Ala dipeptidase (76% gapped-genome sequences of the of L. brevis KB290 (un- amino acid identity) and a low level of amino acid identity published in-house data), to determine whether it contained with genes encoded on the transferable vanA operon of En- relevant antibiotic-resistance genes. Homology-based anal- terococcus faecium BM4147, VanA (33% amino acid iden- Name /food/72-07-44 08/24/2009 07:39AM Plate # 0-Composite pg 1926 # 4

1926 FUKAO ET AL. J. Food Prot., Vol. 72, No. 9

TABLE 4. Variation in the QRDRs of GyrA and ParC in LAB Amino acid (codon) at the positionsa: Ciproﬂoxacin Strain MIC (␮g/ml) GyrA, 83b GyrA, 87b ParC, 80b Reference

L. brevis KB290 8 Ser (TCA) Glu (GAA) Ser (AGT) This study L. acidophilus BFE7429 Ͼ32 Serc Leuc Serc 22 Enterococcus faecium ATCC19434 4 Ser (AGT) Glu (GAG) Ser (AGC) 15 E. faecium ATCC214 32 Ser (AGT) Lys (AAG) Ile (ATC) 15 E. faecium ATCC208 64 Arg (CGT) Glu (GAG) Ile (ATC) 15 E. faecium ATCC221 256 Ile (ATT) Glu (GAG) Ile (ATC) 15 E. faecium ATCC215 256 Tyr (TAT) Glu (GAG) Ile (ATC) 15

E. faecalis 139 25 Arg (AGA) Glu (GAG) Ile (ATC) 24 Downloaded from http://meridian.allenpress.com/jfp/article-pdf/72/9/1923/1681776/0362-028x-72_9_1923.pdf by guest on 25 September 2021 E. faecalis F121 50 Ser (AGT) Gly (GGA) Ile (ATT) 24

a Substituted amino acids that result in a resistant phenotype are presented in boldface text. b Positions correspond to Escherichia coli. c Relevant codon was not available.

tity), VanH (32% amino acid identity), and VanX (30% phenotypes did not transfer to the recipient strain in our amino acid identity). conjugation experiments. Sequence analysis showed that the L. brevis equivalent Ciprofloxacin, a fluoroquinolone, displays poor activity of the E. coli regions associated with fluoroquinolone re- against LABs, and its MICs range from 0.5 to 64 ␮g/ml sistance (Ser-83 and Asp-87 in GyrA, and Ser-80 and Glu- (22, 48). Fluoroquinolone resistance in gram-positive bac- 84 in ParC) were encoded chromosomally, and there had teria is associated with mutations in the QRDR of gyrA and been no substitutions (Table 4). No insertion sequences, in- parC (15, 22, 24, 26, 33, 36, 41). The highly resistant LAB tegrons, or transposons flanked the genes involved. strains (MIC Ͼ 32 ␮g/ml), however, had no amino acid Conjugation experiments. While the positive control substitutions in the QRDR of GyrA or ParC, indicating that tests were positive (Table 5), indicating that the experimen- gyrA or parC mutations were not responsible for the resis- tal conditions permitted the detectable transfer of antibiotic tance (22). Those findings along with our own indicate that resistance traits to E. faecalis, we did not detect L. brevis the slightly greater ciprofloxacin MIC for L. brevis KB290 KB290 transconjugants on any of the selective agar plates might arise from an intrinsic characteristic, such as cell wall (frequency of Ͻ4 ϫ 10Ϫ8 per donor cell), indicating that structure, permeability, or an efflux mechanism that results the ciprofloxacin, tetracycline, and vancomycin resistance in a borderline sensitivity, as defined by the SCAN and traits did not transfer to the recipient strain. FEEDAP criteria. Thirty-eight different tet genes have been identified. DISCUSSION The most widely distributed (found in 42 genera) is tet(M), In this study of probiotic strain L. brevis KB290, the which encodes a ribosomal protection protein (37). While MICs of ciprofloxacin, tetracycline, and vancomycin were, a number of tetracycline resistance genes [tet(K), tet(M), respectively, two, four, and eight times the SCAN recom- tet(O), tet(S), and tet(W)] have been identified in Lacto- mended breakpoint, and for tetracycline was eight times the bacillus (37), only tet(M) has been identified in 24 Tcr Lac- FEEDAP recommended breakpoint for Lactobacillus. tobacillus strains isolated from different types of fermented When we carried out a homology search of the open read- dry sausage (20). Lactobacillus isolates carrying the tet(M) ing frames based on a draft sequence of the whole genome, determinant usually show high levels of tetracycline resis- however, we found no transferable resistance determinants tance (MIC Ͼ 256 ␮g/ml). Four Lactobacillus isolates that and no mutations involved with insertion sequences, inte- show low levels of tetracycline resistance (MICs of 1, 4, grons, or transposons. Moreover, the antibiotic-resistant 12, and 16 ␮g/ml), however, do not carry tet genes (22),

TABLE 5. Conjugative transfer of Lactobacillus brevis KB290 antibiotic resistances by ﬁlter mating with Enterococcus faecalis FA2-2a Donor Antibiotic resistance (plasmid) Selective antibiotic Transfer frequency/donor cell

L. brevis KB290 Tc, Vm, Ci Tc Ͻ4.0 ϫ 10Ϫ8 L. brevis KB290 Tc, Vm, Ci Vm Ͻ4.0 ϫ 10Ϫ8 L. brevis KB290 Tc, Vm, Ci Ci Ͻ4.0 ϫ 10Ϫ8 L. plantarum LMG21684 Tc, Em Tc 1.2 ϫ 10Ϫ6 L. plantarum LMG21687 Tc Tc 6.9 ϫ 10Ϫ7 Enterococcus faecalis JH2SS Em, (pIP501) Em 3.9 ϫ 10Ϫ5 Lactobacillus rhamnosus GG Vm Vm Ͻ3.4 ϫ 10Ϫ9

a Tc, tetracycline; Vm, vancomycin; Ci, ciproﬂoxacin; Em, erythromycin. Name /food/72-07-44 08/24/2009 07:39AM Plate # 0-Composite pg 1927 # 5

J. Food Prot., Vol. 72, No. 9 ANTIBIOTIC RESISTANCE OF L. BREVIS KB290 1927

FIGURE 1. Alignment of deduced amino acid sequences of (A) D-Ala-D-Lac ligase, (B) D-Lac dehydrogenase, and (C) D-Ala- D-Ala dipeptidase from Lactobacillus brevis KB290 with VanA, VanH, and VanX ho- mologs from other LAB. The alignment was performed with ClustalW (43). Black and shaded boxes indicate amino acid identity and similarity, respectively. LbLdh (ATCC 367), Lactobacillus brevis (31); Lp, Lactobacillus plantarum (28); Lm, Leuco- nostoc mesenteroides Ldh (31). Downloaded from http://meridian.allenpress.com/jfp/article-pdf/72/9/1923/1681776/0362-028x-72_9_1923.pdf by guest on 25 September 2021 Name /food/72-07-44 08/24/2009 07:39AM Plate # 0-Composite pg 1928 # 6

1928 FUKAO ET AL. J. Food Prot., Vol. 72, No. 9

and only one (Lactobacillus reuteri SD2112) of six slightly VanH and 2-hydroxycarboxylic acid dehydrogenases. Gene 103: tetracycline-resistant Lactobacillus isolates tested with a 133–134. 6. Bischoff, K. M., K. A. Skinner-Nemec, and T. D. Leathers. 2007. gene-specific microarray encoded a tetracycline resistance Antimicrobial susceptibility of Lactobacillus species isolated from gene tet(W) (25). In the present study, L. brevis KB290 commercial ethanol plants. J. Ind. Microbiol. Biotechnol. 34:739– showed an intermediate level of resistance (MIC, 64 ␮g/ 744. ml), and we, too, did not identify tet(M), tet(O), tet(S), or 7. Borriello, S. P., W. P. Hammes, W. Holzapfel, P. Marteau, J. Schre- tet(W), nor did we identify known tetracycline resistance zenmeir, M. Vaara, and V. Valtonen. 2003. Safety of probiotics that determinants associated with insertion sequences, integrons, contain lactobacilli or bifidobacteria. Clin. Infect. Dis. 15:775–780. 8. Caplice, E., and G. F. Fitzgerald. 1999. Food fermentations: role of or transposons. The intermediate level of resistance in L. microorganisms in food production and preservation. Int. J. Food brevis KB290 may be the result of an unknown resistance Microbiol. 50:131–149. determinant or an intrinsic characteristic. 9. Cataloluk, O., and B. Gogebakan. 2004. Presence of antibiotic resistance in intestinal lactobacilli of dairy and human origin in Tur- L. brevis isolates are usually highly resistant to van- Downloaded from http://meridian.allenpress.com/jfp/article-pdf/72/9/1923/1681776/0362-028x-72_9_1923.pdf by guest on 25 September 2021 comycin (MICs of ϳ128 to 4,096 ␮g/ml), but no specific key. FEMS Microbiol. Lett. 236:7–12. 10. Danielsen, M., and A. Wind. 2003. Susceptibility of Lactobacillus resistance determinant has been identified (6, 10, 12, 19, spp. to antimicrobial agents. Int. J. Food Microbiol. 82:1–11. 46, 48), and the resistance is believed to be an intrinsic 11. Deghorain, M., P. Goffin, L. Fontaine, J. L. Mainardi, R. Daniel, J. characteristic of the strains. The vancomycin MIC is lower Errington, B. Hallet, and P. Hols. 2007. Selectivity for D-lactate in- for L. brevis KB290 (32 ␮g/ml) than it is for other L. brevis corporation into the peptidoglycan precursors of Lactobacillus plan- isolates. We found vancomycin resistance–related genes tarum: role of Aad, a VanX-like D-alanyl-D-alanine dipeptidase. J. Bacteriol. 189:4332–4337. that were chromosomally encoded, not organized in an op- 12. Delgado, S., A. B. Flo´rez, and B. Mayo. 2005. Antibiotic suscepti- eron structure, and had no insertion sequences, integrons, bility of Lactobacillus and Bifidobacterium species from the human or transposons flanking them. These genes showed high de- gastrointestinal tract. Curr. Microbiol. 50:202–207. gree of similarity at the amino acid identity level with the 13. Depardieu, F., B. Perichon, and P. Courvalin. 2004. Detection of the intrinsic resistance genes of L. plantarum NCIMB8826 van alphabet and identification of enterococci and staphylococci at (Fig. 1), whose vancomycin resistance is caused by the syn- the species level by multiplex PCR. J. Clin. Microbiol. 42:5857– 5860. thesis of a peptidoglycan precursor ending with D-lactate 14. Dutka-Malen, S., S. Evers, and P. Courvalin. 1995. Detection of instead of D-alanine (11). They also showed a low level of glycopeptide resistance genotypes and identification to the species amino acid identity with the transferable van genes of the level of clinically relevant enterococci by PCR. J. Clin. Microbiol. Enterococcus strain, but the vancomycin resistance of L. 33:24–27. brevis KB290 did not transfer to a recipient Enterococcus 15. El Amin, N. A., S. Jalal, and B. Wretlind. 1999. Alterations in GyrA and ParC associated with fluoroquinolone resistance in Enterococcus strain. These results imply that L. brevis KB290, like L. faecium. Antimicrob. Agents Chemother. 43:947–949. plantarum, produces a modified peptidoglycan precursor 16. European Commission. 2003. On a generic approach to the safety that causes intrinsic resistance to vancomycin. assessment of micro-organisms used in feed/food and feed/food pro- In conclusion, this study demonstrated that the degree duction. A working paper open for comment. European Commission, of antibiotic resistance observed in L. brevis KB290, which Brussels. 17. European Commission. 2005. Opinion of the Scientific Committee is lower than resistance observed in other Lactobacillus on Animal Nutrition on the criteria for assessing the safety of micro- strains, including other L. brevis probiotic or starter strains, organisms resistant to antibiotics of human clinical and veterinary was attributable to nontransferable intrinsic resistance, and importance. European Commission, Brussels. that L. brevis KB290 fulfills the safety requirements for 18. European Food Safety Authority. 2008. Update of the criteria used probiotic strains. in the assessment of bacterial resistance to antibiotics of human or veterinary importance. EFSA J. 732:1–15. ACKNOWLEDGMENTS 19. Flo´rez, A. B., S. Delgado, and B. Mayo. 2005. Antimicrobial susceptibility of lactic acid bacteria isolated from a cheese environment. We thank Drs. Shuhei Fujimoto, Koichi Tanimoto, and Takako Inoue Can. J. Microbiol. 51:51–58. (Gunma University Graduate School of Medicine) for constant support 20. Gevers, D., M. Danielsen, G. Huys, and J. Swings. 2003. Molecular and guidance. We also thank Dr. Elizabeth Kamei for helpful advice and characterization of tet(M) genes in Lactobacillus isolates from dif- Dr. Miriam Bloom (SciWrite Biomedical Writing and Editing Services) ferent types of fermented dry sausage. Appl. Environ. Microbiol. 69: for professional editing. 1270–1275. 21. Gevers, D., G. Huys, and J. Swings. 2003. In vitro conjugal transfer REFERENCES of tetracycline resistance from Lactobacillus isolates to other gram- 1. Aguirre, M., and M. D. Collins. 1993. Lactic acid bacteria and hu- positive bacteria. FEMS Microbiol. Lett. 8:125–130. man clinical infection. J. Appl. Bacteriol. 75:95–107. 22. Hummel, A. S., C. Hertel, W. H. Holzapfel, and C. M. Franz. 2007. 2. Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. Antibiotic resistances of starter and probiotic strains of lactic acid 1990. Basic local alignment search tool. J. Mol. Biol. 215:403–410. bacteria. Appl. Environ. Microbiol. 73:730–739. 3. Aminov, R. I., N. Garrigues-Jeanjean, and R. I. Mackie. 2001. Mo- 23. Ike, Y., K. Tanimoto, H. Tomita, K. Takeuchi, and S. Fujimoto. 1998. lecular ecology of tetracycline resistance: development and valida- Efficient transfer of the pheromone-independent Enterococcus fae- tion of primers for detection of tetracycline resistance genes encod- cium plasmid pMG1 (Gmr) (65.1 kilobases) to Enterococcus strains ing ribosomal protection proteins. Appl. Environ. Microbiol. 67:22– during broth mating. J. Bacteriol. 180:4886–4892. 32. 24. Kanematsu, E., T. Deguchi, M. Yasuda, T. Kawamura, Y. Nishino, 4. Ammor, M. S., A. B. Flo´rez, and B. Mayo. 2007. Antibiotic resis- and Y. Kawada. 1998. Alterations in the GyrA subunit of DNA gyr- tance in non-enterococcal lactic acid bacteria and bifidobacteria. ase and the ParC subunit of DNA topoisomerase IV associated with Food Microbiol. 24:559–570. quinolone resistance in Enterococcus faecalis. Antimicrob. Agents 5. Arthur, M., C. Molinas, S. Dutka-Malen, and P. Courvalin. 1991. Chemother. 42:433–435. Structural relationship between the vancomycin resistance protein 25. Kastner, S., V. Perreten, H. Bleuler, G. Hugenschmidt, C. Lacroix, Name /food/72-07-44 08/24/2009 07:39AM Plate # 0-Composite pg 1929 # 7

J. Food Prot., Vol. 72, No. 9 ANTIBIOTIC RESISTANCE OF L. BREVIS KB290 1929

and L. Meile. 2006. Antibiotic susceptibility patterns and resistance mutations in enterococci from environmental samples with reduced genes of starter cultures and probiotic bacteria used in food. Syst. susceptibility to ciprofloxacin. FEMS Microbiol. Lett. 231:73–76. Appl. Microbiol. 29:145–155. 37. Roberts, M. C. 2005. Update on acquired tetracycline resistance 26. Kawamura, Y., H. Fujiwara, N. Mishima, Y. Tanaka, A. Tanimoto, genes. FEMS Microbiol. Lett. 245:195–203. S. Ikawa, Y. Itoh, and T. Ezaki. 2003. First Streptococcus agalactiae 38. Saarela, M., L. La¨hteenma¨ki, R. Crittenden, S. Salminen, and T. Mat- isolates highly resistant to quinolones, with point mutations in gyrA tila-Sandholm. 2002. Gut bacteria and health foods—the European and parC. Antimicrob. Agents Chemother. 47:3605–3609. perspective. Int. J. Food Microbiol. 15:99–117. 27. Kishi, A., K. Uno, Y. Matsubara, C. Okuda, and T. Kishida. 1996. 39. Sahm, D. F., J. Kissinger, M. S. Gilmore, P. R. Murray, R. Mulder, Effect of the oral administration of Lactobacillus brevis subsp. coag- J. Sollyday, and B. Clarke. 1989. In vitro susceptibility studies of ulans on interferon-alpha producing capacity in humans. J. Am. Coll. vancomycin-resistant Enterococcus faecalis. Antimicrob. Agents Nutr. 15:408–412. Chemother. 33:1588–1591. 28. Kleerebezem, M., J. Boekhorst, R. van Kranenburg, D. Molenaar, O. 40. Salminen, S., A. von Wright, L. Morelli, P. Marteau, D. Brassart, W. P. Kuipers, R. Leer, R. Tarchini, S. A. Peters, H. M. Sandbrink, M. M. de Vos, R. Fondeń, M. Saxelin, K. Collins, G. Mogensen, S. E. W. Fiers, W. Stiekema, R. M. Lankhorst, P. A. Bron, S. M. Hoffer, Birkeland, and T. Mattila-Sandholm. 1998. Demonstration of safety Downloaded from http://meridian.allenpress.com/jfp/article-pdf/72/9/1923/1681776/0362-028x-72_9_1923.pdf by guest on 25 September 2021 M. N. Groot, R. Kerkhoven, M. de Vries, B. Ursing, W. M. de Vos, of probiotics—a review. Int. J. Food Microbiol. 44:93–106. and R. J. Siezen. 2003. Complete genome sequence of Lactobacillus 41. Schmitz, F. J., M. E. Jones, B. Hofmann, B. Hansen, S. Scheuring, plantarum WCFS1. Proc. Natl. Acad. Sci. USA 100:1990–1995. M. Luckefahr, A. Fluit, J. Verhoef, U. Hadding, H. P. Heinz, and K. 29. Leclercq, R., E. Derlot, J. Duval, and P. Courvalin. 1988. Plasmid- Kohrer. 1998. Characterisation of grlA, grlB, gyrA, and gyrB muta- mediated resistance to vancomycin and teicoplanin in Enterococcus tions in 116 unrelated isolates of Staphylococcus aureus and effects faecium. N. Engl. J. Med. 319:157–161. of mutations on ciprofloxacin MIC. Antimicrob. Agents Chemother. 30. Leroy, F., and L. De Vuyst. 2004. Lactic acid bacteria as functional 42:1249–1252. 42. Teuber, M., L. Meile, and F. Schwarz. 1999. Acquired antibiotic re- starter cultures for the food fermentation industry. Trends Food. Sci. sistance in lactic acid bacteria from food. Antonie Leeuwenhoek 76: Tech. 15:67–78. 15–37. 31. Makarova, K., A. Slesarev, Y. Wolf, A. Sorokin, B. Mirkin, E. Koon- 43. Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. CLUSTAL in, A. Pavlov, N. Pavlova, V. Karamychev, N. Polouchine, V. Shak- W: improving the sensitivity of progressive multiple sequence align- hova, I. Grigoriev, Y. Lou, D. Rohksar, S. Lucas, K. Huang, D. M. ment through sequence weighting, position-specific gap penalties Goodstein, T. Hawkins, V. Plengvidhya, D. Welker, J. Hughes, Y. and weight matrix choice. Nucleic Acids Res. 22:4673–4680. Goh, A. Benson, K. Baldwin, J. H. Lee, I. Dıáz-Mun˜iz, B. Dosti, V. 44. Tynkkynen, S., K. V. Singh, and P. Varmanen. 1998. Vancomycin Smeianov, W. Wechter, R. Barabote, G. Lorca, E. Altermann, R. resistance factor of Lactobacillus rhamnosus GG in relation to en- Barrangou, B. Ganesan, Y. Xie, H. Rawsthorne, D. Tamir, C. Parker, terococcal vancomycin resistance (van) genes. Int. J. Food Micro- F. Breidt, J. Broadbent, R. Hutkins, D. O’Sullivan, J. Steele, G. Unlu, biol. 41:195–204. M. Saier, T. Klaenhammer, P. Richardson, S. Kozyavkin, B. Weimer, 45. Ulrich, A., and T. Mu¨ller. 1999. Heterogeneity of plant-associated and D. Mills. 2006. Comparative genomics of the lactic acid bac- streptococci as characterized by phenotypic features and restriction teria. Proc. Natl. Acad. Sci. USA 103:15611–15616. analysis of PCR-amplified 16S rRNA. J. Appl. Microbiol. 84:293– 32. Mathur, S., and R. Singh. 2005. Antibiotic resistance in food lactic 303. acid bacteria—a review. Int. J. Food Microbiol. 15:281–295. 46. Vay, C., R. Cittadini, C. Barberis, C. Hernań Rodrı´guez, H. Perez 33. Munõz, R., and A. G. De La Campa. 1996. ParC subunit of DNA Martıńez, F. Genero, and A. Famiglietti. 2007. Antimicrobial sus- topoisomerase IV of Streptococcus pneumoniae is a primary target ceptibility of non-enterococcal intrinsic glycopeptide-resistant gram- of fluoroquinolones and cooperates with DNA gyrase A subunit in positive organisms. Diagn. Microbiol. Infect. Dis. 57:183–188. forming resistance phenotype. Antimicrob. Agents Chemother. 40: 47. Wood, B. J. B., and W. H. Holzapfel. 1995. The genera of lactic 2252–2257. acid bacteria. Blackie Academic and Professional, London. 34. National Committee for Clinical Laboratory Standards. 2000. Meth- 48. Zarazaga, M., Y. Saénz, A. Portillo, C. Tenorio, F. Ruiz-Larrea, R. ods for dilution antimicrobial susceptibility tests for bacteria that Del Campo, F. Baquero, and C. Torres. 1999. In vitro activities of grow aerobically, 5th ed. Approved standard M7-A4. National Com- ketolide HMR3647, macrolides, and other antibiotics against Lac- mittee for Clinical Laboratory Standards, Wayne, PA. tobacillus, Leuconostoc, and Pediococcus isolates. Antimicrob. 35. Nomura, M., M. Kobayashi, T. Narita, H. Kimoto-Nira, and T. Oka- Agents Chemother. 43:3039–3041. moto. 2006. Phenotypic and molecular characterization of Lactococ- 49. Zhou, J. S., C. J. Pillidge, P. K. Gopal, and H. S. Gill. 2005. Anti- cus lactis from milk and plants. J. Appl. Microbiol. 101:396–405. biotic susceptibility profiles of new probiotic Lactobacillus and Bi- 36. Petersen, A., and L. B. Jensen. 2004. Analysis of gyrA and parC fidobacterium strains. Int. J. Food Microbiol. 98:211–217.