Effect of the Intake of a Traditional Mexican Beverage Fermented with Lactic Acid Bacteria on Academic Stress in Medical Students

Home , Lactobacillus brevis, Lactobacillus helveticus

nutrients

Article Effect of the Intake of a Traditional Mexican Beverage Fermented with Lactic Acid Bacteria on Academic Stress in Medical Students

Laura Márquez-Morales 1 , Elie G. El-Kassis 1 , Judith Cavazos-Arroyo 2 , Valeria Rocha-Rocha 1, Fidel Martínez-Gutiérrez 3 and Beatriz Pérez-Armendáriz 1,*

1 Biological Science Department, Universidad Popular Autónoma del Estado de Puebla, Puebla 72410, Mexico; [email protected] (L.M.-M.); [email protected] (E.G.E.-K.); [email protected] (V.R.-R.) 2 Social Science Department, Universidad Popular Autónoma del Estado de Puebla, Puebla 72410, Mexico; [email protected] 3 Center for Research in Health Sciences and Biomedicine, Faculty of Chemical Science, Universidad Autónoma de San Luis Potosí, San Luis Potosi 78290, Mexico; ﬁ[email protected] * Correspondence: [email protected]; Tel.: +52-(222)-2299400 (ext. 7774)

Abstract: Dysbiosis of the gut microbiota has been associated with different illnesses and emotional disorders such as stress. Traditional fermented foods that are rich in probiotics suggest modulation of dysbiosis, which protects against stress-induced disorders. The academic stress was evaluated in medical students using the SISCO Inventory of Academic Stress before and after ingestion of an aguamiel-based beverage fermented with Lactobacillus plantarum, Lactobacillus paracasei and Lactobacil- Citation: Márquez-Morales, L.; lus brevis (n = 27) and a control group (n = 18). In addition, microbial phyla in feces were quantified El-Kassis, E.G.; Cavazos-Arroyo, J.; by qPCR. The results showed that the consumption of 100 mL of a beverage fermented with lactic Rocha-Rocha, V.; Martínez-Gutiérrez, acid bacteria (3 × 108 cfu/mL) for 8 weeks significantly reduced academic stress (p = 0.001), while the F.; Pérez-Armendáriz, B. Effect of the Intake of a Traditional Mexican control group (placebo intervention) had no significant changes in the perception of academic stress Beverage Fermented with Lactic Acid (p = 0.607). Significant change (p = 0.001) was shown in the scores for environmental demands, and Bacteria on Academic Stress in physical and psychological factors. Consumption of the fermented beverage significantly increased Medical Students. Nutrients 2021, 13, the phyla Firmicutes and Bacteroidetes but not Gammaproteobacteria. No significant changes were 1551. https://doi.org/10.3390/ found in the control group, except for a slight increase in the phylum Firmicutes. The intake of this nu13051551 fermented beverage suggest a modulation of gut microbiota and possible reduction in stress-related symptoms in university students, without changing their lifestyle or diet. Academic Editor: Alessandra Bordoni Keywords: aguamiel; academic stress; lactic acid bacteria; dysbiosis; gut microbiota; medical students Received: 31 March 2021 Accepted: 26 April 2021 Published: 5 May 2021 1. Introduction Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in Various studies have shown that gut microbiota are linked to stress due to the constant, published maps and institutional affil- bidirectional communication on the microbiota–gut–brain axis [1–3]. However, the totality iations. of communication pathways has yet to be detected, which is a challenge for future studies. Synbiotics, probiotics and prebiotics appear to have the ability to modulate microbiota, which have a close relationship with axis communication and its effect on stress reduction. Gut microbiota are seen to be altered by stress and produce communication inconsis- tencies on the gut microbiota–brain axis when stress becomes chronic [4]. Experiencing Copyright: © 2021 by the authors. Licensee MDPI, Basel, Switzerland. stress has been shown to release cortisol, which activates the hypothalamic–pituitary– This article is an open access article adrenal axis (HPA) [5]. The hypothalamus sends signals that activate the secretion of distributed under the terms and corticotropin releasing hormone (CRH), which, in turn, triggers the release of the adreno- conditions of the Creative Commons corticotropic hormone (ACTH) leading to the secretion of glucocorticoids in the adrenal Attribution (CC BY) license (https:// cortex [6]. As a result, norepinephrine and dopamine are released [7], causing an imbalance creativecommons.org/licenses/by/ in the composition of the gut microbiota and, with that, in the gut bacterial phyla, and 4.0/). neuronal alterations [8,9].

Nutrients 2021, 13, 1551. https://doi.org/10.3390/nu13051551 https://www.mdpi.com/journal/nutrients Nutrients 2021, 13, 1551 2 of 18

The gut microbiota can be defined as the community of microorganisms and viruses, whose concentration is estimated to be approximately in the order of 1013–1014 and which interact synbiotically in the human intestine [10–12]. Representative phyla of the gut microbiota include Firmicutes, Bacteroidetes, Proteobacteria, Actinobacteria, Archaea, Fu- sobacteria and Verrucomicrobiota [13–15]. Previous studies have shown that the genera Lactobacillus and Bifidobacteria, belonging to the phyla Firmicutes and Actinobacteria, respectively, are producers of gamma-aminobutiric acid and serotonin [16], both of which are altered in stressed individuals [17], causing dysbiosis characterized by the growth of enterobacteriaceae capable of producing norepinephrine [18,19]. This leads to a stress feedback loop. These bacterial changes in the gut microbiota can lead to depression and anxiety [20,21], impairment of memory and reasoning [22,23], sleep disorders [24] and irritable bowel syndrome [25], all of which have been detected in university students. In recent years, medical students have been reported to present particularly high stress levels due to being exposed to many academic demands [26–28]. Preclinical studies have shown that stool samples, obtained from university students after a high-stress situation such as an examination period, evidenced a marked reduction in lactic acid microorganisms [29,30] (Figure1). Another clinical study showed that subjects suffering from stress-related irritable bowel syndrome presented an increase in the phyla Proteobacteria and Barnesiella, but a decrease in Firmicutes and Bacteroidetes [31]. In addition, people in a state of depression—a mental illness that, on many occasions, presents in stressed students—showed an increase in Bacteroidetes, Proteobacteria and Actinobacteria and a decrease in Firmicutes [32]. In animal studies, dysbiosis has also been observed in gut microbiota when subjects were exposed to social disruption [33,34]. Recent studies have sought to restore balance to the gut microbiota through synbiotic foods that appear to have a beneficial effect on human health and the neuronal functions of the brain [35]. Synbiotics are a mix of probiotics and prebiotics. Probiotics are living microorganisms which, at the right dose, improve health. Prebiotics, in contrast, are substances which cannot be digested by the body, but which induce the growth and activity of probiotics [36]. Earlier studies of interventions with Lactobacillus casei Shirota probiotics have demon- strated a reduction in stress as well as favorable effects on intestinal dysfunction problems and changes in the microbial diversity of the gut [37]. Analysis of the consumption of the synbiotic Ecologic®825, which contains different strains of Lactobacillus and Bifidobacteria, evidenced changes in emotional memory, reasoning and emotional decision-making [38], abilities that are diminished under stress. Meanwhile, sleep quality and symptoms of anxiety and depression in stressed students were improved with the use of heat-activated Lactobacillus gasseri strain CP2305. Furthermore, an increase was shown in the genus Bifi- dobacterium, as well as a reduction in streptococci [39]. On the other hand, nine lyophilized strains of the genera Lactobacillus and Bifidobacterium, in the synbiotic Ecologic®Barrier, improve cognition in depressed university students, without reducing depression [40]. Recently, there has been a great interest in demonstrating the relationship of prebiotic and probiotic consumption on mental health, as shown in Table1. Previous studies have shown that traditional fermented foods are a good source of probiotics and prebiotics that can modulate the gut microbiota [48,49]. In Mexico, pulque, a pre- Hispanic millennial drink, is a good source of lactic acid bacteria (LAB) [50,51]. Aguamiel is rich in fiber, which acts as a prebiotic, and contains fructooligosaccharides—short polymers of fructose (inulin)—which promote the survival of probiotics in the colon [52]. Aguamiel can also help regulate the gut microbiota [53]. There are few studies of experimental interventions with synbiotics made from products such as pulque and Aguamiel, particularly in stressed university students. Nutrients 2021, 13, x FOR PEER REVIEW 2 of 20

cotropin releasing hormone (CRH), which, in turn, triggers the release of the adrenocorti- cotropic hormone (ACTH) leading to the secretion of glucocorticoids in the adrenal cortex [6]. As a result, norepinephrine and dopamine are released [7], causing an imbalance in the composition of the gut microbiota and, with that, in the gut bacterial phyla, and neuronal alterations [8,9]. The gut microbiota can be defined as the community of microorganisms and viruses, whose concentration is estimated to be approximately in the order of 1013–1014 and which interact synbiotically in the human intestine [10–12]. Representative phyla of the gut microbiota include Firmicutes, Bacteroidetes, Proteobacteria, Actinobacteria, Archaea, Fuso- bacteria and Verrucomicrobiota [13–15]. Previous studies have shown that the genera Lac- tobacillus and Bifidobacteria, belonging to the phyla Firmicutes and Actinobacteria, respectively, are producers of gamma-aminobutiric acid and serotonin [16], both of which are altered in stressed individuals [17], causing dysbiosis characterized by the growth of enterobacteriaceae capable of producing norepinephrine [18,19]. This leads to a stress feedback loop. These bacterial changes in the gut microbiota can lead to depression and anxiety [20,21], impairment of memory and reasoning [22,23], sleep disorders [24] and irritable bowel syndrome [25], all of which have been detected in university students. In recent years, medical students have been reported to present particularly high stress levels due to being exposed to many academic demands [26–28]. Preclinical studies have shown that stool samples, obtained from university students after a high-stress situation such as an examination period, evidenced a marked reduction in lactic acid microorganisms [29,30] (Figure 1). Another clinical study showed that subjects suffering from stress-related irritable bowel syndrome presented an increase in the phyla Proteobacteria and Barnesiella, but a decrease in Firmicutes and Bacteroidetes [31]. In addition, people in a state of depression—a mental illness that, on many occasions, presents in stressed students—showed an increase in Bacteroidetes, Proteobacteria and Actinobacteria and a Nutrients 2021, 13, 1551 decrease in Firmicutes [32]. In animal studies, dysbiosis has also been observed3 ofin 18 gut microbiota when subjects were exposed to social disruption [33,34].

Figure 1. (A) The healthy microbiota mainly indicates genera Lactobacilli and Bacteroides that maintain a normal production of short chain fatty acids (SCFAs) and neurotransmitters such as serotonin, giving a better response to stress and returning to the basal state. The intestinal microbiota, when in balance (Eubiosis), allow an interaction with the vague nerve that maintains the normal metabolism of tryptophan, a precursor of serotonin, and the secretion of gamma aminobutyric acid to generate a healthy psychological and emotional state, in addition to maintaining adequate intestinal secretion and motility. The reduction in pathogenic bacteria in the intestine is controlled by the beneficial microbiota, and the secretion of antimicrobials by the Paneth cells increases the production of glucagon-like peptide (GLP1) that exerts beneficial effects on the metabolism of glucose and glucagon-like peptide-2 (GLP2) that maintains the integrity of the membrane. (B) Dysbiosis refers to a reduced community of beneficial bacteria and an increased number of pathogenic bacteria. When there is stress, the HPA axis and the sympathetic system are deregulated; therefore, the adrenal glands maintain elevated levels of cortisol, epinephrine, and norepinephrine; this leads to a constant feedback to stress with the reduction in SCFAs and the alteration of neurotransmitter levels. The heart rate and energy requirements increase, causing the consumption of a caloric diet. The low-fiber, high-fat diet causes the fermentation of metabolites by the intestinal microbiota to be abnormal. The production of the GLP2 peptide is decreased; therefore, intestinal permeability is increased; this allows the increase in pathogenic bacteria and lipopolysaccharides (LPS), causing loss of intestinal function.

The aim of this research was to assess the effect of a traditional beverage (Aguamiel) fermented with lactic acid bacteria (L. plantarum, L. paracasei and L. brevis) on stressed medical students using the SISCO Academic Stress Questionnaire and a qPCR assay of three phyla in the microbiota of feces to produce healthy regional food alternatives and mitigate the effects of stress. It is important to note that Lactobacillus plantarum, Lactobacillus paracasei and Lactobacillus brevis were recently reclassiﬁed as Lactiplantibacillus plantarum, Lacticaseibacillus paracasei, Levilactobacillus brevis, respectively [54]. Nutrients 2021, 13, 1551 4 of 18

Table 1. Interventions with probiotics, prebiotics and synbiotics in stressed individuals.

Disease or Disorder Product Treated Subjects Probiotics Prebiotics Beneficial Health Effects Time References (Country) Decreased abdominal L. casei shirota YIT Stress 23 men and Fermented dysfunction, abdominal (Japan) Probiotic 25 women 9029 8 weeks [37] (<30 years) 1 × 1011 CFU/mL milk pain, feelings of stress, cortisol reduction. Anxiety, Improves symptoms 29 medical Lactobacillus gasseri associated with stress. depression, CP2305 Fermented Synbiotic students, both milk CP2305 Increase in Bifidobacteria 24 weeks [39] stress sexes 1 × 1010 cells and decrease in (Japan) Streptococci 33 medical Favorable effect on Para- Lactobacillus gasseri physical symptoms and Insomnia psychobiotic students, both Fermented (Japan) CP2305 5 weeks [41] CP2305 sexes 1 × 1010 cells milk CP2305 sleep quality associated (18–34 years) with stress Lactobacillus casei Improves the quality of Stress 49 4th grade Probiotic shirota Fermented sleep according to the 11 weeks [42] (Japan) medical students milk 1 × 109 CFU/mL OSA analysis. Lactobacillus casei Cortisol reduction, Stress 70 medical shirota Fermented decreased abdominal (Japan) Probiotic 8 weeks [43] students 1 × 109 CFU/mL milk discomfort, and stress flu. It can control HPA in rats. Lactobacillus gasseri 219 healthy , Bifidobacterium Stress PA bifidum MF, Reduction in stress and (France) Probiotic volunteers fatigue 32 days [44] (18 to 70 years) Bifidobacterium longum SP Undergraduate Bifidobacterium students: n = 145 longum ssp. Infantis for L. helveticus R0033, Improvements in Stress Bifidobacterium symptoms of diarrhea, Probiotic R0052, 6 weeks [45] (USA) n = 142 for B. bifidum R0071 and constipation and bifidum R007, Lactobacillus abdominal pain. n = 147 for B. helveticus R0052 infantis R0033 3 × 109 CFU Lactobacillus Significant increase in acidophilus, serum sex hormone Stress 30 women Lactobacillus casei binding globulin. (Iran) Symbiotic (18–40 years) and Bifidobacterium Inulin Reduction in serum 12 weeks [46] bifidum insulin levels. Nitric oxide × 9 increase. Beneficial effect 2 10 CFU/g on C-reactive protein Lactobacillus acidophilus, Obesity Lactobacillus casei, Symbiotic 30 men and Inulin Decrease in body weight, 8 weeks [47] (Iran) 20 women Bifidobacterium stress, anxiety bifidum 2 × 109 CFU

2. Materials and Methods 2.1. Sampling and Study Design This clinical trial was approved by the Research Ethics Committee of the Health Sciences department of the Popular Autonomous University of the State of Puebla (CON- BIOETICA21CEI00620131021), Puebla, Mexico, and followed the 1975 Helsinki protocol on human experimentation standards. A single blind, randomized, longitudinal, prospective, experimental, controlled study was conducted. The methodology was divided into two phases: Phase I, elaboration of the fermented beverage with lactic acid bacteria (FBLAB) and elaboration of the placebo, and Phase II, the intervention. The sample comprised 52 male and female students between the ages of 20 and 25. All were Mexican and studying medicine at the private university in the city of Puebla, Mexico. The sample was split into two groups: the experimental group (EXP), n = 27, who consumed the FBLAB, and the control group (CTL), n = 18, who consumed the placebo beverage. Levels N1 and N2 were considered low stress; levels N3, N4 and N5 high stress. Students with a history of anxiety, bipolar disorder, epilepsy, schizophrenia, insomnia or any other neurological disorder, and pregnant women, were excluded. In addition, anyone who had consumed any kind of drug in the four months prior to the trial and/or was under treatment with antidepressants was excluded. The product was delivered once a week, the bottles were labeled with the Nutrients 2021, 13, 1551 5 of 18

name of the day (Monday, Tuesday, etc.) and it was ensured that the participants followed the directions of the exclusion criteria. Furthermore, other aspects of the lifestyle were not controlled (such as smoking, eating, drinking and exercising) to evidence the effects of consumption of the FBLAB under conditions similar to real life. Students who did not provide the information necessary for the measuring instruments or who did not ﬁnish the treatment were withdrawn from the study. Participation was voluntary. An informed consent form, explaining the study in detail, was signed. Study participants received no compensation or economic support.

2.2. Phase I. Elaboration of the FBLAB and Placebo Beverages 2.2.1. Isolation and Selection of Microorganisms from Pulque Three microorganisms of the genus Lactobacillus were isolated from samples of pulque acquired in San Pedro Cholula, Puebla, Mexico. A seed culture was made with 0.1 mL of pulque in 10 mL of Mann Rogosa Sharpe (MRS) broth medium (Merk, Kenilworth, NJ, USA) and incubated at 37 ◦C under anaerobic conditions for 48 h. The decimal dilution technique and cross-streaking on MRS agar medium was used until pure strains were obtained [55]. The puriﬁed strains were then evaluated with the Gram stain and catalase test to prove that they were lactic acid bacteria. In addition, microbial growth was quantiﬁed through growth kinetic studies for 48 h (turbidimetry). The analysis was conducted using UV visible spectrophotometry (model 4255, Seville, Spain) at 560 nm.

2.2.2. Identification of Isolated Strains with LAB Characteristics The strains used in this study were identified by MALDI-TOF (Matrix Assisted Laser Desorption Ionization-Time of Flight) mass spectrometry, with 2.2 software (Bruker Dal- tonics, Billerica, MA) (Bruker, Germany). The isolated strains had the following scores based on mass spectrometry identification: 2.078 Lactobacillus plantarum, 2.374 Lactobacillus paracasei and 2.23 Lactobacillus brevis. Bacterial DNA extraction was performed in triplicate from a 5 mL culture of each of the three strains, using the Quick DNA Fecal/Soil Microbe Miniprep kit (Zymo Research, Irvine, CA, USA), following the manufacturer’s instructions. The integrity and quantity of extracted DNA was verified using the Genova NanoDrop (Jenway™, Bibby Scientific, Burlington, NJ, USA) spectrophotometer to quantify the DNA, measuring absorbance at 260 nm and 280 nm.

2.2.3. Elaboration of FBLAB The Aguamiel was pasteurized at 80 ◦C for 30 min and sucrose added to bring its content to 10◦ Brix. When the beverage was at room temperature, a mixed bacterial inoculum made up of L. plantarum, L. paracasei and L. brevis was added at a concentration of 1%, with an ODλ600 nm between 0.6 and 0.8, and fermented for 14 h. The beverage must reach a probiotic concentration of 3 × 108 cfu/mL. Subsequently, a previously pasteurized coconut ﬂavoring (COCO DREAM®) was added. Packaging was conducted under sterile conditions using previously pasteurized containers and conserved at 4 ◦C. The detailed methodology was in accordance with the provisions of patent No. 371480 (Mexico) [56].

2.2.4. Elaboration of the Placebo Beverage The placebo beverage was made from coconut water and ﬂavoring (COCO DREAM®). The process consisted of pasteurizing the coconut water at 80 ◦C for 30 min, before the Brix degrees were standardized at 10 and ﬂavoring was added at a concentration of 0.2%. The beverage was packaged and conserved under the same sterile conditions as the probiotic beverage.

2.3. Phase II. Student Intervention with FBLAB and the Placebo Beverage 2.3.1. Trial Design The trial was experimental, longitudinal, single-blind, exploratory, with non-randomized sampling. The beverages were delivered to the students for the consumption of 100 mL Nutrients 2021, 13, 1551 6 of 18

per day for a period of two months from 10 April to 10 June 2019. The administration of the beverages was monitored through reminder messages and veriﬁcation of consumption. The SISCO questionnaire was applied before and after the intervention. Stool samples were collected from each study subject before and after the intervention to determine the gut microbiota.

2.3.2. Instrument The instrument used in this study was the SISCO Inventory of Academic Stress. This survey is an instrument proposed and validated by Barraza [57] for the study of chronic academic stress. It measures the adverse effect of stress on the behavior and health of students and was previously applied in other Latin American countries [58,59]. Data collection was performed by applying the questionnaire in the classroom during the summer academic term. It was applied individually and had a duration of 15 min. The Cronbach’s alpha obtained was 0.90. The instrument consisted of 1 dichotomous ﬁlter item that decides whether the respondent will continue with the survey. Stress in general was determined by one question with a ﬁve-value Likert-type scale (1 to 5, where 1 is low and 5 is high) to identify the intensity of academic stress. This was followed by 29 items, which are answered using a 5-value Likert-type scale (Never, Almost Never, Sometimes, Almost Always, and Always). These items are divided into three sections: Stressors (8 items), Symptoms (15 items) and Coping Strategies (6 items) [57,60].

2.3.3. Statistical Method Measures of central tendency and dispersion were calculated for numerical variables; counts and percentages were calculated for categorical variables. Independent Student’s t and χ2 tests were performed. Test results were processed using the SPSS program, version 23 (SPSS Inc., Chicago, IL, USA) with p < 0.05 considered signiﬁcant.

2.4. Analysis of Gut Microbiota 2.4.1. Collection of Stool Samples Stool samples were collected from all subjects on two occasions: the ﬁrst, one week after applying the questionnaire and before the intervention. The second stool sample was collected after the intervention in the two groups (EXP and CTL). The samples were collected in sterile H1015S sample cups (Vela Quin S de R.L de C.V) and immediately frozen at −70 ◦C, where they remained until analysis.

2.4.2. Bacterial DNA Extraction The microbial DNA extraction from the stool samples was performed in triplicate using the QuickDNA Fecal/Soil MiniPrep kit (Zymo Research, Irvine, CA, USA) according to the manufacturer’s instructions. Quantiﬁcation of nucleic acids was conducted by means of UV-visible spectrophotometry, measuring absorbance at 260 nm and 280 nm in a spectrophotometer (Genova NanoDrop Jenway™, Bibby Scientiﬁc, Burlington, NJ, USA).

2.4.3. Quantification of Phyla Bacteroidetes, Firmicutes and Gammaproteobacteria by qPCR Quantiﬁcation of the phyla Firmicutes, Bacteroidetes and Gammaproteobacteria was conducted by ampliﬁcation of 16S rRNA gene by real-time PCR in a Rotor-Gene Q thermocycler using the Rotor-Gene SYBR Green PCR kit (Qiagen, Germantown, MD, USA). The primer used are: Firmicutes (Firm934F) GGAGYATGTGGTTTAATTCGAAGCA, (Firm1060R) AGCTGACGACAACCATGCAC [61]; Bacteroidetes (Bac960F) GTTTAATTC- GATGATACGCGAG (Bac1100R) TTAASCCGACACCTCACGG [62]; Gammaproteobacte- ria (γ1080F) TCGTCAGCTCGTGTYGTGA, (γ1202R) CGTAAGGGCCATGATG [63]. The PCR reactions were performed in triplicate in a total volume of 25 µL to which 1 ng of bacterial genomic DNA was added. The reaction volumes were: 7.5 µL of SYBR Green Master Mix 2X, 1 µL forward primer (10 µM) and 1 ul reverse primer, 10 uM and Nutrients 2021, 13, 1551 7 of 18

4.5 µL RNAase-free water and 1 µL genomic DNA (1 ng/µL). The SybrGreen® PCR kit (Qiagen, Germantown, MD, USA) was used. The PCR program used in the case of the phylum Bacteroidetes is as follows: (1) 95 ◦C for 5 min, (2) 95 ◦C for 15 s, (3) 64 ◦C for 15 s, (4) 72 ◦C for 4 s, (5) repeat stages 2, 3 and 4, 45 times, (6) 4 ◦C for 10 min. The PCR program used for the phylum Firmicutes is the following: (1) 95 ◦C for 5 min, (2) 95 ◦C for 15 s, (3) 61 ◦C for 15 s, (4) 72 ◦C for 10 s, (5) repeat stages 2, 3 and 4, 45 times, (6) 4 ◦C 10 min. The PCR program used for the phylum Gammaproteobacteria is the following: (1) 95 ◦C for 5 min, (2) 95 ◦C for 15 s, (3) 60 ◦C for 15 s, (4) 72 ◦C for 10 s, (5) repeat stages 2, 3 and 4, 45 times, (6) 4 ◦C for 10 min. The calibration curve for the calculation of the number of copies of 16S RNAr gene of the phyla of interest was prepared by cloning one 16S ARNr gene from a representative of each phylum of interest into known quantities of the plasmid pMiniT 2.0 (New England Biolabs, Ipswich, MA, USA). These genes were ampliﬁed using speciﬁc primers: Bacto0297 and Bacto1245 for Bacteroidetes [64], BacF and R1378 for Firmicutes [65] and Bacecofw 1428 and Bacecorev for Gammaproteobacteria [66].

2.4.4. Percentage Change in Abundance of the Phyla Determination of the change in abundance of the phyla Bacteroidetes, Firmicutes and Gammaproteobacteria after treatment compared to before treatment was calculated using the following formula: % change in abundance = [(TA−TB)/TA] * 100 TA = Total number of copies after consumption of FBLAB or placebo TB = Total number of copies before consumption of FBLAB or placebo

2.4.5. Statistical Analysis of Changes in Abundance of the Phyla The means of the number of copies in each phylum were calculated and minimum and maximum values determined at each measurement time and in each intervention group. Non-parametric Kruskal–Wallis tests were applied to make comparisons between the three phyla; the Wilcoxon signed rank test was used to compare the before and after measurements and the Mann–Whitney test was used to compare the measurements between the intervention groups. The analysis was performed with the GraphPad Prism program, version 8.0.0, for Windows (GraphPad Software, San Diego, CA, USA) Statistical signiﬁcance was established at p ≤ 0.05. Correlation tests were performed, using Pearson’s test, to measure correlations between stress levels and the abundance of the 16s rRNA genes of the studied phyla. Signiﬁ- cance was determined at p ≤ 0.05.

3. Results 3.1. Academic Stress Level of Students before and after Intervention with FBLAB and Placebo Of the sample of 52 students, 7 were dropped based on the elimination criteria. The information of the remaining 45 participants was analyzed, of whom 60% were women and 40% men between the ages of 20 and 25 years. A descriptive analysis of the level of concern or nervousness was carried out in all the medical students. All the medical students included in the sample reported academic stress. The students were divided into two groups, the CTL group (n = 18) with an average level of stress of 2.88, and the EXP group (n = 27) with an average stress level of 3.88. This difference is a limitation for the comparison between groups; therefore, it must be considered that at the beginning of the intervention, the EXP group expressed significantly higher levels of stress (p = 0.001). However, it is possible to identify the change (before and after) for each group independently. Figure2a presents the results of the measurement of academic stress for the CTL group; stress perception showed no significant difference (p = 0.607) before and after interventions, while, for the EXP group, the stress level showed a significant reduction (p = 0.001) (Figure2b) after interventions. The results show that, in the EXP group, 0% of participants reported high stress levels (N4 and N5) after the intervention, compared to 22.2% of par- Nutrients 2021, 13, x FOR PEER REVIEW 8 of 20

group (n = 27) with an average stress level of 3.88. This difference is a limitation for the comparison between groups; therefore, it must be considered that at the beginning of the intervention, the EXP group expressed significantly higher levels of stress (p = 0.001). However, it is possible to identify the change (before and after) for each group independently. Figure 2a presents the results of the measurement of academic stress for the CTL group; stress perception showed no significant difference (p = 0.607) before and after interventions, while, for the EXP group, the stress level showed a significant reduction (p = Nutrients 2021, 13, 1551 0.001) (Figure 2b) after interventions. The results show that, in the EXP group, 0% of par-8 of 18 ticipants reported high stress levels (N4 and N5) after the intervention, compared to 22.2% of participants in the CTL group, while 77.8% of participants in the EXP group reported ticipants in the CTL group, while 77.8% of participants in the EXP group reported low low stress levels (N1 and N2) after the intervention, compared to 22.2% of participants in stress levels (N1 and N2) after the intervention, compared to 22.2% of participants in the the CTL group. CTL group.

✱

Figure 2. Academic stress intensity levels. Frequency of students which perceived each stress level: N1, N2 (low stress level), N3, N4, N5 (high stress level). (a) Before (BCTL) and after (ACTL) the intervention with the placebo beverage (CTL group): data did no show signiﬁcant differences (p = 0.607).(b) Before (BEXP) and after (AEXP) the intervention with the FBLAB (EXP group): data showed signiﬁcant differences (* p = 0.001, α = 0.05). Statistical analysis was performed using the Student t-test.

Regarding to the results for environmental stressors using the SISCO questionnaire for paired samples (Student’s T-test for paired samples), the results for the EXP group indicated a signiﬁcant change in the scores of all the variables, except for the religiosity variable (p = 0.422) (Table2). Nutrients 2021, 13, 1551 9 of 18

Table 2. Effect of the intervention with BFLAB or placebo beverage on the severity of academic stress-related symptoms, as determined using the SISCO questionnaire (1).

Comparison (2) (2) between VARIABLES CTL Group EXP Group Groups (3)

Stressors from Environmental Before (x) After (x) p Before (x) After (x) p Before (x) p After (x) p Demands CTL CTL 2.44 ± 0.20 1.67 ± 0.21 Competition with 2.44 ± 0.86 1.67 ± 0.91 0.018 ** 2.89 ± 0.80 1.00 ± 1.11 0.001 ** 0.089 0.033 * group mates EXP EXP 2.89 ± 0.15 1.00 ± 0.21 CTL CTL Home and 3.67 ± 0.19 2.78 ± 0.31 3.67 ± 0.84 2.78 ± 1.35 0.013 ** 4.00 ± 0.62 1.41 ± 1.60 0.001 ** 0.160 0.004 ** schoolwork EXP EXP overload 4.00 ± 0.11 1.41 ± 0.30 The teacher’s CTL CTL 2.28 ± 0.19 2.83 ± 0.31 personality and 2.28 ± 0.83 2.83 ± 1.34 0.078 2.89 ± 0.93 1.70 ± 1.79 0.003 ** 0.026 * 0.02 * EXP EXP character 2.89 ± 0.18 1.79 ± 0.34 Evaluations (exams, CTL CTL 3.56 ± 0.25 2.89 ± 0.38 essays, research 3.56 ± 1.10 2.89 ± 1.64 0.175 4.11 ± 0.70 1.30 ± 1.54 0.001 ** 0.068 0.002 ** EXP EXP papers, etc.) 4.11 ± 0.13 1.30 ± 0.29 The type of work required by the CTL CTL teachers 3.06 ± 0.20 2.50 ± 0.30 3.06 ± 0.87 2.50 ± 1.29 0.172 3.37 ± 0.84 1.56 ± 1.80 0.001 ** 0.237 0.047 * (consultation of EXP EXP topics, worksheets, 3.37 ± 0.16 1.56 ± 0.34 essays, concept maps, etc.) Not understanding CTL CTL 2.89 ± 0.25 2.50 ± 0.25 2.89 ± 1.08 2.50 ± 1.10 0.321 3.44 ± 1.01 1.44 ± 1.60 0.001 ** 0.092 0.012 * the topics discussed EXP EXP in class. 3.44 ± 0.19 1.44 ± 0.30 Class participation CTL CTL 2.39 ± 0.31 2.17 ± 0.33 (answering 2.39 ± 1.33 2.17 ± 1.42 0.655 3.11 ± 1.05 1.30 ± 1.46 0.001 ** 0.063 0.054 questions, EXP EXP presentations, etc.) 3.11 ± 0.20 1.30 ± 0.28 CTL CTL 3.00 ± 0.25 2.61 ± 0.34 Limited time to 3.00 ± 1.08 2.61 ± 1.46 0.401 3.85 ± 0.95 1.37 ± 1.71 0.001 ** 0.011 * 0.013 * complete tasks EXP EXP 3.85 ± 0.18 1.37 ± 0.33 Physical reactions Sleep disorder CTL CTL 2.06 ± 0.18 1.61 ± 0.23 2.06 ± 0.80 1.61 ± 0.98 0.119 2.81 ± 1.11 0.85 ± 1.06 0.001 ** 0.011 * 0.018 * (insomnia or EXP EXP nightmares) 2.81 ± 0.21 0.85 ± 0.20 Chronic fatigue CTL CTL 2.00 ± 0.22 1.61 ± 0.25 2.00 ± 0.97 1.61 ± 1.09 0.202 2.89 ± 1.15 1.19 ± 1.39 0.001 ** 0.008 * 0.257 (permanent EXP EXP tiredness) 2.89 ± 0.22 1.19 ± 0.26 CTL CTL 2.11 ± 0.25 1.94 ± 0.27 Headaches or 2.11 ± 1.08 1.94 ± 1.16 0.681 3.00 ± 1.24 1.41 ± 1.55 0.002 ** 0.015 * 0.192 migraines EXP EXP 3.00 ± 0.23 1.41 ± 0.29 Digestive problems, CTL CTL 1.78 ± 0.25 1.44 ± 0.21 1.78 ± 1.06 1.44 ± 0.92 0.302 3.19 ± 1.21 0.67 ± 0.73 0.001 ** 0.001 * 0.005 ** abdominal pain, EXP EXP and diarrhea 3.19 ± 0.23 0.67 ± 0.14 CTL CTL Scratching, nail 2.39 ± 0.29 1.28 ± 0.21 2.39 ± 1.24 1.28 ± 0.89 0.014 ** 3.52 ± 1.37 0.67 ± 0.73 0.001 ** 0.007 * 0.022 * biting, rubbing, etc. EXP EXP 3.52 ± 0.26 0.67 ± 0.14 CTL CTL Drowsiness or 2.67 ± 0.21 2.11 ± 0.27 increased need for 2.67 ± 0.91 2.11 ± 1.18 0.096 3.33 ± 1.00 1.22 ± 1.40 0.001 ** 0.026 0.027 * sleep EXP EXP 3.33 ± 0.19 1.22 ± 0.26 Psychological reactions Restlessness, CTL 2.56 ±.28 CTL 1.78 ±.27 inability to relax 2.56 ± 1.20 1.78 ± 1.17 0.059 3.00 ± 0.88 0.81 ± 0.92 0.001 ** EXP 0.187 EXP 0.013 * and be calm 3.00 ± 0.16 0.81 ± 0.17 Feelings of CTL CTL 2.00 ± 0.22 1.61 ± 0.25 2.00 ± 0.97 1.61 ± 1.09 0.218 2.52 ± 0.75 0.85 ± 1.06 0.001 ** 0.065 0.006 ** depression and EXP EXP sadness 2.52 ± 0.14 0.85 ± 0.20 CTL CTL Anxiety, anguish, 2.11 ± 0.21 1.33 ± 0.16 2.11 ± 0.90 1.33 ± 0.69 0.001 ** 3.26 ± 0.94 0.96 ± 1.09 0.001 ** 0.001 0.027 * despair EXP EXP 3.26 ± 0.18 0.96 ± 0.21 CTL CTL 2.67 ± 0.25 2.50 ± 0.34 Lack of 2.67 ± 1.08 2.50 ± 1.47 0.712 3.33 ± 0.88 1.33 ± 1.54 0.001 ** 0.037 0.169 concentration EXP EXP 3.33 ± 0.16 1.33 ± 0.29 Nutrients 2021, 13, 1551 10 of 18

Table 2. Cont.

Comparison (2) (2) between VARIABLES CTL Group EXP Group Groups (3)

Stressors from Environmental Before (x) After (x) p Before (x) After (x) p Before (x) p After (x) p Demands

Feelings of CTL CTL 2.11 ± 0.29 2.17 ± 0.28 aggression or 2.11 ± 1.23 2.17 ± 1.20 0.871 2.56 ± 1.01 1.30 ± 1.46 0.002 ** 0.213 0.035 * EXP EXP increased irritability 2.56 ± 0.19 1.30 ± 0.28 Behavioral reactions Conflicts or CTL CTL 1.83 ± 0.18 1.94 ± 0.27 tendencies to argue 1.83 ± 0.79 1.94 ± 1.16 0.717 2.52 ± 0.98 1.26 ± 1.43 0.001 ** 0.013 * 0.085 EXP EXP or discuss 2.52 ± 0.18 1.26 ± 0.27 CTL CTL 1.78 ± 0.27 2.17 ± 0.34 Isolation from 1.78 ± 1.17 2.17 ± 1.47 0.310 2.26 ± 1.02 1.33 ± 1.52 0.019 * 0.164 0.073 others EXP EXP 2.26 ± 0.19 1.33 ± 0.29 CTL CTL Reluctance to ± ± complete ± ± ± ± 2.11 0.21 2.50 0.32 2.11 0.90 2.50 1.38 0.233 2.44 0.75 1.41 1.50 0.006 ** EXP 0.203 EXP 0.016 * schoolwork 2.44 ± 0.14 1.41 ± 0.28 CTL CTL Increase or decrease 2.67 ± 0.28 1.94 ± 0.31 2.67 ± 1.19 1.94 ± 1.35 0.126 3.30 ± 0.91 1.30 ± 1.35 0.001 ** 0.066 0.123 in food EXP EXP consumption 3.30 ± 0.17 1.30 ± 0.26 Coping reactions Assertiveness (defending CTL CTL 3.61 ± 0.16 3.17 ± 0.32 preferences, ideas 3.61 ± 0.70 3.17 ± 1.38 0.238 3.85 ± 0.72 1.85 ± 1.99 0.001 ** 0.27 0.012 * EXP EXP or feelings without 3.85 ± 0.13 1.85 ± 0.38 harming others) CTL CTL Planning and 3.28 ± 0.17 2.72 ± 0.32 3.28 ± 0.75 2.72 ± 1.36 0.135 3.37 ± 0.79 1.59 ± 1.65 0.001 ** 0.694 0.016 * carrying out tasks EXP EXP 3.37 ± 0.15 1.59 ± 0.31 CTL CTL ± ± ± ± 3.28 ± 0.25 2.50 ± 0.34 Self-flattery 3.28 1.07 2.50 1.47 0.110 2.89 1.01 1.11 1.25 0.001 ** EXP 0.232 EXP 0.002 ** 2.89 ± 0.19 1.11 ± 0.24 Religiousness CTL CTL 2.22 ± 0.25 2.00 ± 0.31 2.22 ± 1.06 2.00 ± 1.33 0.631 2.56 ± 1.19 1.33 ± 1.47 0.422 0.331 0.122 (prayers or EXP EXP attendance at mass) 2.56 ± 0.22 1.33 ± 0.28 CTL CTL Search for 2.61 ± 0.25 2.56 ± 0.32 2.61 ± 1.09 2.56 ± 1.38 0.889 3.56 ± 0.97 1.33 ± 1.57 0.001 ** 0.006 * 0.009 * information about EXP EXP the situation 3.56 ± 0.18 1.33 ± 0.30 Expression and CTL CTL 2.61 ± 0.24 2.67 ± 0.28 confidence (talking 2.61 ± 1.04 2.67 ± 1.19 0.893 3.30 ± 1.20 1.37 ± 1.50 0.001 ** 0.048 * 0.002 * about the situation EXP EXP of concern) 3.30 ± 0.23 1.37 ± 0.28 (1) A Likert-type scale from 1 to 5 was used, where 1 indicated mild to no symptoms and 5 indicated severe symptoms. (2) The Student’s t-test for paired samples was used. (3) The Student’s t-test for independent samples was used. * p < 0.05, ** p < 0.01.

In the CTL group, 25 of the 29 stressors were non-significant while four were significant, presenting lower means in the second measurement: two environmental stressors (competition with fellow students (p = 0.018) and excessive assignments and schoolwork (p = 0.013)), one physical reaction (scratching, nail-biting, rubbing, etc. (p = 0.014)), and one psychological reaction (anxiety, anguish, despair (p = 0.001)). In the Student’s T-test for independent samples (Table2), the mean stress scores before and after the interventions were compared. In the EXP group, the mean stress score of 12 items showed a significant decrease.

3.2. Effect of FBLAB Consumption on Gut Microbiota The effect of the consumption of the LAB-fermented beverage was evaluated on three phyla, Bacteroidetes, Firmicutes and Gammaproteobacteria, in the gut microbiota of stressed students. The results presented in Figure3 show the number of copies of the 16S rRNA gene of the studied phyla. The ANOVA analysis of the phylum Bacteroidetes showed a signiﬁcant increase in the mean number of copies of the 16S gene in the stools of the EXP group after intervention (p = 0.0001), while in the CTL group, no signiﬁcant differences were found in the mean number of copies of the same gene before and after Nutrients 2021, 13, 1551 11 of 18

intervention (p = 0.5798). The phylum Firmicutes showed a significant increase in the mean number of copies of the 16S gene in stools of the EXP group after intervention (p = 0.0056); in addition, the CTL group showed a significant increase in the firmicutes (p = 0.0385). The increase in the phylo firmicutes in both studied groups, EXP and CTL, showed different meanings. For the EXP group, the dysbiosis in the ratio of firmicutes to bacteroidetes Nutrients 2021, 13, x FOR PEER REVIEW 12 of 20 decreased because both bacteroidetes and firmicutes increased, while, for the CTL group, the dysbiosis was more marked, because the abundance of the phylo bacteroidetes did not increase in the same proportion (Figure3a,b). The phylum Gammaproteobacteria showed no significant differences (Figure3c) in the mean number of copies of the 16S gene before and after intervention in both the EXP (p = 0.0731) and CTL (p = 0.2121) groups.

Figure 3. Abundance of the phylaFigure Bacteroidetes 3. Abundance (a), Firmucutes of the phyla (b) Bacteroidetesand Gammaproteobacteria (a), Firmucutes (c), ( bin) the and feces Gammaproteobacteria microbiota (c), in of students with academic stressthe before feces (white) microbiota and af ofter students (black) withthe intervention academic stress with beforethe FBLAB (white) (EXP and group, after (black)n = 27) theor intervention the placebo beverage (CTL group, n = 18). Abundance is expressed as 16S rRNA gene copy number. Non-parametric Krus- kal–Wallis tests were applied to make comparisons between the three phyla; the Wilcoxon signed rank test was used to compare the before and after measurements and the Mann–Whitney test was used to compare the measurements between the intervention groups. Significant difference: *p < 0.05, ** p < 0.01, *** p < 0.001.

Nutrients 2021, 13, 1551 12 of 18

with the FBLAB (EXP group, n = 27) or the placebo beverage (CTL group, n = 18). Abundance is expressed as 16S rRNA gene copy number. Non-parametric Kruskal–Wallis tests were applied to Nutrients 2021, 13, x FOR PEER REVIEW 13 of 20 make comparisons between the three phyla; the Wilcoxon signed rank test was used to compare the before and after measurements and the Mann–Whitney test was used to compare the measurements between the intervention groups. Significant difference: * p < 0.05, ** p < 0.01, *** p < 0.001. Due to the great natural variability between individuals in the number of bacteria of each phylumDue to thein the great gut natural microbiota, variability we chose between to present individuals the results in the as number a percentage of bacteria of changeof each in phylum each subject in the before gut microbiota, and after consumption we chose topresent of the FBLAB the results and asthe a placebo. percentage The of change in each subject before and after consumption of the FBLAB and the placebo. The results are shown in Figure 4. A significant increase in the abundance of Bacteroidetes results are shown in Figure4. A significant increase in the abundance of Bacteroidetes (83%) was observed after consumption of the FBLAB in the EXP group, but no significant (83%) was observed after consumption of the FBLAB in the EXP group, but no significant change in the abundance of this phylum (3%) was observed after consumption of the pla- change in the abundance of this phylum (3%) was observed after consumption of the cebo. The consumption of both beverages (FBLAB and placebo) resulted in an increase in placebo. The consumption of both beverages (FBLAB and placebo) resulted in an increase the abundance of the phylum Firmicutes for both groups; however, consumption of the in the abundance of the phylum Firmicutes for both groups; however, consumption of the FBLAB generated a significantly higher increase (95%) in the abundance of Firmicutes FBLAB generated a significantly higher increase (95%) in the abundance of Firmicutes than than consumption of the placebo (19%). No significant change was observed in the abun- consumption of the placebo (19%). No significant change was observed in the abundance of dance of the phylum Gammaproteobacteria in gut microbiota after consumption of either the phylum Gammaproteobacteria in gut microbiota after consumption of either beverage beverage (6% for the EXP group and 4% for the CTL group). (6% for the EXP group and 4% for the CTL group).

Figure 4. Box-and-whisker plot representing percentages of change of abundance of the phyla bac- Figure 4. Box-and-whisker plot representing percentages of change of abundance of the phyla bacteroidetes, firmicutes and gammaproteobacteria in teroidetes,feces microbiota ﬁrmicutes of students and gammaproteobacteria with academic stress in afte fecesr the microbiota intervention of students with the with BFLAB academic (EXP stress group, vertical lines) or the placeboafter the beve interventionrage (CTL with group, the BFLABdots), compared (EXP group, to verticalbefore the lines) intervention. or the placebo The beveragepercentage (CTL of group, change in abundance was calculateddots), compared using the to fo beforellowing the formula: intervention. % change The percentage in abundance of change = [(TA in−TB)/TA] abundance × 100. was TA calculated = number of 16S rRNA copies afterusing consumption the following of FBLAB formula: or % placebo. change TB in abundance= number of = 16S [(TA rRNA−TB)/TA] copies ×before100. TAconsumption = number of 16S of FBLAB or placebo. StatisticalrRNA analysiscopies was after performed consumption using ofthe FBLAB Student’s or placebo.t-test. ** p TB< 0.01, = number *** p < 0.001. of 16S rRNA copies before consumption of FBLAB or placebo. Statistical analysis was performed using the Student’s t-test. ** p In< 0.01, Table *** 3,p

microbiota of the EXP group before the consumption of the FBLAB.

Nutrients 2021, 13, 1551 13 of 18

Table 3. Correlation between stress levels and observed changes in studied microbial phyla, before and after the intervention with BFLAB or placebo beverage.

Treatment Firmicutes Bacteroidetes Gammaproteobacteria Pearson r p Pearson r p Pearson r p CTL before −0.0899 0.7228 −0.2677 0.2829 −0.0246 0.9228 CTL after −0.2341 0.1749 −0.3164 0.1004 0.0530 0.8346 CTL before and after (to −0.1504 0.1907 −0.2925 0.0834 0.0127 0.9410 observe the change over time) EXP before −0.4268 0.0132 * −0.2700 0.0866 −0.0261 0.8968 EXP after −0.2075 0.1496 −0.1520 0.2245 −0.0156 0.9382 EXP before and after (to −0.4644 0.0002 * −0.3894 0.0018 * −0.0278 0.4231 observe the change over time) * p < 0.05 indicated signiﬁcant correlation, using the Pearson test, between stress levels and phyla abundance in feces, as measured with 16S rRNA gene copy number.

4. Discussion The results of the Figure1 are consistent with a study where a probiotic made with L. plantarum DR7 administered to stressed adults for 12 weeks reduced stress symptoms along with a significant decrease in plasma pro-inflammatory cytokines such as IFN-γ (p < 0.0001) and TNF-α (p = 0.0006) in the DR7 group as compared to the placebo group [67]. Regarding to the results for environmental stressors using the SISCO questionnaire for paired samples (Student’s T-test for paired samples), the results for the EXP group indicated a significant change in the scores of all the variables, except for the religiosity variable (p = 0.422)(Table2 ). This coincides with other studies where it has been observed that medical students value these items more frequently as stressors [68–70]. The results indicated a significant association between the consumption of FBLAB and environmental demands and physical, psychological and behavioral reactions, as well as six coping responses, showing lower means after intervention. Regarding physical symptoms, consumption of FBLAB generated positive effects similar to the probiotic L. casei Shirota (Lcs), reported as having a beneficial effect on sleep quality after states of high stress. This study showed a 20% reduction in delta power (initial time to sleep and final time), in the probiotic group versus the placebo group, after 11 weeks of the intervention, concluding that the consumption of Lcs may help to maintain the perceived quality of sleep during the stress period [48]. Other studies with multispecies probiotics showed a reduction in symptoms, such as diarrhea and irritable bowel syndrome (IBS), that are associated with stress, showing a significant decrease (p < 0.0001) with the consumption of B. bifidum R0071, as compared to placebo and other probiotics. In this study, the EXP group showed a significant reduction (p = 0.001) in the occurrence of diarrhea and IBS, unlike the CTL group, which showed no change (p = 0.302) after the intervention. The EXP group showed improvement in the item “chronic fatigue”, while the CTL group showed no change (Table2). Furthermore, the interventions with FBLAB in this study show that it has a favorable effect on psychological reactions including depression (p = 0.001). Similarly, other research showed that using L. plantarum 299v (LP299) reduces symptoms of depression. Rudzki et al. [71], showed a significant reduction in the expression of kynurenine (a metabolite associated with depression, involved in the tryptophan pathway) in people who consumed LP299. In terms of behavioral reactions, the EXP group showed changes in eating habits, with the item “increase or decrease in food” being significant. The consumption of a probiotic with L. rhamnosus has been shown to reduce stress symptoms, appetite and cravings and improve self-esteem in women [72,73]. Stress has been shown to reduce the ability to cope with problems; however, it has been proven that the administration of single or multispecies probiotics can reduce stress and help improve cognitive ability to cope with situations common to students [74]. This suggests that the consumption of FBLAB in this study shows similar effects, as observed in most of the items. However, more studies are required using other support instruments. Nutrients 2021, 13, 1551 14 of 18

The increased abundance of Firmicutes in the gut microbiota of the EXP group after invention with FBLAB may be a consequence of the daily consumption of a beverage fermented with three species of the genus Lactobacillus belonging to the phylum Firmicutes (Figure3). Previous studies have related the consumption of strains of the genus Lacto- bacillus with increased abundance of Firmicutes in gut microbiota [75,76]. The increase observed in the genus Bacteroidetes after consumption of the FBLAB is in contrast with a previous study, which showed that consumption of the strain L. Casei Shirota had no significant effect on this phylum in the gut microbiota of people with obesity [77]; these differences may be due to the fact that, in this study, subjects suffered from stress and not obesity. The balance of the microbial phyla is multifactorial: gender, stress, obesity, doses and intervention time are some of the factors that modulate the gut microbiota. In addition, several mechanisms are involved in the balance of the gut microbiota such as the increase in immune cells, the permeability of the intestinal barrier and the presence of antimicrobial peptides [76,77]. The observed increase in the abundance of both Firmicutes and Bacteroidetes (Figure4) makes it possible to maintain a balance between these two phyla, a balance usually associated with a healthy gut microbiota [78] and possibly with the observed decrease in stress (Figure2). The increase in Bacteroidetes shows an equilibrium with Firmicutes (Figure4), which may suggest that the Firmicutes Bacteroidetes balance is associated with decreased stress. The absence of effects in the EXP group on the abundance of Gammaproteobacteria coincides with a previous study where no significant change was observed in the abundance of Enterobacteriaceae after consumption of L. acidophilus and Bifidobacterium animalis. However, although Gammaproteobacteria did not show a change, it is recognized that small changes in the composition of the fecal microbiota affect gene expression and metabolic products [78]. These results suggest that the consumption of the FBLAB restored balance to the gut microbiota of stressed students, as shown by the increased abundance of Bacteroidetes and Firmicutes (Figure4). This change is likely to be the result of an increased abundance of beneficial species belonging to both groups of microorganisms. It is important to highlight that while the abundance of Gammaproteobacteria did not change significantly after consumption of the FBLAB (EXP group), its proportion of total bacteria decreased in relation to the significant increase in Bacteroidetes and Firmicutes. The decrease in stress levels of medical students after consumption of the FBLAB suggests an association with the restoration of a healthy gut microbiota. Different results have been obtained for intervention with probiotics, prebiotics or synbiotics and stress in a study by Gautam [79], which observed an increase in the ratio of firmicutes/bacteroidetes with increased stress levels in rodents, as opposed to results when interventions are made in humans [80]. In general, an increase in the proportion of firmicutes and a decrease in the proportion of bacteroidetes in the gut microbiota are associated with several diseases such as obesity [81]. However, an increasing body of knowledge indicates that this is not always the case since diverging results are reported under varying circumstances such as disease type, age, geographical origin of individuals, lifestyle, diet, etc. [80]. When stress levels in the EXP group before and after the treatment were compared, a statistically significant negative correlation was observed between stress levels and the abundance of both firmicutes and bacteroidetes in gut microbiota (Table3). The reduced microbial diversity in the gut increases the risk of a negative health impact from the pathogenic bacteria. The dysbiosis generates an increase in the permeability of the intestinal barrier and the reduction in the immune response, resulting in a bacterial translocation and a possible negative impact on the brain–gut axis [11]. Our results highlight the need for a more detailed study of the gut microbiota at the family and genus levels. This would greatly improve our understanding of the complex dynamics of gut microbiota in response to diet, lifestyle and environmental stimuli and its relationship with human health. Nutrients 2021, 13, 1551 15 of 18

5. Conclusions The consumption of the FBLAB—a mead-based beverage fermented with L. plantarum, L. paracasei and L. brevis—may have a beneficial effect on stress reduction and the correction of the dysbiosis in the gut microbiota of university students, without interfering with their lifestyle or diet. Traditional or new lactic acid beverages can be a healthy food option for gut microbiota modulation. It is necessary to repeat this study with a larger group of participants, and this will be conducted in the future to confirm the promising results identified in this study regarding the effectiveness of the FBLAB.

Author Contributions: The authors responsibilities were as follows: Conceptualization, methodology, investigation: L.M.-M. Formal analysis, writing—original draft: L.M.-M.; B.P.-A.; J.C.-A. and E.G.E.-K. Statistical analysis and validation: V.R.-R. Review and editing: B.P.-A.; J.C.-A.; E.G.E.-K. and F.M.-G. Project administration: B.P.-A. All authors have read and agreed to the published version of the manuscript. Funding: This research received no external funding. Institutional Review Board Statement: The study was conducted according to the guidelines of the Declaration of Helsinki and approved by Ethics Committee of UPAEP with protocol code: CONBIOETICA21CEI00620131021. Informed Consent Statement: Informed consent was obtained from all subjects involved in the study. Data Availability Statement: Data reported in this study can be obtained by contacting Dr. Beatriz Pérez-Armendariz ([email protected]). Acknowledgments: The authors express their gratitude to Laura Contreras Mioni, Sara Paulina Gallegos Orozco, Ada Esmeralda Nuñez and Michelle Magaña. Conﬂicts of Interest: The authors declare no conﬂict of interest.

References 1. Mayer, E.A.; Tillisch, K.; Gupta, A. Gut/brain axis and the microbiota. J. Clin. Investig. 2015, 125, 926–938. [CrossRef][PubMed] 2. Foster, J.A.; Rinaman, L.; Cryan, J.F. Stress & the gut-brain axis: Regulation by the microbiome. Neurobiol. Stress 2017, 7, 124–136. [CrossRef][PubMed] 3. Liang, S.; Wu, X.; Jin, F. Gut-Brain Psychology: Rethinking Psychology from the Microbiota–Gut–Brain Axis. Front. Integr. Neurosci. 2018, 12, 33. [CrossRef][PubMed] 4. Farzi, A.; Fröhlich, E.E.; Holzer, P.Gut Microbiota and the Neuroendocrine System. Neurother. Neurother. J. Am. Soc. Exp. Neurother. 2018, 15, 5–22. [CrossRef] 5. Kim, Y.-K.; Shin, C. The Microbiota-Gut-Brain Axis in Neuropsychiatric Disorders: Pathophysiological Mechanisms and Novel Treatments. Curr. Neuropharmacol. 2018, 16, 559–573. [CrossRef][PubMed] 6. Oligschlaeger, Y.; Yadati, T.; Houben, T.; Oliván, C.M.C.; Shiri-Sverdlov, R. Inﬂammatory Bowel Disease: A Stressed “Gut/Feeling”. Cells 2019, 8, 659. [CrossRef] 7. Lieberman, H.R.; Thompson, L.A.; Caruso, C.M.; Niro, P.J.; Mahoney, C.R.; McClung, J.P.; Caron, G.R. The catecholamine neurotransmitter precursor tyrosine increases anger during exposure to severe psychological stress. Psychopharmacology 2015, 232, 943–951. [CrossRef][PubMed] 8. Konturek, P.C.; Brzozowski, T.; Konturek, S.J. Stress and the gut: Pathophysiology, clinical consequences, diagnostic approach and treatment options. J. Physiol. Pharmacol. Off. J. Pol. Physiol. Soc. 2011, 62, 591–599. 9. Bonaz, B.; Bazin, T.; Pellissier, S. The Vagus Nerve at the Interface of the Microbiota-Gut-Brain Axis. Front. Neurosci. 2018, 12, 49. [CrossRef] 10. Cresci, G.A.; Bawden, E. The Gut Microbiome: What we do and don’t know. Nutr. Clin. Pr. 2015, 30, 734–746. [CrossRef] 11. Dinan, T.G.; Cryan, J.F. Gut instincts: Microbiota as a key regulator of brain development, ageing and neurodegeneration. J. Physiol. 2016, 595, 489–503. [CrossRef] 12. Gur, T.L.; Worly, B.L.; Bailey, M.T. Stress and the Commensal Microbiota: Importance in Parturition and Infant Neurodevelopment. Front. Psychiatry 2015, 6, 5. [CrossRef] 13. Wang, H.-X.; Wang, Y.-P. Gut Microbiota-brain Axis. Chin. Med. J. 2016, 129, 2373–2380. [CrossRef][PubMed] 14. Grochowska, M.; Wojnar, M.; Radkowski, M. The gut microbiota in neuropsychiatric disorders. Acta Neurobiol. Exp. 2018, 78, 69–81. [CrossRef] 15. Pushpanathan, P.; Mathew, G.S.; Selvarajan, S.; Seshadri, K.G.; Srikanth, P.Gut Microbiota and Its Mysteries. Indian J. Med. Microbiol. 2019, 37, 268. [CrossRef][PubMed] Nutrients 2021, 13, 1551 16 of 18

16. Strandwitz, P. Neurotransmitter modulation by the gut microbiota. Brain Res. 2018, 1693, 128–133. [CrossRef][PubMed] 17. Cenit, M.C.; Sanz, Y.; Codoñer-Franch, P. Influence of gut microbiota on neuropsychiatric disorders. World J. Gastroenterol. 2017, 23, 5486–5498. [CrossRef] 18. Yunes, R.A.; Poluektova, E.U.; Dyachkova, M.S.; Klimina, K.M.; Kovtun, A.S.; Averina, O.V.; Orlova, V.; Danilenko, V. GABA production and structure of gadB / gadC genes in Lactobacillus and Bifidobacterium strains from human microbiota. Anaerobe 2016, 42, 197–204. [CrossRef] 19. Strandwitz, P.; Kim, K.H.; Terekhova, D.; Liu, J.K.; Sharma, A.; Levering, J.; McDonald, D.; Dietrich, D.; Ramadhar, T.R.; Lekbua, A.; et al. GABA-modulating bacteria of the human gut microbiota. Nat. Microbiol. 2019, 4, 396–403. [CrossRef] 20. Sudo, N. Role of gut microbiota in brain function and stress-related pathology. Biosci. Microbiota Food Health 2019, 38, 75–80. [CrossRef][PubMed] 21. Mayer, S.E.; Lopez-Duran, N.L.; Sen, S.; Abelson, J.L. Chronic stress, hair cortisol and depression: A prospective and longitudinal study of medical internship. Psychoneuroendocrinology 2018, 92, 57–65. [CrossRef] 22. Desbonnet, L.; Clarke, G.R.; Shanahan, F.; Dinan, T.G.; Cryan, J.F. Microbiota is essential for social development in the mouse. Mol. Psychiatry 2014, 19, 146–148. [CrossRef] 23. Gareau, M. Cognitive Function and the Microbiome. In International Review of Neurobiology; Cryan, J.F., Clarke, G., Eds.; Academic Press: Cambridge, MA, USA, 2016; Volume 131, pp. 227–246. [CrossRef] 24. Sredniawa,´ A.; Drwiła, D.; Krotos, A.; Wojta´s,D.; Kostecka, N.; Tomasik, T. Insomnia and the level of stress among students in Krakow, Poland. Trends Psychiatry Psychother. 2019, 41, 60–68. [CrossRef][PubMed] 25. Chong, P.P.; Chin, V.K.; Looi, C.Y.; Wong, W.F.; Madhavan, P.; Yong, V.C. The Microbiome and Irritable Bowel Syndrome–A Review on the Pathophysiology, Current Research and Future Therapy. Front. Microbiol. 2019, 10, 1136. [CrossRef] 26. Rosiek, A.; Rosiek-Kryszewska, A.; Leksowski, Ł.; Leksowski, K. Chronic Stress and Suicidal Thinking Among Medical Students. Int. J. Environ. Res. Public Health 2016, 13, 212. [CrossRef][PubMed] 27. Stegers-Jager, K.M.; Savas, M.; Van Der Waal, J.; Van Rossum, E.F.C.; Woltman, A.M. Gender-specific effects of raising Year-1 standards on medical students’ academic performance and stress levels. Med. Educ. 2020, 54, 538–546. [CrossRef] 28. Szemik, S.; Gajda, M.; Kowalska, M. The review of prospective studies on mental health and the quality of life of physicians and medical students. Med. Pr. 2020, 71, 483–491. [CrossRef][PubMed] 29. Knowles, S.R.; Nelson, E.A.; Palombo, E.A. Investigating the role of perceived stress on bacterial flora activity and salivary cortisol secretion: A possible mechanism underlying susceptibility to illness. Biol. Psychol. 2008, 77, 132–137. [CrossRef][PubMed] 30. Karl, J.P.; Margolis, L.M.; Madslien, E.H.; Murphy, N.E.; Castellani, J.W.; Gundersen, Y.; Hoke, A.V.; LeVangie, M.W.; Kumar, R.; Chakraborty, N.; et al. Changes in intestinal microbiota composition and metabolism coincide with increased intestinal permeability in young adults under prolonged physiological stress. Am. J. Physiol. Liver Physiol. 2017, 312, G559–G571. [CrossRef] [PubMed] 31. Peter, J.; Fournier, C.; Durdevic, M.; Knoblich, L.; Keip, B.; Dejaco, C.; Trauner, M.; Moser, G. A Microbial Signature of Psychological Distress in Irritable Bowel Syndrome. Psychosom. Med. 2018, 80, 698–709. [CrossRef] 32. Jiang, H.; Ling, Z.; Zhang, Y.; Mao, H.; Ma, Z.; Yin, Y.; Wang, W.; Tang, W.; Tan, Z.; Shi, J.; et al. Altered fecal microbiota composition in patients with major depressive disorder. Brain Behav. Immun. 2015, 48, 186–194. [CrossRef] 33. Bailey, M.T.; Dowd, S.E.; Galley, J.D.; Hufnagle, A.R.; Allen, R.G.; Lyte, M. Exposure to a social stressor alters the structure of the intestinal microbiota: Implications for stressor-induced immunomodulation. Brain Behav. Immun. 2011, 25, 397–407. [CrossRef] 34. Gao, X.; Cao, Q.; Cheng, Y.; Zhao, D.; Wang, Z.; Yang, H.; Wu, Q.; You, L.; Wang, Y.; Lin, Y.; et al. Chronic stress promotes colitis by disturbing the gut microbiota and triggering immune system response. Proc. Natl. Acad. Sci. USA 2018, 115, E2960–E2969. [CrossRef] 35. Altve¸s,S.; Yildiz, H.K.; Vural, H.C. Interaction of the microbiota with the human body in health and diseases. Biosci. Microbiota Food Health 2020, 39, 23–32. [CrossRef] 36. Probiotics and Prebiotics|World Gastroenterology Organisation n.d. Available online: https://www.worldgastroenterology.org/ guidelines/global-guidelines/probiotics-and-prebiotics (accessed on 11 October 2020). 37. Kato-Kataoka, A.; Nishida, K.; Takada, M.; Kawai, M.; Kikuchi-Hayakawa, H.; Suda, K.; Ishikawa, H.; Gondo, Y.; Shimizu, K.; Matsuki, T.; et al. Fermented Milk Containing Lactobacillus casei Strain Shirota Preserves the Diversity of the Gut Microbiota and Relieves Abdominal Dysfunction in Healthy Medical Students Exposed to Academic Stress. Appl. Environ. Microbiol. 2016, 82, 3649–3658. [CrossRef] 38. Bagga, D.; Reichert, J.L.; Koschutnig, K.; Aigner, C.S.; Holzer, P.; Koskinen, K.; Moissl-Eichinger, C.; Schöpf, V. Probiotics drive gut microbiome triggering emotional brain signatures. Gut Microbes 2018, 9, 486–496. [CrossRef][PubMed] 39. Nishida, K.; Sawada, D.; Kuwano, Y.; Tanaka, H.; Rokutan, K. Health Benefits of Lactobacillus gasseri CP2305 Tablets in Young Adults Exposed to Chronic Stress: A Randomized, Double-Blind, Placebo-Controlled Study. Nutrients 2019, 11, 1859. [CrossRef] 40. Chahwan, B.; Kwan, S.; Isik, A.; van Hemert, S.; Burke, C.; Roberts, L. Gut feelings: A randomised, triple-blind, placebo-controlled trial of probiotics for depressive symptoms. J. Affect. Disord. 2019, 253, 317–326. [CrossRef][PubMed] 41. Dimidi, E.; Cox, S.R.; Rossi, M.; Whelan, K. Fermented Foods: Definitions and Characteristics, Impact on the Gut Microbiota and Effects on Gastrointestinal Health and Disease. Nutrients 2019, 11, 1806. [CrossRef][PubMed] 42. Yilmaz, I.; Dolar, M.E.; Ozpinar, H. Effect of administering kefir on the changes in fecal microbiota and symptoms of inflammatory bowel disease: A randomized controlled trial. Turk. J. Gastroenterol. 2019, 30, 242–253. [CrossRef][PubMed] Nutrients 2021, 13, 1551 17 of 18

43. Escalante, A.; Giles-Gómez, M.; Hernández, G.; Córdova-Aguilar, M.S.; López-Munguía, A.; Gosset, G.; Bolívar, F. Analysis of bacterial community during the fermentation of pulque, a traditional Mexican alcoholic beverage, using a polyphasic approach. Int. J. Food Microbiol. 2008, 124, 126–134. [CrossRef] 44. Escalante, A.; Soto, D.R.L.; Gutiérrez, J.E.V.; Giles-Gómez, M.; Bolívar, F.; López-Munguía, A. Pulque, a Traditional Mexican Alcoholic Fermented Beverage: Historical, Microbiological, and Technical Aspects. Front. Microbiol. 2016, 7, 1026. [CrossRef] 45. Torres-Maravilla, E.; Lenoir, M.; Mayorga-Reyes, L.; Allain, T.; Sokol, H.; Langella, P.; Sánchez-Pardo, M.E.; Bermúdez-Humarán, L.G. Identification of novel anti-inflammatory probiotic strains isolated from pulque. Appl. Microbiol. Biotechnol. 2016, 100, 385–396. [CrossRef] 46. Chandel, D.S.; Perez-Munoz, M.E.; Yu, F.; Boissy, R.; Satpathy, R.; Misra, P.R.; Sharma, N.; Chaudhry, R.; Parida, S.; Peterson, D.A.; et al. Changes in the Gut Microbiota After Early Administration of Oral Synbiotics to Young Infants in India. J. Pediatr. Gastroenterol. Nutr. 2017, 65, 218–224. [CrossRef][PubMed] 47. Nishida, K.; Sawada, D.; Kawai, T.; Kuwano, Y.; Fujiwara, S.; Rokutan, K. Para-psychobiotic Lactobacillus gasseri CP 2305 ameliorates stress-related symptoms and sleep quality. J. Appl. Microbiol. 2017, 123, 1561–1570. [CrossRef] 48. Takada, M.; Nishida, K.; Gondo, Y.; Kikuchi-Hayakawa, H.; Ishikawa, H.; Suda, K.; Kawai, M.; Hoshi, R.; Kuwano, Y.; Miyazaki, K.; et al. Beneficial effects of Lactobacillus casei strain Shirota on academic stress-induced sleep disturbance in healthy adults: A double-blind, randomised, placebo-controlled trial. Benef. Microbes 2017, 8, 153–162. [CrossRef] 49. Takada, M.; Nishida, K.; Kataoka-Kato, A.; Gondo, Y.; Ishikawa, H.; Suda, K.; Kawai, M.; Hoshi, R.; Watanabe, O.; Igarashiet, T.; et al. Probiotic Lactobacillus casei strain Shi-rota relieves stress-associated symptoms by modulating the gut–brain interaction in human and animal models. Neurogastroenterol. Motil. 2016, 28, 1027–1036. Available online: https://pubmed.ncbi.nlm.nih. gov/26896291/ (accessed on 12 December 2020). [CrossRef][PubMed] 50. Allaert, F.A.; Courau, S.; Forestier, A. Effect of magnesium, probiotic, and vitamin food supplementation in healthy subjects with psychological stress and evaluation of a persistent effect after discontinuing intake. Panminerva Med. 2016, 58. Available online: https://pubmed.ncbi.nlm.nih.gov/27309258/ (accessed on 12 December 2020). 51. Culpepper, T.; Christman, M.C.; Nieves, C.; Specht, G.J.; Rowe, C.C.; Spaiser, S.J.; Ford, A.; Dahl, W.; Girard, S.; Langkamp- Henken, B. Bifidobacterium bifidum R0071 decreases stress-associated diarrhoea-related symptoms and self-reported stress: A secondary analysis of a randomised trial. Benef. Microbes 2016, 7, 327–336. [CrossRef][PubMed] 52. Nasri, K.; Jamilian, M.; Rahmani, E.; Bahmani, F.; Tajabadi-Ebrahimi, M.; Asemi, Z. The effects of synbiotic supplementa-tion on hormonal status, biomarkers of inflammation and oxidative stress in subjects with polycystic ovary syn-drome: A randomized, double-blind, placebo-controlled trial. BMC Endocr. Disord. 2018, 18. Available online: https://pubmed.ncbi.nlm.nih.gov/296499 96/ (accessed on 12 December 2020). [CrossRef] 53. Hadi, A.; Sepandi, M.; Marx, W.; Moradi, S.; Parastouei, K. Clinical and psychological responses to synbiotic supple-mentation in obese or overweight adults: A randomized clinical trial. Complement. Ther. Med. 2019, 47, 102216. Available online: https://pubmed.ncbi.nlm.nih.gov/31780038/ (accessed on 12 December 2020). [CrossRef][PubMed] 54. Zheng, J.; Wittouck, S.; Salvetti, E.; Franz, C.M.A.P.; Harris, H.M.B.; Mattarelli, P.; O’Toole, P.W.; Pot, B.; Vandamme, P.; Walter, J.; et al. A taxonomic note on the genus Lactobacillus: Description of 23 novel genera, emended description of the genus Lactobacillus Beijerinck 1901, and union of Lactobacillaceae and Leuconostocaceae. Int. J. Syst. Evol. Microbiol. 2020, 70, 2782–2858. Available online: https://www.microbiologyresearch.org/content/journal/ijsem/10.1099/ijsem.0.004107 (accessed on 12 December 2020). [CrossRef] 55. Arteaga-Chávez, F.; López-Vera, M.; Laurencio-Silva, M.; Rondón-Castillo, A.; Milián-Florido, G.; Barrios-González, V.; Bocourt- Salabarría, R. Selección e identificación de aislados de Bacillus spp. del tracto digestivo de pollos de traspatio, con potencial probiótico. Pastos Y Forrajes 2017, 40, 55–64. 56. Armandáriz, B.P.; Aparicio, E.; El Kassis, E.G.; Ortega, G.R.; Arroyo, J.C. Producción de Una Bebi-Da no Láctea y no Alcohólica Elaborada a Base De Jugo De Agave Salmiana Adicionada Con Probióticos; MX 371480B; Ciudad de México: Mexico City, Mexico, 2020. 57. Barraza, M.A. El Inventario SISCO del Estrés Académico; Investigación Educativa Duranguense: México City, Mexico, 2007; pp. 90–93. ISSN 2007-039X. Nº. 7. Dgo, Mexico. 58. Manrique-Millones, D.; Millones-Rivalles, R.; Manrique-Pino, O. The SISCO Inventory of Academic Stress: Examina-tion of its psychometric properties in a Peruvian sample. Ansiedad Y Estrés. 2019, 25, 28–34. [CrossRef] 59. Castillo, A.G.; Saez, K.; Perez, C.; Navarrete, J.L.C. Validity and reliability of SISCO inventory of academic stress among health students in Chile. JPMA J. Pak. Med. Assoc. 2018, 68, 1759–1762. 60. Barraza, M.A. El estrés académico en alumnos de maestría y sus variables moduladoras: Un diseño de diferencia de grupos. Av. En Psicol. Latinoam. 2008, 26, 270–289. Available online: https://www.redalyc.org/articulo.oa?id=79926212 (accessed on 12 December 2020). 61. Guo, X.; Xia, X.; Tang, R.; Zhou, J.; Zhao, H.; Wang, K. Development of a real-time PCR method forFirmicutesandBacteroidetesin faeces and its application to quantify intestinal population of obese and lean pigs. Lett. Appl. Microbiol. 2008, 47, 367–373. [CrossRef][PubMed] 62. Yang, Y.-W.; Chen, M.-K.; Yang, B.-Y.; Huang, X.-J.; Zhang, X.-R.; He, L.-Q.; Zhang, J.; Hua, Z.-C. Use of 16S rRNA Gene-Targeted Group-Specific Primers for Real-Time PCR Analysis of Predominant Bacteria in Mouse Feces. Appl. Environ. Microbiol. 2015, 81, 6749–6756. [CrossRef] Nutrients 2021, 13, 1551 18 of 18

63. De Gregoris, T.B.; Aldred, N.; Clare, A.S.; Burgess, J.G. Improvement of phylum- and class-specific primers for real-time PCR quantification of bacterial taxa. J. Microbiol. Methods 2011, 86, 351–356. [CrossRef] 64. Garbeva, P.; Van Veen, J.A.; Van Elsas, J.D. Predominant Bacillus spp. in Agricultural Soil under Different Management Regimes Detected via PCR-DGGE. Microb. Ecol. 2003, 45, 302–316. [CrossRef] 65. Toth, I.K.; Avrova, A.O.; Hyman, L.J. Faculty Opinions recommendation of Rapid identification and differentiation of the soft rot erwinias by 16S-23S intergenic transcribed spacer-PCR and restriction fragment length polymorphism analyses. Appl. Environ. Microbiol. 2001, 67, 4070–4076. [CrossRef] 66. Weisburg, W.G.; Barns, S.M.; Pelletier, D.A.; Lane, D.J. 16S ribosomal DNA amplification for phylogenetic study. J. Bacteriol. 1991, 173, 697–703. [CrossRef][PubMed] 67. Chong, H.; Yusoff, N.A.; Hor, Y.-Y.; Lew, L.-C.; Jaafar, M.; Choi, S.-B.; Yusoff, M.; Wahid, N.; Bin Abdullah, M.F.I.L.; Zakaria, N.; et al. Lactobacillus plantarum DR7 alleviates stress and anxiety in adults: A randomised, double-blind, placebo-controlled study. Benef. Microbes 2019, 10, 355–373. [CrossRef][PubMed] 68. de La Rosa-Rojas, G.; Chang-Grozo, S.; Delgado-Flores, L.; Oliveros-Lijap, L.; Murillo-Pérez, D.; Ortiz-Lozada, R.; Vela-Ulloa, G.; Yhuri, C.N. Level of stress and coping strategy in medical students compared with students of other careers. Gac. Med. Mex. 2015, 151, 443–449. [PubMed] 69. Alejandra, D.; Cáceres, S.; Ballesteros, G.H.P. Validación del inventario SISCO del estrés académico y análisis comparativo en adultos jóvenes de la Universidad Industrial de Santander y la Universidad Pontificia Bolivariana, Seccional Bucaramanga, Colombia. Praxis Investigativa ReDIE: Revista Electrónica de la Red Durango de Investigadores Educativos [Internet]. 2021. Available online: https://dialnet.unirioja.es/servlet/articulo?codigo=6534519 (accessed on 30 April 2021). 70. Macías, A.B.; García, L.A.G.; Madero, A.G.; de León, F.C. El estrés académico en alumnos de odontología. Rev. Mex. Estomatol. 2019, 6, 12–26. 71. Rudzki, L.; Ostrowska, L.; Pawlak, D.; Małus, A.; Pawlak, K.; Waszkiewicz, N.; Szulc, A. Probiotic Lactobacillus Plantarum 299v decreases kynurenine concentration and improves cognitive functions in patients with major depression: A double-blind, randomized, placebo controlled study. Psychoneuroendocrinology 2019, 100, 213–222. [CrossRef] 72. Sanchez, M.; Darimont, C.; Drapeau, V.; Emady-Azar, S.; Lepage, M.; Rezzonico, E.; Ngom-Bru, C.; Berger, B.; Philippe, L.; Ammon-Zuffrey, C.; et al. Effect ofLactobacillus rhamnosusCGMCC1.3724 supplementation on weight loss and maintenance in obese men and women. Br. J. Nutr. 2014, 111, 1507–1519. [CrossRef] 73. Liang, S.; Wang, T.; Hu, X.; Luo, J.; Li, W.; Wu, X.; Duan, Y.; Jin, F. Administration of Lactobacillus helveticus NS8 improves behavioral, cognitive, and biochemical aberrations caused by chronic restraint stress. Neuroscience 2015, 310, 561–577. [CrossRef] 74. Papalini, S.; Michels, F.; Kohn, N.; Wegman, J.; Van Hemert, S.; Roelofs, K.; Arias-Vasquez, A.; Aarts, E. Stress matters: Randomized controlled trial on the effect of probiotics on neurocognition. Neurobiol. Stress 2019, 10, 100141. [CrossRef] 75. Cox, A.J.; Makino, H.; Cripps, A.W.; West, N.P. Recovery of Lactobacillus casei strain Shirota (LcS) from faeces with 14 days of fermented milk supplementation in healthy Australian adults. Asia Pac. J. Clin. Nutr. 2019, 28, 734–739. 76. Stadlbauer, V.; Leber, B.; Lemesch, S.; Trajanoski, S.; Bashir, M.; Horvath, A.; Tawdrous, M.; Stojakovic, T.; Fauler, G.; Fickert, P.; et al. Lactobacillus casei Shirota Supplementation Does Not Restore Gut Microbiota Composition and Gut Barrier in Metabolic Syndrome: A Randomized Pilot Study. PLoS ONE 2015, 10, e0141399. [CrossRef] 77. Koliada, A.; Syzenko, G.; Moseiko, V.; Budovska, L.; Puchkov, K.; Perederiy, V.; Gavalko, Y.; Dorofeyev, A.; Romanenko, M.; Tkach, S.; et al. Association between body mass index and Firmicutes/Bacteroidetes ratio in an adult Ukrainian population. BMC Microbiol. 2017, 17, 120. [CrossRef][PubMed] 78. Matijašić,B.B.; Obermajer, T.; Lipoglavšek, L.; Sernel, T.; Locatelli, I.; Kos, M.; Šmid, A.; Rogelj, I. Effects of synbiotic fermented milk containing Lactobacillus acidophilus La-5 and Bifidobacterium animalis ssp. lactis BB-12 on the fecal microbiota of adults with irritable bowel syndrome: A randomized double-blind, placebo-controlled trial. J. Dairy Sci. 2016, 99, 5008–5021. [CrossRef] 79. Gautam, A.; Kumar, R.; Chakraborty, N.; Muhie, S.; Hoke, A.; Hammamieh, R.; Jett, M. Altered fecal microbiota composi-tion in all male aggressor-exposed rodent model simulating features of post-traumatic stress disorder. J. Neurosci. Res. 2018, 96, 1311–1323. [CrossRef][PubMed] 80. Magne, F.; Gotteland, M.; Gauthier, L.; Zazueta, A.; Pesoa, S.; Navarrete, P.; Balamurugan, R. The Firmicutes/Bacteroidetes Ratio: A Relevant Marker of Gut Dysbiosis in Obese Patients? Nutrients 2020, 12, 1474. [CrossRef][PubMed] 81. Kasai, C.; Sugimoto, K.; Moritani, I.; Tanaka, J.; Oya, Y.; Inoue, H.; Tameda, M.; Shiraki, K.; Ito, M.; Takei, Y.; et al. Comparison of the gut microbiota composition between obese and non-obese individuals in a Japanese population, as analyzed by terminal restriction fragment length polymorphism and next-generation sequencing. Gastroenterology 2015, 15, 1–10. [CrossRef]