DOCSLIB.ORG

Rpp2, an Essential Protein Subunit of Nuclear Rnase P, Is Required for Processing of Precursor Trnas and 35S Precursor Rrna in Saccharomyces Cerevisiae

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Rpp2, an Essential Protein Subunit of Nuclear Rnase P, Is Required for Processing of Precursor Trnas and 35S Precursor Rrna in Saccharomyces Cerevisiae Proc. Natl. Acad. Sci. USA Vol. 95, pp. 6716–6721, June 1998 Biochemistry Rpp2, an essential protein subunit of nuclear RNase P, is required for processing of precursor tRNAs and 35S precursor rRNA in Saccharomyces cerevisiae VIKTOR STOLC*, ALEXANDER KATZ†, AND SIDNEY ALTMAN†‡ †Department of Biology, Yale University, New Haven, CT 06520; and *Department of Cell Biology, Yale University School of Medicine, New Haven, CT 06510 Contributed by Sidney Altman, March 31, 1998 ABSTRACT RPP2, an essential gene that encodes a 15.8- has been suggested that RNase P is an ancestor of RNase kDa protein subunit of nuclear RNase P, has been identified MRP, because RNase MRP has been found only in eukaryotes in the genome of Saccharomyces cerevisiae. Rpp2 was detected (20). Yeast RNase MRP functions in processing of precursor by sequence similarity with a human protein, Rpp20, which rRNAs at the A3 site in the internal transcribed sequence of copurifies with human RNase P. Epitope-tagged Rpp2 can be the 35S precursor rRNA (21) and also cleaves RNA primers found in association with both RNase P and RNase mitochon- for mitochondrial DNA replication (22, 23). Although RNase drial RNA processing in immunoprecipitates from crude MRP does not cleave ptRNAs in vitro, its role in rRNA extracts of cells. Depletion of Rpp2 protein in vivo causes processing is affected by proteins that associate with RNase P accumulation of precursor tRNAs with unprocessed introns in vivo (11–14). RNase P functions in the biosynthesis of and 5* and 3* termini, and leads to defects in the processing tRNAs (8) and appears to have a role in rRNA processing in of the 35S precursor rRNA. Rpp2-depleted cells are defective yeast (14, 24). Thus, processing of precursor tRNA and rRNA in processing of the 5.8S rRNA. Rpp2 immunoprecipitates may be coordinated by the activity of these two related cleave both yeast precursor tRNAs and precursor rRNAs enzymes (14). accurately at the expected sites and contain the Rpp1 protein We report here the cloning and functional characterization orthologue of the human scleroderma autoimmune antigen, of an essential (Rpp2, 15.8-kDa) subunit of S. cerevisiae Rpp30. These results demonstrate that Rpp2 is a protein nuclear RNase P. The gene for this protein, RPP2, was subunit of nuclear RNase P that is functionally conserved in identified by virtue of its homology with a human Rpp20, eukaryotes from yeast to humans. which copurifies with human RNase P (10, 25). The role of Rpp2 protein in processing of precursor tRNA and the 35S RNase P is a ubiquitous endoribonuclease that cleaves 59 precursor rRNA is similar to that of Rpp1, a previously terminal leader sequences of precursor tRNAs to generate 59 characterized yeast RNase P protein subunit (14). A condi- mature termini of tRNAs (1, 2). It is a ribonucleoprotein tional lethal yeast strain of Rpp2 revealed multiple defects in enzyme composed of RNA and protein subunits. Eubacterial processing of precursor tRNAs and precursor 35S rRNA. RNase P consists of a single catalytic RNA subunit (3) and a These results demonstrate that Rpp2 is a protein subunit of single, small, very basic protein cofactor ('14 kDa) that nuclear RNase P that is functionally conserved in eukaryotes increases the catalytic activity and substrate range of the from yeast to humans (10, 12, 14, 25). holoenzyme (4, 5). Archaeal and eukaryotic RNase P RNA have not been shown to be catalytic in vitro in the absence of MATERIALS AND METHODS protein subunits, despite the genetic, biochemical, and phylo- genetic evidence which showed that the RNA subunits of these Strains, Media, and General Procedures. S. cerevisiae strains enzymes are essential for activity and share significant struc- used in this study are VS200 (MATayMATa GAL1yGAL1 tural similarities to the eubacterial RNAs (6–9). The depen- ade2–101yade2–101 leu2–3, 112yleu2–3, 112 ura5–52yura5–52 dence of eukaryotic RNase P on protein components suggests his3-D200yhis3-D200 lys2–801ylys2–801 trp1-D63ytrp1-D63 that the protein subunits may be required for a direct role in RPP2yrpp2::HIS3), VS202A (MATa GAL1 ade2–101 leu2–3, the catalytic activity of the enzyme. However, the exact 112 ura5–52 his3-D200 lys2–801 trp1-D63 rpp2::HIS3 1 identity of all the eukaryotic protein subunits has not yet been pRS314FHRPP2(TRP1)), VS203 (MATa GAL1 ade2–101 determined. At least seven proteins are associated with highly leu2–3, 112 ura5–52 his3-D200 lys2–801 trp1-D63 rpp2::HIS3 1 purified RNase P from human cells: Rpp14, Rpp20, Rpp25, pRS314FHRPP2(TRP1) 1 pRS3163xRPP1(URA3)), VS211B Rpp29, Rpp30, Rpp38, and Rpp40 (10). Genetic and biochem- (MATa GAL1 ade2–101 leu2–3, 112 ura5–52 his3-D200 lys2– ical approaches in Saccharomyces cerevisiae identified four 801 trp1-D63 rpp2::HIS3 1 pRS314RPP2(TRP1)), VS214 proteins—Pop1, Pop3, Pop4 (homologue of Rpp29), and Rpp1 (MATayMATa GAL1yGAL1 ade2–101yade2–101 leu2–3, (homologue of Rpp30)—that associate with RNase P; these 112yleu2–3, 112 ura5–52yura5–52 his3-D200yhis3-D200 lys2– proteins also associate with a related enzyme called RNase 801ylys2–801 trp1-D63ytrp1-D63), VS301A (MATa GAL1 mitochondrial RNA processing (RNase MRP; refs. 11–14). ade2–101 leu2–3, 112 ura5–52 his3-D200 lys2–801 trp1-D63 Yeast nuclear RNase P and RNase MRP are related ribo- rpp2::HIS3 1pYCPGAL::rpp2 (URA3)), and VS301D (MATa nucleoprotein (RNP) enzymes essential for biosynthesis of GAL1 ade2–101 leu2–3, 112 ura5–52 his3-D200 lys2–801 trp1- tRNAs and rRNAs (15–18). The RNA component of RNase D63 RPP2 1pYCPGAL(URA3)). Genetic techniques and MRP has secondary structure similarity to RNase P RNA (19), preparations of standard media were performed according to and both enzymes appear to share protein subunits in vivo.It Abbreviations: Rpp2, RNase P protein 2; ptRNA, precursor tRNA; The publication costs of this article were defrayed in part by page charge prRNA, precursor rRNA, RNase MRP, RNase mitochondrial RNA processing; ITS, internal transcribed sequences. payment. This article must therefore be hereby marked ‘‘advertisement’’ in Data deposition: The sequence reported in this paper has been accordance with 18 U.S.C. §1734 solely to indicate this fact. deposited in the GenBank database (accession no. AF055991). © 1998 by The National Academy of Sciences 0027-8424y98y956716-6$2.00y0 ‡Towhomreprintrequestsshouldbeaddressed.e-mail:sidney.altman@ PNAS is available online at http:yywww.pnas.org. qm.yale.edu. 6716 Downloaded by guest on September 30, 2021 Biochemistry: Stolc et al. Proc. Natl. Acad. Sci. USA 95 (1998) 6717 established procedures (33). The identities of all constructs pRS314FHRPP2. To generate the GAL::RPP2 construct, the were verified by sequencing. Oligonucleotides used in this RPP2 coding sequence was subcloned from pRPP2SK as a study are: RPP2HIS5, 59-AACGAGTAACGAAACACCCA- 0.9-kb BstNI fragment into pYCPGAL(URA3) to generate TCTTTGAAAACTCTAACGCATAAGCCTCGTTCAGA- pYCPGAL::rpp2. ATGACACG-39; RPP2HIS3, 59-ATAGTATACAATAACA- Strain Construction. RPP2-disrupted diploid strain VS200 ATGAGCGCTAAAAGTATGACATATTAAACTCTTG- was transformed with pRS314FHRPP2 and sporulated. The GCCTCCTCTAG-39; RPP2FH, 59-TGCACCCAGGATGG- resulting spores were dissected, and spores that had a disrupted ACTACAAGGATGACGATGACAAGCATCATCATCAT- RPP2 gene but harbored pRS314FHRPP2 plasmid were viable CATCATGCTATGGCACTCAAAAAGAATACAC-39; (VS202A). The two haploids that depend on the plasmid RPP2J, 59-GCCATCCTGGGTGCAG-39; RPP2R, 59-TCCC- pRS314FHRPP2 grew at rates identical to the wild-type hap- CGCGGGGACGGCCGCTTCATCAATTCTGTTTACCC- loids (VS211B). VS202A also was transformed with TTG-39; RPP2T, 59-CGGAATTCGTTTATCAAGTGGAT- pRS316–3xmyc::RPP1 (14) and grown in media lacking uracil, ATGC-39; oligonucleotide a is oligonucleotide no. 5 in ref. 14; to generate VS203. VS200 was transformed with oligonucleotide b, 59-GGCCAGCAATTTCAAGT-39; pYCPGAL::rpp2 sporulated, and germinated on medium con- SNR190, 59-GGCTCAGATCTGCATGTGTTG-39. taining galactose. Viable spores were obtained from several Gene Disruption. A genomic clone encoding the RPP2 locus independent tetrads. Haploids with a disrupted RPP2 allele was identified in the S. cerevisiae genome database (SGD) and that depend on pYCPGAL::rpp2 (VS301A) grew on galactose- obtained from the American Tissue Culture Collection containing plates but not on glucose-containing plates (data (ATCC) as a cosmid (ATCC 71051), which was sequenced not shown). previously. A 2.2-kb AflII fragment that encodes RPP2 was Other Methods. Immunoprecipitations, RNase P and subcloned into pBluescript (SK) vector to generate pRPP2SK. RNase MRP enzymatic assays, and RNA extraction and Using oligonucleotides RPP2HIS5 and RPP2HIS3, the HIS3 analysis were performed as described; immunoprecipitates gene was amplified by PCR from plasmid pRS313(HIS3). The were washed in IP150 buffer (14). Primer extension analysis of resulting 1.2-kb fragment was gel-purified and then was inte- the cleavage of internal transcribed sequences 141 (ITS141) grated at the RPP2 genomic locus in the diploid yeast strain prRNA substrate at the A3 site was performed by using VS214 to generate VS200. The correct replacement of one oligonucleotide 6 (14), according to manufacturer’s procedure allele was verified by PCR digest analysis. Oligonucleotides for reverse transcriptase (Promega). RPP2R and RPP2T were used to amplify genomic DNA isolated from VS200, and the resulting (1.6-kb) fragment RESULTS encoding HIS3 and flanking sequences of RPP2 was mapped with restriction enzymes. An Essential Yeast Gene Encodes a Homologue of Human Construction of Plasmids. A plasmid encoding the FLAG- Rpp20, a Protein Subunit of Nuclear RNase P. We identified HIS epitope-tagged RPP2, pRS314FHRPP2(TRP1), was gen- the RPP2 gene by searching the SGD (26) with the protein erated by PCR using oligonucleotides RPP2FH, RPP2J, sequence of the human Rpp20 protein, which copurifies with RPP2R, RPP2T, and pRPP2SK as template. The PCR frag- human nuclear RNase P (10, 25). We used a computational ment was subcloned into pRS314(TRP1) plasmid to generate sequence search algorithm (BLASTP) (27) to identify a previ- FIG. 1. Yeast Rpp2 is homologous to the human Rpp20 protein.
Load more

Recommended publications
  • Mouse Pop1 Conditional Knockout Project (CRISPR/Cas9)
    https://www.alphaknockout.com Mouse Pop1 Conditional Knockout Project (CRISPR/Cas9) Objective: To create a Pop1 conditional knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Pop1 gene (NCBI Reference Sequence: NM_152894 ; Ensembl: ENSMUSG00000022325 ) is located on Mouse chromosome 15. 17 exons are identified, with the ATG start codon in exon 2 and the TGA stop codon in exon 17 (Transcript: ENSMUST00000052290). Exon 4~5 will be selected as conditional knockout region (cKO region). Deletion of this region should result in the loss of function of the Mouse Pop1 gene. To engineer the targeting vector, homologous arms and cKO region will be generated by PCR using BAC clone RP23-365B13 as template. Cas9, gRNA and targeting vector will be co-injected into fertilized eggs for cKO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Exon 4 starts from about 9.92% of the coding region. The knockout of Exon 4~5 will result in frameshift of the gene. The size of intron 3 for 5'-loxP site insertion: 2480 bp, and the size of intron 5 for 3'-loxP site insertion: 1452 bp. The size of effective cKO region: ~2209 bp. The cKO region does not have any other known gene. Page 1 of 8 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele 5' gRNA region gRNA region 3' 1 4 5 6 7 17 Targeting vector Targeted allele Constitutive KO allele (After Cre recombination) Legends Exon of mouse Pop1 Homology arm cKO region loxP site Page 2 of 8 https://www.alphaknockout.com Overview of the Dot Plot Window size: 10 bp Forward Reverse Complement Sequence 12 Note: The sequence of homologous arms and cKO region is aligned with itself to determine if there are tandem repeats.
    [Show full text]
  • Towards Reconstitution of Human Rnase P Protein Subunits with Human and Bacterial Rnase P Rnas
    Towards reconstitution of human RNase P protein subunits with human and bacterial RNase P RNAs Research Thesis Presented in partial fulfillment of the requirements for graduation with research distinction in Biochemistry in the undergraduate colleges of The Ohio State University by Chigozirim Ekeke The Ohio State University June 2011 Project Advisor: Dr. Venkat Gopalan 1 DEDICATION Dedicated to the Ekeke family for their support, love, and blessings throughout my undergraduate career. 2 ACKNOWLEDGEMENTS I would like to thank Dr. Venkat Gopalan for his mentorship, wisdom, and unselfishness in helping me throughout my undergraduate research studies. He has taught me how to be a better scientist and student. I consider his presence in my life a true blessing. I thank Dr. Lien Lai for her guidance and willingness to help me throughout my research experience. Her opinions, critiques, and invaluable wisdom have molded me into a better researcher as well. I also thank Dr. Caroline Breitenberger for serving on my thesis committee and support throughout my collegiate career. I am grateful to the wonderful colleagues that I worked with in the Gopalan laboratory: Dr. Wen-Yi Chen, Dr. I-Ming Cho, Dr. Anil Challa, Dr. Gireesha Mohannath, Sathiyanarayanan Manivannan, and Cecilia Go. I appreciate their assistance and insights in helping me throughout my research. Additionally, I would like to thank Stella Lai, Emily Wong, Derek Smith, and Andrew Merriman for their sincere friendship and advice throughout this project. I am grateful and humbled by the financial support provided to me by the NSF Research Experience for Undergraduates Supplement (2010), OSU College of Biological Sciences (2009, 2010), and the OSU Colleges of the Arts and Sciences (2010-2011).
    [Show full text]
  • Role and Regulation of the P53-Homolog P73 in the Transformation of Normal Human Fibroblasts
    Role and regulation of the p53-homolog p73 in the transformation of normal human fibroblasts Dissertation zur Erlangung des naturwissenschaftlichen Doktorgrades der Bayerischen Julius-Maximilians-Universität Würzburg vorgelegt von Lars Hofmann aus Aschaffenburg Würzburg 2007 Eingereicht am Mitglieder der Promotionskommission: Vorsitzender: Prof. Dr. Dr. Martin J. Müller Gutachter: Prof. Dr. Michael P. Schön Gutachter : Prof. Dr. Georg Krohne Tag des Promotionskolloquiums: Doktorurkunde ausgehändigt am Erklärung Hiermit erkläre ich, dass ich die vorliegende Arbeit selbständig angefertigt und keine anderen als die angegebenen Hilfsmittel und Quellen verwendet habe. Diese Arbeit wurde weder in gleicher noch in ähnlicher Form in einem anderen Prüfungsverfahren vorgelegt. Ich habe früher, außer den mit dem Zulassungsgesuch urkundlichen Graden, keine weiteren akademischen Grade erworben und zu erwerben gesucht. Würzburg, Lars Hofmann Content SUMMARY ................................................................................................................ IV ZUSAMMENFASSUNG ............................................................................................. V 1. INTRODUCTION ................................................................................................. 1 1.1. Molecular basics of cancer .......................................................................................... 1 1.2. Early research on tumorigenesis ................................................................................. 3 1.3. Developing
    [Show full text]
  • ARCIVES Genome Sequencing Technology: Improvement of the Electrophoretic Sequencing Process and Analysis of the Sequencing Tool Industry by Kazunori Maruyama Ph.D
    Genome Sequencing Technology: Improvement of the Electrophoretic Sequencing Process and Analysis of the Sequencing Tool Industry by Kazunori Maruyama Ph.D. in Material Science, Mie University (2001) M.S. in Macromolecular Science, Osaka University (1993) Submitted to the Alfred P. Sloan School of Management and the Department of Chemical Engineering in Partial Fulfillment of the Requirements for the Degrees of Master of BusinessAdministration and Master of Science in Chemical Engineering In Conjunction with the Leaders for Manufacturing Program at the MASSACHUSETTSINSUE Massachusetts Institute of Technology OF TECHNOLOY June 2005 JUN 01 2005 02005 Massachusetts Institute of Technology. All rights reserved. LIBRARIES Signature of Author Alfred P. Sloan School of Management Department of Chemical Engineering May 6, 2005 Certified by -- Roy E. Welsch Professor of Statistics and Management Science Thesis Advisor Certified by r Patrick S. Doyle Assistant-Professor of Chemical Engineering Thesis Advisor Accepted by · - Margaret Andrews Alfred P. Sloan School of Management Executive Director of Masters Program Accepted by - - Daniel Blankschtein Department of Chemical Engineering Graduate Committee Chairman .ARCIVES Genome Sequencing Technology: Improvement of the Electrophoretic Sequencing Process and Analysis of the Sequencing Tool Industry by Kazunori Maruyama Ph.D. in Material Science, Mie University (2001) M.S. in Macromolecular Science, Osaka University (1993) Submitted to the Alfred P. Sloan School of Management and the Department of Chemical Engineering in Partial Fulfillment of the Requirements for the Degrees of Master of Business Administration and Master of Science in Chemical Engineering ABSTRACT A primary bottleneck in DNA-sequencing operations is the capacity of the detection process. Although today's capillary electrophoresis DNA sequencers are faster, more sensitive, and more reliable than their precursors, high purchasing and running costs still make them a limiting factor in most laboratories like those of the Broad Institute.
    [Show full text]
  • Nuclear Domains of the RNA Subunit of Rnase P
    Journal of Cell Science 110, 829-837 (1997) 829 Printed in Great Britain © The Company of Biologists Limited 1997 JCS8126 Nuclear domains of the RNA subunit of RNase P Marty R. Jacobson1, Long-Guang Cao1,*, Krishan Taneja2, Robert H. Singer2,†, Yu-li Wang1 and Thoru Pederson1,‡ 1Cell Biology Group, Worcester Foundation for Biomedical Research, Shrewsbury, MA 01545, USA 2Department of Cell Biology, University of Massachusetts Medical Center, Worcester, MA 01655, USA *Present address: Department of Molecular Genetics and Microbiology, University of Florida, PO Box 100266, Gainesville, FL 32610, USA †Present address: Department of Anatomy and Structural Biology, Albert Einstein College of Medicine, Bronx, NY 10461-1975, USA ‡Author for correspondence (e-mail: [email protected]) SUMMARY The ribonucleoprotein enzyme RNase P catalyzes the 5′ microinjection. In contrast, a truncated RNase P RNA con- processing of pre-transfer RNA, and has also recently been taining the To binding domain but lacking nucleotides 89- implicated in pre-ribosomal RNA processing. In the 341 became rapidly localized in nucleoli following nuclear present investigation, in situ hybridization revealed that microinjection. However, unlike the full-length RNase P RNase P RNA is present throughout the nucleus of RNA, this 3′ truncated RNA remained stably associated mammalian cells. However, rhodamine-labeled human with the nucleoli and did not translocate to the nucleo- RNase P RNA microinjected into the nucleus of rat kidney plasm. These results suggest a nucleolar phase in the mat- (NRK) epithelial cells or human (HeLa) cells initially uration, ribonucleoprotein assembly or function of RNase localized in nucleoli, and subsequently became more evenly P RNA, mediated at least in part by the nucleolar To distributed throughout the nucleus, similar to the steady- antigen.
    [Show full text]
  • Rpp1, an Essential Protein Subunit of Nuclear Rnase P Required for Processing of Precursor Trna and 35S Precursor Rrna in Saccharomyces Cerevisiae
    Downloaded from genesdev.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press Rpp1, an essential protein subunit of nuclear RNase P required for processing of precursor tRNA and 35S precursor rRNA in Saccharomyces cerevisiae Viktor Stolc1 and Sidney Altman2,3 1Department of Cell Biology, Yale University School of Medicine, New Haven, Connecticut 06510 USA; 2Department of Biology, Yale University, New Haven, Connecticut 06520 USA The gene for an essential protein subunit of nuclear RNase P from Saccharomyces cerevisiae has been cloned. The gene for this protein, RPP1, was identified by virtue of its homology with a human scleroderma autoimmune antigen, Rpp30, which copurifies with human RNase P. Epitope-tagged Rpp1 can be found in association with both RNase P RNA and a related endoribonuclease, RNase MRP RNA, in immunoprecipitates from crude extracts of cells. Depletion of Rpp1 in vivo leads to the accumulation of precursor tRNAs with unprocessed 5* and 3* termini and reveals rRNA processing defects that have not been described previously for proteins associated with RNase P or RNase MRP. Immunoprecipitated complexes cleave both yeast precursor tRNAs and precursor rRNAs. [Key Words: Rpp1; essential protein subunit; nuclear RNase P; S. cerevisiae; precursor tRNA; precursor rRNA] Received June 5, 1997; revised version accepted July 25, 1997. Ribonuclease P (RNase P) is a ubiquitous endoribonucle- limited. RNAse P isolated from human cells copurifies ase that consists of protein and RNA subunits. It cleaves with an RNA (H1; 340), and at least six proteins—Rpp14, 58-terminal leader sequences of precursor tRNAs (Darr et Rpp20, Rpp25, Rpp30, Rpp38, and Rpp40 (Eder et al.
    [Show full text]
  • CREB-Dependent Transcription in Astrocytes: Signalling Pathways, Gene Profiles and Neuroprotective Role in Brain Injury
    CREB-dependent transcription in astrocytes: signalling pathways, gene profiles and neuroprotective role in brain injury. Tesis doctoral Luis Pardo Fernández Bellaterra, Septiembre 2015 Instituto de Neurociencias Departamento de Bioquímica i Biologia Molecular Unidad de Bioquímica y Biologia Molecular Facultad de Medicina CREB-dependent transcription in astrocytes: signalling pathways, gene profiles and neuroprotective role in brain injury. Memoria del trabajo experimental para optar al grado de doctor, correspondiente al Programa de Doctorado en Neurociencias del Instituto de Neurociencias de la Universidad Autónoma de Barcelona, llevado a cabo por Luis Pardo Fernández bajo la dirección de la Dra. Elena Galea Rodríguez de Velasco y la Dra. Roser Masgrau Juanola, en el Instituto de Neurociencias de la Universidad Autónoma de Barcelona. Doctorando Directoras de tesis Luis Pardo Fernández Dra. Elena Galea Dra. Roser Masgrau In memoriam María Dolores Álvarez Durán Abuela, eres la culpable de que haya decidido recorrer el camino de la ciencia. Que estas líneas ayuden a conservar tu recuerdo. A mis padres y hermanos, A Meri INDEX I Summary 1 II Introduction 3 1 Astrocytes: physiology and pathology 5 1.1 Anatomical organization 6 1.2 Origins and heterogeneity 6 1.3 Astrocyte functions 8 1.3.1 Developmental functions 8 1.3.2 Neurovascular functions 9 1.3.3 Metabolic support 11 1.3.4 Homeostatic functions 13 1.3.5 Antioxidant functions 15 1.3.6 Signalling functions 15 1.4 Astrocytes in brain pathology 20 1.5 Reactive astrogliosis 22 2 The transcription
    [Show full text]
  • Accurate Prediction of Kinase-Substrate Networks Using
    bioRxiv preprint doi: https://doi.org/10.1101/865055; this version posted December 4, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Accurate Prediction of Kinase-Substrate Networks Using Knowledge Graphs V´ıtNov´aˇcek1∗+, Gavin McGauran3, David Matallanas3, Adri´anVallejo Blanco3,4, Piero Conca2, Emir Mu~noz1,2, Luca Costabello2, Kamalesh Kanakaraj1, Zeeshan Nawaz1, Sameh K. Mohamed1, Pierre-Yves Vandenbussche2, Colm Ryan3, Walter Kolch3,5,6, Dirk Fey3,6∗ 1Data Science Institute, National University of Ireland Galway, Ireland 2Fujitsu Ireland Ltd., Co. Dublin, Ireland 3Systems Biology Ireland, University College Dublin, Belfield, Dublin 4, Ireland 4Department of Oncology, Universidad de Navarra, Pamplona, Spain 5Conway Institute of Biomolecular & Biomedical Research, University College Dublin, Belfield, Dublin 4, Ireland 6School of Medicine, University College Dublin, Belfield, Dublin 4, Ireland ∗ Corresponding authors ([email protected], [email protected]). + Lead author. 1 bioRxiv preprint doi: https://doi.org/10.1101/865055; this version posted December 4, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Abstract Phosphorylation of specific substrates by protein kinases is a key control mechanism for vital cell-fate decisions and other cellular pro- cesses. However, discovering specific kinase-substrate relationships is time-consuming and often rather serendipitous.
    [Show full text]
  • Capturing the SARS-Cov-2 RNA Genome and Its Bound Proteins with RAP-MS
    SUPPLEMENTARY FIGURES Supplementary Figure 1 | Capturing the SARS-CoV-2 RNA genome anD its bounD proteins with RAP-MS. a, Alignment of protein-crosslinked RNA fragments to the SARS- CoV-2 genome following RNA antisense purification of SARS-CoV-2. Two replicate experiments are shown. b, Fraction of all aligned sequence reads mapping to the human or SARS-CoV-2 genomes in pilot RAP-MS experiment. c, As in b, but for full scale SARS-CoV- 2 RAP-MS and RMRP RAP-MS experiments. D, Western blot of SARS-CoV-2 and RMRP RAP-MS experiments. Antibodies for SARS-CoV-2 nucleoprotein (Abcam, ab272852) and human POP1 (Proteintech, 12029-1-AP) were used. 1 Supplementary Figure 2 | Connecting the SARS-CoV-2 RNA interactome to proteome dynamics in infected cells. a, Principle component analysis for proteome measurements of SARS-CoV-2 infected or Mock infected HuH-7 cells. b, Gene set enrichment analysis for proteins significantly regulated in global proteome measurements. Gene sets enriched in 2 addition to those shown in Figure 3b are presented. c, Protein-protein association network of expanded SARS-CoV-2 interactome proteins (blue: interactome protein, not regulated; red: interactome protein, regulated) and their connections to differentially regulated proteins upon SARS-CoV-2 infection. Upregulated proteins are shown in light grey; downregulated proteins are shown in dark grey. Circle sizes scale to the number of connections of each interactome protein. 3 Supplementary Figure 3 | Functional valiDation of SARS-CoV-2-binding proteins. a, Schematic of dual-fluorescence translation reporter to quantify ribosomal frameshifting efficiency. The depicted control construct contains EGFP and mCherry in an in-frame orientation, leading to the production of both fluorescence proteins separated by a self- cleaving 2A peptide when the 0 reading frame is translated.
    [Show full text]
  • Cryo-EM Structure of Catalytic Ribonucleoprotein Complex Rnase MRP
    bioRxiv preprint doi: https://doi.org/10.1101/2020.03.17.996132; this version posted March 18, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Cryo-EM structure of catalytic ribonucleoprotein complex RNase MRP Authors: Anna Perederina1, Di Li1, Hyunwook Lee1, Carol Bator1, Igor Berezin1, Susan L. Hafenstein1,2, Andrey S. Krasilnikov1,3* Affiliations: 1Department of Biochemistry and Molecular Biology, Pennsylvania State University, University Park, PA 16802 2Department of Medicine, Pennsylvania State University, Hershey, PA 17033 3Center for RNA Biology, Pennsylvania State University, University Park, PA 16802 *Correspondence to: [email protected] Abstract: RNase MRP is an essential eukaryotic ribonucleoprotein complex involved in the maturation of rRNA and the regulation of the cell cycle. RNase MRP is related to the ribozyme-based RNase P, but it has evolved to have distinct cellular roles. We report a cryo-EM structure of the S. cerevisiae RNase MRP holoenzyme solved to 3.0 Å. We describe the structure of this 450 kDa complex, interactions between its components, and the organization of its catalytic RNA. We show that while the catalytic center of RNase MRP is inherited from the ancestral enzyme RNase P, the substrate binding pocket of RNase MRP is significantly altered by the addition of unique RNA and protein elements, as well as by RNA-driven protein remodeling. One Sentence Summary: Changes in peripheral RNA elements and RNA-driven protein remodeling result in diversification of related catalytic RNPs 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.17.996132; this version posted March 18, 2020.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name processing of precursor 1, ribonuclease P/MRP family, (S. cerevisiae) Gene Symbol Pop1 Organism Mouse Gene Summary Description Not Available Gene Aliases 4932434G09Rik RefSeq Accession No. NC_000081.6, NT_039618.8 UniGene ID Mm.248779 Ensembl Gene ID ENSMUSG00000022325 Entrez Gene ID 67724 Assay Information Unique Assay ID qMmuCED0045941 Assay Type SYBR® Green Detected Coding Transcript(s) ENSMUST00000052290, ENSMUST00000079028 Amplicon Context Sequence TCTGACGCAGGGGCTGTGGTCAGGCCCCCTTCCAGGACTAACCTCACACTGCTC CAGGCTCCTCCTAGGCTTTGTCACACAGGGAGATTTTTCTATGGCTGCTGGCTG TGGAGAAGCCTTAGGGTTTGTTAGTATGACCGGCTTGCT Amplicon Length (bp) 117 Chromosome Location 15:34530256-34530402 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 100 R2 0.9999 cDNA Cq 23.04 cDNA Tm (Celsius) 83.5 gDNA Cq 24.05 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Pop1, Mouse Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Mouse Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect.
    [Show full text]
  • Microarray Bioinformatics and Its Applications to Clinical Research
    Microarray Bioinformatics and Its Applications to Clinical Research A dissertation presented to the School of Electrical and Information Engineering of the University of Sydney in fulfillment of the requirements for the degree of Doctor of Philosophy i JLI ··_L - -> ...·. ...,. by Ilene Y. Chen Acknowledgment This thesis owes its existence to the mercy, support and inspiration of many people. In the first place, having suffering from adult-onset asthma, interstitial cystitis and cold agglutinin disease, I would like to express my deepest sense of appreciation and gratitude to Professors Hong Yan and David Levy for harbouring me these last three years and providing me a place at the University of Sydney to pursue a very meaningful course of research. I am also indebted to Dr. Craig Jin, who has been a source of enthusiasm and encouragement on my research over many years. In the second place, for contexts concerning biological and medical aspects covered in this thesis, I am very indebted to Dr. Ling-Hong Tseng, Dr. Shian-Sehn Shie, Dr. Wen-Hung Chung and Professor Chyi-Long Lee at Change Gung Memorial Hospital and University of Chang Gung School of Medicine (Taoyuan, Taiwan) as well as Professor Keith Lloyd at University of Alabama School of Medicine (AL, USA). All of them have contributed substantially to this work. In the third place, I would like to thank Mrs. Inge Rogers and Mr. William Ballinger for their helpful comments and suggestions for the writing of my papers and thesis. In the fourth place, I would like to thank my swim coach, Hirota Homma.
    [Show full text]