DOCSLIB.ORG

BREAKFAST SPECIALTIES of the HOUSE! All Specialties Are Served with Our Rubyspuds

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
BREAKFAST SPECIALTIES of the HOUSE! All Specialties Are Served with Our Rubyspuds Good Morning! 35MAGIC YEARS! BREAKFAST SPECIALTIES of the HOUSE! All specialties are served with our RubySpuds. ♥ Eggs Benedict Awesome Egg Sandwich Lean Canadian bacon served atop a toasted Two farm-fresh jumbo eggs over hard, American English muffin with two poached jumbo eggs cheese and your choice of thick-cut bacon, turkey topped with a rich Hollandaise sauce. 9.99 bacon, turkey sausage, veggie sausage or lean country ham on a lightly grilled RubyRoll. 8.99 V Huevos Rancheros Two farm-fresh jumbo eggs any style served on crispy flour tortillas layered with vegetarian black beans, house-made salsa and guacamole, shredded cheeses, sour cream, black olives and chopped green onions. 9.99 NEW! Southern Fried Benny Poached eggs, chicken tenders, buttermilk biscuit, country gravy and RubySpuds. 10.99 NEW! Country Breakfast Sliders Buttermilk biscuits, country gravy, fried eggs, turkey V California Benedict sausage, cheddar cheese and RubySpuds. 7.99 Two poached eggs served on a toasted English muffin, grilled tomato slices and avocado slices, NEW! Breakfast Grilled Cheese then ladled with our delicious Hollandaise Grilled sourdough toast, eggs over hard, Swiss sauce. Served with mixed fresh fruit instead of and Cheddar cheese, bacon, avocado and chipotle RubySpuds. 10.59 mayo served with RubySpuds. 7.99 Ruby’s Breakfast Burrito NEW! Mile High Quesadilla A giant flour tortilla filled with scrambled jumbo Flour tortilla, scrambled eggs, Jack and Cheddar eggs, house-made salsa, shredded cheeses and cheeses, onion, bell pepper, ham, mushrooms your choice of thick-cut bacon, turkey bacon, lean and ancho cream served with RubySpuds. 8.99 country ham, club sausage links, veggie sausage or lean turkey sausage. Served with vegetarian NEW! Country Sausage & Biscuit Bowl black beans. 9.59 Buttermilk biscuits, country gravy, two jumbo eggs, sausage, Cheddar & Jack cheeses and tots. 8.99 EGG-ZACTLY! All egg dishes are served with our RubySpuds and your choice of fluffy HOT BEIGNETS, toast or English muffin. Substitute Egg Whites or Eggbeaters® in any entrée for 1.00. ♥DELUXE CORNED BEEF HASH & EGGS Two farm-fresh, jumbo eggs cooked any style and the best corned beef hash you’ve ever tasted! 10.75 V GARDEN SCRAMBLE Three jumbo eggs scrambled with sautéed mushrooms, spinach, onions, bell peppers, house-made salsa and shredded Cheddar and Monterey Jack cheeses.10.99 THE “REALLY” TWO EGG BREAKFAST BIG BREAKFAST Two farm-fresh, jumbo eggs cooked your way. 8.29 Three jumbo eggs served with thick-cut bacon, ♥ club sausage links and lean country ham for the TWO EGGS COMBO “really” big appetite! 11.59 A power breakfast with your choice of thick-cut bacon, turkey bacon, lean country ham, club sausage links, veggie sausage or turkey sausage. 9.59 How DE-LITE-FUL! ♥ Multigrain Hot Cakes V Egg White Omelette These are a nutritious blend of English walnuts Egg whites with low-fat American cheese, fresh and almond granola. A delicious and healthy sautéed mushrooms, diced tomato and spinach. treat! 8.99 Served with mixed fresh fruit and your choice of toast or English muffin. 11.25 V Oatmeal A bowl of all-natural steel cut oatmeal served V Skinny Eggs with golden raisins, candied pecans, brown sugar Two jumbo eggs scrambled together with our and 2% low-fat milk on the side. Healthy and house-made salsa. Served with cottage cheese, delicious! 6.99 whole wheat toast and a wedge of melon. 8.29 02/17-MV HOT off the GRIDDLE! Served with two farm-fresh jumbo eggs any style and your choice of a breakfast meat: thick-cut bacon, turkey bacon, lean country ham, club sausage links, veggie sausage or turkey sausage. All griddle items are served with butter and syrup. ♥ CINNAMON ROLL FRENCH TOAST COMBO We slice our jumbo cinnamon roll, dip it in a rich egg batter, then grill it to a golden brown. Perfection! 11.99 RUBY’S FRENCH TOAST COMBO Made with golden-grilled, thick-sliced egg bread. 9.99 RUBY’S BUTTERMILK HOT CAKES COMBO Real buttermilk hot cakes. A stack of breakfast goodness with all the trimmings! 9.99 ♥ RUBY’S ORIGINAL MALTED WAFFLE COMBO Crispy, light and made just the way you like ‘em. 9.99 ♥ NEW! BANANA NUT Ruby’s Favorite FRENCH TOAST COMBO Two thick slices of griddled banana nut bread, Vegetarian topped with caramel, powdered sugar and whipped cream. 11.99 V BiggerOMELETTES! All omelettes are served with our RubySpuds and your choice of fluffy HOT BEIGNETS, toast or English muffin. Substitute Egg Whites or Eggbeaters® in any Omelette 1.00 ♥ Ruby’s “Butcher Block” V Veggie Omelette Filled with fresh sautéed mushrooms, diced tomato, Omelette spinach and shredded Cheddar and Monterey Stuffed with shredded Cheddar and Monterey Jack cheeses. A healthy delight! 10.99 Jack cheeses and your choice of one breakfast meat: thick-cut bacon, turkey bacon, lean country ham, club sausage, veggie sausage or turkey sausage.10.99 Denver Omelette Lean country ham, red and green peppers, onions and shredded Cheddar and Monterey Jack cheeses. 10.99 ABC Omelette Thick-cut bacon, melted Pepper Jack cheese and avocado, served with house-made salsa. 10.99 Shake Up Your Morning! CARAMEL HERSHEY’S® CHOCOLATE COFFEE PEANUT BUTTER DOUBLE VANILLA STRAWBERRY OREO 02/17-MV A La Carte RUBY’S ORIGINAL MALTED WAFFLE 7.99 RUBY’S BUTTERMILK HOT CAKES 7.99 CINNAMON ROLL FRENCH TOAST 9.99 MULTI GRAIN HOT CAKES 8.99 RUBY’S FRENCH TOAST 7.99 BANANA NUT FRENCH TOAST 9.99 On the Side BEIGNETS 3.99 RUBY’S JUMBO CINNAMON ROLL 4.99 TOAST WITH BUTTER & JELLY 2.59 COTTAGE CHEESE 1.99 TOMATO SLICES 1.99 MIXED FRESH FRUIT 3.99 BREAKFAST MEAT 2.99 Thick-Cut Bacon, Turkey Bacon, Lean Country Ham, Club Sausage Links, Veggie Sausage or Lean Turkey Sausage Hot Beverages COFFEE ROASTERS Our custom blended coffee with a decadent twist. Served with whipped cream Caramel, Vanilla, Hazelnut, Dark Chocolate, or Sugar-free Vanilla SWINGTIME COFFEE* Ruby’s own custom blended South American coffee Regular or Decaffeinated HOT CHOCOLATE With whipped cream HOT TEA* Ask your server for selections Decaffeinated available * FREE REFILLS FOR DINE-IN GUESTS Cold Beverages BREAKFAST JUICES Orange, Apple, Cranberry, Grapefruit, Tomato MILK Whole, 2% Low-fat, Non-fat ICED TEA* LEMONADE* STRAWBERRY LEMONADE* MINERAL WATER Still or Sparkling SOFT DRINKS* Coke, Diet Coke, Sprite, Barq’s Root Beer, Pibb, Fuze Iced Tea Add a Shot of Flavor! Cherry, Lemon, Chocolate, Vanilla * FREE REFILLS FOR DINE-IN GUESTS QUALITY IS THE KEY! We’re proud to serve products that are made with the highest quality ingredients available. That’s true from our Fresh Premium Natural USDA Choice beef to our famous French Fries and golden RubyRings cooked in non-hydrogenated, zero trans-fat, cholesterol-free, pure vegetable oil. Our commitment is to truly great food and prompt, outstanding service. Your satisfaction is always guaranteed. No matter what you order, you’ll love it or we’ll replace it immediately. RUBY WANTS TO KNOW! WE GLADLY ACCEPT “HOW DID YOU ENJOY YOUR RUBY’S Visa, MasterCard, Discover, EXPERIENCE?” VISIT US AT American Express and Diner’s Club. WWW.RUBYSFEEDBACK.COM Sorry, no checks. Consuming raw or under-cooked meats, poultry, seafood, shellfish, or eggs may increase your risk of food borne illness. RUBY’S, RUBY’S DINER and the Ruby Girl Logo are registered service marks of Ruby’s Diner, Inc. OREO is a registered trademark of Kraft Foods. 02/17-MV Welcome! 35MAGIC YEARS! LUNCH & DINNER Shareable APPETIZERS & SIDES! We use only non-hydrogenated, zero trans-fat, cholesterol-free, pure vegetable oil. NEW! Loaded Tots Crispy Green Beans Crispy, golden brown tater tots covered with Light and crisp breaded your choice of clam chowder, chili or country green beans served gravy. 6.99 with buffalo ranch, honey mustard, and RubyRings ranch dipping sauces Hot and crispy, golden onion rings. 6.99 on the side. 5.99 Fried Calamari Asian Style Breaded tender calamari strips, served light Lettuce Wraps and crisp with cocktail sauce, tartar sauce and Create your own lettuce ranch. 9.59 wraps with your choice of chicken breast, sauteed vegetables, crisp wontons, and lettuce cups served with our delicious spicy teriyaki sauce. 9.59 Frings® A combination of our French Fries and RubyRings for those who want the best of both worlds! 4.99 ♥ Chicken Tenders Crispy, all white meat chicken strips served with BBQ, Ranch and Honey Mustard dipping sauces. 8.99 FRESH SALADS! Feel free to substitute the following dressings on any salad: • Ranch • Thousand Island • Pomegranate Vinaigrette • Bleu Cheese • Honey Mustard • Original Asian • Chardonnay Vinaigrette • Caesar • Light Italian • Fat-Free Sesame Ginger ♥ MEDITERRANEAN SALAD COBB SALAD Fresh romaine tossed with cucumbers, tomatoes, Fresh salad mix, red onions, Kalamata olives, Feta cheese and hard-boiled egg, fresh oregano in a Chardonnay Vinaigrette avocado, dressing. 10.59 roasted Add grilled chicken 2.59 | Add grilled shrimp 2.99 diced turkey CHICKEN CAESAR SALAD breast, Fresh romaine, tender grilled chicken, Bleu shredded Parmesan cheese, croutons and cheese Caesar dressing. 9.99 crumbles, Substitute grilled shrimp for additional 2.99 tomatoes, bacon, mushrooms and black olives. 11.50 ♥ CHINESE CHICKEN SALAD Fresh salad mix, celery, green onions, red bell pepper, wonton strips and tender grilled chicken breast tossed with our Original Asian dressing. Optional: Fat-Free Sesame Ginger Dressing. 10.99 V RUBY’S APPLE, PECAN & BLEU CHEESE SALAD Fresh spring mix, romaine, julienne apples, dried cranberries, candied pecans and golden raisins tossed in a Pomegranate Vinaigrette with Bleu cheese crumbles. 9.99 Add grilled chicken 2.59 | Add grilled shrimp 2.99 HomeStyle CHILI & SOUPS! ♥ Clam Chowder ♥ Ruby’s Chili Ruby’s original family recipe.
Load more

Recommended publications
  • Introduction to Linux – Part 1
    Introduction to Linux – Part 1 Brett Milash and Wim Cardoen Center for High Performance Computing May 22, 2018 ssh Login or Interactive Node kingspeak.chpc.utah.edu Batch queue system … kp001 kp002 …. kpxxx FastX ● https://www.chpc.utah.edu/documentation/software/fastx2.php ● Remote graphical sessions in much more efficient and effective way than simple X forwarding ● Persistence - can be disconnected from without closing the session, allowing users to resume their sessions from other devices. ● Licensed by CHPC ● Desktop clients exist for windows, mac, and linux ● Web based client option ● Server installed on all CHPC interactive nodes and the frisco nodes. Windows – alternatives to FastX ● Need ssh client - PuTTY ● http://www.chiark.greenend.org.uk/~sgtatham/putty/download.html - XShell ● http://www.netsarang.com/download/down_xsh.html ● For X applications also need X-forwarding tool - Xming (use Mesa version as needed for some apps) ● http://www.straightrunning.com/XmingNotes/ - Make sure X forwarding enabled in your ssh client Linux or Mac Desktop ● Just need to open up a terminal or console ● When running applications with graphical interfaces, use ssh –Y or ssh –X Getting Started - Login ● Download and install FastX if you like (required on windows unless you already have PuTTY or Xshell installed) ● If you have a CHPC account: - ssh [email protected] ● If not get a username and password: - ssh [email protected] Shell Basics q A Shell is a program that is the interface between you and the operating system
    [Show full text]
  • Unix: Beyond the Basics
    Unix: Beyond the Basics BaRC Hot Topics – September, 2018 Bioinformatics and Research Computing Whitehead Institute http://barc.wi.mit.edu/hot_topics/ Logging in to our Unix server • Our main server is called tak4 • Request a tak4 account: http://iona.wi.mit.edu/bio/software/unix/bioinfoaccount.php • Logging in from Windows Ø PuTTY for ssh Ø Xming for graphical display [optional] • Logging in from Mac ØAccess the Terminal: Go è Utilities è Terminal ØXQuartz needed for X-windows for newer OS X. 2 Log in using secure shell ssh –Y user@tak4 PuTTY on Windows Terminal on Macs Command prompt user@tak4 ~$ 3 Hot Topics website: http://barc.wi.mit.edu/education/hot_topics/ • Create a directory for the exercises and use it as your working directory $ cd /nfs/BaRC_training $ mkdir john_doe $ cd john_doe • Copy all files into your working directory $ cp -r /nfs/BaRC_training/UnixII/* . • You should have the files below in your working directory: – foo.txt, sample1.txt, exercise.txt, datasets folder – You can check they’re there with the ‘ls’ command 4 Unix Review: Commands Ø command [arg1 arg2 … ] [input1 input2 … ] $ sort -k2,3nr foo.tab -n or -g: -n is recommended, except for scientific notation or start end a leading '+' -r: reverse order $ cut -f1,5 foo.tab $ cut -f1-5 foo.tab -f: select only these fields -f1,5: select 1st and 5th fields -f1-5: select 1st, 2nd, 3rd, 4th, and 5th fields $ wc -l foo.txt How many lines are in this file? 5 Unix Review: Common Mistakes • Case sensitive cd /nfs/Barc_Public vs cd /nfs/BaRC_Public -bash: cd: /nfs/Barc_Public:
    [Show full text]
  • LAB MANUAL for Computer Network
    LAB MANUAL for Computer Network CSE-310 F Computer Network Lab L T P - - 3 Class Work : 25 Marks Exam : 25 MARKS Total : 50 Marks This course provides students with hands on training regarding the design, troubleshooting, modeling and evaluation of computer networks. In this course, students are going to experiment in a real test-bed networking environment, and learn about network design and troubleshooting topics and tools such as: network addressing, Address Resolution Protocol (ARP), basic troubleshooting tools (e.g. ping, ICMP), IP routing (e,g, RIP), route discovery (e.g. traceroute), TCP and UDP, IP fragmentation and many others. Student will also be introduced to the network modeling and simulation, and they will have the opportunity to build some simple networking models using the tool and perform simulations that will help them evaluate their design approaches and expected network performance. S.No Experiment 1 Study of different types of Network cables and Practically implement the cross-wired cable and straight through cable using clamping tool. 2 Study of Network Devices in Detail. 3 Study of network IP. 4 Connect the computers in Local Area Network. 5 Study of basic network command and Network configuration commands. 6 Configure a Network topology using packet tracer software. 7 Configure a Network topology using packet tracer software. 8 Configure a Network using Distance Vector Routing protocol. 9 Configure Network using Link State Vector Routing protocol. Hardware and Software Requirement Hardware Requirement RJ-45 connector, Climping Tool, Twisted pair Cable Software Requirement Command Prompt And Packet Tracer. EXPERIMENT-1 Aim: Study of different types of Network cables and Practically implement the cross-wired cable and straight through cable using clamping tool.
    [Show full text]
  • Install and Run External Command Line Softwares
    job monitor and control top: similar to windows task manager (space to refresh, q to exit) w: who is there ps: all running processes, PID, status, type ps -ef | grep yyin bg: move current process to background fg: move current process to foreground jobs: list running and suspended processes kill: kill processes kill pid (could find out using top or ps) 1 sort, cut, uniq, join, paste, sed, grep, awk, wc, diff, comm, cat All types of bioinformatics sequence analyses are essentially text processing. Unix Shell has the above commands that are very useful for processing texts and also allows the output from one command to be passed to another command as input using pipe (“|”). less cosmicRaw.txt | cut -f2,3,4,5,8,13 | awk '$5==22' | cut -f1 | sort -u | wc This makes the processing of files using Shell very convenient and very powerful: you do not need to write output to intermediate files or load all data into the memory. For example, combining different Unix commands for text processing is like passing an item through a manufacturing pipeline when you only care about the final product 2 Hands on example 1: cosmic mutation data - Go to UCSC genome browser website: http://genome.ucsc.edu/ - On the left, find the Downloads link - Click on Human - Click on Annotation database - Ctrl+f and then search “cosmic” - On “cosmic.txt.gz” right-click -> copy link address - Go to the terminal and wget the above link (middle click or Shift+Insert to paste what you copied) - Similarly, download the “cosmicRaw.txt.gz” file - Under your home, create a folder
    [Show full text]
  • ANSWERS ΤΟ EVEN-Numbered
    8 Answers to Even-numbered Exercises 2.1. WhatExplain the following unexpected are result: two ways you can execute a shell script when you do not have execute permission for the file containing the script? Can you execute a shell script if you do not have read permission for the file containing the script? You can give the name of the file containing the script as an argument to the shell (for example, bash scriptfile or tcsh scriptfile, where scriptfile is the name of the file containing the script). Under bash you can give the following command: $ . scriptfile Under both bash and tcsh you can use this command: $ source scriptfile Because the shell must read the commands from the file containing a shell script before it can execute the commands, you must have read permission for the file to execute a shell script. 4.3. AssumeWhat is the purpose ble? you have made the following assignment: $ person=zach Give the output of each of the following commands. a. echo $person zach b. echo '$person' $person c. echo "$person" zach 1 2 6.5. Assumengs. the /home/zach/grants/biblios and /home/zach/biblios directories exist. Specify Zach’s working directory after he executes each sequence of commands. Explain what happens in each case. a. $ pwd /home/zach/grants $ CDPATH=$(pwd) $ cd $ cd biblios After executing the preceding commands, Zach’s working directory is /home/zach/grants/biblios. When CDPATH is set and the working directory is not specified in CDPATH, cd searches the working directory only after it searches the directories specified by CDPATH.
    [Show full text]
  • Solarwinds Engineer's Toolset Fast Fixes to Network Issues
    DATASHEET SolarWinds Engineer’s Toolset Fast Fixes to Network Issues SolarWinds® Engineer’s Toolset (ETS) helps you monitor and troubleshoot your network with TRY IT FREE the most trusted tools in network management. Version 11.0 now comes with an intuitive web console for 5 of the most popular tools - Response Time Monitor, Interface Monitor, CPU 14 days, full version Monitor, Memory Monitor, and TraceRoute. WHY CHOOSE ENGINEER’S TOOLSET? » Monitor and alert in real time on network availability and health. » Perform robust network diagnostics for faster troubleshooting and quick resolution of complex network issues. » Easily deploy an array of network discovery tools including Port Scanner, Switch Port Mapper, and Advanced Subnet Calculator. » Manage Cisco® devices with specialized tools including Real-time NetFlow Analyzer, Config Downloader, and Config Compare. » Cut troubleshooting time in half and put frequently used tools at your fingertips. SolarWinds Orion integration makes easier and faster troubleshooting allowing you to start tools contextually from any monitored element in Orion. page 1 DATASHEET: SOLARWINDS ENGINEER’S TOOLSET INTUITIVE WEB INTERFACE Response Time Monitor Web access for Response Time Monitor allows you to monitor availability of multiple devices TRY IT FREE in real time and obtain latency and availability information in tabular form. 14 days, full version Memory Monitor Web-based Memory Monitor allows you to monitor memory utilization in real time and enables you to view current memory utilization alongside the total memory available. CPU Monitor Monitor CPU load for multiple devices in real time and set warning and alarm thresholds for each device independently. Interface Monitor The Interface Monitor allows you to view real-time interface statistics for routers and switches simultaneously.
    [Show full text]
  • Command $Line; Done
    http://xkcd.com/208/ >0 TGCAGGTATATCTATTAGCAGGTTTAATTTTGCCTGCACTTGGTTGGGTACATTATTTTAAGTGTATTTGACAAG >1 TGCAGGTTGTTGTTACTCAGGTCCAGTTCTCTGAGACTGGAGGACTGGGAGCTGAGAACTGAGGACAGAGCTTCA >2 TGCAGGGCCGGTCCAAGGCTGCATGAGGCCTGGGGCAGAATCTGACCTAGGGGCCCCTCTTGCTGCTAAAACCAT >3 TGCAGGATCTGCTGCACCATTAACCAGACAGAAATGGCAGTTTTATACAAGTTATTATTCTAATTCAATAGCTGA >4 TGCAGGGGTCAAATACAGCTGTCAAAGCCAGACTTTGAGCACTGCTAGCTGGCTGCAACACCTGCACTTAACCTC cat seqs.fa PIPE grep ACGT TGCAGGTATATCTATTAGCAGGTTTAATTTTGCCTGCACTTGGTTGGGTACATTATTTTAAGTGTATTTGACAAG >1 TGCAGGTTGTTGTTACTCAGGTCCAGTTCTCTGAGACTGGAGGACTGGGAGCTGAGAACTGAGGACAGAGCTTCA >2 TGCAGGGCCGGTCCAAGGCTGCATGAGGCCTGGGGCAGAATCTGACCTAGGGGCCCCTCTTGCTGCTAAAACCAT >3 TGCAGGATCTGCTGCACCATTAACCAGACAGAAATGGCAGTTTTATACAAGTTATTATTCTAATTCAATAGCTGA >4 TGCAGGGGTCAAATACAGCTGTCAAAGCCAGACTTTGAGCACTGCTAGCTGGCTGCAACACCTGCACTTAACCTC cat seqs.fa Does PIPE “>0” grep ACGT contain “ACGT”? Yes? No? Output NULL >1 TGCAGGTTGTTGTTACTCAGGTCCAGTTCTCTGAGACTGGAGGACTGGGAGCTGAGAACTGAGGACAGAGCTTCA >2 TGCAGGGCCGGTCCAAGGCTGCATGAGGCCTGGGGCAGAATCTGACCTAGGGGCCCCTCTTGCTGCTAAAACCAT >3 TGCAGGATCTGCTGCACCATTAACCAGACAGAAATGGCAGTTTTATACAAGTTATTATTCTAATTCAATAGCTGA >4 TGCAGGGGTCAAATACAGCTGTCAAAGCCAGACTTTGAGCACTGCTAGCTGGCTGCAACACCTGCACTTAACCTC cat seqs.fa Does PIPE “TGCAGGTATATCTATTAGCAGGTTTAATTTTGCCTGCACTTG...G” grep ACGT contain “ACGT”? Yes? No? Output NULL TGCAGGTTGTTGTTACTCAGGTCCAGTTCTCTGAGACTGGAGGACTGGGAGCTGAGAACTGAGGACAGAGCTTCA >2 TGCAGGGCCGGTCCAAGGCTGCATGAGGCCTGGGGCAGAATCTGACCTAGGGGCCCCTCTTGCTGCTAAAACCAT >3 TGCAGGATCTGCTGCACCATTAACCAGACAGAAATGGCAGTTTTATACAAGTTATTATTCTAATTCAATAGCTGA
    [Show full text]
  • OPTICORE LS-XP I/O Point Expanders
    OPTICORE LS-XP I/O Point Expanders The OEMCtrl® OptiCORE™ LS-XP expanders are capable of controlling HVAC equipment with high I/O point counts (up to 180) through expandable I/O boards. The OptiCORE I/O expanders deliver input and output capacity to the powerful OptiCORE LS-CPU controller. Up to nine OptiCORE I/O expanders can be added to an OptiCORE controller. OptiCORE I/O expanders are designed for flexible panel configurations. They are DIN rail or screw-tab mountable and can be mixed and matched to meet the I/O requirements of the equipment being controlled. The expanders can be mounted directly to the LS-CPU controller or remotely mounted up to 500’ away. Key Features and Benefits OptiCORE LS XP812u Hardware Features n Expands the OptiCORE LS-CPU processor to support up to 180 I/O points n Backplane mounting via srew tab or DIN rail mounting n Removable screw terminals for I/O connections n Hand-Auto-Off switches on all output channels n Software selectable input configuration - no jumpers n Color-coated I/O and easy to read labeling minimizes wiring errors n LEDs for each output for easy identification of output status whether configured as an AO or DO n LEDs for status indicators for Power, Run, Error, Xnet TX and Xnet Rx Part# LSXP48u LSXP812u LSXP012u Universal Outputs 4 8 0 OptiCORE L-CPU + LS-XP point expanders Universal Inputs 8 12 12 Support for up to 9 I/O expanders (180 points) 1025 Cobb Place Boulevard, Kennesaw, GA 30144 | 770-429-3060 | oemctrl.com Specifications Power 24 Vac ±10%, 50-60 Hz, 50 VA, 26 Vdc ±10%, 15 W, Single Class 2 source only, 100 VA or less Physical Fire-retardant plastic ABS, UL94-5VA, Weight: 1 lb.
    [Show full text]
  • Introduction to BASH, LMOD, SLURM Shells
    MARCC Tutorial Introduction to BASH, LMOD, SLURM Shells • BASH: Bourne Again SHell (Recommended) • DASH • SH -> /bin/bash • ZSH Connecting • ssh gateway2.marcc.jhu.edu -l [email protected] • scp FILE [email protected]@dtn2.marcc.jhu.edu:~/scratch/. • scp -r DIR [email protected]@dtn2.marcc.jhu.edu:~/scratch/. • WINDOWS: Using Putty: http://www.putty.org Navigating • cd .. #### Change to parent dir • cd - #### Change dir down • cd (cd ~) #### change dir HOME • ls -a -l -t -r #### list files in cwd • pwd #### print current work dir • du -kh - -max-depth=1 Home • ~ • ~/scratch • ~/work Environment variables • printenv | grep -i path • echo : built-in command—-> writes arguments to standard output • echo $PATH • echo $LD_LIBRARY_PATH • echo $MANPATH • echo $PYTHONPATH Finding files • Directories (folders) are just special files • find . -type d • locate • which • type Finding commands • Commands are *mostly* just executable files • which python • which ml <— won’t work because ml is a function • type ml • type python Completion • Line commands • TAB is your friend • ls /cm/shared/apps/MATLAB/R2[TAB] History • history • !1000 • !-2 • !! • up, down • CTRL-r, CTRL-a Regex • www.regexr.com • * • [] #### range • ` ` ##### ls `wich python` • | (pipe) ##### ls -l | more • | (or) ‘ #### egrep ‘and|or|to’ README • / \ Manipulating files • mkdir • rm -i -r -f • cp -r • ln -s Text files • nano • vim, emacs • less, more • cat, sed, grep, cut, join, paste • head, tail Streams • stdin, stdout, stderr • >, >>, |, & • tee Configuring BASH • Hidden files names start with with
    [Show full text]
  • Unix Commands (09/04/2014)
    Unix Commands (09/04/2014) • Access control – login <login_name> – exit – passwd <login_name> – yppassswd <loginname> – su – • Login as Super user – su <login> • Login as user <login> • Root Prompt – [root@localhost ~] # • User Prompt – [bms@raxama ~] $ On Line Documentation – man <command/topic> – info <command/topic> • Working with directories – mkdir –p <subdir> ... {-p create all directories in path if not present} mkdir –p /2015/Jan/21/14 will create /2015, Jan, 21 & 14 in case any of these is absent – cd <dir> – rm -r <subdir> ... Man Pages • 1 Executable programs or shell commands • 2 System calls (functions provided by the kernel) • 3 Library calls (functions within program libraries) • 4 Special files (usually found in /dev) • 5 File formats and conventions eg /etc/passwd • 6 Games • 7 Miscellaneous (including macro packages and conventions), e.g. man(7), groff(7) • 8 System administration commands (usually only for root) • 9 Kernel routines [Non standard] – man grep, {awk,sed,find,cut,sort} – man –k mysql, man –k dhcp – man crontab ,man 5 crontab – man printf, man 3 printf – man read, man 2 read – man info Runlevels used by Fedora/RHS Refer /etc/inittab • 0 - halt (Do NOT set initdefault to this) • 1 - Single user mode • 2 - Multiuser, – without NFS (The same as 3, if you do not have networking) • 3 - Full multi user mode w/o X • 4 - unused • 5 - X11 • 6 - reboot (Do NOT set init default to this) – init 6 {Reboot System} – init 0 {Halt the System} – reboot {Requires Super User} – <ctrl> <alt> <del> • in tty[2-7] mode – tty switching • <ctrl> <alt> <F1-7> • In Fedora 10 tty1 is X.
    [Show full text]
  • Basic Unix Command
    Basic Unix Command The Unix command has the following common pattern command_name options argument(s) Here we are trying to give some of the basic unix command in Unix Information Related man It is used to see the manual of the various command. It helps in selecting the correct options to get the desirable output. Just need to give man command finger Getting information about a local and remote user. Sometimes you may want to know what all user are currently logged into the Unix system then this will help passwd Changing your password for the user. If you are logged in, then enter passwd,it will change the password for the current user. From root login you can change password for any user by using passwd who Finding out who is logged on which find the source directory of the executable being used uname print name of current system. On Solaris uname -X will give the cpu and various other informations uptime Time since the last reboot File listing and directory manipulation command ls List contents of Directory(s) Syntax: ls options OPTIONS The following options are supported:-a Lists all entries, including those that begin with a dot (.), which are normally not listed. -d If an argument is a directory, lists only its name (not its contents); often used with -l to get the status of a directory. -n The same as -l, except that the owner's UID and group's GID numbers are printed, rather than the associated character strings. -r Reverses the order of sort to get reverse alphabetic or oldest first as appropriate.
    [Show full text]
  • Gnu Coreutils Core GNU Utilities for Version 6.9, 22 March 2007
    gnu Coreutils Core GNU utilities for version 6.9, 22 March 2007 David MacKenzie et al. This manual documents version 6.9 of the gnu core utilities, including the standard pro- grams for text and file manipulation. Copyright c 1994, 1995, 1996, 2000, 2001, 2002, 2003, 2004, 2005, 2006 Free Software Foundation, Inc. Permission is granted to copy, distribute and/or modify this document under the terms of the GNU Free Documentation License, Version 1.2 or any later version published by the Free Software Foundation; with no Invariant Sections, with no Front-Cover Texts, and with no Back-Cover Texts. A copy of the license is included in the section entitled \GNU Free Documentation License". Chapter 1: Introduction 1 1 Introduction This manual is a work in progress: many sections make no attempt to explain basic concepts in a way suitable for novices. Thus, if you are interested, please get involved in improving this manual. The entire gnu community will benefit. The gnu utilities documented here are mostly compatible with the POSIX standard. Please report bugs to [email protected]. Remember to include the version number, machine architecture, input files, and any other information needed to reproduce the bug: your input, what you expected, what you got, and why it is wrong. Diffs are welcome, but please include a description of the problem as well, since this is sometimes difficult to infer. See section \Bugs" in Using and Porting GNU CC. This manual was originally derived from the Unix man pages in the distributions, which were written by David MacKenzie and updated by Jim Meyering.
    [Show full text]