DOCSLIB.ORG

Lithonia PT2U MV Parabolic Spec Sheet

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Lithonia PT2U MV Parabolic Spec Sheet FEATURES & SPECIFICATIONS INTENDED USE — Designed for use in open area applications and electronic offices where optical control, visual comfort and light cut-off are important. Attributes: Design optimized for use with T8 lamps and low-profile electronic ballasts. Aluminum louvers utilize the latest developments in louver finishing for minimized louver iridescence. CONSTRUCTION — Black reveal provides floating louver appearance, conceals optional air-supply slots. Square corner end plates improve strength and durability. Integral T-bar safety clips hold fixture to T-bar securely; no fasteners required. Heavy-gauge hinges die-formed for maximum strength; spring action latches concealed in black reveal. Parabolics Housing formed from cold-rolled steel. Louver formed from anodized aluminum. No asbestos used in this product. Finish: Five-stage iron-phosphate pretreatment ensures superior paint adhesion. Painted parts finished with high-gloss, baked white enamel. ELECTRICAL — Electronic ballasts are sound rated A. Full light output, reduced energy. Less than 10% THD multi-volt operation (120-277). Fixture conforms to UL1570 and is suitable for damp locations. AWM, TFN or THHN wire used throughout, rated for required temperatures. LISTINGS — UL Listed (Standard). WARRANTY — 2-year limited warranty. Complete warranty terms located at www.acuitybrands.com/CustomerResources/Terms_and_conditions.aspx NOTE: Actual performance may differ as a result of end-user environment and application. Specifications subject to change without notice. Specifications PT2U 2x2: 9-cell Specifications PT3 2x4: 18-cell Length: 24 (61.0) Length: 48 (122.0) Width: 24 (61.0) Width: 24 (61.0) Depth: 4-1/2 (11.4) Depth: 4-1/2 (11.4) Weight: 32 lbs (14.5 kg) Weight: 32 lbs (14.5 kg) All dimensions are inches (centimeters) unless otherwise indicated. ORDERING INFORMATION Catalog # of # of Ballast # of Lamp Lamp Pallet Number UPC Description Lamps Cells Wattage Voltage type Ballasts type Pre-wired included qty. PT3 MV 745975079155 2x4 recessed, static 3 18 32 120-277 Electronic, instant start 1 N/A N N 20 PT3L MV 745975079421 2x4 recessed, static 3 18 32 120-277 Electronic, instant start 1 3500 K N Y 20 PT3LW MV 745975079360 2x4 recessed, static 3 18 32 120-277 Electronic, instant start 1 3500 K Y Y 20 PT3 2MV 745975118373 2x4 recessed, static 3 18 32 120-277 Electronic, instant start 2 N/A N N 20 PT3A MV 745975079513 2x4 recessed, air 3 18 32 120-277 Electronic, instant start 1 N/A N N 20 PT2U MV 745975079247 2x2 recessed, static 2 9 32-U lamp 120-277 Electronic, instant start 1 N/A N N 40 PT2UA MV 745975490417 2x2 recessed, air 2 9 32-U lamp 120-277 Electronic, instant start 1 N/A N N 40 PT2UALW MV 745975466580 2x2 recessed, air 2 9 32-U lamp 120-277 Electronic, instant start 1 3500 K Y Y 40 PT3L41 MV 745976877781 2x4 recessed, static 3 18 32 120-277 Electronic, instant start 1 4100 K N Y 20 PT3L41W MV 745975728473 2x4 recessed, static 3 18 32 120-277 Electronic, instant start 1 4100 K Y Y 20 FLUORESCENT PARABOLIC Parabolics 2'x4' and 2'x2' MOUNTING DATA DIMENSIONS All dimensions are inches (centimeters) unless otherwise indicated. Appropriate Ceiling Type Trim Type Exposed grid tee G Concealed grid tee G, ST 4-1/2 2-13/16 3-1/2 (11.4) (7.1) (8.9) 24 3” end blade depth (61.0) PHOTOMETRICS Calculated using the zonal cavity method in accordance with IESNA LM41 procedures. Floor reflectances are 20%. Lamp configurations shown are typical. Full photometric data on these and other configurations available upon request. TEST NO: LTL14671 CS PT3 MV LUMENS PER LAMP: 2850 LUM. EFF. - 75.1% LAMPS PER LUMINAIRE: 3 Coefficients of Utilization fp %02 pc 80% 70% 50% pw 50% 30% 10% 50% 30% 10% 50% 30% 10% 0 89 89 89 87 87 87 83 83 83 1 80 78 75 79 76 74 76 74 72 2 71 67 63 70 66 63 67 64 61 3 64 58 54 62 57 53 60 56 53 4 57 51 46 56 50 46 54 49 45 5 51 45 40 50 44 40 49 44 40 RCR 6 46 40 35 45 39 35 44 39 35 7 42 36 31 41 35 31 40 35 31 8 38 32 28 38 32 28 37 31 28 9 35 29 25 34 29 25 34 28 25 10 32 26 23 32 26 23 31 26 22 Zonal Lumen Summary Zone Lumens % Lamp% Fixture 0° - 30° 1982.1 23.2 30.9 0° - 40° 3413.2 39.9 53.1 0° - 60° 5866.8 68.6 91.4 0° - 90° 6422.1 75.1 100.0 90° - 180° 0.0 0.0 0.0 0° - 180° 6422.1 75.1 100.0 PARABOLICS.
Load more

Recommended publications
  • Introduction to Linux – Part 1
    Introduction to Linux – Part 1 Brett Milash and Wim Cardoen Center for High Performance Computing May 22, 2018 ssh Login or Interactive Node kingspeak.chpc.utah.edu Batch queue system … kp001 kp002 …. kpxxx FastX ● https://www.chpc.utah.edu/documentation/software/fastx2.php ● Remote graphical sessions in much more efficient and effective way than simple X forwarding ● Persistence - can be disconnected from without closing the session, allowing users to resume their sessions from other devices. ● Licensed by CHPC ● Desktop clients exist for windows, mac, and linux ● Web based client option ● Server installed on all CHPC interactive nodes and the frisco nodes. Windows – alternatives to FastX ● Need ssh client - PuTTY ● http://www.chiark.greenend.org.uk/~sgtatham/putty/download.html - XShell ● http://www.netsarang.com/download/down_xsh.html ● For X applications also need X-forwarding tool - Xming (use Mesa version as needed for some apps) ● http://www.straightrunning.com/XmingNotes/ - Make sure X forwarding enabled in your ssh client Linux or Mac Desktop ● Just need to open up a terminal or console ● When running applications with graphical interfaces, use ssh –Y or ssh –X Getting Started - Login ● Download and install FastX if you like (required on windows unless you already have PuTTY or Xshell installed) ● If you have a CHPC account: - ssh [email protected] ● If not get a username and password: - ssh [email protected] Shell Basics q A Shell is a program that is the interface between you and the operating system
    [Show full text]
  • Unix: Beyond the Basics
    Unix: Beyond the Basics BaRC Hot Topics – September, 2018 Bioinformatics and Research Computing Whitehead Institute http://barc.wi.mit.edu/hot_topics/ Logging in to our Unix server • Our main server is called tak4 • Request a tak4 account: http://iona.wi.mit.edu/bio/software/unix/bioinfoaccount.php • Logging in from Windows Ø PuTTY for ssh Ø Xming for graphical display [optional] • Logging in from Mac ØAccess the Terminal: Go è Utilities è Terminal ØXQuartz needed for X-windows for newer OS X. 2 Log in using secure shell ssh –Y user@tak4 PuTTY on Windows Terminal on Macs Command prompt user@tak4 ~$ 3 Hot Topics website: http://barc.wi.mit.edu/education/hot_topics/ • Create a directory for the exercises and use it as your working directory $ cd /nfs/BaRC_training $ mkdir john_doe $ cd john_doe • Copy all files into your working directory $ cp -r /nfs/BaRC_training/UnixII/* . • You should have the files below in your working directory: – foo.txt, sample1.txt, exercise.txt, datasets folder – You can check they’re there with the ‘ls’ command 4 Unix Review: Commands Ø command [arg1 arg2 … ] [input1 input2 … ] $ sort -k2,3nr foo.tab -n or -g: -n is recommended, except for scientific notation or start end a leading '+' -r: reverse order $ cut -f1,5 foo.tab $ cut -f1-5 foo.tab -f: select only these fields -f1,5: select 1st and 5th fields -f1-5: select 1st, 2nd, 3rd, 4th, and 5th fields $ wc -l foo.txt How many lines are in this file? 5 Unix Review: Common Mistakes • Case sensitive cd /nfs/Barc_Public vs cd /nfs/BaRC_Public -bash: cd: /nfs/Barc_Public:
    [Show full text]
  • LAB MANUAL for Computer Network
    LAB MANUAL for Computer Network CSE-310 F Computer Network Lab L T P - - 3 Class Work : 25 Marks Exam : 25 MARKS Total : 50 Marks This course provides students with hands on training regarding the design, troubleshooting, modeling and evaluation of computer networks. In this course, students are going to experiment in a real test-bed networking environment, and learn about network design and troubleshooting topics and tools such as: network addressing, Address Resolution Protocol (ARP), basic troubleshooting tools (e.g. ping, ICMP), IP routing (e,g, RIP), route discovery (e.g. traceroute), TCP and UDP, IP fragmentation and many others. Student will also be introduced to the network modeling and simulation, and they will have the opportunity to build some simple networking models using the tool and perform simulations that will help them evaluate their design approaches and expected network performance. S.No Experiment 1 Study of different types of Network cables and Practically implement the cross-wired cable and straight through cable using clamping tool. 2 Study of Network Devices in Detail. 3 Study of network IP. 4 Connect the computers in Local Area Network. 5 Study of basic network command and Network configuration commands. 6 Configure a Network topology using packet tracer software. 7 Configure a Network topology using packet tracer software. 8 Configure a Network using Distance Vector Routing protocol. 9 Configure Network using Link State Vector Routing protocol. Hardware and Software Requirement Hardware Requirement RJ-45 connector, Climping Tool, Twisted pair Cable Software Requirement Command Prompt And Packet Tracer. EXPERIMENT-1 Aim: Study of different types of Network cables and Practically implement the cross-wired cable and straight through cable using clamping tool.
    [Show full text]
  • Install and Run External Command Line Softwares
    job monitor and control top: similar to windows task manager (space to refresh, q to exit) w: who is there ps: all running processes, PID, status, type ps -ef | grep yyin bg: move current process to background fg: move current process to foreground jobs: list running and suspended processes kill: kill processes kill pid (could find out using top or ps) 1 sort, cut, uniq, join, paste, sed, grep, awk, wc, diff, comm, cat All types of bioinformatics sequence analyses are essentially text processing. Unix Shell has the above commands that are very useful for processing texts and also allows the output from one command to be passed to another command as input using pipe (“|”). less cosmicRaw.txt | cut -f2,3,4,5,8,13 | awk '$5==22' | cut -f1 | sort -u | wc This makes the processing of files using Shell very convenient and very powerful: you do not need to write output to intermediate files or load all data into the memory. For example, combining different Unix commands for text processing is like passing an item through a manufacturing pipeline when you only care about the final product 2 Hands on example 1: cosmic mutation data - Go to UCSC genome browser website: http://genome.ucsc.edu/ - On the left, find the Downloads link - Click on Human - Click on Annotation database - Ctrl+f and then search “cosmic” - On “cosmic.txt.gz” right-click -> copy link address - Go to the terminal and wget the above link (middle click or Shift+Insert to paste what you copied) - Similarly, download the “cosmicRaw.txt.gz” file - Under your home, create a folder
    [Show full text]
  • ANSWERS ΤΟ EVEN-Numbered
    8 Answers to Even-numbered Exercises 2.1. WhatExplain the following unexpected are result: two ways you can execute a shell script when you do not have execute permission for the file containing the script? Can you execute a shell script if you do not have read permission for the file containing the script? You can give the name of the file containing the script as an argument to the shell (for example, bash scriptfile or tcsh scriptfile, where scriptfile is the name of the file containing the script). Under bash you can give the following command: $ . scriptfile Under both bash and tcsh you can use this command: $ source scriptfile Because the shell must read the commands from the file containing a shell script before it can execute the commands, you must have read permission for the file to execute a shell script. 4.3. AssumeWhat is the purpose ble? you have made the following assignment: $ person=zach Give the output of each of the following commands. a. echo $person zach b. echo '$person' $person c. echo "$person" zach 1 2 6.5. Assumengs. the /home/zach/grants/biblios and /home/zach/biblios directories exist. Specify Zach’s working directory after he executes each sequence of commands. Explain what happens in each case. a. $ pwd /home/zach/grants $ CDPATH=$(pwd) $ cd $ cd biblios After executing the preceding commands, Zach’s working directory is /home/zach/grants/biblios. When CDPATH is set and the working directory is not specified in CDPATH, cd searches the working directory only after it searches the directories specified by CDPATH.
    [Show full text]
  • Solarwinds Engineer's Toolset Fast Fixes to Network Issues
    DATASHEET SolarWinds Engineer’s Toolset Fast Fixes to Network Issues SolarWinds® Engineer’s Toolset (ETS) helps you monitor and troubleshoot your network with TRY IT FREE the most trusted tools in network management. Version 11.0 now comes with an intuitive web console for 5 of the most popular tools - Response Time Monitor, Interface Monitor, CPU 14 days, full version Monitor, Memory Monitor, and TraceRoute. WHY CHOOSE ENGINEER’S TOOLSET? » Monitor and alert in real time on network availability and health. » Perform robust network diagnostics for faster troubleshooting and quick resolution of complex network issues. » Easily deploy an array of network discovery tools including Port Scanner, Switch Port Mapper, and Advanced Subnet Calculator. » Manage Cisco® devices with specialized tools including Real-time NetFlow Analyzer, Config Downloader, and Config Compare. » Cut troubleshooting time in half and put frequently used tools at your fingertips. SolarWinds Orion integration makes easier and faster troubleshooting allowing you to start tools contextually from any monitored element in Orion. page 1 DATASHEET: SOLARWINDS ENGINEER’S TOOLSET INTUITIVE WEB INTERFACE Response Time Monitor Web access for Response Time Monitor allows you to monitor availability of multiple devices TRY IT FREE in real time and obtain latency and availability information in tabular form. 14 days, full version Memory Monitor Web-based Memory Monitor allows you to monitor memory utilization in real time and enables you to view current memory utilization alongside the total memory available. CPU Monitor Monitor CPU load for multiple devices in real time and set warning and alarm thresholds for each device independently. Interface Monitor The Interface Monitor allows you to view real-time interface statistics for routers and switches simultaneously.
    [Show full text]
  • Command $Line; Done
    http://xkcd.com/208/ >0 TGCAGGTATATCTATTAGCAGGTTTAATTTTGCCTGCACTTGGTTGGGTACATTATTTTAAGTGTATTTGACAAG >1 TGCAGGTTGTTGTTACTCAGGTCCAGTTCTCTGAGACTGGAGGACTGGGAGCTGAGAACTGAGGACAGAGCTTCA >2 TGCAGGGCCGGTCCAAGGCTGCATGAGGCCTGGGGCAGAATCTGACCTAGGGGCCCCTCTTGCTGCTAAAACCAT >3 TGCAGGATCTGCTGCACCATTAACCAGACAGAAATGGCAGTTTTATACAAGTTATTATTCTAATTCAATAGCTGA >4 TGCAGGGGTCAAATACAGCTGTCAAAGCCAGACTTTGAGCACTGCTAGCTGGCTGCAACACCTGCACTTAACCTC cat seqs.fa PIPE grep ACGT TGCAGGTATATCTATTAGCAGGTTTAATTTTGCCTGCACTTGGTTGGGTACATTATTTTAAGTGTATTTGACAAG >1 TGCAGGTTGTTGTTACTCAGGTCCAGTTCTCTGAGACTGGAGGACTGGGAGCTGAGAACTGAGGACAGAGCTTCA >2 TGCAGGGCCGGTCCAAGGCTGCATGAGGCCTGGGGCAGAATCTGACCTAGGGGCCCCTCTTGCTGCTAAAACCAT >3 TGCAGGATCTGCTGCACCATTAACCAGACAGAAATGGCAGTTTTATACAAGTTATTATTCTAATTCAATAGCTGA >4 TGCAGGGGTCAAATACAGCTGTCAAAGCCAGACTTTGAGCACTGCTAGCTGGCTGCAACACCTGCACTTAACCTC cat seqs.fa Does PIPE “>0” grep ACGT contain “ACGT”? Yes? No? Output NULL >1 TGCAGGTTGTTGTTACTCAGGTCCAGTTCTCTGAGACTGGAGGACTGGGAGCTGAGAACTGAGGACAGAGCTTCA >2 TGCAGGGCCGGTCCAAGGCTGCATGAGGCCTGGGGCAGAATCTGACCTAGGGGCCCCTCTTGCTGCTAAAACCAT >3 TGCAGGATCTGCTGCACCATTAACCAGACAGAAATGGCAGTTTTATACAAGTTATTATTCTAATTCAATAGCTGA >4 TGCAGGGGTCAAATACAGCTGTCAAAGCCAGACTTTGAGCACTGCTAGCTGGCTGCAACACCTGCACTTAACCTC cat seqs.fa Does PIPE “TGCAGGTATATCTATTAGCAGGTTTAATTTTGCCTGCACTTG...G” grep ACGT contain “ACGT”? Yes? No? Output NULL TGCAGGTTGTTGTTACTCAGGTCCAGTTCTCTGAGACTGGAGGACTGGGAGCTGAGAACTGAGGACAGAGCTTCA >2 TGCAGGGCCGGTCCAAGGCTGCATGAGGCCTGGGGCAGAATCTGACCTAGGGGCCCCTCTTGCTGCTAAAACCAT >3 TGCAGGATCTGCTGCACCATTAACCAGACAGAAATGGCAGTTTTATACAAGTTATTATTCTAATTCAATAGCTGA
    [Show full text]
  • OPTICORE LS-XP I/O Point Expanders
    OPTICORE LS-XP I/O Point Expanders The OEMCtrl® OptiCORE™ LS-XP expanders are capable of controlling HVAC equipment with high I/O point counts (up to 180) through expandable I/O boards. The OptiCORE I/O expanders deliver input and output capacity to the powerful OptiCORE LS-CPU controller. Up to nine OptiCORE I/O expanders can be added to an OptiCORE controller. OptiCORE I/O expanders are designed for flexible panel configurations. They are DIN rail or screw-tab mountable and can be mixed and matched to meet the I/O requirements of the equipment being controlled. The expanders can be mounted directly to the LS-CPU controller or remotely mounted up to 500’ away. Key Features and Benefits OptiCORE LS XP812u Hardware Features n Expands the OptiCORE LS-CPU processor to support up to 180 I/O points n Backplane mounting via srew tab or DIN rail mounting n Removable screw terminals for I/O connections n Hand-Auto-Off switches on all output channels n Software selectable input configuration - no jumpers n Color-coated I/O and easy to read labeling minimizes wiring errors n LEDs for each output for easy identification of output status whether configured as an AO or DO n LEDs for status indicators for Power, Run, Error, Xnet TX and Xnet Rx Part# LSXP48u LSXP812u LSXP012u Universal Outputs 4 8 0 OptiCORE L-CPU + LS-XP point expanders Universal Inputs 8 12 12 Support for up to 9 I/O expanders (180 points) 1025 Cobb Place Boulevard, Kennesaw, GA 30144 | 770-429-3060 | oemctrl.com Specifications Power 24 Vac ±10%, 50-60 Hz, 50 VA, 26 Vdc ±10%, 15 W, Single Class 2 source only, 100 VA or less Physical Fire-retardant plastic ABS, UL94-5VA, Weight: 1 lb.
    [Show full text]
  • Introduction to BASH, LMOD, SLURM Shells
    MARCC Tutorial Introduction to BASH, LMOD, SLURM Shells • BASH: Bourne Again SHell (Recommended) • DASH • SH -> /bin/bash • ZSH Connecting • ssh gateway2.marcc.jhu.edu -l [email protected] • scp FILE [email protected]@dtn2.marcc.jhu.edu:~/scratch/. • scp -r DIR [email protected]@dtn2.marcc.jhu.edu:~/scratch/. • WINDOWS: Using Putty: http://www.putty.org Navigating • cd .. #### Change to parent dir • cd - #### Change dir down • cd (cd ~) #### change dir HOME • ls -a -l -t -r #### list files in cwd • pwd #### print current work dir • du -kh - -max-depth=1 Home • ~ • ~/scratch • ~/work Environment variables • printenv | grep -i path • echo : built-in command—-> writes arguments to standard output • echo $PATH • echo $LD_LIBRARY_PATH • echo $MANPATH • echo $PYTHONPATH Finding files • Directories (folders) are just special files • find . -type d • locate • which • type Finding commands • Commands are *mostly* just executable files • which python • which ml <— won’t work because ml is a function • type ml • type python Completion • Line commands • TAB is your friend • ls /cm/shared/apps/MATLAB/R2[TAB] History • history • !1000 • !-2 • !! • up, down • CTRL-r, CTRL-a Regex • www.regexr.com • * • [] #### range • ` ` ##### ls `wich python` • | (pipe) ##### ls -l | more • | (or) ‘ #### egrep ‘and|or|to’ README • / \ Manipulating files • mkdir • rm -i -r -f • cp -r • ln -s Text files • nano • vim, emacs • less, more • cat, sed, grep, cut, join, paste • head, tail Streams • stdin, stdout, stderr • >, >>, |, & • tee Configuring BASH • Hidden files names start with with
    [Show full text]
  • Unix Commands (09/04/2014)
    Unix Commands (09/04/2014) • Access control – login <login_name> – exit – passwd <login_name> – yppassswd <loginname> – su – • Login as Super user – su <login> • Login as user <login> • Root Prompt – [root@localhost ~] # • User Prompt – [bms@raxama ~] $ On Line Documentation – man <command/topic> – info <command/topic> • Working with directories – mkdir –p <subdir> ... {-p create all directories in path if not present} mkdir –p /2015/Jan/21/14 will create /2015, Jan, 21 & 14 in case any of these is absent – cd <dir> – rm -r <subdir> ... Man Pages • 1 Executable programs or shell commands • 2 System calls (functions provided by the kernel) • 3 Library calls (functions within program libraries) • 4 Special files (usually found in /dev) • 5 File formats and conventions eg /etc/passwd • 6 Games • 7 Miscellaneous (including macro packages and conventions), e.g. man(7), groff(7) • 8 System administration commands (usually only for root) • 9 Kernel routines [Non standard] – man grep, {awk,sed,find,cut,sort} – man –k mysql, man –k dhcp – man crontab ,man 5 crontab – man printf, man 3 printf – man read, man 2 read – man info Runlevels used by Fedora/RHS Refer /etc/inittab • 0 - halt (Do NOT set initdefault to this) • 1 - Single user mode • 2 - Multiuser, – without NFS (The same as 3, if you do not have networking) • 3 - Full multi user mode w/o X • 4 - unused • 5 - X11 • 6 - reboot (Do NOT set init default to this) – init 6 {Reboot System} – init 0 {Halt the System} – reboot {Requires Super User} – <ctrl> <alt> <del> • in tty[2-7] mode – tty switching • <ctrl> <alt> <F1-7> • In Fedora 10 tty1 is X.
    [Show full text]
  • Basic Unix Command
    Basic Unix Command The Unix command has the following common pattern command_name options argument(s) Here we are trying to give some of the basic unix command in Unix Information Related man It is used to see the manual of the various command. It helps in selecting the correct options to get the desirable output. Just need to give man command finger Getting information about a local and remote user. Sometimes you may want to know what all user are currently logged into the Unix system then this will help passwd Changing your password for the user. If you are logged in, then enter passwd,it will change the password for the current user. From root login you can change password for any user by using passwd who Finding out who is logged on which find the source directory of the executable being used uname print name of current system. On Solaris uname -X will give the cpu and various other informations uptime Time since the last reboot File listing and directory manipulation command ls List contents of Directory(s) Syntax: ls options OPTIONS The following options are supported:-a Lists all entries, including those that begin with a dot (.), which are normally not listed. -d If an argument is a directory, lists only its name (not its contents); often used with -l to get the status of a directory. -n The same as -l, except that the owner's UID and group's GID numbers are printed, rather than the associated character strings. -r Reverses the order of sort to get reverse alphabetic or oldest first as appropriate.
    [Show full text]
  • Gnu Coreutils Core GNU Utilities for Version 6.9, 22 March 2007
    gnu Coreutils Core GNU utilities for version 6.9, 22 March 2007 David MacKenzie et al. This manual documents version 6.9 of the gnu core utilities, including the standard pro- grams for text and file manipulation. Copyright c 1994, 1995, 1996, 2000, 2001, 2002, 2003, 2004, 2005, 2006 Free Software Foundation, Inc. Permission is granted to copy, distribute and/or modify this document under the terms of the GNU Free Documentation License, Version 1.2 or any later version published by the Free Software Foundation; with no Invariant Sections, with no Front-Cover Texts, and with no Back-Cover Texts. A copy of the license is included in the section entitled \GNU Free Documentation License". Chapter 1: Introduction 1 1 Introduction This manual is a work in progress: many sections make no attempt to explain basic concepts in a way suitable for novices. Thus, if you are interested, please get involved in improving this manual. The entire gnu community will benefit. The gnu utilities documented here are mostly compatible with the POSIX standard. Please report bugs to [email protected]. Remember to include the version number, machine architecture, input files, and any other information needed to reproduce the bug: your input, what you expected, what you got, and why it is wrong. Diffs are welcome, but please include a description of the problem as well, since this is sometimes difficult to infer. See section \Bugs" in Using and Porting GNU CC. This manual was originally derived from the Unix man pages in the distributions, which were written by David MacKenzie and updated by Jim Meyering.
    [Show full text]