Transcriptional Profiles of Differentiating Periocular Neural

ABSTRACT

Transcriptional profiles of differentiating periocular neural crest cells and the function of Nephronectin during chick corneal development by Lian Bi During eye formation, periocular neural crest cells (pNC) migrate and differentiate to form the anterior ocular structures. In the chick cornea, this process involves two waves of migration that result in the formation of the corneal endothelium and stroma. Abnormalities in pNC migration lead to corneal malformation, such as anterior segment dystrophy. Corneal dystrophies, infections, and injuries can lead to corneal blindness, one of the major causes of blindness.

Alternative treatments are developed because of the limitation of traditional corneal transplantation. These treatments benefit from the study of the molecular basis of corneal development and regeneration. However, corneal development is not fully understood.

The purpose of this work was to elucidate the gene expression profiles during pNC migration and to examine the function of a highly regulated gene,

Nephronectin (NPNT), during corneal formation. By performing RNA-seq analysis comparing pNC to the derived corneal structures, I analyzed differentially expressed genes and examined differentiated pathways during corneal formation. This project was designed to summarize the transcriptional regulation that happens at three levels: signaling pathways, transcription factors, and the downstream endothelial

and stromal genes, providing gene candidates involved in corneal formation for future studies.

From the RNA-seq analysis, I identified novel upregulation of NPNT among the extracellular matrix (ECM) proteins of the cornea. NPNT has been studied in other developmental processes but has not been linked to the corneal formation. I report that NPNT is distributed in the primary stroma during pNC migration. Its receptor, Integrin (ITG) α8, is expressed in the pNC that migrate on the primary stroma. Thus, I hypothesized that NPNT interacts with ITGα8β1 to promote pNC migration during corneal development. I performed functional studies by the RCAS-

RNAi system. The knockdown of either NPNT or ITGα8 resulted in the reduction of corneal stromal thickness. Further studies revealed that NPNT overexpression upregulated cell numbers in the corneal stroma but did not increase cell proliferation. Inhibition of ITGα8 in vivo and in vitro both reduced pNC migration.

Together, the functional studies link NPNT/ITGα8β1 signaling to pNC migration during corneal formation. This study reveals a previously unknown ECM-receptor pathway in corneal formation, suggesting a potential gene target or culture matrix in corneal development and regeneration.

Collectively, this work depicts the transcription profiles during chick embryonic corneal development and investigates the function of a candidate ECM protein, NPNT, in this process. This comprehensive analysis served as a foundation of the molecular mechanisms underlying pNC migration, proliferation, and differentiation, providing potential clinical targets during corneal development and induction signals for corneal regeneration.

Acknowledgments

First and foremost, I would like to thank Dr. Peter Lwigale for his guidance and mentorship in my graduate research and thesis writing. I also want to express my love for my fantastic labmates, Justin, Anna, and Ruda, and great thanks to their help and encouragement. Our friendship will last forever. Thanks to previous

Lwigale lab members and undergrads who mentored or assisted me in my research.

I also wish to thank my committee members, BCB professors, and BCB faculty. The support I received from you was precious.

This work could not have been completed without the support of many other people. Over the past five years, I made friends with wonderful people within or outside of Rice Biosciences. They are always there to help. Thank my friends Siyu and Wenbo, who are in different cities but stay connected all the time. Thank my parents, who are far away but always behind me to provide unparalleled support.

Special thanks go to my fluffy kitties, Peanut and Brucie, for being the best companions during my writing.

Lastly, best wish to my best roommate Yidan who is also defending in April.

Contents

Acknowledgments ...... iv

Contents ...... v

List of Figures ...... ix

List of Tables ...... xi

Abbreviations ...... xii

Chapter 1: Literature review ...... 1 1.1. Overview of cornea ...... 1 1.1.1. Structure and function of the cornea ...... 1 1.1.2. Disease, damage and traditional treatment of the cornea ...... 3 1.1.3. Innovative treatments for corneal disease...... 5 1.2. Overview of corneal development ...... 7 1.2.1. Cranial neural crest cells ...... 7 1.2.2. Periocular neural crest migration and anterior segment formation ...... 9 1.2.3. Corneal formation in model organisms ...... 11 1.3. Overview of corneal ECM ...... 12 1.3.1. ECM proteins in corneal development ...... 13 1.3.2. Role of ECM in corneal wound healing ...... 15 1.3.3. Role of ECM in corneal diseases ...... 17 1.4. Overview of ECM protein Nephronectin ...... 18 1.4.1. Potential receptors of NPNT ...... 19 1.4.2. Npnt/Itgα8β1 signaling is critical in mouse kidney formation ...... 21 1.4.3. Function and regulation of Npnt in osteoblast differentiation ...... 22 1.4.4. Function of NPNT in other tissue formation processes ...... 23 1.4.5. Clinical application of Npnt ...... 25 1.5. Hypotheses and Objectives ...... 26

Chapter 2: Materials and Methods ...... 27 2.1. Animals ...... 27 2.1.1. Manipulation of the embryo ...... 27

2.1.2. Tissue collection...... 27 2.1.3. Egg windowing for in ovo manipulation ...... 28 2.2. Cell and tissue culture ...... 29 2.2.1. DF-1 cell maintaining ...... 29 2.2.2. Viral production with DF-1 cells ...... 29 2.2.3. In vivo explant culture ...... 30 2.2.4. BrdU staining ...... 30 2.3. Histology ...... 31 2.3.1. Modified Carnoy’s fixative ...... 31 2.3.2. PFA fixation ...... 31 2.3.3. Methanol fixation ...... 31 2.3.4. Paraffin embedding and section ...... 32 2.3.5. Cryo-sectioning ...... 32 2.3.6. Hematoxylin-eosin staining ...... 33 2.4. In situ Hybridization ...... 33 2.4.1. Probe synthesis ...... 33 2.4.2. Section and whole-mount in situ Hybridization ...... 34 2.5. Section and whole-mount immunostaining ...... 35 2.6. Reverse transcription PCR ...... 36 2.7. Quantitative real-time PCR ...... 37 2.8. Software and Statistics ...... 37 Chapter 3: A Transcriptomic Analysis of Differential Gene Expression during Chick Periocular Neural Crest Differentiation into Corneal Cells ...... 39 3.1. Introduction ...... 39 3.2. Methods ...... 42 3.2.1. Animals ...... 42 3.2.2. Tissue collection...... 42 3.2.3. RNA sequencing and mapping ...... 43 3.2.4. Data access ...... 44 3.2.5. DEGs and Pathway Analyses ...... 44 3.2.6. In situ hybridization and immunostaining ...... 45

vii

3.3. Results ...... 46 3.3.1. Generation of a comprehensive transcriptome during pNC differentiation into corneal cells ...... 46 3.3.2. Identification of differentially expressed genes between pNC and corneal cells ...... 49 3.3.3. Changes in NCC gene expression in the periocular region and cornea ...... 50 3.3.4. Differentiation of pNC is regulated by multiple signaling pathways ...... 53 3.3.4.1. RA signaling pathway ...... 54 3.3.4.2. TGFβ pathway ...... 58 3.3.4.3. Wnt signaling ...... 62 3.3.5. Differential expression of transcription factors during early corneal development ...... 65 3.3.6. Identification of genes involved in pNC differentiation into corneal endothelium ...... 67 3.3.7. Identification of genes involved in pNC differentiation into keratocytes ...... 69 3.4. Conclusions ...... 70

Chapter 4: The Expression of ECM Protein NPNT and Its Receptors in the Cornea ...... 72 4.1. Introduction ...... 72 4.2. Rationale ...... 74 4.3. Expression and distribution of NPNT during chick corneal development ...... 75 4.4. The localization of ITGα8 in early chick corneal formation ...... 78 4.5. Expression pattern of other receptors during chick corneal development ...... 80 4.5.1. Expression pattern of other Integrins during chick corneal ...... 81 4.5.2. Expression pattern of EGF receptors during chick corneal ...... 82 4.6. Colocalization of NPNT with basement membrane proteins during chick corneal formation ...... 83 4.7. Conclusion and Discussion ...... 85 4.7.1. ITGα8-expressed pNC are migrating in the NPNT-distributed primary stroma ...... 85 4.7.2. NPNT in the Bowman’s layer may interact with membrane receptors and CEBM ECM ...... 86 Chapter 5: The Function of NPNT/ ITGα8β1 Signaling during Chick Corneal Development ...... 89

viii

5.1. Background: RNAi knockdown with RCAS system in the chick embryo ...... 89 5.2. Rationale ...... 92 5.3. Vector design and construction ...... 93 5.4. Validation of shRNA knockdown efficacy in DF-1 cells ...... 94 5.4.1. Screening for efficient knockdown with RT-PCR ...... 95 5.4.2. Screening for efficient knockdown construct with qRT-PCR ...... 96 5.5. Microinjection of concentrated viral particles into chick embryos ...... 98 5.6. Functional study of NPNT and ITGα8 in the cornea ...... 101 5.6.1. Knockdown of NPNT results in decreased corneal stromal thickness ...... 101 5.6.2. Overexpression of NPNT results in increased corneal stromal thickness ..... 102 5.6.3. Knockdown of ITGα8 results in decreased corneal stromal thickness ...... 106 5.6.4. Inhibition of ITGα8β1 disrupted pNC migration in vivo and in vitro ...... 108 5.6.4.1. NPNT/ITGα8β1 interaction is involved in pNC migration in vitro ...... 109 5.6.4.2. Knockdown of ITGα8 reduces the migration of pNC into the corneal endothelium at E5 ...... 110 5.7. Conclusion and discussion ...... 111

Chapter 6: Conclusions and Future Directions ...... 114

Bibliography ...... 118

Appendix A: Supplemental tables for RNA-seq experiment ...... 137

Appendix B: Supplemental Figures for NPNT Project ...... 141

List of Figures

Figure 1.1 The structure of human cornea...... 3

Figure 1.2 Migration of cranial neural crest and the migration of pNC to form the cornea...... 9

Figure 1.3 Two types of ECM structures...... 13

Figure 1.4 Overview of Npnt/Itgα8β1signaling in kidney development...... 19

Figure 3.1 RNA-seq experimental design and general analysis...... 48

Figure 3.2 Changes in the molecular identity of NCC ...... 52

Figure 3.3 RA signaling pathway...... 56

Figure 3.4 TGF-β Signaling pathway...... 59

Figure 3.5 Wnt Signaling pathway...... 64

Figure 4.1 Expression pattern of NPNT mRNA in the developing chick eye...... 76

Figure 4.2 Distribution pattern of the NPNT protein in the developing chick eye...... 78

Figure 4.3 Expression pattern of ITGα8 mRNA in the developing chicken eye 80

Figure 4.4 Expression patterns of other receptors of NPNT in chicken eyes .... 83

Figure 4.5 Double immunofluorescence of NPNT with other ECM proteins. .... 85

Figure 5.1 RCAS and RNAi system...... 91

Figure 5.2 Evaluation of gene expression in knockdown and overexpressed DF-1 cell lines by RT-PCR...... 96

Figure 5.3 Screening of NPNT knockdown by qRT-PCR...... 98

Figure 5.4 Injection of NPNT shRNA into chick embryos...... 100

Figure 5.5 Knockdown of NPNT in the chick cornea...... 102

Figure 5.6 Overexpression of NPNT in the chick cornea...... 104

Figure 5.7 Thickening of NPNTOE corneas is not related to cell proliferation...... 106

Figure 5.8 Knockdown of ITGα8 results in decreased corneal stromal thickness...... 108

Figure 5.9 The effect of ITGα8β1 inhibition on pNC migration...... 111

List of Tables

Table 2.1 Primers used in the NPNT project...... 34

Table 2.2 Primary antibodies used in NPNT project ...... 36

Table 3.1 Primers of in situ hybridization probes to confrim the RNA-seq results...... 46

Table 5.1 List of shRNA constructs and qRT-PCR primers designed...... 94

Abbreviations abs: absolute value en: (corneal) endothelium

ASD: anterior segment dysgenesis env: envelop protein

BCIP: 5-bromo-4-chloro-3-indolyl ep: (corneal) epithelium phosphate BMP: bone morphogenetic protein ERK: extracellular signal-regulated protein kinases cds: coding region FBS： fetal bovine serum

CEBM: corneal epithelial basement FDR: false discovery rate membrane CEC: corneal endothelium cell FGF: fibroblast growth factor

CHED: Congenital Hereditary gag: (viral) structural protein (capsid) Endothelial Dystrophy Ct: threshold cycle value GAPDH: glyceraldehyde 3-phosphate dehydrogenase Cu6: Chick U6 (promoter) GDNF: glial cell-derived neurotrophic factor

DAPI: 4',6-diamidino-2-phenylindole GFP： green fluorescent protein

DEG: differentially expressed gene GRN: gene regulatory network

DMEM: Dulbecco’s Modified Eagle H&E: hematoxyilin-eosin staining Medium E(#): embryonic (day of gestation) HH/S: Hamburger-Hamilton stage ec/E: ectoderm HSPG: heparan sulfate proteoglycans

ECM: extracellular matrix ICA： iridal-corneal angle

EGF: epidermal growth factor ITG: integrin

EMT: epithelial-to-mesenchymal JNK: Jun N-terminal kinase transition

xiii

KEGG: Kyoto Encyclopedia of Genes and pol: polymerase Genomes L: lens PSC: pluripotent stem cell

MAB: Maleic acid buffer R: retina

MAM: meprin, A-5 protein, and receptor RA: retinoic acid protein-tyrosine phosphatase µ MAPK: mitogen-activated protein kinase RC: reverse complement

NBT: nitro blue tetrazolium RCAS: replication competent avian sarcomaleukosis virus NCC: neural crest cells RCASBP: RCAS with Bryan polymerase

NPNT: Nephronectin RGD: Arg-Gly-Asp oc: optic cup RPE: retinal pigmented epithelium

PBS: phosphate buffered saline RT-PCR: reverse transcription PCR

PBT: PBS+ Triton X-100 shRNA: short hairpin RNA

PCA: principal component analysis siRNA: short interfering RNA

Pen- Penicillin-Streptomycin st: (corneal) stroma Strep: PFA: paraformaldehyde TGF-β: transforming growth factor

PI3K: phosphoinositide-3 kinase UTR: untranslated region pNC: periocular neural crest cells Wnt: wingless-type MMTV integration site family POEM: preosteoblast EGF-like repeat α-SMA: α-smooth muscle actin protein with MAM domain

Literature review

1.1. Overview of cornea

1.1.1. Structure and function of the cornea

The cornea is the transparent layer lying at the anterior window of the eye.

The cornea of the vertebrates plays two primary roles: It accounts for more than

70% of light refraction for vision and serves a barrier to protect the inner eye.

Because of these two functions, the cornea has specialized structures to maintain both transparency and curvature (Maurice, 1957; Eghrari et al., 2015).

The cornea is composed of three cellular layers: the corneal epithelium, the corneal stroma, and the corneal endothelium (Figure 1.1). In-between are two acellular basement membrane layers composed of extracellular matrix (ECM). From the outer layer, the corneal epithelium is the external layer of the cornea with 4-6 stratified cell layers. The superficial epithelium is exposed to the environment, so it

2 has tight junctions to prevent dehydration and pathogens. The basal epithelial cells come from the limbal region, move outward to replenish cells in the outer layer. The corneal epithelium adheres to the basement membrane of laminins and other ECM proteins through cell adhesions such as hemidesmosomes. Underneath, the corneal stroma is a mesenchymal layer filled with collagen matrix secreted by the embedded keratocytes. It is responsible for ~80% of the corneal volume with regularly assembled collagen fibril, ensuring transparency. Between corneal stroma and corneal endothelium, there is another basement membrane known as the

Descemet’s membrane. The corneal endothelium is a single layer of hexagonal cells firmly connected by tight junctions. It controls the nutrient and water flow into the cornea to keep it relatively dehydrated (Eghrari et al., 2015; Lwigale, 2015). The cornea is also innervated by sensory nerves that originate from the trigeminal ganglion. It is one of the most innervated tissues in the human body. Besides, to maintain its transparency, the cornea has to be avascular (Lwigale, 2015).

Figure 1.1 The structure of human cornea. From the outer layer (top), the cornea has three cellular layers: corneal epithelium, corneal stroma, and cornea endothelium. In between, there are also two basement membranes: The epithelial basement membrane with the adjacent Bowman’s layer, and the endothelial basement membrane, also known as Descemet’s membrane (Secker and Daniels, 2008)

When corneal layers function normally, the light is focused on the retina for the next step of vision information processing. However, clouding of the cornea or distortion of its curvature will result in loss of vision.

1.1.2. Disease, damage and traditional treatment of the cornea

Corneal blindness is one of the major ophthalmic public health problems globally, affecting around 5% of blind people. Various causes can lead to corneal related-vision loss, including infection, nutritional, inflammatory, inherited, iatrogenic, and degenerative conditions (Burton, 2009).

4 The corneal epithelium can be differentiated from the surrounding ocular surface ectoderm because of its transparency. It is the first barrier to infection or trauma. Corneal epithelial cells are maintained by cell division at the limbal stem region. However, defect- or damage-caused limbal cell depletion results in conjunctiva invasion into the cornea, leading to corneal opacification and visual loss

(Dua and Azuara-Blanco, 2000). Wounds that traverse into the stromal layer are another cause of corneal opacity. The fibroblastic wound healing process in the corneal stroma sometimes leaves scar-structures in the cornea, disrupting vision

(Fini, 1999). Corneal curvature is also crucial for focusing light. An acquired corneal disease, keratoconus, is a progressive symptom of the cornea when the collagen fibers are unable to maintain the structure. The affected cornea becomes thinner and bulges into a cone-shape, which distorts both focus and vision (Galvis et al.,

2017).

Corneal endothelial cells are critical in several primary or secondary diseases, but harder to regenerate. For example, Congenital Hereditary Endothelial

Dystrophy (CHED) is characterized by severe dystrophy or even the absence of corneal endothelium, leading to excessive hydration and cornea opacification. A mutation in gene Slc4a11 in endothelial cells was identified for a severe type of

CHED (Ehlers et al., 1998). Fuchs endothelial corneal dystrophy is an acquired endothelial defect that may occur during the iatrogenic process, such as endothelial keratoplasty (Soh and Mehta, 2018). Other congenital corneal diseases also include corneal dermoid, cornea plana, and CYP1B1 cytopathy (Nischal, 2015).

5 At the early stage of corneal diseases, drug or corrective lenses can help prevent the progression. However, with worsening conditions, the widely-adopted therapy is entire or partial keratoplasty (corneal transplant), which is limited by the lack of access to donor corneas (Akpek et al., 2014; Gain et al., 2016), encouraging researchers to develop alternative therapies.

1.1.3. Innovative treatments for corneal disease

To seek an alternative treatment of the corneal blindness, scientists are looking into areas of advanced therapy areas. Aside from the non-biomaterial artificial cornea devices such as the Boston KPro® or AlphaCor® (Akpek et al.,

2014), bioengineered corneas are being developed. The artificial ECM scaffold is usually adopted for the 3D structure of the cornea. For example, experiments were conducted to culture isolated corneal cells on collagen gel (Minami et al., 1993) or collagen-chondroitin sulfate foams (Vrana et al., 2008), and they formed corneal-like structures. With further developments of techniques, cultures of layer-structure such as bioengineered human corneal endothelial cell sheets (Ide et al., 2006) and

3D bio-printed corneal stroma (Isaacson et al., 2018) have been generated in the lab.

However, these cultures still require a large number of corneal cells from donated human corneas.

Besides the need for tissue engineering, in vitro corneal cell culture is also needed in cell therapy for some corneal diseases. The culture of limbal stem cells is a method for the treatment of limbal cell deficiency. In a clinical attempt, patients experiencing corneal opacity due to limbal stem cell deficiency were treated with

6 autologous fibrin-cultured limbal stem cells (Rama et al., 2001). The corneal stroma is usually regeneratable, except for occasions when fibrotic-scars form and affect vision. Thus, injection of cultured stromal stem cells in model animals was tested for scar formation prevention (Basu et al., 2014). There are more studies on non- regenerable corneal endothelial cells. To alleviate the limitation of current endothelial corneal transplants, scientists tested conditions to culture and expand endothelial cells. In recent clinical trials, human corneal endothelial expanded from precursors in vitro, were successfully utilized to treat patients with bullous keratopathy (Kinoshita et al., 2018; Parikumar et al., 2018). In vitro ocular lineage restriction of human pluripotent stem cells (PSCs) is another method for corneal endothelium cell expansion (Zhao and Afshari, 2016). A research team successfully induced polygon-shaped corneal endothelial cell-like cells, and transplanted them into model organisms to restore corneal transparency (Zhang et al., 2014).

Gene therapy is another direction for treating corneal diseases. For example,

Transforming growth factor-β (TGF-β) signaling has been implicated in corneal scarring (Hassell and Birk, 2010). Thus, it is proposed that the downregulation of

TGF-β signaling may help resolve the scar. AAV-mediated Smad-7 inhibition or overexpression of Decorin has been tested in animal corneal wound healing models with the corneal haze (Mohan et al., 2010; Gupta et al., 2017). In addition, AAV-vectors were utilized to overexpress transcription factor E2F2 to increase endothelial cell proliferation in the cultured human cornea (McAlister et al., 2005). Other applications of gene therapy in cornea disorders include corneal neovascularization,

Mucopolysaccharidosis VII, and Herpetic stromal keratitis (Klausner et al., 2007).

7 Currently, the only corneal-related gene therapy under clinical trial is on the adjunctive intervention for superficial corneal opacity or corneal scarring.

(http://www.abedia.com/wiley/record_detail.php?ID=1628). This, however, is just the beginning. More gene treatments are proposed on treating congenital diseases mentioned in the previous section, especially those that have single gene mutations

(Jun and Larkin, 2003).

The directions of advanced therapies of corneal diseases rely on the progress of basic research. Studies on corneal development and regeneration will benefit various clinical aspects, including identifying novel gene targets for treatment, signals for corneal cell induction, candidates of ECM scaffold proteins. Thus, comprehensive research into the molecular levels of corneal development and regeneration is needed.

1.2. Overview of corneal development

Corneal development in the vertebrate is a complex process that involves cell migration, proliferation, and differentiation. The three layers of the cornea are from different origins. The neural crest cells are a special type of stem cells that contribute to this process.

1.2.1. Cranial neural crest cells

The neural crest is a precursor cell group that originates from the neural tube. Neural crest cells exhibit both multipotent and migratory properties and

8 contribute to various tissues, including nerves, cartilage, and connective tissues.

They are sometimes referred as ‘the fourth germ layer’ because they endow the vertebrates with the potential of evolutionary diversity (Le Douarin et al., 2004).

The transcriptional regulation of this process is referred to as the neural crest gene regulatory network (GRN, Simoes-Costa et al., 2014; Simoes-Costa and Bronner,

2015). Among the neural crest populations that arise from different regions, we focus on the cranial neural crest cells that contribute to ocular tissues.

Cranial neural crest cells that migrate to the periocular region are induced between the rostral diencephalon and metencephalon neural tube (Jasrapuria-

Agrawal and Lwigale, 2014). During gastrulation, gradients of extracellular signals or morphogens such as Fibroblast growth factors (FGFs), Bone morphogenetic proteins (BMPs), and Wnt inhibitors regulate a balance between neuronal and ectodermal transcriptional factors and induce the pre-migratory neural crest at the border of the neural plate and the non-neural ectoderm (Simoes-Costa and Bronner,

2015). Established neural crest cells then go through an epithelial-to-mesenchymal transition (EMT) process to delaminate from the neural tube.

Under signaling networks, transcription factors such as Snai1/2, FoxD3, and

Twist instruct the cells to become mesenchymal and migrate directionally (Knecht and Bronner-Fraser, 2002; Simoes-Costa and Bronner, 2015). Neural crest then migrates away from the neural tube and goes to various cranial regions. Migratory neural crest can be tracked by HNK-1 staining as shown in Figure 1.2. During migration, transcriptional factors such as Sox10 and FoxD3 maintain the stemness

9 and migration, while the dynamic signals from the environment send cues instructing the neural crest to differentiate into corresponding structures throughout the head. Our focus is on the anterior eye including the iris, eyelid, jaw, ganglion, melanocytes, and especially the cornea (Creuzet et al., 2005a).

Figure 1.2 Migration of cranial neural crest and the migration of pNC to form the cornea. (A) Staining of migratory cranial neural crest with migratory neural crest cell marker HNK-1 during early chick development. White circle: persumptive eye. Arrow points to the rostral direction. S: Hamburger Stage. (B-F) Corneal development process presented by chick/quail chimeric embryo. L: Lens; Ep: corneal epithelium; St: corneal stroma; En: Corneal endothelium. Blue: DAPI; Red: QCPN. Adapted from Lwigale et al., 2005.

1.2.2. Periocular neural crest migration and anterior segment formation

Cranial neural crest cells that end up in the periocular region are called periocular neural crest cells (pNC). In chick embryos, these neural crest cells are induced at around Hamburger Stage (S)9 (Hamburger and Hamilton, 1951) and start migration at S10. They arrive at the periocular region at about embryonic day

10 (E)3 and pause in the periocular region until E4.5. They eventually migrate to form the anterior segment of the eye, contribute to various ocular structures, including the corneal endothelium, the corneal stroma, and connective tissues (Lwigale et al.,

2004; Creuzet et al., 2005b).

The migration of pNC to form the anterior segment is regulated by environmental signals produced by the optic cup and the lens. Ablation of the lens in the chick results in dysregulated pNC migration and malformation of the cornea

(Beebe and Coats, 2000; Lwigale and Bronner-Fraser, 2009). The role of major signaling pathways including Retinoic Acid (RA), Wnt, and TGF-β signaling pathways (Saika et al., 2001; Matt et al., 2005; Gage et al., 2008) and their cross-talks have been studied in mice. RA from the optic cup (Matt et al., 2005) and TGF-β2 from the lens (Ittner et al., 2005) regulate transcription factors Pitx2 and Foxc1, upregulating Dkk2 that inhibits canonical Wnt signaling (Lehmann et al., 2003;

Evans and Gage, 2005; Gage et al., 2008). Knockout mice of Pitx2 and Foxc1 showed phenocopy that is similar to human anterior segment dysgenesis (ASD, Kitamura et al., 1999; Kume and Seo, 2010). In humans, the development of the anterior segment is advanced by the 5th month of gestation (Sowden, 2007). Defects in pNC migration, proliferation, or differentiation result in ASD, which is comprised of a spectrum of ocular disorders characterized by malformation of the cornea, iris, lens, and eyelids in the patients (Cook, 1989). Several genes are involved in different symptoms of ASD. For example, Peters' anomaly is characterized by the clouding of the cornea and adhesions of the iris and cornea and is usually associated with mutation of genes Pitx2, Foxc1, Pax6, Foxe3, or Cyp1b1 (Sowden, 2007).

11 However, comparing to the study of cranial neural crest GRN, the studies on pNC forming anterior segment were separate and segmented, limiting to abovementioned major signaling pathways. There is still a lack of a comprehensive understanding of the genes that are involved in pNC migration and differentiation.

1.2.3. Corneal formation in model organisms

Our lab has adopted the chicken as a model organism to study the intricate process of corneal formation for two reasons: first, there are many similarities between the human and chick corneal development process (Eghrari et al., 2015); second, embryonic chicken eyes are large and performing in ovo manipulations is convenient, which facilitates our research.

During chicken corneal development, the different layers of the cornea are from different origins. The surface ectoderm adjacent to the lens gradually differentiates to the corneal epithelium whereas other layers are derived from the pNC. As the ectoderm (presumptive corneal epithelium) secretes ECM proteins into the region between it and the lens to form the primary stroma. pNC begin to migrate into the presumptive corneal region over the primary stroma at E4.5. The first wave of pNC forms a single layer of corneal endothelium at E5. Then the second wave of migration starts at E6 and forms the corneal stroma that lies between corneal epithelial and corneal endothelium (Lwigale and Bronner-Fraser, 2009; Lwigale,

2015). Our lab identified a signal mechanism involved in the waves of pNC migration. The lens-secreted signal pathway of semaphorins3A and its receptor, neuropilin-1, serves as a checkpoint to determine the population of the pNC that

12 either enter the cornea or pause in the periocular region (Lwigale and Bronner-

Fraser, 2007; McKenna et al., 2012).

During human corneal development, similarly, there are also two waves of pNC migration to form corneal layers separately. However, corneal formation in rodents is different: there is only one wave of pNC migration to form the corneal mesenchymal region. This segment gradually differentiates into the two separate layers of corneal stroma and the corneal endothelium (Lwigale, 2015). Thus, our lab adopts a combination of different corneal development model systems, including chicken embryos, mouse embryos, and human cell lines.

1.3. Overview of corneal ECM

The extracellular matrices are 3D extracellular macromolecules that appear throughout the body (Bonnans et al., 2014). There are two typical ECM structures: the interstitial matrix is the supportive scaffold of cells in the tissues; the other ECM structure is the basement membrane, which is the fibrous structure connects between the epithelia and underlying connective tissues (Figure 1.3, LeBleu et al.,

2007). There are around 300 proteins in the mammalian ECM, including Collagen,

Proteoglycans and Glycoproteins (Yue, 2014). The compositions of ECM are tissue- specific, time-specific, and even region-specific across the same tissue (Kabosova et al., 2007; Kruegel and Miosge, 2010). The ECM proteins perform essential roles during tissue development and regeneration.

Figure 1.3 Two types of ECM structures. The schematic of general structures formed by ECM proteins in mammals. Two maim structures include the interstitial matrix around the cells and the basement membrane that formed at the connection of epithelium and underlying connective tissues. Adapted from Bonnans et al., 2014

1.3.1. ECM proteins in corneal development

ECM in the cornea is also structured in aforementioned two forms and plays essential roles in corneal development and regeneration. There are two basement membranes connecting the epithelium (corneal epithelium and corneal endothelium) to the connective tissue (corneal stroma, Quantock and Young, 2008;

Torricelli et al., 2013). The interstitial matrix exists throughout all layers of the cornea and is essential for the corneal stroma.

As discussed in Section 1.2.3, at around E3.5 of chick corneal development, the presumptive corneal epithelium synthesizes and secretes type I and II collagen fibrils and other ECM proteins into the space between the presumptive corneal epithelium and the lens to form the primary stroma (Hay and Revel, 1969).

14 Collagens are the primary structural component of ECM. The first wave of pNC migrates on the ECM of primary stroma and becomes the corneal endothelium. The corneal endothelium also secretes type I and II collagen to add to the primary stroma (Linsenmayer et al., 1977; Hendrix et al., 1982). The second wave of pNC migrates into the primary stroma and secretes a huge amount of secondary stroma

(Quantock and Young, 2008). The most abundant component of the secondary stroma is collagen I fibers. To maintain the corneal transparency, these collagen fibers are packed regularly within uniform lamellae that reduce light scattering to the least (Hassell and Birk, 2010). Type V collagens are also important that they assist with the regulation of corneal fibril assembly. Besides, several other non-fibril collagens are in small amounts but essential for the stability and diameters of stromal fibers (Tzortzaki et al., 2003). Another main type of ECM protein in the corneal stroma is proteoglycan which consists of core proteins covalently bound to glycosaminoglycan side chains with sulfated groups. These core proteins function to regulate the size and arrangement of corneal stroma fibers (Quantock and Young,

2008). There are 4 proteoglycans abundant in the adult human cornea, including the decorin, lumican, keratocan, and mimecan (Quantock and Young, 2008; Massoudi et al., 2016).

The basement membrane is a more complex structure in comparison to the interstitial matrix. The corneal epithelial basement membrane (CEBM) consists of type IV collagen, type VII collagen, laminin 332, nidogens, and heparan sulfate proteoglycans (Inomata et al., 2012). Type IV collagens are the major basement membrane collagens that support the whole structure. Laminins are the second

15 abundant ECM proteins in the basement membrane. Laminin 332 forms the anchoring filaments that are assisted by anchoring fibrils of type VII collagen involved in epithelial-stroma attachment (Massoudi et al., 2016). The layer closer to the basal epithelial cells is lamina lucida and the layer closer to the stroma is lamina densa, characterized by heparan sulfate proteoglycans (HSPG), especially perlecan

(Fujikawa et al., 1984; Sato et al., 2013). In some species, including primates and avian, there is an additional ECM layer between the corneal stroma and the lamina densa, called the Bowman’s layer (also referred to as Bowman’s membrane). This is a non-regenerative layer at the top of corneal stroma mostly made up of similar collagens: type I and type V collagen fibers (Linsenmayer et al., 1983). The

Descemet’s (endothelial) membrane is secreted by the corneal endothelium. This basement membrane contains collagens (types IV and type VIII), laminins (laminin

332, 411, and 511) and proteoglycans (such as perlecan and nidogens, Kabosova et al., 2007). The chains of these collagens are dynamic during development and aging

(Massoudi et al., 2016).

1.3.2. Role of ECM in corneal wound healing

As we discussed previously, corneal wounding due to several factors results in the wound healing process. This process is critical in the cornea to maintain transparency. ECM remodeling is a key process during wound healing.

Upon penetrating damage, the affected keratocytes go through apoptosis immediately. The epithelial cells lose the hemidesmosomes and migrate to the wounded area. Re-epithelization of the corneal epithelium is assisted by the ECM

16 (Bhatiacharya and Chandrasekher, 2016). An important ECM protein involved in this process is fibronectin, which binds to receptor integrin α5 and promotes cell migration (Ren et al., 1994; Nakamura and Nishida, 1999). The upregulation of fibronectin during wound healing is promoted by TGF-β signals in the cornea (Usui et al., 1998). In respond to wounding, the keratocytes adjacent to the wound start to actively proliferate. During the wound healing process, the keratocytes become fibroblasts that stop expressing corneal crystallins and instead initiate production of

ECM that involves in wound healing such as fibronectin and proteinases. Fibroblasts close to the epithelium produce α-SMA and present a phenotype of myofibroblasts.

These cells deposit a massive amount of wound healing ECM that affects the opacity of the cornea (Fini and Stramer, 2005). In an ideal scenario such as the embryo, the fibroblasts will resolve after the repair is done. However, persistence of the myofibroblasts results in corneal opacity, which may cause visual impairment, also known as cornea scarring in the adult cornea (Spurlin and Lwigale, 2013b).

The basement membrane also plays an important role during the wound healing process. The broken basement membrane leads to epithelial-stromal interactions that initiate the fibrosis process (Zieske et al., 2001). Limitation of the basement membrane damage results in solely keratocyte death with less scar formation, suggesting a better approach to corneal surgery (Fini and Stramer,

2005).

17 1.3.3. Role of ECM in corneal diseases

The role of ECM is critical in diseases, cancer progression, and immune reaction (Bonnans et al., 2014). Similarly, some corneal diseases are due to ECM defects. ECM proteins also show abnormalities in several diseases such as keratoconus, Fuchs endothelial corneal dystrophy (FECD), and glaucoma (Kenney et al., 1997; Vithana et al., 2011; Okumura et al., 2015).

As mentioned in Section 1.2.2, ASD is a spectrum of eye defects with mutations in different genes. One of the genes that involved in ASD is type IV collagen. The mutation of Col4A1 leads to several vision defects, including corneal opacities in ASD patients and mice model (Coupry et al., 2010). Type IV collagen is also involved in posterior polymorphous corneal dystrophy that affects the endothelium and the Descemet’s membrane (Merjava et al., 2009). Another ECM protein linked to ASD is Laminin β2: loss of function of this gene results in Pierson syndrome, sometimes with a cloudy and enlarged cornea (Bredrup et al., 2008).

Mutation of type IV collagen is also one of the causes of keratoconus (Stabuc-

Silih et al., 2009). ECM related changes are frequently observed in the cornea with keratoconus: altered ECM components including appearance of non-corneal

(limbus, conjunctiva) ECM, fragmentation of the epithelium basement membrane and Bowman’s layer, and even fibrotic ECM invading into the Bowman’s layer

(Kenney et al., 1997; Tuori et al., 1997; Greene et al., 2017). Attempts have been made by transplanting Bowman’s layer to the keratoconus cornea to reduce the thinner and steeper of cornea (van Dijk et al., 2014).

1.4. Overview of ECM protein Nephronectin

Nephronectin (NPNT) was identified as a ligand of Integrin (ITG)α8β1 in the kidney and received this name for its function during kidney development

(Brandenberger et al., 2001). It was once named as POEM (Preosteoblast EGF-like repeat protein with MAM domain) when it was discovered by molecular cloning from MC3T3, a mouse cell line with preosteoblastic phenotype (Morimura et al.,

2001). Human npnt is located on chromosome 4 and expressed in many embryonic and adult tissues (Huang and Lee, 2005). Since discovery, its functions during embryonic development and renal diseases have been studied. Our lab identified

NPNT to be highly expressed during chick corneal development for the first time, which leads to its potential function during corneal development (Bi and Lwigale,

2019).

NPNT is a secreted protein with several functional domains, similar to its mouse homolog (Brandenberger et al., 2001; Morimura et al., 2001) (Figure 1.4A).

There is a putative signal peptide at the N-terminus of NPNT, followed by five EGF- like repeats that are potentially involved in the EGF receptor pathway (Arai et al.,

2017). At the C-terminus, the MAM domain is involved in protein-protein interactions. Previous experiments suggest its function in cell adhesion (Morimura et al., 2001) and binding ability to other ECM proteins (Sato et al., 2013). In between, there is a less conserved linker segment with a triple amino acid Arg-Gly-

19 Asp (RGD) motif that could be recognized by ITGα8β1 in kidney development

(Brandenberger et al., 2001).

Figure 1.4 Overview of Npnt/Itgα8β1signaling in kidney development. (A) The structure of chicken NPNT. From N-terminal to C-terminal are five EGF domains, a central link containing an RGD motif, and a MAM domain. (B, B’) The phenotypes of mice control and Npnt knockout embryonic kidneys. Adapted from James M. Linton et al., 2007. (C) Schematic of the interaction between Npnt and Itgα8β1. In mouse kidney, Npnt in the basement membrane interacts with cell membrane receptor Itgα8β1, which is a heterodimer consisting subunit Itgα8 and Itgβ1. This epithelial-mesenchymal interaction initiates downstream pathways that regulate target gene expression. Adapted from Kiyozumi et al., 2012.

1.4.1. Potential receptors of NPNT

Multiple domains of NPNT protein offer the ability to interact with other proteins and perform different functions. With its RGD domain, NPNT has the potential to bind to RGD Integrins. Integrins are a group of membrane receptors that

20 interact with ECM proteins to initiate intracellular responses. They have two non- covalently associated subunits α and β that combinate to determine an Integrin heterodimer. One of the groups of Integrin are RGD Integrins that could recognize the ligands containing RGD motif (Stepp, 2006). Among them, ITGα8β1 is the first and the only studied protein in this class so far that binds strongly to NPNT by the

RGD motif. In an affinity assay, integrin α8β1-, αVβ3-, αVβ5-, αVβ6-, and α4β7- expressing human K562 cells can bind to npnt at different levels, of which α8β1 binds the most among them (Brandenberger et al., 2001). Of all the RGD-containing

ECM ligands, Itgα8β1 maintains the preference to bind to NPNT not only by the RGD motif but also through an assisting LFEIFEIER sequence (Sato et al., 2009). This sequence is also presented in the chick NPNT sequence. As a control, the binding of

Npnt to ItgαVβ3 is neither RGD- nor LFEIFEIER-dependent (Sato et al., 2009).

The EGF domain of NPNT has the potential to bind to the EGF receptors. In the mouse, Justin Ma investigated the expression of ErbB1, ErbB2, ErbB3 and found that ErbB1 is expressed in the presumptive corneal stroma and epithelium

(unpublished data). There is the possibility of interaction of ERBB1 with NPNT in the chick cornea also.

NPNT is also capable of binding to proteoglycans (Sato et al., 2013). Tests revealed that NPNT binds to HSPGs such as Agrin and Perlecan through its MAM domain. NPNT could also bind to chondroitin sulfate-proteoglycans through five

EGF-like repeats (Sato et al., 2013). A potential explanation is the presence of HSPGs

21 in the basement membrane serves to form a structure with NPNT. Besides, NPNT forms multimers through the binding of the MAM domain (Sato et al., 2009).

1.4.2. Npnt/Itgα8β1 signaling is critical in mouse kidney formation

Npnt/ Itgα8β1 signaling is critical during the formation of the mouse kidney

(Linton et al., 2007). During this process, ureteric bud invades into clusters of metanephric mesenchyme. Npnt is distributed in the basement membrane of the ureteric bud epithelium, whereas its receptor Itgα8β1 is expressed in the adjacent metanephric mesenchyme. The epithelial-mesenchymal interaction stimulates the expression of glial cell-derived neurotrophic factor (GDNF) in the adjacent mesenchyme, activating the downstream pathway that induces condensation and epithelialization of the mesenchyme (Figure 1.4C). By fusing with the ureteric buds, they form the proximal tubule and glomerulus of the nephrons (Brandenberger et al., 2001; Gullberg, 2007; Linton et al., 2007). Knockout of Itgα8β1 or Npnt reduced the expression of Gdnf at the critical timepoint E11.5 of kidney development , and disrupted the invasion of the ureteric bud into the metanephric mesenchyme

(Figure 1.4B). Most of the mutant mice with either Npnt or itgα8β1 knockout display kidney anagenesis on one or both sides of the kidney (Muller et al., 1997; Linton et al., 2007). A potential pathway to be regulated during this ECM-receptor process is the MAPK pathway (Linton et al., 2007).

Interestingly, later studies revealed that during kidney development, a protein family called Fras, including QBRICK, Fras1, and Frem2, is involved in the

22 Npnt/ Itgα8β1 interaction. A condition known as Fraser syndrome shows similar renal agenesis to Npnt/ Itgα8β1/Gdnf regulation. When the Fras protein Qbrick is knocked out, expression of Npnt mRNA is not altered. However, the Npnt distributed at the sublamina densa region of the epidermal basement member through the MAM domain is absent, and the unbound Npnt is depleted (probably through degradation). Thus the binding of Itgα8β1 to the basement membrane is missing, and renal development is defective (Kiyozumi et al., 2012). However, the integrity of the basement membrane surrounding the ureteric buds is not disrupted in Npnt-/- mouse kidney. Expression of Laminin, Fibronectin, or Collagen IV is not altered

(Linton et al., 2007).

1.4.3. Function and regulation of Npnt in osteoblast differentiation

Npnt also contributes to cell differentiation during bone formation. Npnt was found to be expressed in the long bones in vivo (Kahai et al., 2010). Researchers adopted a differentiation assay with mouse osteoblast cell line, MC3T3-E1. This cell line is widely adapted to study bone development as it goes through all three stages of proliferation, differentiation, and mineralization/nodule formation when induced. Differentiated osteoblast cells express alkaline phosphatase (ALP) as a differentiation marker that could be stained easily, as well as a visible morphology change. Knockdown of Npnt reduced the differentiation while its overexpression promoted osteoblast differentiation (Kahai et al., 2009, 2010). The EGF repeats of

Npnt are required to activate the ERK-MAPK signaling pathway involved in this process (Kahai et al., 2010).

23 In the osteoblast differentiation assay, expression of Npnt is strongly inhibited by TGF-β signals. TGF-β1 or SMAD2 treatment resulted in the downregulation of Npnt and disruption of osteoblast differential (Miyazono et al.,

2007; Fang et al., 2010; Tsukasaki et al., 2012). Similarly, Npnt expression is promoted by BMPs, especially BMP-2 (Kurosawa et al., 2016). Other direct/indirect regulators of Npnt found in this system include: 1. Wnt3a up-regulates Npnt through the canonical Wnt/β-catenin pathway (Ikehata et al., 2017); 2. FGF-2 suppresses

Npnt expression through JNK and PI3K pathways (Kato et al., 2018); 3. vitamin D3 up-regulates Npnt through binding to the nuclear receptors (Hiranuma et al., 2016);

4. IL-1β inhibits Npnt expression via ERK1/2 and JNK pathway (Iezumi et al., 2017). miRNA regulation was also studied: For example, miR-378 can bind to the 3’UTR

(untranslated region) of Npnt. Extra miR-378 inhibits Npnt through the disruption of the glycosylation process of Npnt protein (Kahai et al., 2009). The overexpression of 3’UTR of Npnt regulated downstream genes that function in cell proliferation (Lee et al., 2011).

1.4.4. Function of NPNT in other tissue formation processes

Npnt is also expressed in the other tissues. Hence, the functions of Npnt in some other tissue formation processes have been studied. Npnt appears in the developing tooth. Studies found that in human tooth germ, npnt in the basement membrane regulates the expression pattern of the critical transcription factor Sox2 through the EGF-like domains. The knockdown of Npnt decreases dental epithelial stem cell proliferation and differentiation, resulting in reduced size of tooth germ

24 (Arai et al., 2017). Other reports also revealed that Npnt induces proliferation, differentiation, and mineralization on a mouse odontoblast-like cell line (MDPC-23 cells, Tang and Saito, 2017a) and a human dental pulp stem cell line (hDPSCs) in vitro (Tang and Saito, 2017b).

Other experiments also examined the functions of Npnt in other organogenesis. Npnt is deposited at the basement membrane of the mouse hair follicle and induces the differentiation of Itgα8β1-expressing mesenchymal cells into arrector pili muscle and maintains their attachment (Fujiwara et al., 2011). During hair follicle development, knockdown of NPNT is related to the reduction of the amount of arrector pili muscle that anchored to the hair follicles (Fujiwara et al.,

2011). Another study in the zebrafish heart development demonstrated that knockdown of NPNT with morpholino resulted in the failure of atrioventricular valve formation (Patra et al., 2011). The Morpholino technique in the Xenopus

(African claw frog) showed that blockage of NPNT splicing caused a unique phenotype of forelimb missing during tadpole development (Abu-Daya et al., 2011).

Previously, a report demonstrated Npnt is one of the ECM components of the stem cell niche of the eye limbal region (Ordonez and Di Girolamo, 2012). However, there is neither Npnt expression nor function study in the embryonic development of the cornea.

25 1.4.5. Clinical application of Npnt

There have been several attempts to use Npnt in the clinical aspects. Recent reports reveal that in the human kidney, npnt is highly upregulated in many renal diseases. For example, nephronectin immunoreactivity is detected in biopsy specimens of diabetic nephropathy (Nakatani et al., 2012a; Nakatani et al., 2012b).

Npnt is also detected in regenerating tubular cells and the urine after acute tubular necrosis (Cheng et al., 2008). The upregulation of Npnt is detected in the steroid- sensitive nephrotic syndrome patients (Watany and El-Horany, 2018). Thus, Npnt has the potential to serve as a biomarker for the diagnosis of several renal diseases.

Npnt has been studied in some cancer models. Its role in breast cancer metastatic processes was studied and proposed to be a novel prognostic marker in a subgroup of patients (Steigedal et al., 2018). A different study suggested that loss of

Npnt is beneficial for melanoma progression (Kuphal et al., 2008).

Applications of Npnt have been studied in cardiac tissue engineering.

Researchers tried to adopt Npnt as an as an adhesive material for the 3D culture of cardiomyocytes. The tissue culture was successful with the cells maintaining normal adhesion and function (Patra et al., 2012).

A research suggested that Npnt might be involved in autoimmune disease. To test, an anti-Npnt antibody was designed to treat the anti-type II collagen-induced arthritis in the mice and reduced the symptom (Kon et al., 2020).

26 1.5. Hypotheses and Objectives

• The first project of this work is to examine the gene regulatory network of pNC

migration in the chick corneal formation process. I analyzed the expression

profiles of pNC and derived corneal tissues at different levels of signaling

pathways, transcriptional factors, and corneal specific genes.

• In the second project, the expression study of NPNT/ ITGα8β1 in the chick

cornea is performed. NPNT/ ITGα8β1 signaling is hypothesized to promote pNC

migration during chick corneal formation. The hypothesis is examined by loss-

of-function and gain-of-function studies.

Materials and Methods

2.1. Animals

Animal studies were approved by the Institutional Animal Care and Use

Committee (IACUC) at Rice University. Fertilized White Leghorn chicken (Gallus gallus domesticus) was obtained from Texas A&M Poultry Center (College Station,

TX). The eggs were incubated at 38°C under humidified conditions until the desired stages (Hamburger and Hamilton, 1951) or incubation date.

2.1.1. Manipulation of the embryo

2.1.2. Tissue collection

At desired stages, embryos before E3 (Day 3) were dissected from the disk and collected. For older embryos, the heads of E3 to E6 embryos or eyes of embryos

older than E6 were collected. Embryos were processed in Ringer’s solution for the whole-mount experiment or fixed for further sectioning. To isolate the cornea, the anterior eyes were dissected out and then the lens and retinal tissue were removed.

For specific experiments that required a specific layer of the cornea (e.g., RNA collection), corneas were treated in dispase® to loosen the basement membrane between the epithelium and the other corneal layers. Then with forceps, we collected the corneal epithelium and other layers separately.

2.1.3. Egg windowing for in ovo manipulation

Eggs were incubated until the desired stage. A standard protocol of egg processing was developed by Spurlin (Spurlin and Lwigale, 2013a). In the experiment, we firstly opened a small hole at the narrow end of the egg and used a syringe to remove around 3 ml of albumen. This step allowed the embryos to sink to the bottom. Then we sealed the hole with a small piece of tape. A window (diameter

~5 cm) was opened with curved forceps until the germinal disc was fully uncovered.

To keep the spicemen hydrated, we added few drops of Ringer’s solution (with 50

U/ml Penicillin-Streptomycin (Pen-Strep)) over the embryo. Opened eggs were ready for the subsequent in ovo manipulation, including microinjection, electroporation, and bead implantation. These processes will be discussed more in

Chapter 5. After manipulation, the eggs were carefully labeled, sealed, and moved back to the incubator for further development.

2.2. Cell and tissue culture

2.2.1. DF-1 cell maintaining

DF-1 cells (Lot 58217603, ATCC®) were immortalized chicken fibroblast cells with a high proliferation rate and good capacity for viral production (Kong et al., 2011). For each use, cells were revived from Frozen tubes of fourth passage and cultured in complete media (10% Fetal bovine serum (FBS), 1% Pen-Strep in

Dulbecco's Modified Eagle Medium (DMEM)).

2.2.2. Viral production with DF-1 cells

Early passage cells were maintained under routine conditions. I used the

Lipofectamine® system to transfect the cells. Briefly, Lipofectamine® LTX was mixed with the vector in a small amount of cell media, then PLUS™ Reagent was added to assist. DNA-lipid complex was formed and added to the cells with around

50–80% confluency. After one to two days, the cells were checked for GFP, and passaged to a large flask. The media containing the virus were collected in the next

24 to 48 hours when the cells attached and proliferated at around 80% confluency.

After filtering to remove the cell debris, the supernatant was centrifuged with a

Beckman® Ultracentrifuge for 1.5 hour, 21,000 rpm at 4℃. Viral pellet was

resuspended in the minimum amount of media (~500 ul), aliquoted, and then frozen for further use.

2.2.3. In vivo explant culture

E3 anterior eyes were dissected and incubated at 37℃ in dispase

(Worthington®) to loosen the tissue. The periocular mesenchyme tissues were then collected and divided into an equal volume for culture. Labtek-II 8-well dishes were incubated with 100 µl of poly-L lysine and then coated with Fibronectin or NPNT at

10 µg/ml at 37°C for 2 hours. The explants were plated on coated dishes with complete media. ITGα8β1 inhibitor (23-AA peptide, 10 µM) and NucBlue Hoechst-

33342 live stain was added. Explants were then incubated in 37°C humidified chamber with 5% CO2 and fixed at desired time points for observation.

2.2.4. BrdU staining

The stock BrdU solution is diluted in the culture media to 10 µM solution.

Anterior eyes were collected at desired stages, and BrdU was injected to the space between the cornea and lens. The anterior eyes were submerged into BrdU solution for 2 hours at 37℃ and then collected for the following experiment.

2.3. Histology

2.3.1. Modified Carnoy’s fixative

Freshly isolated tissues were fixed overnight at 4°C in modified Carnoy’s fixative (60% ethanol, 30% formaldehyde, and 10% glacial acetic acid). This fixation method is utilized for section in situ hybridization because it provides a relatively good balance between morphology and RNA preservation (Cox et al., 2006).

2.3.2. PFA fixation

PFA fixation preserves tissues by cross-linking. This method is universal and is applied to primary antibodies without special requirements. Paraformaldehyde

(PFA) solutions (4%) were prepared and frozen for later use. Tissues collected or cell mounted on slides were fixed overnight at 4°C in cold 4% PFA solutions. After phosphate buffered saline (PBS) washing, the tissues either went directly to whole- mount experiments or went through the embedding procedure for sectioning.

2.3.3. Methanol fixation

For the best outcome of NPNT antibodies, different fixatives were tested, and methanol fixation (98% methanol, 2% glacier acid) provided the best staining.

Tissues were collected and submerged in methanol fixative (prechilled on dry ice), then stored at -80℃ for more than two days. After transition of temperatures from -

20℃ to 4℃ to room temperature, the methanol-fixed tissues then went to either paraffin or cryo-embedding procedures.

2.3.4. Paraffin embedding and section

The fixed embryos or tissues were dehydrated through a series of increasing ethanol concentration and cleared with histosol. Embryos were infiltrated in a 65℃ oven with paraffin wax overnight. Embryos were then embedded in individual blocks for future use. The blocks were sectioned on a microtome to 10 um then mounted on glass slides, then incubated on a 42℃ warmer for more than two days until thoroughly dried.

2.3.5. Cryo-sectioning

The collected embryos were fixed by PFA or methanol fixations. After washing with PBS, embryos were equilibrated into 5% and then 15% sucrose in

PBS. Embryos can be stored in 15% sucrose for an extended time or go directly to gelatin embedding. Gelatin molds of embryos were flash-frozen in liquid nitrogen and stores at -80℃. Cryo-sectioning of tissues was performed on a Micro® HM550 at 12 microns. Sections were then mounted on glass slides and saved in a -80℃ freezer for future use.

2.3.6. Hematoxylin-eosin staining

Hematoxylin-eosin (H&E) staining was performed according to the standard protocols. Briefly, the tissues were stained for 15 seconds in Hemotoxin and counterstained for 40 seconds in Eosin. Stained tissues were then de-hydrolyzed in pure ethanol or methanol twice and cleared through histosol twice, then mounted with Cytoseal™.

2.4. In situ Hybridization

2.4.1. Probe synthesis

Probes were designed by Primer-blast (NCBI) or adapted from Gallus

Expression in situ Hybridization Analysis (Geisha) and cloned into pCR®II-TOPO® vector or pCR®4-TOPO® with dual promoters (Invitrogen). Digoxigenin-labeled riboprobes were generated by in vitro transcription with Superscript III®. A list of primers used is provided in Table 2.1.

Table 2.1 Primers used in the NPNT project. All primers were designed in Gallus gallus.

Name Transcript Forward (5'-3') Reverse (5'-3') NPNT XM_015276574 CACCTCCAACGCCACCTCTACCTA ATGTGATGTTGAGAAGAGGACGCT NPNT ORF XM_015276574 CTAATGCTCTTCAGAGCAGCG ATGCATTGGGCCAAACAAG ITGa8 XM_015281310 CCACCTGAAGCAGATTACAC ACCGCTAGTACCAGTAGACCA ITGAV NM_205439 ATTCTGCTGGATTGTGGTGAG CTGATACGATGATTGCGGTTA ITGB3 XM_015299304 CGTGCTCGGATGCCTGTAC TTCCCACGGTATGTGATGTTG ITGB5 NM_204483 TGGTTTCCGCCACCTCTTG TTTGGACCGAATGCTGTTGT ITGB6 XM_015289713 AAGCTGGCAGGAATCGTTA CTGATGCGGAAGAAAGGTC GAPDH NM_204305 GATTCTACACACGGACACTTCA CTGAGGGAGCTGAGATGATAAC EGFR NM_205497 GGCCAGTATTCCCTTGCTGT TCAGTGGTTCGACAAGCTCC ERBB2 NM_001044661 TCCAGAACGACACGATTGGG GGGTGCTTGGTGTCCTTGAT

2.4.2. Section and whole-mount in situ Hybridization

The section in situ hybridization was performed as previously described

(Etchevers et al., 2001). Briefly, dewaxed and rehydrated sections were hybridized with probes in an oven set on probe-specific hybridization temperature (equation: y

= -127.15 x2 +190.66 x- 4.62, y: hybridization temperature; x: probe GC content,

Sprulin, 2016) for more than 20 hours. After blocking in blocking solution (Maleic acid buffer (MAB) with 0.1%Tween, 2% Bohringer’s blocking agent, and 2% animal serum), specimen was incubated in of anti-digoxigenin antibody (Diluted 1/2000 in blocking solution) overnight. After washing, sections were equilibrated with NTMT

(0.1 M NaCl, 0.1 M Tris, pH 9.5, 50 mM MgCl2, and 0.1% Tween-20). Then slides were cultured in 5-bromo-4-chloro-3-indolyl phosphate (BCIP)/nitro blue tetrazolium (NBT) color reaction system (0.1% NBT and 0.375% BCIP in NTMT) until the optimum color appeared. The embryos with high specific staining and low

background were fixed in 4% PFA, dehydrated, and mounted with CytoSeal®.

Brightfield images were captured using a Zeiss Axiocam mounted on an

AxioImager2 microscope.

Whole-mount in situ hybridization went through a similar process with a longer time of each step. After the color reaction, embryos were mounted in PBS and imaged.

2.5. Section and whole-mount immunostaining

Paraffin sections or cryosections were rehydrated and washed in PBST following standard protocols. For the PFA-fixed samples, an antigen-retrieval process was done by incubating in 100℃ sodium citrate buffer (10 mM Sodium citrate, 0.05% Tween 20, pH 6.0) for 10 minutes. After being in the blocking buffer for 1 hour, slides were then incubated in the primary antibody in a humid chamber at 4℃ overnight. A list of primary antibodies is summarized in

Table 2.2. After washing, fluorescent-conjugated secondary antibodies were applied to the slides at a concentration of 1:200. Before mounting, we used 4',6- diamidino-2-phenylindole (DAPI) to counterstain the nuclei as needed. Slides were cover-slipped with Fluormount® and imaged by multi-channel fluorescent Imaging with an AxioImager2 fluorescent microscope.

The process of the whole-mount immunostaining was similar, but the timing of each step was prolonged (for embryos) or shortened (for cells). The stained

samples were mounted in PBS, then image with or without z-stack and ApoTome with an AxioImager2 fluorescent microscope.

Table 2.2 Primary antibodies used in NPNT project

Antibody Host Dilution Company NPNT1 Rabbit IgG 1:100 Abcam NPNT2 Rabbit IgG 1:100 Biorbyt QCPN Mouse IgG1 1:1 DHSB HNK-1 Mouse IgM 1:50 DSHB GFP Rabbit IgG 1:500 Invitrogen BrdU Mouse IgG1 1:50 DSHB Protocollagen type I Mouse IgG1 1:30 DSHB Fibronectin Mouse IgG2a 1:30 DSHB Laminin Mouse IgG1 1:30 DSHB Perlecan Mouse IgG1 1:30 DSHB

2.6. Reverse transcription PCR

Dissected tissue such as corneas are submerged in at least 5-fold the volume of TRIzol™. Cells plated in 30 mm plated are homogenized in 1 ml TRIzol™. The RNA extraction procedures went according to the Invitrogen™ TRIzol™ Reagent Protocol.

The RNA precipitation was performed at room temperature for 10 min and then washed by 1 ml ethanol twice. Air dried RNA pellets were dissolved in 30 ul DEPC water and treated with Turbo™ DNAse I system to remove the genomic DNA. The amount of RNA in each sample was normalized by Nanodrop. Reverse transcription is performed with the same amount of RNA with the SuperScript® First Strand

System.

2.7. Quantitative real-time PCR

DF-1 cells with or without viral infection were cultured in 30 mm plates and checked under a fluorescent microscope for GFP expression. Total RNA was extracted as described in Section 2.5 with Trizol Reagent TRIzol™. Genomic DNA was removed with TURBO DNA-free (Ambion). The quality of RNA was assessed using a Nanodrop to have the ratio of absorbance at 260 nm and 280 nm more than

2 and the ratio of absorbance at 260 nm and 280 nm more than 1.8. RNA integrity was verified by agarose gel electrophoresis to show two clear 16S and 28S RNA bands. Normalized RNA was reverse transcribed with SuperScript® First Strand

System. Quantitative real-time PCR (qRT-PCR) was conducted on a CFX96 Real-time instrument/C1000 Thermal Cycler (Biorad) using Perfecta SYBR Green SuperMix. A list of primers used is provided in Table 5.1B GAPDH and β-Actin were used as an internal control. Primers used for the chick genome were designed and compared to identify the pairs that produced the optimum melting curve. Each sample had three repeats and blank controls with water and RNA. The log 2 fold change was calculated as the threshold cycle value of the target gene relative to the control gene and control cDNA from non-infected DF-1 cells (ΔΔCt).

2.8. Software and Statistics

ImageJ was used to measure the brightness, length, or volume of the staining through images. Microsoft Excel was used for basic statistics and Two-tailed T-test

was used to determine significance. With data collected, Microsoft Excel was employed for simple plotting and GraphPad Prism 5 for plotting of the gene knockdown comparisons.

A Transcriptomic Analysis of Differential Gene Expression during Chick Periocular Neural Crest Differentiation into Corneal Cells

A substantial portion of this chapter is from Bi L, Lwigale P, Dev Dyn. 2019

Jul;248(7):583-602.

3.1. Introduction

The cornea is a multilayered transparent tissue comprised predominantly of cells derived from a multipotent embryonic cell population, the neural crest cells

(NCC). Cranial NCC progenitors of the cornea originate from the neural tube region encompassing the caudal diencephalon and the rostral metencephalon (Lwigale et

al., 2004; Creuzet et al., 2005b). This population of NCC forms different streams that migrate into the frontal-nasal, periocular, and maxilla-mandibular regions (Noden,

1975; Johnston et al., 1979; Serbedzija et al., 1992) where they respond to environmental cues and differentiate into region-specific tissues. pNC contribute to various ocular structures including the cornea, eyelids, and connective tissues

(Lwigale et al., 2004; Creuzet et al., 2005b). Defects in pNC migration, proliferation, and differentiation are associated with a condition known as ASD (Cook, 1989). ASD is comprised of spectrum of ocular disorders characterized by malformation of the cornea, iris, lens, and eyelids (Churchill and Booth, 1996; Sowden, 2007). Despite the significance of NCC to eye development, very little is known about the molecular underpinnings of their differentiation into ocular tissues.

During chick corneal development, pNC occupy the mesenchyme surrounding the rudimentary eye for approximately two days prior to their initial migration into the presumptive corneal region at about E4.5. Migration of pNC into the presumptive corneal region occurs in two waves (Hay and Revel, 1969; Lwigale et al., 2005). The first wave forms the corneal endothelium, an interior monolayer of cells that establishes a barrier and regulates fluid movement between the anterior chamber and the cornea (Waring et al., 1982). The second wave of migration occurs at about E6, when pNC invade the acellular primary stroma and differentiate into keratocytes, which synthesize the ECM of the corneal stroma (Linsenmayer et al.,

1984; Quantock and Young, 2008). The intricate behavior of pNC during chick corneal development is in part regulated by the lens vesicle, given that its ablation

results in precocious migration and malformation of the cornea (Beebe and Coats,

2000; Lwigale and Bronner-Fraser, 2009). The molecular signals involved in regulating pNC migration were pinpointed to lens-derived Semaphorin3A and the spatiotemporal downregulation of its receptor, Nrp1, by a subset of pNC, which permitted their migration into the presumptive corneal region (Lwigale and

Bronner-Fraser, 2009). Studies in mice have identified that RA signaling regulates transcription factors expressed by pNC including Pitx2 and Foxc1 that inhibit canonical Wnt signaling via upregulation of Dkk2 (Lehmann et al., 2003; Evans and

Gage, 2005; Gage et al., 2008). Knockout of any one of these genes in mice phenocopy the corneal and iridial defects observed in humans with ASD (Gage et al.,

1999; Kitamura et al., 1999; Kume and Seo, 2010). Together, these studies have advanced our understanding of early corneal development, but the molecular mechanisms that transform pNC into the diverse progeny of ocular cells remain unclear.

In this study, we take advantage of the stepwise contribution of avian pNC to the nascent cornea and survey their gene expression profile during differentiation into corneal endothelium and keratocytes by RNA-Seq analysis. We evaluated changes in expression profile of candidate NCC markers following aggregation in the periocular region. We studied changes in gene expression profiles of components of the major signaling pathways (RA, TGFβ, and Wnt) associated with ocular development. We identified genes that are likely to be involved in pNC differentiation into corneal endothelium and keratocytes. Altogether, these data

serve as a foundation to advance our understanding of the molecular mechanisms underlying pNC migration, proliferation and differentiation.

3.2. Methods

3.2.1. Animals

Fertilized White Leghorn chicken (Gallus gallus domesticus) and Japanese quail eggs (Coturnix coturnix japonica) were obtained from commercial sources and incubated at 38°C under humidified conditions. Quail-chick chimeras were generated to track cells of neural crest origin in ocular tissues by grafting dorsal neural tube explants from stage 9 (Hamburger and Hamilton, 1951) quail donors to stage-matched chick embryos as previously described (Lwigale et al., 2005). Chick and chimeric embryos were incubated until E3, E5, or E7. Embryos were manipulated according to protocols approved by the Institutional Animal Care and

Use Committee (IACUC) at Rice University.

3.2.2. Tissue collection

Periocular neural crest (pNC) mesenchyme was obtained by dissecting the anterior half of the eyes from E3 embryos. Corneal endothelium (En) tissues were obtained by trimming E5 corneas at boundary with the periocular region. Combined keratocytes and corneal endothelium (KEn) tissues were obtained by trimming E7 corneas at the boundary with the limbus region. All tissues were incubated in

dispase (1.5 mg/ml; Worthington) at 38°C for 5 minutes, then rinsed twice in

Ringer’s solution. For the pNC, the ectoderm, lens vesicles, and optic cups were removed and discarded, and the periocular mesenchyme from 26 eyes was pooled into each sample. For the En, the corneal epithelium was removed and discarded, and the endothelial layers from 120 eyes were pooled into each sample. For the KEn, the corneal epithelium was removed and discarded, and the stroma and endothelium from 10 corneas were pooled into each sample. The KEn samples included the corneal endothelium to capture any changes in gene expression at this time point. Three biological repeats were made for each group for a total of 9 samples. All samples were immediately immersed in Trizol (Life Technologies), flash frozen in liquid nitrogen, and shipped in dry ice to BGI.US® for library preparation and sequencing.

3.2.3. RNA sequencing and mapping

Sequencing library of each sample was prepared according to Illumina

Standard Protocols. High-throughput sequencing was performed by Illumina

HiSeqTM4000 (Single Read, 50bp) and generated an average of 47,074,369 raw sequencing reads from each sample. Under quality control, 46,928,426 clean reads were kept after removal of reads with low-quality, adaptors, or high content of unknown bases. Clean reads were then mapped to Gallus gallus reference assembly

Galgal5 and annotated gene model (GenBank: GCA_000002315.3) using Bowtie 2

(Langmead and Salzberg, 2012) and HISAT (Kim et al., 2015). The average mapping

ratio with reference gene was 76.26% and average genome mapping ratio was

93.10%. The mapped reads were then counted by RSEM (Li and Dewey, 2011).

3.2.4. Data access

RNA-Seq data sets have been deposited in the in the NCBI’s GEO database

(https://www.ncbi.nlm.nih.gov/geo/browse/). Accession number (GSE120434).

3.2.5. DEGs and Pathway Analyses

Differentially expressed genes (DEGs) were screened out by EdgeR

(Robinson et al., 2010) and NoiseqBio (Tarazona et al., 2011; Tarazona et al., 2015).

Each pair (En/pNC, KEn/pNC, or KEn/En) was compared, and DEGs were chosen based on the following standards: (1) CPM (count per million) greater than 1 in at least three samples; (2) Log2 fold change greater than 1 in both EdgeR and

NoiseqBIO; (3) FDR (corrected p-value, q-value) less than 0.05 in EdgeR and

Probability (equal to 1-FDR) more than 95% (in NoiseqBio. To reduce false positive rate, overlapped (common) genes from EdgeR and NoiseqBio were defined as DEGs for further analysis. KEGG pathway analysis (Kanehisa et al., 2012) was performed by DAVID Bioinformatics Resources (Huang da et al., 2009). Top significant pathways were ordered by q-value, which is a corrected p-value by multiple hypothesis testing using the Benjamini-Hochberg, with 0.01 as a cutoff.

Neural crest genes with CPM greater than 1 in three pNC samples are considered to be expressed. Genes associated with RA, Wnt and TGF-beta pathways

were analyzed with KEGG pathway and map database and published data from

Pubmed. Transcription factors, corneal endothelium, and ECM genes were analyzed with various tools including KEGG Orthology database, KEGG pathway database,

InterPro database, and published data from Pubmed.

3.2.6. In situ hybridization and immunostaining

Experiments are performed according to Chapter 2. Primers used in the experiment are listed in Table 3.1.

For Immunostaining, mouse anti-QCPN monoclonal antibody (1:1, IgG1,

DHSB) was used to identify quail neural crest-derived cells during corneal development. Secondary antibody (Alexa 594 Goat anti-mouse IgG1, Invitrogen) was used at a concentration of 1:200.

Table 3.1 Primers of in situ hybridization probes to confrim the RNA-seq results. All primers were designed in Gallus gallus. (Bi L, Lwigale P, 2019)

Gene ID Symbol Forward primer (5'-3’) Reverse primer (5'-3’)

NCC 395245 MSX2 CGAGGAGCACCACAAAGTCAAG GACAGGAGTAGCATAGAGTCCAACG 432368 SNAI2 CTGTGTGGACTACAACCGGG CTTCACATCCGAGTGGGTCT 395734 RHOB TCGTCTTCAGCAAGGACGAG GCAATTGATGCAGCCGTTCT RA 416880 ALDH2 ATCCCTTGGAACTTCCCCCT ACTGATGCCCAACAGCAACT 419480 DHRS3 CCTTCCCTTCCTTCGCTTTAT GTGCTTCCAAACTCCACATTTC 386585 NR2F2 CAAAGTTGGCATGAGACGGG AGCTTCCCGAATCGTGTTGG TGF-β 421461 LTBP1 TGCATCAAACCTAACTGTGCA TCGGAAGTTAGTGGCTGTCA 428413 BAMBI GATCGCCATTCCAGCTACAT TTTGCTGTCGTTGATCTTGC 395897 TGFBI CACACAGCTCTACTCCGACC GGCCAACTCAAACAGGGTCT Wnt 100858542 AES TGTTTCCACAAAGCCGACAC TTCTCCCCATCGTCGTCTTG 424707 WLS AGTGATCGCCTTTCTGGTGG GCTATGGGTCCAACCTGCTT 395862 PITX2 AGCGGACGCACTTCACCAGC CGCAGCTCAGTCCGTGGCAA

3.3. Results

3.3.1. Generation of a comprehensive transcriptome during pNC

differentiation into corneal cells

During early ocular development in chick, the status of pNC differentiation can be categorized into three phases: (1) aggregation of NCC into the periocular region, which occurs between E2-E3; (2) migration of pNC into the presumptive corneal region to form the endothelial layer by E5; and (3) migration of pNC into the primary corneal ECM to form the stromal keratocytes by E7. At each of the above stages, NCC are subjected to different environmental cues that play important roles in their migration, proliferation, and differentiation (Brugmann et al., 2006; Lwigale

and Bronner-Fraser, 2009). Our analysis of NCC contribution to early ocular development using the quail/chick chimera technique indicates that the periocular mesenchyme at E3 is mostly comprised of quail-derived QCPN-positive pNC that give rise to the corneal endothelium at E5, and to the keratocytes and endothelium at E7 (Figure 3.1A).

To identify changes in gene expression during pNC formation of corneal cells, we isolated periocular mesenchyme from E3 (pNC), the monolayer of corneal endothelium at E5 (En), and the combined stroma and endothelium at E7 (KEn)

(Figure 3.1B). Three biological triplicates for each time point were prepared for

RNA-Seq analysis as described in the methods section. Principal-components analysis (PCA) was applied to all mapped genes from the 9 samples to determine the reproducibility of biological repeats by Noiseq. The Scatter plots indicate good separation between pNC, En, and KEn, as well as good clustering of the three biological repeats of each sample, with system variance of 89% (Figure 3.1C).

Figure 3.1 RNA-seq experimental design and general analysis (A) Localization of neural crest cells in the periocular region and their corneal derivatives revealed by immunostaining cross sections of quail-chick chimera eyes for QCPN (red) at various stages of ocular development. (B) Periocular neural crest cells (pNC), corneal endothelium (En), or the combined keratocytes and corneal

endothelium (KEn) were isolated at E3, E5, and E7, respectively. (C) PCA plot showing that the triplicate samples from pNC (Red), En (Green), and KEn (Blue) cluster together. Principal components 1 and 2 summarize 89% of the system variance. (D) Bar graph showing numbers of differentially expressed genes (red indicates upregulated and blue indicates downregulated genes). (E) Histogram representation indicating the number of DEGs between pNC-En, pNC-KEn, and En-KEn belonging to significant KEGG pathways. Abbreviations: ec, ectoderm; oc, optic cup; L, lens; ep, epithelium; en, endothelium; st, stroma. Scale bar: 100 μm. (Bi L and Lwigale P, 2019)

3.3.2. Identification of differentially expressed genes between pNC and

corneal cells

To identify differentially expressed genes, we performed further analysis using a cutoff of abs(log2)≥1 and FDR<0.05 on genes that overlapped between

NoiseqBio and EdgeR analyses. Based on these analyses, 3160 genes were differentially expressed between pNC and En (Figure 3.1D). The 2101 upregulated genes represent En and the 1059 downregulated genes represent pNC. Likewise,

3800 genes were differentially expressed between pNC and KEn (Figure 3.1D), of which 2307 upregulated genes represent KEn and the 1493 downregulated genes represent pNC. Given that both En and KEn contain corneal endothelial cells, we analyzed the difference between these two groups. Differentially expressed genes between En and KEn (2096) may be involved either in keratocyte differentiation or associated with further development of the corneal endothelium between E5 and

E7. In this group, 846 genes are upregulated and 1250 genes are downregulated.

KEGG pathway analysis indicated enrichment of similar pathways between pNC/En

and pNC/KEn, with the top five corresponding to focal adhesion, ECM-receptor interaction, cell adhesion, melanogenesis, and MAPK signaling (Figure 3.1E).

3.3.3. Changes in NCC gene expression in the periocular region and cornea

Given that NCC reside in the periocular region for approximately two days before their initial migration into the presumptive cornea (Hay and Revel, 1969), we investigated whether they change their molecular signature prior to and during their differentiation into corneal cells. A list of 47 genes was generated from candidate chick NCC genes (Simoes-Costa et al., 2014; Simoes-Costa and Bronner,

2015), and we examined their expression in pNC, En, and KEn. From this list, 44 NCC genes were expressed in pNC, of which 21 were downregulated, 7 were upregulated, and 10 were constitutively expressed in both En and KEn. Interestingly, 6 genes were either downregulated or maintained in only En or KEn. (Figure 3.2A). Of the 3

NCC genes that were not expressed in the pNC (Dlx6, Erg, Zic4), Erg was upregulated during corneal development. These results indicate that the molecular signature of

NCC is maintained in the periocular region and partially during early corneal development. This assumption is supported by our previous study showing that keratocytes isolated from E10 quail corneas were capable of differentiating into other NCC-derived tissues when grafted into the migratory stream of stage 9 chick embryos (Lwigale et al., 2005). To validate the expression of NCC genes, we chose one gene from each category based on whether they were downregulated (Msx2), maintained (Snai2), or upregulated (Rhob) during corneal development and

analyzed their spatiotemporal expression by in situ hybridization. Our results revealed that Msx2 and Snai2 are expressed in the periocular region (Figure 3.2B, C).

Unlike Msx2, which is restricted to the periocular region, expression of Snai2 is maintained in the corneal endothelium (Figure 3.4C, arrowhead) and stroma. Msx1 and Msx2 are involved in NCC survival, proliferation, and differentiation (Liu et al.,

1999; Ishii et al., 2005), and it is possible that some of the early functions are maintained only in the pNC. Snai2 is involved in the epithelial-mesenchymal transition required for NCC delamination from the neural tube (Taneyhill et al.,

2007). We show that expression of Snai2 is maintained when pNC undergo mesenchyme-endothelial transition to form the corneal endothelium, which strongly expresses N-cadherin (Reneker et al., 2000; Lwigale et al., 2005). Inhibition of E-cadherin by Snai2 requires Lmo4 (Ochoa et al., 2012), which is downregulated in our RNA-Seq data (Figure 3.2A), suggesting that Snai2 may play a different role that does not affect cell adhesion molecules in the corneal endothelium.

Figure 3.2 Changes in the molecular identity of NCC (A) Analysis based on 47 candidate NCC genes indicates that 44 genes were expressed and 3 were not expressed in the periocular region. Of the 44 expressed genes, 21 were downregulated, 10 were constitutively expressed, and 8(7+1) were upregulated during corneal development. (B-D) Section in situ hybridization of E3, E5, and E7 anterior eyes indicating that: (B) Msx2 is strongly expressed in the periocular region but undetectable in the corneal endothelium and stroma; (C) Snai2 is maintained at all three time points; and (D) RhoB is minimal in the periocular region, but it is strongly expressed in the corneal endothelium and stroma. Arrow indicates periocular region and arrowheads indicate corneal endothelium. Abbreviations: pNC, periocular neural crest; ec, ectoderm; oc, optic cup; L, lens; ep, epithelium; en, endothelium; st, stroma. Scale bars: 100 μm. (Bi L and Lwigale P, 2019)

From our list of NCC genes, only Adam11, Cdh11, Csrnp1, Lims1, RhoB, Ap-2β, and Myc are upregulated during corneal development. As an example from this group, we validated the spatiotemporal expression of RhoB. Our data indicate that

RhoB is expressed by a few cells in the periocular region (Figure 3.2D, arrow), then it is strongly expressed in the corneal endothelium (Figure 3.2D, arrowhead), and in both the corneal endothelium and stroma at E7. During early development, RhoB is expressed in the dorsal neural tube and transiently in migratory NCC, and it is involved in the delamination process (Liu and Jessell, 1998). The function of RhoB during corneal development remains unclear, but it has been shown to play a critical role during barrier formation in vascular endothelial cells (Marcos-Ramiro et al.,

2016). Our data also show upregulation of TfAp2β, which suggests a potential role during chick corneal development. Conditional knockout of TfAp2β in the NCC lineage in mice caused several defects in NCC-derived ocular tissues including malformation of the corneal endothelium and stroma (Martino et al., 2016).

3.3.4. Differentiation of pNC is regulated by multiple signaling pathways

Signals from the neural plate, ectoderm, and adjacent mesoderm mediate

NCC formation at the neural plate border with the ectoderm. These include growth factors such as Wnt (Saint-Jeannet et al., 1997), BMP (Liem et al., 1995), FGF

(Monsoro-Burq et al., 2003), and RA signaling (Villanueva et al., 2002; Martinez-

Morales et al., 2011). These signaling pathways regulate NCC formation at all embryonic axial levels, except for RA signaling, which is absent in the rostral cranial

NCC streams that contribute to the eye (Maden et al., 1998). pNC experience similar signals from the adjacent ocular tissues (optic cup, lens, and ectoderm) prior to their migration into the presumptive corneal region. RA signaling is from the optic cup and ectoderm (Li et al., 2000; Matt et al., 2005; Molotkov et al., 2006), whereas TGFβ and BMP are expressed in the lens and optic cup (Trousse et al., 2001; Saika et al.,

2002) . Several Wnts are expressed in the ectoderm, optic cup, and lens (Jin et al.,

2002; Fokina and Frolova, 2006). Interestingly, disruption of these major signaling pathways leads to dysgenesis of NCC-derived ocular tissues (Gage et al., 1999;

Kitamura et al., 1999; Kume and Seo, 2010), but the mechanisms of how they are regulated and their action on pNC are not clearly understood. Our KEGG pathway analysis also indicates that the above signaling pathways are changed during corneal development, thus, we analyzed the expression of RA, TGFβ, and Wnt signaling components and their downstream targets.

3.3.4.1. RA signaling pathway

Genetic studies in mice showed that three retinaldehyde dehydrogenase enzymes (Raldh1/2/3) responsible for RA synthesis are all required for proper development (Dupe et al., 2003; Molotkov et al., 2006; Maden, 2007). Our

data indicate high-level expression of components of the RA signaling pathway during pNC differentiation into corneal cells (

Figure 3.3A). These include transporter genes (Stra6, Crabp1/2 and Rbp5,

Fabp5), enzymes (Dhrs3, Rdh5/12/14, and Aldh1a2), regulatory protein (Cyp26b1), and nuclear receptors (Nr2f1/2, Nr2c1, Rxrα, Rarα, and Rarβ, Ppard). Of these genes,

Aldh1a2, Dhrs3, and Cyp26b1, were significantly upregulated in En and KEn compared to pNC (

Figure 3.3A). Upregulation of Aldh1a2 and Dhrs3 was confirmed by in situ hybridization to determine the specific localization of RA synthesis and inhibition, respectively. Although strongly expressed in the optic cup at E3, Aldh1a2 is not expressed in the pNC. Consistent with our RNA-Seq data, Aldh1a2 is expressed in the corneal endothelium at E5 and E7 (

Figure 3.3C, arrowheads) with sparse staining in the stroma. Similarly, expression of Dhrs3 is minimal in the pNC at E3, but robust in the corneal endothelium at E5 and E7 (

Figure 3.3D, arrowheads), and also expressed in the stroma. Our data show for the first time that the corneal endothelium expresses Aldh1a2 and thus, acts as a potential source for RA signaling, which may act in either an autocrine or paracrine fashion to regulate chick corneal development. Interestingly, our results also suggest that the RA inhibitors Dhrs3 and Cyp26b1 (Sakai et al., 2001; Feng et al.,

2010; Kam et al., 2013) may act at the same time to modulate the levels of signaling in the corneal endothelium and stroma. Our assumption matches previous

observations that RA signaling is intensified in various ocular tissues, including the cornea of Cyp26a1 null mice (Sakai et al., 2004).

Figure 3.3 RA signaling pathway. (A) Black boxes indicate constitutively expressed genes, red boxes indicate upregulated genes, and blue boxes indicate downregulated genes. Double colored boxes indicate partial upregulation, downregulation, or maintenance during corneal development. (B-D) Section in situ hybridization of E3, E5, and E7 anterior eyes showing that: (B) Aldh1a2 is expressed in the optic cup but not the periocular mesenchyme at E3, but it is vividly expressed in the corneal endothelium (arrowhead), and sparsely expressed in the stroma at E7. (C) Expression of Dhrs3 is

ubiquitous but low at E3, but becomes strong in the corneal endothelium (arrowhead) and stroma. (D) Nr2f2 is expressed in the periocular mesenchyme at E3 (arrow), but it is not detectable in the corneal endothelium and stroma at E5 and E7. (E) Heatmap showing the relative upregulation and downregulation of RA target genes between En/pNC and KEn/pNC. Font color of genes indicates previous known RA-upregulated (red) or RA-downregulated (blue) genes. Abbreviations: pNC, periocular neural crest; ec, ectoderm; oc, optic cup; L, lens; ep, epithelium; en, endothelium; st, stroma. Dotted lines represent the cell and nuclear membranes. Scale bars: 100 μm. (Bi L and Lwigale P, 2019)

Downregulated RA genes in En and KEn include Crabp1, Nr2f1 and Nr2f2 (

Figure 3.3A). Downregulation of Crabp1, which promotes RA degradation

(Dong et al., 1999; Michalik and Wahli, 2007), may cause an increase in nuclear RA mediated by Crabp2 that is constitutively expressed. Nr2f1 and Nr2f2 (also known as Coup-tf1 and Coup-tf2) are transcription factors that function as RA nuclear receptors (Kruse et al., 2008; Pickens et al., 2013), but they have also been shown to inhibit RA signaling by binding to retinoic acid response elements (RAREs) of downstream genes (Kliewer et al., 1992; Tran et al., 1992). Our in situ hybridization analysis confirms that Nr2f2 is expressed in the pNC (

Figure 3.3D, arrow), but it is not detectable in the corneal endothelium or stroma (

Figure 3.3D). A similar pattern of downregulation is expected for the expression of Nr2f1, which may indicate a potential increase in expression of RA- target genes in the corneal endothelium and stroma.

Activation of RA signaling leads to upregulation or downregulation of target genes (Balmer and Blomhoff, 2002; Matt et al., 2005). Examples of RA-target genes in the cornea include transcription factors that are either upregulated (Pitx2, Dkk2,

Pax6, TfAp2β) or downregulated (Sox9, Msx1, Otx2, Lmo2,

Figure 3.3A,E). Pitx2, Foxc1, Pax6 play important roles during mouse corneal development (Smith et al., 2000; Kanakubo et al., 2006; Gage et al., 2014), and they are among the ASD genes linked to dysgenesis of the human cornea (Sowden, 2007).

3.3.4.2. TGFβ pathway

The TGFβ superfamily comprises of TGFβs, BMPs, and other ligands, which regulate differentiation, proliferation, migration, and apoptosis in numerous cell types including the NCC (Shah et al., 1996; Chai et al., 2003; Wurdak et al., 2005).

Comparison of En and KEn to pNC indicated that Tgfβ1/2/3 and Bmp4/7 are expressed during corneal development. Tgfβ2 was upregulated and Bmp5 was the only transcript downregulated in En and KEn (Figure 3.4A). In mice TGFβ2 signaling from the lens induces expression of Pitx2 and Foxc1 in the NCC mesenchyme of the presumptive cornea, and its absence causes severe ocular defects including corneal thinning and absence of the corneal endothelium (Saika et al., 2001; Ittner et al.,

2005). Ectopic expression of Bmp5 in the chick neural retina transforms it into retinal pigment epithelium (Steinfeld et al., 2017), but its function in the pNC remains unclear.

Figure 3.4 TGF-β Signaling pathway. (A) Black boxes indicate constitutively expressed genes, red boxes indicate upregulated genes, and blue boxes indicate downregulated genes. Double colored boxes indicate partial upregulation, downregulation, or maintenance during corneal development. (B-D) Section in situ hybridization of E3, E5, and E7 anterior eyes showing that: (B) Ltbp1 is lightly expressed in the periocular mesenchyme at E3 whereas it is strongly expressed in the corneal endothelium and stroma. (C) Bambi is expressed in the optic cup, low in the periocular mesenchyme, and not detectable in the corneal endothelium and stroma. (D) Expression of Tgfβi is also low in the periocular mesenchyme at E3, but it is expressed in the corneal endothelium at E5

(arrowhead) and stroma at E7. (E) Heatmap showing the relative upregulation and downregulation of TGFβ and BMP target genes between En/pNC and KEn/pNC. Font color of genes indicates TGFβ- or BMP-upregulated (red) or TGFβ- downregulated (blue) genes. Abbreviations: pNC, periocular neural crest; ec, ectoderm; oc, optic cup; L, lens; ep, epithelium; en, endothelium; st, stroma. Dotted lines represent the cell and nuclear membranes. Scale bars: 100 μm. (Bi L and Lwigale P, 2019)

The following regulators of TGFβ (Crm1, Thbs1, Ltbp1/2, Dcn, Tgif1/2,

Smurf1/2, Rbx1, Skp1 and Cul1) were expressed during corneal development. Of these, Thbs1, Ltbp1/2, and Dcn were upregulated in En and KEn (Figure 3.4A), indicating their potential function during corneal development. Thbs1 activates

TGFβ and inhibits angiogenesis (Good et al., 1990; Schultz-Cherry et al., 1994;

Tolsma et al., 1997). In the adult cornea, Thsb1 is expressed in the corneal endothelium and stroma (Hiscott et al., 2006), where it plays a role as an antiangiogenic agent during wound healing (Hiscott et al., 1999; Matsuba et al.,

2011; Blanco-Mezquita et al., 2013). Ltbp1 is expressed in a few cells in the periocular region, but it is robust in the corneal endothelium and stroma (Figure

3.4B). LTBP1 plays an important role during secretion, deposition, and activation of

TGFβ in glioma cells (Tritschler et al., 2009), and it is possible that it plays similar roles during corneal development. DCN inhibits TGFβ signaling by binding directly to its active form (Yamaguchi et al., 1990; Border et al., 1992), and it has also been shown to prevent fibrillogenesis of corneal collagen and to cause fibrosis during wound healing (Rada et al., 1993; Mohan et al., 2010). Therefore, upregulation of

Dcn in En and KEn indicates potential modulation of TGFβ signaling, which might be required for activation of specific downstream genes during corneal development.

Our data indicate that Bambi is the only TGFβ regulator that is downregulated in En and KEn (Figure 3.4A). BAMBI is a pseudo-receptor with similar structure to TGFβR1 that inhibits TGFβ signaling and activates canonical

Wnt signaling (Onichtchouk et al., 1999; Lin et al., 2008). We confirmed that Bambi is expressed in the pNC (Figure 3.4C, arrowhead) where it may play a role in Wnt signaling, but it is not detectable in the corneal endothelium and stroma, which correspond with the upregulation of TGFβ signaling in the cornea.

The TGFβ superfamily receptors Tgfβr1/2, Bmpr1A/2, and downstream components including Smad1/2/3/4/5/6 were all constitutively expressed in pNC,

En, and KEn (Figure 3.4A). Several transcription factors downstream of TGFβ signaling were either upregulated (Myc, Twist2, Fos) or downregulated (Sox9,

Lin28a). Surprisingly, some TGFβ activated transcription factors such as Snai1,Tbx3,

Sox9, and Lin28a were downregulated, whereas some that are inhibited by TGFβ

(Irx3 and Myc) were upregulated (Figure 3.4E a). Our data also indicate that majority of the transcription factors activated by BMP signaling such as Id1/2/3,

Msx1, and Hey1 are downregulated during corneal development (Figure 3.4A, E). An example of a TGFβ downstream target that was upregulated in En and KEn is Tgfβ- induced (Tgfβi, also known as Bigh3), which was confirmed to be expressed in the corneal endothelium (Figure 3.4D, arrowhead) and stroma. Tgfβi encodes an ECM protein induced by TGFβ that interacts with collagen (Skonier et al., 1992;

Hashimoto et al., 1997). Recent studies have shown that mutations in Tgfβi in humans cause a condition known as granular corneal dystrophy, which is characterized by opaque deposits in the corneal stroma (Kattan et al., 2017; Nielsen et al., 2017; Chao-Shern et al., 2018). Therefore, its upregulation in our data suggests that TGFβI may play a role in organizing collagen fibrils synthesized by the corneal endothelium and keratocytes during early development.

3.3.4.3. Wnt signaling

Defects in Wnt signaling pathway cause dysgenesis of the anterior ocular tissues in humans and mice (Ittner et al., 2005; Reis and Semina, 2011;

Bankhead et al., 2015). Analysis of the components of the Wnt signaling pathway indicates that despite the expression of several ligands in chick ocular tissues

(Fokina and Frolova, 2006), only Wnt2B, Wnt4, Wnt5A, Wnt6, Wnt9A, and Wnt9B were highly expressed in the pNC and its corneal derivatives during development

(Figure 3.5A). Genes representing regulators of Wnt signaling at multiple levels including Frzb, Dact1/2, Dkk3, Sfrp1/2, Bambi, Axin1/2, Nlk, Groucho, Wls, Aes, and

Ctbp1 were also constitutively expressed in pNC, En and KEn. In this group, only Wls and Bambi mediate Wnt signaling, and the remaining are inhibitors. We confirmed by in situ hybridization that both Wls and Aes are constitutively expressed in the pNC, corneal endothelium, and stroma (Figure 3.5B, C). Wnt receptors and co- receptors including Frz1/2/6/7/9 and Lrp5/6 were also constitutively expressed.

Frz8/10 were upregulated in En but downregulated in KEn, and Frz4 was

downregulated during corneal development (Figure 3.5A). Downstream components of Wnt signaling such as Dvl1/3, Gsk3β, and Ctnnb1 were either upregulated or constitutively expressed, whereas Tcf7, Tcf7l1 and Lef1 were downregulated. Combined, our data suggest that the pNC, corneal endothelium and keratocytes have the potential for canonical Wnt signaling. However, the expression of multiple inhibitors including the upregulation of Dkk2 suggest that Wnt signaling is regulated at multiple levels during corneal development. We therefore examined the expression of Wnt target genes in En and KEn and observed that some Wnt- upregulated genes were downregulated (Sox17, Fst, Jag1, Stra6, Sall4, Ret, Tbx3), whereas others were upregulated (Nos2, Myc, Axin2, Fn1, Cyr61, Pitx2, Mmp2, Lbh,

Wisp1) in our data (Figure 3.5E). However, Cldn1 was upregulated in En but downregulated in KEn, and Sp5 was downregulated in En but upregulated KEn. Our data also show that some Wnt-downregulated genes (Tnfrsf1, Cdh1) were upregulated during corneal development. As an example of a Wnt target gene, we confirmed the expression of Pitx2 and observed vivid expression in the pNC, En, and

KEn (Figure 3.5D). Pitx2 is activated by Wnt signaling (Kioussi et al., 2002; Briata et al., 2003), but also indirectly acts as a Wnt inhibitor via upregulation of Dkk2 (Gage et al., 2008).

Figure 3.5 Wnt Signaling pathway. (A) Black boxes indicate constitutively expressed genes, red boxes indicate upregulated genes, and blue boxes indicate downregulated genes. Double colored boxes indicate partial upregulation, downregulation, or maintenance during corneal development. (B-D) Section in situ hybridization of E3, E5, and E7 anterior eyes showing that: (B) Wls and (C) Aes are both expressed in the periocular mesenchyme at E3, and in the corneal endothelium and stroma. (D) Pitx2 is strongly expressed in

the periocular mesenchyme, corneal endothelium, and stroma. (E) Heatmap showing the relative upregulation and downregulation of Wnt target genes between En/pNC and KEn/pNC. Font color of genes indicates Wnt-upregulated (red) or Wnt- downregulated (blue) genes. Abbreviations: pNC, periocular neural crest; ec, ectoderm; oc, optic cup; L, lens; ep, epithelium; en, endothelium; st, stroma. Dotted arrows indicate implied connection in the literature. Scale bars: 100 μm. (Bi L and Lwigale P, 2019)

Wnt11, the main ligand for the Wnt/PCP pathway, was upregulated in

KEn and Wnt5A, which functions in both the Wnt/calcium and Wnt/PCP pathways

(Yamanaka et al., 2002; Sato et al., 2010), and was maintained at all stages of corneal development. Components of the Wnt/PCP pathway (Damm2, Mapk10, Rock2,

Prickle2, Rhoa, Rac1, Cdc42) and Wnt/calcium pathway (Nfactc1, Prkca, Camk2d,

Ryk, Camk2b) were either upregulated or constitutively expressed. These results raise the possibility that non-canonical Wnt signaling occurs during corneal development and it may be involved in in inducing cell migration and polarity.

3.3.5. Differential expression of transcription factors during early corneal

development

Our data indicate that differential expression of components of the major signaling pathways (RA, Wnt, TGFβ) correspond with the transformation of pNC into corneal endothelium and keratocytes. To identify the genes involved in the process of pNC differentiation into corneal cells, we examined the changes in expression of transcription factors (Appendix Table A1). Upregulated genes with known ocular functions include Pax6 and Znf469. Pax6, which is induced by RA

signaling, is expressed in various ocular tissues and it plays a major role in eye development (Hill et al., 1991; Fujiwara et al., 1994; Baulmann et al., 2002). Analysis of NCC-derived cells in Pax6sey/+ mice showed abnormal migration into the eye

(Kanakubo et al., 2006). Znf469 is involved in ECM synthesis and defects in this gene causes a connective tissue disorders in humans including an ocular defect known as brittle cornea syndrome (Zlotogora et al., 1990; Al-Hussain et al., 2004; Vincent et al., 2014). Based on these examples, the upregulated genes may represent transcription factors involved in key processes of corneal development including cell migration, proliferation, and differentiation.

The downregulated genes represent transcription factors that are only expressed in the pNC (Appendix Table A1). Among these are some of the bona fide NCC genes such as Foxd3, Sox9, and Sox10 (Figure 3.2A). Foxd3 is required for self-renewal and maintenance of NCC multipotency (Labosky and Kaestner, 1998;

Dottori et al., 2001; Mundell and Labosky, 2011), thus its downregulation may be required during pNC differentiation into corneal cells. Sox9 plays an early role during NCC induction (McKeown et al., 2005), but it is later required for chondrogenesis (Zhao et al., 1997; Sahar et al., 2005). Therefore, it is possible that the expression of Sox9 in the pNC may promote the formation of orbital bones, whereas its downregulation in En and KEn might be involved in preventing ossification of the cornea. Similarly, Sox10 is required during NCC induction, but it is later involved in their differentiation into non-mesenchymal derivatives including melanocytes and peripheral neurons (Southard-Smith et al., 1998; Dutton et al.,

2001). Downregulation of Sox10 in En and KEn raises the possibility that both the melanocyte and neural lineages are prevented in the cornea.

Also, among the downregulated genes were representatives of transcription factors that are not expressed by cranial NCC, therefore we considered them specific for the periocular mesenchyme. pNC that do not form the cornea give rise to various skeletomuscular derivatives and also contribute pericytes to the ocular vasculature

(Creuzet et al., 2005a). This is reflected in the pNC transcription factors that play important roles in osteogenesis, myogenesis, and vasculogenesis. For example, Hey1 is a downstream target of Notch signaling that is involved in vasculogenesis and osteoblastic differentiation (Fischer et al., 2004; Salie et al., 2010). Dach2 is required during eye and limb development in drosophila (Mardon et al., 1994), and it synergizes with Eya2 during myogenesis in chick (Heanue et al., 1999). Cited2 is a negative regulator of Hif-1 that is required for normal lens development and regression of the hyaloid vasculature (Chen et al., 2009).

3.3.6. Identification of genes involved in pNC differentiation into corneal

endothelium

The corneal endothelium is comprised of polarized cells that form tight junctions and transport fluids between the cornea and anterior chamber, which is critical for maintaining stromal deturgescence and transparency (Waring et al.,

1982). Our data indicate that most genes involved in membrane transport, cell polarity, and cell junctions were upregulated in both En and KEn (Appendix Table

A2). Examples of membrane transporter genes that are upregulated in the corneal endothelium include Aqp1 and Abcb5. Aqp1 is a bi-directional water transporter

(Sui et al., 2001), which indicates potential increase in fluid absorption during pNC differentiation into corneal cells. Abcb5 is an ATP-dependent transporter that is also a well-known marker for limbal stem cells (Chen et al., 2005; Ksander et al., 2014).

The characteristic hexagonal shape of the corneal endothelium is due to forces that straighten the actomyosin fibers on the apical surface that faces the anterior chamber. The apical surface is also marked by ZO-1, whereas the basal surface that is in contact with the Descemet’s membrane is labeled by α3β1 (He et al., 2016). Interestingly, although ZO-1 (tjp1) is a major component of the adult corneal endothelium (Petroll et al., 1999; Ramachandran and Srinivas, 2010), it was not upregulated in our data sets, suggesting that its expression and function may arise at a later time point than the stages of corneal development used for this study.

Our data indicate that Thy-1, which is involved in cell polarity, was upregulated

(Appendix Table A2). Thy-1 is predominantly expressed in neurons, where it is involved in cell attachment, migration and polarization (Tiveron et al., 1994; Leyton et al., 2001; Kong et al., 2013). Thy-1 is also localized on apical surfaces of epithelial cells (Powell et al., 1991), but it has not been studied in the corneal endothelium.

Genes involved in cell junctions include Cldn4, Cldn3, and Cdh2 (N-cadherin).

Of these genes, Cldn3 is involved in tight junction barrier function in the submandibular glands (Mei et al., 2015; Yokoyama et al., 2017), and it is possible that it plays a similar role in the corneal endothelium. Cdh2 mediates cell adhesion

in neural cells, and it is a well-known marker for corneal endothelial cells (Reneker et al., 2000). Its upregulation indicates the potential for formation of intercellular bonds at the onset of endothelial differentiation.

We also detected genes that are highly expressed in the adult corneal endothelium (Chng et al., 2013). These were either upregulated (Mgarp, Myoc,

Col8a2, Ldha) or constitutively expressed at all three time points (Vim, Tspan6, Tpj2,

Atp1b1, Tpt1, Prdx6, Appendix Table A2).

3.3.7. Identification of genes involved in pNC differentiation into

keratocytes

Keratocytes are characterized by their ability to synthesize the stromal ECM, which is comprised of collagens and proteoglycans that constitute more than 90% of the cornea (Knupp et al., 2009; Hassell and Birk, 2010). Our data show that genes for several ECM-related proteins are upregulated during corneal development

(Appendix Table A3). A majority of the upregulated corneal ECM genes belong to collagen. They represent fibrillar collagens (Col1/2/5/6/11/27) required for the corneal structure, and nonfibrillar collagens, which are either associated with the collagen fibrils (Col9/14/16) or expressed on cell surfaces (Col4/8/17) (Shaw and

Olsen, 1991; Kadler et al., 1996; Knupp et al., 2009). Collagens form the bulk of the corneal stroma and associate with ECM proteins and regulatory enzymes that align and space the structural fibrils in configurations that elicit transparency (Rada et al.,

1993; Michelacci, 2003; Hassell and Birk, 2010). Our data also show that genes for

several proteins expressed in the adult cornea are upregulated in En and KEn. They include glycoproteins (Ntn3, Vit, Spon2,Olfml2b, and Thsb2), proteoglycans

(Ogn[Mimecan], Kera, and Dcn), other ECM proteins (Egfl6, Npnt, Ptn, and Ltbp1/2), and regulatory enzymes (Mmp27, AdamTS2/5/8, and Colgalt2). We also identified some ECM genes that were significantly downregulated in the En and KEn (Vwf, Vtn,

Hapln1, Leprel1, Hpse2 and Csgalnact1). Given the functional differences between the corneal endothelium and keratocytes (Waring et al., 1982; Linsenmayer et al.,

1984; Quantock and Young, 2008), we were surprised that many of the ECM-related genes were expressed by both cell-types. One possibility is that some of these genes are transiently expressed in the corneal endothelium, and this discrepancy could be resolved by comparing their localization at later stages of development.

Alternatively, most of the ECM proteins may be intracellularly degraded upon synthesis in the corneal endothelium (Ko and Kay, 2001; Lee et al., 2012) and thereby do not contribute to the corneal matrix.

3.4. Conclusions

We have used RNA-Seq analysis to provide an unbiased depiction of gene expression for NCC in the periocular region and during their differentiation into corneal endothelium and stromal keratocytes. We confirmed the expression patterns of candidate genes at in the periocular region and during corneal development by in situ hybridization. We highlighted minor deviations in gene expression following aggregation of cranial NCC in the periocular region, suggesting

that pNC maintain a level of multipotency that enables their contribution to various ocular structures later in development. We focused on three major pathways (RA,

Wnt and TGFβ) involved in corneal development and identified for the first time that several modulators are upregulated during pNC differentiation into corneal cells, which could be critical in directing the expression of downstream transcription factors with potential roles in establishing endothelial and keratocyte identities. Previous studies have shown that there is crosstalk between these pathways during corneal development. The RNA-Seq data provides a useful tool for generating gene regulatory networks for pNC migration, proliferation, and differentiation. These data not only provide a foundation for identifying genes with novel function during corneal development, they also provide a valuable resource for future studies of corneal diseases, stem cell biology, and bioengineering of corneal tissues.

The Expression of ECM Protein NPNT and Its Receptors in the Cornea

4.1. Introduction

NPNT was first identified as a ligand of ITGα8β1 during the development of the embryonic kidney (Brandenberger et al., 2001; Morimura et al., 2001). Nephron formation is achieved by the repeated invasion of the ureteric bud into the clustered metanephric mesenchyme and the subsequentially branching. During this process,

NPNT is distributed in the basement membrane of the ureteric bud, and ITGα8β1 is expressed in the surrounding metanephric mesenchyme (Miner, 2001). The epithelial-mesenchymal interaction between these two cell populations results in the activation of downstream signals and the transcriptional regulation of key genes

(Figure 1.4C) (Miner, 2001; Gullberg, 2007; Linton et al., 2007). In mice, knockout of either Npnt or Itgα8β1 resulted in kidney agenesis (Linton et al., 2007).

Chicken NPNT, which is similar to its mouse homolog, is an EGF-like protein composed of three functional domains (Figure 1.4A, Kiyozumi et al., 2012). The N- terminus of NPNT contains five EGF-like repeats that are potentially involved in the

EGFR pathway that regulates cell proliferation during tooth germ formation (Arai et al., 2017; Tang and Saito, 2017). The MAM domain at the C-terminus may contribute to the attachment of NPNT to the cell surface (Morimura et al., 2001) and other ECM proteins, such as HSPGs (Sato et al., 2013). The RGD motif located at the central link of NPNT (Figure 1.4A) is recognized by RGD Integrins, especially ITGα8β1, as occurs in kidney development (Brandenberger et al., 2001). NPNT was also studied in other developmental events; for example, it contributes to the cell differentiation in the mouse osteoblast cell line (Miyazono et al., 2007; Kahai et al., 2010) and epithelial stem cell proliferation during tooth germ formation (Arai et al., 2017). NPNT is also involved in atrioventricular valve formation during zebrafish heart development

(Patra et al., 2011), arrector pili muscle anchoring during hair follicle development

(Fujiwara et al., 2011), and endothelial cell migration during angiogenesis (Kuek et al., 2016a).

There are some candidates that may interact with NPNT in the cornea. In previous studies, ITGα8β1 was found to be not only the first receptor to interact with NPNT but also the receptor that presents the highest affinity to it, comparing

to some other Integrins (Brandenberger et al., 2001). Correspondingly, ITGα8β1 also holds the preference to bind to NPNT through the RGD motif and a binding- facilitating sequence LFEIFEIER (Sato et al., 2009). The existence of both sequences on chick NPNT protein has been confirmed. Other RGD Integrins were shown to have certain degree of attachment to NPNT, though some of them have special preference ligands (Brandenberger et al., 2001). EGFRs were shown to interact with

NPNT during tooth formation and were found in the mice cornea (Tang and Saito,

2017b; Justin Ma, unpublished data).

4.2. Rationale

Our RNA-Seq analysis reported novel upregulation of NPNT during pNC migration and differentiation into the cornea layers (Log 2 Foldchange 6.24,

Appendix A). This highlighted the potential involvement of NPNT during the corneal formation process for the first time, despite a previous report of NPNT in the limbal stem cell niche in the adult human eye (Polisetti et al., 2016). To better understand the function of NPNT in the developing cornea, localization was examined for both

RNA and protein of NPNT. The mRNA expression reveals the cell types that produce

NPNT, and the protein distribution points to the functional location of secreted

NPNT. The previous studies of NPNT in other organs identified it to be localized to the basement membrane, which may apply to the cornea. Moreover, previous studies showed that NPNT functions through a typical ECM signaling by binding to the membrane receptor and activating the intracellular signals. Identifying whether

there is ITGα8β1 or another NPNT receptor in the cornea would aid our understanding of its function in this tissue.

This approach will provide us with new insights into this novel ECM protein, the corneal ECM-receptor pathways, and the interactions between corneal ECM proteins. Furthermore, NPNT and other ECM proteins also have the potential to be a gene target for treatment of corneal illness (Steigedal et al., 2018; Watany and El-

Horany, 2018) or a culture matrix for engineering corneal tissues (Patra et al., 2012;

Sun et al., 2018).

4.3. Expression and distribution of NPNT during chick corneal

development

Firstly, in situ hybridization was performed at E3, E4.5, E5, E6, E7 and E9 corneas presenting the important stages in chicken eye development (Figure 1.2B-

F). Digoxigenin-labeled riboprobe was used to detect NPNT mRNA, whereas the sense probe was adopted as the negative control. In the E3 chick eye, NPNT mRNA is expressed by the lens and the optic cup (specifically in the retinal pigmented epithelium (RPE, Figure 4.1A). This result confirms a previous study reporting

NPNT being expressed in the mouse lens (Brandenberger et al., 2001). The expression in the lens goes down and vanishes at around E9 (Figure 4.1B-D), and the RPE staining also goes lower and barely remains in the presumptive iris region after E6 (Figure 4.1B-F). At E6, when the pNC is migrating into the corneal region,

NPNT is strongly expressed by the migrating pNC (Figure 4.1C). This strong expression of NPNT remains in the cornea stroma and goes lower after E9 (Figure

4.1E-F). Outside the cornea, the expression of NPNT is also visible in the eyelid, cartilage, and muscle of the eyeball, which matches the previous reports of NPNT in osteoblast and muscle tissues (Morimura et al., 2001; Kuek et al., 2016b).

Figure 4.1 Expression pattern of NPNT mRNA in the developing chick eye. Levels of NPNT mRNA expression were revealed by section in situ hybridization on transverse chick eye sections at different stages (A-F). NPNT is expressed in the lens and retina, especially strong at RPE at E3 (A) and E4.5n(B) chick eye. It starts to be expressed in the corneal stroma at E6 (C). The stromal staining remains in E12 cornean (F). E: ectoderm; oc: optic cup; L: lens; pNC: periocular neural crest cells; ep: corneal epithelium; st: corneal stroma: en: corneal endothelium; R: retina; ICA: Iridal- corneal angel. Scale bar: 100 µm.

The distribution of NPNT protein is different from the mRNA pattern. In the

E3 chick eye, NPNT protein is distributed in the lens epithelium, primary stroma, and RPE before the first wave of pNC migration (Figure 4.2A). Later, at E5 and E6, when the second wave of pNC is migrating to form the stroma, it is in the primary stroma and localized to the CEBM region (Figure 4.2BC). After the corneal stroma is formed, NPNT localizes strongly to the CEBM from E7 to E9 and disappears after E9

(Figure 4.2D-E). Though the mRNA is there until later stages, the NPNT protein in the CEBM region is gone after E9 after the pNC migration, probably by some degradation mechanism.

Figure 4.2 Distribution pattern of the NPNT protein in the developing chick eye. Immunofluorescence reveals NPNT protein distribution on transverse chick eye sections at different stages (A-F). DAPI (blue) counterstained the nuclei and was psuedo-colored to be more contrasty. At E3, NPNT (red) can be seen in a lower degree in the lens epithelium, primary stroma, and RPE (A). At E5 and E7, it is also in the primary stroma but strongly condensed to the CEBM region (B, C). The condensed NPNT is visible at E9 (E) but gone at E10 (F). E: ectoderm; oc: optic cup; L: lens; pNC: periocular neural crest cells; ep: corneal epithelium; st: corneal stroma: en: corneal endothelium; R: retina; ICA: Iridal-corneal angel. Scale bar: 100 µm.

4.4. The localization of ITGα8 in early chick corneal formation

The distribution of NPNT in the primary stroma and later the CEBM region is similar to the distribution in the kidney, leading to potential similar epithelial/mesenchymal interaction in the cornea as the kidney. Integrins are non- secreted membrane proteins, so the mRNA pattern indicates both the production

and function locations of the protein. Since ITGβ1 is a universal subunit, I focused on the expression pattern of the subunit ITGα8. The colocalization of ITGα8 with NPNT may provide us with directions for the function of NPNT in the cornea.

I examined the expression of ITGα8 during corneal development by in situ hybridization. ITGα8 is expressed in a dispersed manner, showing expression in individual cells (Figure 4.3). At E4, ITGα8 is expressed by the leading edge of migratory pNC, which is going to form the corneal endothelium (Figure 4.3A). Later, when the second wave of pNC migrates to form the stroma, ITGα8 is expressed by the immature migratory keratocytes at E7 (Figure 4.3B). By E9, ITGα8 is downregulated in the corneal stroma, but it is shown in another pNC-derived tissue, the iridal-corneal angle (ICA, Figure 4.3D). Outside of the cornea, ITGα8 is also expressed in a lower amount in the lens epithelium and iris.

Figure 4.3 Expression pattern of ITGα8 mRNA in the developing chicken eye Levels of mRNA expression were revealed by section in situ hybridization on transverse chick eye sections at different stages (A-D). At E4, ITGα8 is expressed by the leading edge of migratory pNC (A). At E6 and E7, ITGα8 is expressed by the immature migratory keratocytes (B, C). By E9, ITGα8 is downregulated in the corneal stroma but shown in ICA (D). oc: optic cup; L: lens; pNC: periocular neural crest cells; ep: corneal epithelium; st: corneal stroma: en: corneal endothelium; R: retina; ICA: Iridal-corneal angel. Scale bar: 100 µm.

4.5. Expression pattern of other receptors during chick corneal

development

When the corneal stroma is formed after E6, NPNT is distributed in the CEBM region and not in contact with ITGα8 anymore. The CEBM attaches the corneal

epithelium to the corneal stroma and controls the signals that interact through this two cell types (LeBleu et al., 2007). Thus, the possibility exists that there might be other receptors in the corneal epithelium or other basement membrane ECM proteins that interact with NPNT at later stages. The spatiotemporal expression patterns of these proteins may provide additional clues of the role of NPNT in the

CEBM region.

4.5.1. Expression pattern of other Integrins during chick corneal

In previous studies, cell lines expressing other RDG Integrins, including

ITGαVβ3, ITGαVβ5, and ITGαVβ6 have been shown to have some degree of binding ability with NPNT (Brandenberger et al., 2001). First, the expression of ITGαV, β5, and β6 subunits were examined by RT-PCR in the E7 corneas. The result shows that

ITGαV and β5 are expressed in the epithelium of E7 cornea. Because NPNT is not detectable in the corneal epithelium (Figure 4.1), it was adopted as a negative control (Figure 4.4A). In situ hybridization experiment was performed to check the exact location of ITGαV in the E7 chick eye. The result showed that ITGαV is clearly expressed in the lens epithelium and scattered in a low amount in the corneal stroma (Figure 4.4C). Thus, it is less likely to interact with NPNT in the E7 cornea epithelium. The experiment was started with a few of the Integrin candidates that had shown in previous studies to adhere to NPNT. If further experiments are needed, another candidate is ITGα4β7, which is not an RGD Integrin, but previously showed high adhesive activity to NPNT (Brandenberger et al., 2001).

4.5.2. Expression pattern of EGF receptors during chick corneal

RT-PCR for four chick EGF receptors (EGFR, ERBB2, ERBB3, ERBB4) were performed and only found EGFR and ERBB2 to be expressed in the E7 cornea

(Figure 4.4B). Positive cDNA controls for ERBB3, ERBB4 are remained to be done.

Based on the RT-PCR, in situ hybridization was used to validate the localization of

EGFR and ERBB2 in the E7 cornea. EGFR and ERBB2 are not detected in the pNC, the corneal endothelium, or the stroma at E5 and E7. However, there is strong EGFR staining and week ERBB2 staining in the E7 corneal epithelium (Figure 4.4D, E).

Intense staining of EGFR in the lens and ERBB2 in the retina were observed.

Figure 4.4 Expression patterns of other receptors of NPNT in chicken eyes (A) RT-PCR of Integrins in E7 cornea epithelium. ITGαV, β5 are detectable when NPNT is adopted as a negative control. (B) RT-PCR of EGFRs in the E7 corneal epithelium. EGFR and ERBB2 are detectable, but no positive controls were used for the other two pairs of primers. GAPDH was also used as positive control but not shown. (C) ITGaV mRNA expression at E7 in the lens epithelium. (D) EGFR mRNA expression at E7 corneal epithelium .(F) ERBB2 mRNA expression in E7 chick eye. The expression in the lens epithelial is weak but visible.

4.6. Colocalization of NPNT with basement membrane proteins

during chick corneal formation

NPNT located at the basement membrane region can also be investigated by referring to other CEBM markers. The CEBM is a complex structure: the layer that is closer to the basal epithelial cells is the lamina lucida; the other layer that is closer to the stroma is the lamina densa, characterized by the presence of HSPG, especially

Perlecan (Fujikawa et al., 1984; Sato et al., 2013). Bowman’s layer lies under the lamina densa and consists of similar components as the corneal stroma

(Linsenmayer et al., 1983). In the kidney, NPNT in the basement membrane forms complexes with the ECM components though the RGD domain (Figure 1.4A, Talbot et al., 2016). The MAM domain of NPNT also shows the ability to bind to other ECM proteins, especially HSPGs (Kruegel and Miosge, 2010; Sato et al., 2013), which are abundant in the corneal basement membrane (Hassell et al., 1992). These interactions may help NPNT bind to and maintain the structure in the basement membrane region throughout the corneal development.

To understand the exact location of NPNT in the basement membrane region,

Double-immunostainings of NPNT with three typically basement membrane ECM proteins were performed. NPNT does not colocalize with Laminin that marks the two layers of CEBM (

Figure 4.5A). NPNT is adjacent to Perlecan and located closer to the corneal stroma (Figure 4.5B). This proximity links it to Bowman’s layer. To test, NPNT was colocalized with Procollagen I, the marker of Bowman’s layer in the early chick

embryos (Figure 4.5C). In addition, the proximity of NPNT and Perlecan reminds us of the binding ability of these two proteins in the mouse (Sato et al., 2013).

Figure 4.5 Double immunofluorescence of NPNT with other ECM proteins. (A) NPNT does not colocalize with Laminin, which is a marker of lamina lucida (upper layer of the basement membrane. (B) NPNT is adjacent to Perlecan, which is a marker of lumina densa (lower layer of the basement membrane). (C) NPNT colocalizes with Procollagen I, which is a marker of Bowman’s layer in the early embryos. Red: NPNT; Green: Basement membrane protein; Blue: DAPI. Scale Bar: 100 µm.

4.7. Conclusion and Discussion

4.7.1. ITGα8-expressed pNC are migrating in the NPNT-distributed primary

stroma

Before the second wave of pNC migration at E6, NPNT mRNA is expressed in the surrounding optic tissues, but the protein is located to the primary stroma.

ITGα8 is expressed in the corresponding migrating pNC and the newly formed derivatives.

Noticeably, the ITGα8-expressed pNC cells are migrating on the matrix that contains abundant NPNT. This distribution pattern resembles the mouse kidney model, where NPNT in the basement membrane interacts with ITGα8β1 in the mesenchymal cells (Linton et al., 2007). This ECM-receptor signaling activates the downstream intracellular transcription regulation. The underlying hypothesis is that in the chick cornea, NPNT/ITGα8β1 signaling may be involved in pNC migration during the early stages of corneal development. Understand this process would require continuing functional studies by the knockdown of NPNT/ITGα8β1 (see next Chapter). However, this colocalization is lost at later stages of corneal development.

Interestingly, in the kidney, NPNT is shown to be expressed by the epithelial cells like other basement membrane proteins (Arai et al., 2017). However, there is no expression of NPNT in the corneal epithelium. It is worth investigating how the optic cup-expressed NPNT ended up in the primary stroma. There might be a similar mechanism as in the kidney that NPNT binds to ECM proteins to be stabilized in the basement membrane. One of our interest is whether the Fras family of proteins are also expressed in the cornea (Kiyozumi et al., 2012).

4.7.2. NPNT in the Bowman’s layer may interact with membrane receptors and

CEBM ECM

In the later stage of corneal development, NPNT is distributed at the CEBM region, especially the Bowman’s layer, after the three-layer structure is formed.

Possible interaction with NPNT in this region includes Integrins, EGF receptors, as well as basement membrane ECM proteins. In our preliminary studies, EGFR and

ERBB2 are expressed in the corneal epithelium, and Perlecan distributed in the basement membrane is in contact with NPNT.

EGFRs are expressed in the corneal epithelium at E7, whereas keratocyte- expressed NPNT is condensed at the CEBM region. These factors may interact and perform some functions. Studies showed that basement membrane not only connects the epithelium to the stroma, but also serves as a regulator for signals entering the epithelium (Kalluri, 2003; LeBleu et al., 2007). Since epithelial cells go through a slow differentiation process until E14 (Lwigale, 2015), NPNT might also be involved in epithelial differentiation (Hendrix et al., 1982; Zhao et al., 2007).

Further protein interaction and functional experiments are needed to confirm the potential function of NPNT.

The localization of NPNT in the Bowman’s layer is close to Perlecan, and these two components have been shown to bind to each other; there may be an interaction that facilitate maintaining the basement membrane structure and adherence of corneal epithelium to the other layers (Inomata et al., 2012). Further understanding of this process may be achieved by performing protein interaction experiments such as co-immunoprecipitation and functional experiments such as knockdown of NPNT or Perlecan.

NPNT may also contribute to the organization of Bowman’s layer. The current studies on Bowman’s layer are limited and contradictory. Its function in the embryo eye is not well-studied, but this process has some roles in maintaining the integrity and curvature of the cornea epithelium in the adult eye (Hendrix et al.,

1982; Zhao et al., 2007). Some diseases are linked to the malformation of Bowman’s layer. For exmaple, Bowman’s Layer Dystrophy is a progressive disorder leading to corneal opacification (Waring et al., 1978). Breaks of Bowman’s layer were also found in the keratoconus corneas (Tuori et al., 1997). Transplantation of Bowman’s layer has been utilized to prevent the progression of keratoconus (van Dijk et al.,

2014). Understanding of the role of NPNT for the early formation of Bowman’s layer may be helpful with the regeneration of this non-generative layer.

The Function of NPNT/ ITGα8β1 Signaling during Chick Corneal Development

To understand the function of NPNT during chick cornea development, RCAS

(replication-competent ASLV with a splice acceptor) system and RNA interference

(RNAi) system were utilized to knock down the gene expression in chick embryos

(Brummelkamp et al., 2002).

5.1. Background: RNAi knockdown with RCAS system in the

chick embryo

RNAi is a powerful tool to study the function of a target gene in different systems. In this process, small non-coding RNA molecules induce gene silencing by

binding to the RNA-induced silencing complex (RISC, Zamore et al., 2000). Various forms of RNAi have been developed, including the short interfering RNA (siRNA) and short hairpin RNA (shRNA) system (Moore et al., 2010). RNAi can be achieved by direct delivery of the siRNAs into the cells whereas our lab uses shRNA that can be integrated into the host genome and can keep RNAi constantly working to achieve an extended period of knockdown (Figure 5.1). shRNA is a synthesized RNA sequence with a secondary structure that resembles a hairpin (Figure 5.1D). A viral vector delivers double-stranded DNA that contains shRNA sequence (Figure 5.1C) to be integrated into the host genome. With the assistance of the host polymerase, the virus replicates itself and produces a double-stranded RNA (Figure 5.1D). The double-stranded RNA is processed by RNase Dicer to a shorter siRNA (Figure 5.1E).

The guide strand of siRNA then incorporates into the RISC and finds the homologous sequence on target mRNA. The nucleases in the RISC fully degrade the recognized mRNA after the siRNA sufficiently hybridizes with the target sequence (Figure 5.1F)

(Zamore et al., 2000). Due to the efficiency and convenience of this system, RNAi has been used in the chick embryo to perform loss-of-function studies of target genes

(Dai et al., 2005). A retroviral system RCAS has been widely used to deliver synthetic shRNA (Harpavat and Cepko, 2006; Kwiatkowski et al., 2016).

Figure 5.1 RCAS and RNAi system. An shRNA construct (A) is inserted in the shuttle vector SLAX (B). (C) The fragment carries shRNA, Cu6 promotor, and GFP marker which are transferred to the RCAS vector by homologous recombinant. (D) Integrated into the host genome, RCAS will express the construct and form an RNA with hairpin structure. (E) shRNA is spliced to dsRNA. (F) The antisense RNA guides the RISC to degrade the mRNA of target genes. RC: reverse complement. pol: polymerase. env: envelop protein. gag: structural protein (capsid). Adapted from Ruda Cui, unpublished.

RCAS system is an avian retroviral vector derived from the SR-A strain of

Rous sarcoma virus (Hughes, 2004). There are different types of RCAS vectors based on modification of functions, including RCASBP, which is a replication-competent strain. Compared to the replication-defective strains, RCASBP is a replication- competent strain. This virus maintains the ability to integrate into the host genome, replicate inside the cells, and form the complete viral structure to infect more cells.

RCAS vector can carry up to 2.5kb of the target gene, reproduce itself, and express the target gene rapidly inside the host avian cells (Smith et al., 2009). RCAS has been

used in multiple labs to deliver shRNA and is our lab’s vector of choice for in vivo gene knockdown (Bromberg-White et al., 2004; Kwiatkowski et al., 2016).

The DF-1 chick fibroblast cell system has been used to produce RCAS virus for knockdown experiments. DF-1 cells are self-immortalized fibroblast cells derived originally from the 10-day-old East Lansing Line 0 eggs (Bacon et al., 2000).

They maintain their advantages of fast proliferation rate and good tolerance for viruses, including the Rous sarcoma virus (Giotis et al., 2017). This cell line has been widely used to produce the virus and examine gene regulation ability of the virus.

5.2. Rationale

From its expression pattern, we hypothesized that NPNT plays a role during pNC migration. To test the effect of NPNT and ITGα8 knockdown, I utilized the RCAS virus and RNAi system in the chick embryo. This Chapter first describes the process of the generation, screening, and proliferation of knockdown and overexpression constructs, providing our lab with an improved and detailed method to construct and produce viruses for chick genes in the future. Secondly, knockdown and overexpression constructs were applied to the chick embryo to study the function of

NPNT and ITGα8. According to my hypothesis, knockdown of NPNT disrupts pNC migration and results in the malformation of the cornea. To analyze the pathway by which NPNT may affect cell migration, knockdown of ITGα8 was also performed to see if it caused a similar phenotype as the NPNT knockdown. We predicted that both

knockdown phenotypes to be similar to those in ASD, including defective corneal stroma and endothelium.

5.3. Vector design and construction

RNAi target sequences (21 bp) were designed along the NPNT isoform 8

(XP_015132060.1) with online tools including BLOCK-iT™ RNAi Designer. The following standards were applied to check each generated sequence manually: 1) sequences were blasted through the chick genome and had fewer than 16 bp overlap with other mRNAs; 2) sequences fell into the shared mRNA region of all

NPNT transcripts (Moore et al., 2010; Bofill-De Ros and Gu, 2016). Four 21 bp sequences were selected with three in the coding region (NPkd1, NPkd3, and NPkd5) and one in the NPNT 3’ UTR region (NPkdU, Table 5.1A, Figure 5.3A). The ITGα8 RNAi sequences were designed in a similar way (Table 5.1A). The target sequences were then linked to its reverse complementary sequence by a loop sequence

(TTCAAGAGA). A short termination sequence and restriction enzyme sites at each end were added to create ~60 bp shRNA fragments (Figure 5.1A). The sense and antisense fragments were synthesized by Sigma-Aldrich®. The annealed dsDNA pieces were ligated into a shuttle vector pSLAX to add a Chick U6 (Cu6) promoter and a GFP reporter (Figure 5.1B). Then the shRNA pieces were cloned into the

RCASBP vector by homologous recombination using a CloneEZ® kit (Figure 5.1C).

The SLAX and RCASBP vectors were sequenced at each modified step to verify the sequences. Df-1 cells were transfected to generate the full RCASBP virus containing

my constructs. Then the viruses were concentrated for the following experiments in accordance to the method detailed in Chapter 2.

Table 5.1 List of shRNA constructs and qRT-PCR primers designed. * indicates the selected shRNA or primer pair.

A. Chick shRNA sequence Label Sequence Location on Transcript NP-kd1* GCTACTGTCTGAATGGCTACA CDS493 NP-kd3 GGAGACAGTGCCAACCTATAT CDS313 NP-kd5 GGAACAAACTGCATACAAAGG CDS903 NP-kdU* GCTCGGAAAGTCTTAGTATTA 3'UTR-341 a8-kd14 GAGGAGACTCAGATGTAGACA CDS1438 a8-kd16 GCAGCATTTGAAGGCCAAAGT CDS1647 a8-kd21 GGGTTGAACGCAACAACAAGG CDS2173 B. Chick qPCR primers Gene Forward (5'-3') Reverse (5'-3') GAPDH AGAGGGTAGTGAAGGCTGCT AAGTCAGGAGACAACCTGG ACTB AGCGAACGCCCCCAAAGTTCT AGCTGGGCTGTTGCCTTCACA HPRT1 CGCTCCATGGCGACTCACA GCCAGTCTCTCTGTCCTGTCC NPNT-P1 ATGTGCTGAAAGGGGAAGTG CCTGCACATGTAGCTTCCAA NPNT-P2 ACACGTCCTTTGCTTGTTCC TGGGTCATCATTTGCTTCAA NPNT-P3 CTGGGAGCCAGTTAGAGACG GGTCCATGAGCACCACTTCT NPNT-P4 GGACTGGGCATCAAGAGTGT GGAGGAGTTGGCTGTGCTAC NPNT-P5* TCACTGCCATTGACCTTTGA GTGCTGAGCTCCTTTCCTGT

5.4. Validation of shRNA knockdown efficacy in DF-1 cells

Naive DF-1 cells were cultured until ~80% confluent then passaged into 35 mm culture dishes. Viruses in the same volume were added to each plate after one day. Within 36 hours, three of the NPNT shRNA constructs (NPkd1, NPkd5, and NPkdU) produced >90% GFP staining. The cells were then examined for NPNT expression.

ITGα8 knockdown experiments were conducted similarly.

5.4.1. Screening for efficient knockdown with RT-PCR

shRNA efficiency with RT-PCR were examined due to rapidity and convenience of this method (Ojeda et al., 2017). Cells collected after viral infection were hemolyzed in Trizol™ and RT-PCR was performed as described in Chapter 2 with ~29- 30 replicate cycles. An equal amount of the PCR product was loaded onto

1% agarose gel. The RT-PCR of ITGα8 shRNA showed that the α8kd14 construct could consistently reduce the ITGα8 mRNA to the lowest amount (Figure 5.2B). It was chosen for the subsequent experiments and will henceforth be labeled as ITGα8KD.

The screening for the NPNT-shRNA was more contradictory. In one experiment, construct NP kd1 and NP kdU seemed to have a better knockdown efficacy than other constructs, however, this result was not replicable (Figure 5.2A). This inconsistency may indicate that none of my constructs could deplete all the NPNT mRNA in the cell assay. Because RT-PCR is a qualitative and not a quantitative method, the RT-PCR results may not discern differential knockdown efficacy for these constructs.

Further experiment of qRT-PCR on NPNT shRNA constructs was used to find the best candidate for in vivo knockdown.

Figure 5.2 Evaluation of gene expression in knockdown and overexpressed DF-1 cell lines by RT-PCR. (A) RT-PCR of NPNT in control and NPNT-knockdown DF-1 cells infected with shRNA NPkd1, NPkd3 NPkd5, and NPkdU. Lower lane: GAPDH as a loading control. (B) RT-PCR of ITGα8 in control and ITGα8 knockdown DF-1 cell lines infected with shRNA α8kd14, α8kd16, and α8kd21. (C) RT-PCR of NPNT in control and NPNT-overexpressed DF-1 cells lines (Justin Ma, unpublished)

5.4.2. Screening for efficient knockdown construct with qRT-PCR

qRT-qPCR is a sensitive method to detect low expression genes and to quantify the difference in gene expression levels among samples. The detailed process is described in Chapter 2. I designed 5 pairs of primers along the NPNT mRNA transcript (Figure 5.3A) and adopted control primers from previous research

(Anna Babushkina, unpublished, Table 5.1B). Primer pair P5 was chosen for the experiment after test runs for the best melting curve. To account for cell density and cell aging, qRT-PCR was performed on cells of different conditions. For the first experiment, the DF-1 cells were maintained at 12th passage at full confluency, as an older and crowded less-optimized group. The second qRT-PCR was performed on

optimized cells with only the sixth passage and confluency around 90%. Each sample had three repeats and blank control without any cDNA. The ΔΔCt of NPNT is normalized by the Ct of the control gene and relative to Ct of control samples (non- infected DF-1 cells). Analysis of the average knockdown of these two was calculated, and the expression of NPNT was lower in the cells infected by construct NPkd1 and

NPkdU (Figure 5.3B). However, NPNT in construct NPkd5 seems to be up-regulated, potentially because of an unknown feedback regulation (Figure 5.3B). Thus, constructs NPkd1 and NPkdU were both kept for the following knockdown experiment.

Figure 5.3 Screening of NPNT knockdown by qRT-PCR. (A) The map shows the relative locations of shRNAs and qPCR primers on the NPNT transcript. Blue dot: shRNA target sequence. Purple pointer: Forward (F) or reverse (R) qPCR primers. Black and purple interval: different exons. Black double line: ORF. dashed grey line: UTR. Generated by Snapgene®. (B) qPCR experiments revealed the downregulation of NPNT in cell lines transfected with NPkd1 and NPkdU. The qPCR of NPNT was carried out with different housekeeping genes of GAPDH and β-Actin and Primer pair 5. The expression of NPNT in each sample was normalized to the housekeeping genes. Y axis presents the average fold change of NPNT expression in the knockdown cell lines compare to control DF-1 cell line (fold change=1).

5.5. Microinjection of concentrated viral particles into chick

embryos

Based on the expression pattern of ITGα8, ITGα8 shRNA will need to be applied to the pNC. To achieve the precise infection, we injected the concentrated

virus into the neural tube of embryos at S8 (Figure 5.4B, Nakamura et al., 2004;

Harpavat and Cepko, 2006), when the cranial neural crest has not yet migrated.

Comparing to the ITGα8 knockdown, NPNT knockdown required more optic tissues to be infected. At E3, NPNT is widely expressed throughout the optic tissue, including the optic cup and the lens, although the protein is visualized strongly in the primary stroma. Then at E6, the migratory pNC also express NPNT (Figure 4.1 A-

D). Thus, the aim of the injection would be a combination of infection in the lens, retina, and pNC. To find the best infection efficacy, multiple stages and locations of injection were tested. First, embryos were injected at early stages (~S4) aiming to place the virus throughout the head, so all of the ocular tissues would be infected

(Figure 5.4A). However, the embryos presented a low survival rate (n= 1/12). To overcome this early embryonic death, injections at a later stages were conducted. At

S10-S11, the optic vesicle is extended from the head and become easier to target.

Virus was injected into the newly formed optic vesicle to infect the retina and injected at the adjacent ectoderm to infect the lens. To infect the pNC, virus was also injected directly to the migrating cranial neural crest (Figure 5.4C). As a result, the lens was robustly infected. However, the migration of cranial neural crest was disrupted even in the control embryos, which interfered with observations of knockdown phenotypes. Our previous injection at mid-stage (S7-S9) neural tube resulted in GFP in the cornea, but not in the surrounding tissues. To improve, viruses were applied on both the neural tube and the ectoderm surrounding the presumptive eye (Figure 5.4B). This method increased the number of GFP-positive

100

cells in the lens and retina, aiming to eliminate corneal NPNT in the early stage

(Figure 5.4D-E).

Figure 5.4 Injection of NPNT shRNA into chick embryos. (A) Microinjection of the virus into an early-stage chick embryo. Arrows represent the injection of virus to cover the presumptive head region (B) Microinjection of the virus into a mid-stage embryo. Arrows represent the injection of virus into the neural tube and surround the ectoderm. (C) Microinjection of the virus into a late-stage embryo. Arrows represent the injection of virus to the optic vesicle and periocular region of the chick embryo. (A-C) Adapted from Hamburger V. and Hamilton HL, 1951. (D-E) Whole-mount immunofluorescent of GFP on E5 eyes injected with the GFP control (D), NPkd1(E) or NPkd1(F) at mid-stage (S7-S9).

Embryos injected at mid-stage (S7-S9) were checked for GFP fluorescence at

E5. The embryos injected with control RCAS(B)-GFP virus showed bright GFP in the whole lens in most eyes (n=6/8). Embryos injected with NPkd1 showed some

(~40%) GFP infection in the lens in 2/12 eyes. Embryos injected with NPkd1 presented high (~80%) GFP staining in the lens in 7/10 eyes. The in vivo infection

101

rate of shRNA construct NPkdU seemed to be more robust than shRNA construct

NPkd1. Thus, RCAS(B)-GFP-NPkdU (subsequently labeled as NPNTKD) was chosen for further knockdown experiments.

5.6. Functional study of NPNT and ITGα8 in the cornea

5.6.1. Knockdown of NPNT results in decreased corneal stromal thickness

In situ hybridization was applied at E5 eyes to examine the expression of

NPNT in the optic cup and the lens that was infected by the NPNTKD virus (Figure

5.4D, F). The expression level of NPNT in the lens epithelium and RPE is lower in the

NPNTKD embryos in comparison with the control GFP embryos (Figure 5.5A, A’), indicating some degree of knockdown of NPNT in the eye.

Then H&E staining was used to visualize the structure of E7 cornea after pNC migration. The corneal stroma is thinner in the NPNTKD embryos, comparing to the

GFP control (Figure 5.5B). I measured the thickness of the corneal stroma at the three random points at the central cornea. A two-tailed t-test was performed on the averaged thicknesses of control and knockdown corneal stroma and showed the thickness to be significantly reduced in the knockdown embryos (Figure 5.5C).

From here, NPNT expression seems to be correlated with the amount of corneal stroma cell, which is probably related to pNC migration and keratocyte proliferation.

102

Figure 5.5 Knockdown of NPNT in the chick cornea. (A, A’) In situ hybridization of control or knockdown E5 cornea. Arrows point to the site of mRNA staining. The expression level of NPNT in the lens epithelium and RPE is lower in the NpntKD embryo in comparison with the control embryo. (B, B’) H&E staining of the central E7 cornea. Blue Double-headed arrows label the thickness of the corneal stroma. L: lens. ep: corneal epithelium. st: corneal stroma. en: corneal endothelium. RPE: retinal pigmented epithelium. Scale bar: 100 µm. (C) Statistics comparing stromal thickness in the control and knockdown embryos. NGFP =4, NKD =4. **, P <0.01.

5.6.2. Overexpression of NPNT results in increased corneal stromal

thickness

To follow up the knockdown experiment, a NPNT-overexpression construct was designed as RCAS-CU6-GFP-NPNT-cds (Figure 5.2C) to study the effect of extra

NPNT in the cornea. The concentrated NPNTOE virus was injected into the neural tube at S8 and embryos were collected at E7, E9, and E15.

103

At E9, the expression level of NPNT is significantly upregulated in all three layers of the cornea and the lens in the RCAS-NPNTOE embryos compared to the control embryos (Figure 5.6A, A’), indicating a robust upregulation of NPNT in the optic tissues. Immunofluorescence of NPNT protein was also performed on E9 embryos to show the increase of NPNT in the corneal stroma (Figure 5.7 A, A’). Both experiments validated the successful expression of NPNT mRNA and the production of exogenous NPNT protein in the chick eye.

The H&E staining of the collected embryos showed an increase of corneal thickness at E9, but the corneal epithelium and endothelium were not thickened

(Figure 5.6B, B’). The thickness of knockdown corneas at different stages, including

E7, E9, and E15, was measured and compared to the wild type. It showed that at E7, there was no significant difference. However, at E9, the NPNTOE corneas were significantly thicker and had more than twice the thickness of the wild type corneas.

Similarly, at E15, the NPNTOE corneas were also significantly thicker and had almost twice the thickness of the wild type cornea (Figure 5.6C).

104

Figure 5.6 Overexpression of NPNT in the chick cornea. (A, A’) In situ hybridization of E9 wild type and NPNT-overexpression cornea. The expression of NPNT is up-regulated in all layers of cornea with overexpression compared to the control cornea. (B, B’) H&E staining of the E9 central corneas in control or overexpression embryos. Dashed arrow: Corneal stromal thickness. Scale bar: 100 µm. (C) Statistics of E7, E9, and E15 corneal thickness in control and NPNTOE embryos. T-test applied. ns, not significant; ***, P <0.001. (D) Statistics of E7, E9, and E15 stromal cell density in control and NPNTOE embryos. T-test applied: ns, not significant; *, P <0.1. Adapted from Justin Ma, unpublished.

We next investigated the factors that might affect the thickness of corneal stroma. These possibilities include increased hydration, excess ECM, or excess cells.

105

Therefore, the density of the cells in the central cornea was measured. There was no significant difference in cell density between NPNTOE and control embryos at E7, E9, and E15, indicating there were indeed more cells in the NPNTOE embryos (Figure

5.6D).

To explain for the origin of these extra keratocytes, we performed BrdU staining on those corneas to show the proliferation rate of cells (Figure 5.7B, B’).

The rates of proliferation were calculated by normalizing the number of BrdU- positive cells to the number of DAPI-positive cells in E7, E9, and E15 control or

NPNTOE corneas. There was no significant upregulation of cell proliferation at any stage and even fewer proliferating cells in the E9 NPNTOE corneas (Figure 5.7B, B’).

Lack of extra cell proliferation led us to consider whether these cells are coming from elevated cell migration.

106

Figure 5.7 Thickening of NPNTOE corneas is not related to cell proliferation. (A, A’) NPNT immunostaining of E9 control or overexpression cornea. NPNT (red) is up-regulated in the NPNTOE corneas. (B, B’) BrdU staining of the E9 control and overexpression cornea. The BrdU (green) stains for proliferating cells. Scale bar: 100µm. (C) Statistics of the rate of BrdU cell number/all cell number in E7, E9, and E15 Control and overexpression embryo. T-test applied. ns, not significant; *, P<0.1 (Justin Ma, unpublished).

5.6.3. Knockdown of ITGα8 results in decreased corneal stromal thickness

ITGα8 knockdown was performed based on two reasons: First, ITGα8β1 has high binding specificity to NPNT among other proteins (Brandenberger et al., 2001;

Sato et al., 2009) and colocalized with NPNT in the cornea. The hypothesis is that

ITGα8β1 is the receptor of NPNT in the cornea at the early stages. If knockdown of

ITGα8 replicate the phenotype of NPNT knockdown in the cornea, the most likely possibility is that these two proteins are in the same pathway. Second, NPNT is expressed in multiple ocular tissues and hard to knockdown. ITGα8 β1 is not an

107

ECM protein, and the mRNA of ITGα8 is specifically expressed in the pNC, which is easier to target at stage 8 neural tube by microinjection. Third, there is ITGα8β1 inhibitor available (Inhibitory peptide) that can be utilized in multiple experiments.

For the ITGα8 knockdown embryos, concentrated ITGα8KD virus was injected into the neural tube at S8 and the embryos were collected at E7. In situ hybridization was performed on E7 embryos. The ITGα8 mRNA expression is reduced in the cornea stroma, comparing to the control embryo (Figure 5.8A).

H&E staining was performed to observe the phenotype of ITGα8KD embryos.

For each cornea, I randomly measured three points along the central corneal stroma to get an average thickness of corneal stroma (Figure 5.8B). A t-test on these embryos reveals that there is significant reduction of corneal stroma thickness in the knockdown group compared to the control (Figure 5.8C, NCON=7, NKD=9; p=0.047). The phenotype of ITGα8KD embryos was similar to those of NPNTKD embryos, suggesting a potential NPNT/ITGα8β1 interaction in pNC migration during chick corneal development.

108

Figure 5.8 Knockdown of ITGα8 results in decreased corneal stromal thickness. (A, A’) In situ hybridization of control or ITGα8 knockdown E7 cornea. Arrows point to the site of mRNA staining. The expression level of ITGα8 in the corneal stroma is lower in the ITGα8KD embryo compared to the control embryo. (B, B’) H&E staining of the E7 cornea. Blue double-headed arrows label the thickness of the corneal stroma. L: lens. ep: corneal epithelium. st: corneal stroma. en: corneal endothelium. RPE: retinal pigmented epithelium. Scale bar: 100 µm. (C) Statistics of corneal stromal thickness in the control and ITGα8KD embryos. NCON =7, NKD =9; p =0.047.

5.6.4. Inhibition of ITGα8β1 disrupted pNC migration in vivo and in vitro

At E4, we observed the expression of ITGα8 in the pre-migratory pNC (Figure

4.3A), which will be migrating to form the corneal endothelium. However significant difference between the E7 control and ITGα8 OE corneal endothelium is not observed. A potential explanation is that at E5, the ITGα8OE virus may not infect enough pNC to cause corneal endothelium defection. Thus, we conducted further observations on two different levels. First, we simplified the model to an in vitro pNC migration assay. Explants of pre-migratory pNC that expressing ITGα8 were

109

cultured on NPNT and then inhibited from ITGα8β1 signaling. Secondly, we examined the ability of individual ITGα8KD virus-infected pNC to enter the cornea at

E5 when the corneal endothelium has formed.

5.6.4.1. NPNT/ITGα8β1 interaction is involved in pNC migration in vitro

To confirm our hypothesis that ITGα8 expression is necessary for the pNC migration on NPNT, in vitro pNC migration (dispersion) assay was designed to evaluate the effect of NPNT/ITGα8β1 on pNC migration. As described in the method,

E3 periocular mesenchyme explants of the same size were placed on NPNT- or

Fibronectin-coated plates. Fibronectin was selected as a control ECM for three reasons. First, Fibronectin also contains RGD motif that can be recognized by RGD

ITG, such as ITGα5β1 (Alfandari et al., 2003). Second, it is distributed in the surrounding ectoderm basement membrane, whereas NPNT is in the CEBM. Third,

Fibronectin has been studies to be involved in neural crest but not pNC migration

(Bilozur and Hay, 1988).

Periocular mesenchyme explants were cultured on NPNT or Fibronectin.

Over time they attached and began to disperse from the initial sites of placement.

The pNC on NPNT were migrating away from the explants in a separated manner, whereas fewer pNC left the explants on Fibronectin (Figure 5.9A1-A3, B1-B3).

Moreover, when ITGα8β1 inhibitor (inhibitory peptide) was added to the plate, the migration pattern of pNC on NPNT was altered and similar to the Fibronectin migration pattern (Figure 5.9C1-C3). For each explant, the number of migrating cells

110

was counted to show that the difference of pNC migration on NPNT compared to

Fibronectin was significant. The addition of ITGα8β1 inhibitor also significantly reduced the amount of NPNT induced pNC migration (Figure 5.9D).

5.6.4.2. Knockdown of ITGα8 reduces the migration of pNC into the corneal

endothelium at E5

Chick embryos that were injected with ITGα8KD and GFP viruses into S8 neural tubes were collected at E5 and were visualized using whole-mount immunofluorescence. The observation of the E5 corneal endothelium showed that

GFP-positive cells in the knockdown embryos migrated poorly into the corneal region, whereas the GFP-positive pNC in the control group could still migrate

(Figure 5.9E, E’). This experiment indicates that knockdown of ITGα8 affected the migration of pNC to form the corneal endothelium.

111

Figure 5.9 The effect of ITGα8β1 inhibition on pNC migration. (A-C) The inhibition of ITGα8β1 reduces the NPNT/ ITGα8-dependent migration of pNC in vitro. (A1-A3) The migration pattern of pNC on the Fibronectin-coated plate. (B1-B3) The migration pattern of pNC on the NPNT-coated plate. (C1-C3) The migration pattern of pNC on NPNT-coated plate with ITGα8β1 inhibitor added. (D) Statistics of the number of migrating pNC on NPNT, Fibronectin, or NPNT with ITGα8β1 inhibitor. ***, p <0.001. (A-D) Adapted from Justin Ma, unpublished. (E, E’) GFP-positive pNC migrated into the corneal endothelium in E5 GFP control or ITGα8KD corneas. (E) In the GFP control, GFP positive cells migrated into the cornea and formed the corneal endothelium. (E’) In the ITGα8 KD, few GFP positive cells migrated into the cornea and formed the corneal endothelium. Green: GFP; Red: Phalloidin; Blue: DAPI. Dashed curve: corneal region.

5.7. Conclusion and discussion

The RCAS RNAi knockdown and overexpression systems provide us a reliable way to assess loss-of-function and gain-of-function in the chick cornea. The knockdown of NPNT in the chick cornea resulted in a decrease of corneal stromal thickness, whereas the overexpression of NPNT presented an increasing corneal

112

stromal thickness. Further observation into cell count and cell density in the NPNTOE cornea pointed to excess cell amount in the thickened cornea stroma, but no excess in cell proliferation. Knockdown of ITGα8 in the chick cornea replicated the phenotype in the NPNT knockdown cornea, suggesting functional interactions between these two proteins and between the NPNT-containing primary stroma and

ITGα8-expressed pNC.

In vitro migration assay of pNC on NPNT or Fibronectin matrix presented different migration patterns. The addition of ITGα8β1 inhibitor disrupted the pNC migration on NPNT matrix. The disruption of ITGα8KD-infected pNC migration in vivo suggests that NPNT-dependent migration of pNC is based on the membrane receptor ITGα8β1.

The knockdown of NPNT in E7 chick by the NPkdU construct can be backed up by the knockdown provided by the NPkd1 construct. Dispite the infection rate in

NPkd1-infected chick eye is lower, two E5 and two E7 embryos with a moderate infection rate (> 40% GFP in the lens) were collected. E5 embryos showed less

NPNT in the lens compared to the control embryos, suggesting a potential knockdown. H&E on E7 corneas showed a decrease of corneal stroma thickness comparing to the control (Appendix Figure B1). With two shRNA constructs designed at different locations of NPNT mRNA (Figure 5.3A) producing similar knockdown phenotypes, sn off-target effect for each single shRNA can be hereafter excluded.

113

Of note, the knockdown of NPNT may not be sufficient for a full phenotype in the cornea. According to a previous research, NPNT is in the same subfamily of protein EGF-like-6 (EGFL6) with the similar functional domains. In the kidney, the interaction between NPNT and ITGα8β1 is critical, but the frequency of kidney malformation in the NPNT knockout embryos is less than ITGα8β1 knockout embryos (Linton et al., 2007). This different response be explained by the redundant function of EGFL6 to NPNT. In the muscle cell niche, the knockdown of NPNT stimulated the upregulation of EGFL6 (Fujiwara et al., 2011). For our study, EGFL6 is also up-regulated in the developing cornea using the RNA-seq study (Appendix A).

However, EGFL6 had been studied in angiogenesis (Chim et al., 2011) which does not in the cornea. Investigation of the expression of EGFL6 in the cornea may be important for a better understanding of the function of NPNT in the cornea.

114

Conclusions and Future Directions

During corneal development, the migration of pNC is a critical yet complex step. This dissertation discussed the general transcriptional profiles of pNC and the derived corneal tissues, providing candidate pathways, transcription factors, and genes that potentially contribute to the corneal formation. Among these candidates,

ECM protein, NPNT was studied from its expression and function aspects during corneal development.

NPNT/ITGα8β1 signaling is involved in pNC migration. During corneal formation, ITGα8-expressed pNC cells have been shown to migrate on the matrix containing abundant NPNT. The RCAS RNAi knockdown or overexpression of NPNT resulted in the decrease or increase, respectively, of corneal stromal thickness.

Thickening of the cornea is due to more cells in the corneal stroma but no elevated cell proliferation. Knockdown of ITGα8 replicated the phenotype in NPNT

115

knockdown, indicating functional interactions between these two proteins and between the corneal epithelial and mesenchymal cells. In vitro migration assay suggested a unique migration pattern of pNC on NPNT matrix that relies on

ITGα8β1 functions. To picture more details of this ECM-receptor pathway, the further experiments can be focused on the downstream pathways in the pNC that might be activated by ITGα8β1, for example, MAPK pathways (Linton et al., 2007).

In addition, the function of keratocyte-expressed NPNT in Bowman’s layer requires future studies. First, the function of NPNT in the Bowman’s layer is hypothesized to be related to the corneal epithelial attachment or even differentiation. The expression patterns of some potential receptors, including the

ITGs and the EGF receptors were examined in the corneal epithelium. However, in our NPNT knockdown embryos, excess epithelium detachment was not observed compared to the control embryos. The effect of knockdown may be limited by the insufficient knockdown efficacy of NPNT in the cornea or the redundant function of

EGFL6 with NPNT in this process. More knockdown samples will need to be examined to confirm the frequency of phenotypes. Secondly, NPNT in the Bowman’s layer is colocalized or in contact with other basement membrane ECM proteins, as shown in Chapter 4. In the cornea, the homeostasis between ECM proteins is important but complicated (Yazdanpanah et al., 2017). There can be some crosstalk between NPNT and other basement membrane ECM proteins. The expression of other ECM proteins in NPNTKD corneas is under examination.

116

Comparing to the chick cornea, the staining of Npnt in mouse cornea implied a potentially different function of Npnt in the rodents. In the adult mouse, Npnt mRNA is expressed by the endothelial cells, and the protein is distributed at the

Descemet’s membrane (Appendix Figure B2). This difference in NPNT distribution may come from the different patterns of mouse pNC migration compared to the chick. In the mouse, pNC migrate into the cornea in one wave and differentiate later into the corneal stroma and endothelium. Further research of the role of Npnt in the mouse can be achieved by obtaining the Npnt knockout mice from previous researchers (Linton et al., 2007). Our lab will be working on identification of the

Npnt knockout phenotypes in the mouse cornea.

Apart from embryonic development, the function of NPNT in corneal wound healing is also worth investigation. Multiple reports are available on the involvement of ECM proteins in the corneal wound healing. For example,

Fibronectin is involved in different types of cornea wound healing processes

(Ohashi et al., 1983; Spigelman et al., 1985) and corneal epithelial cells migration

(Nishida et al., 1983). In this work, it is also inspired to study the NPNT expression by corneal debridement experiments. The preliminary results indicate an upregulation of NPNT in the wound healing corneal epithelium (Figure B3). The expression suggests a potential utilization of NPNT on corneal wound healing promotion. NPNT and other ECM proteins also have the potential as a gene target for the treatment of corneal illness (Steigedal et al., 2018; Watany and El-Horany,

117

2018) or a culture matrix for engineering corneal tissues (Patra et al., 2012; Sun et al., 2018).

The RNA-seq studies provide potential directions to study corneal development and regeneration events. This research can serve as a foundation for exploring the molecular mechanisms underlying pNC migration, proliferation, and differentiation. This work, while conducted in the model of chick embryo, can be extended to mammal models. Further studies provide potential clinical targets during corneal development and induction signals for corneal regeneration.

118

Bibliography

Abu-Daya A, Nishimoto S, Fairclough L, Mohun TJ, Logan MP, Zimmerman LB. 2011. The secreted integrin ligand nephronectin is necessary for forelimb formation in Xenopus tropicalis. Dev Biol 349:204-212. Akpek EK, Alkharashi M, Hwang FS, Ng SM, Lindsley K. 2014. Artificial corneas versus donor corneas for repeat corneal transplants. Cochrane Database Syst Rev:CD009561. Al-Hussain H, Zeisberger SM, Huber PR, Giunta C, Steinmann B. 2004. Brittle cornea syndrome and its delineation from the kyphoscoliotic type of Ehlers-Danlos syndrome (EDS VI): report on 23 patients and review of the literature. Am J Med Genet A 124A:28-34. Alfandari D, Cousin H, Gaultier A, Hoffstrom BG, DeSimone DW. 2003. Integrin alpha5beta1 supports the migration of Xenopus cranial neural crest on fibronectin. Dev Biol 260:449-464. Arai C, Yoshizaki K, Miyazaki K, Saito K, Yamada A, Han X, Funada K, Fukumoto E, Haruyama N, Iwamoto T, Takahashi I, Fukumoto S. 2017. Nephronectin plays critical roles in Sox2 expression and proliferation in dental epithelial stem cells via EGF-like repeat domains. Sci Rep 7:45181. Bacon LD, Hunt HD, Cheng HH. 2000. A review of the development of chicken lines to resolve genes determining resistance to diseases. Poult Sci 79:1082-1093. Balmer JE, Blomhoff R. 2002. Gene expression regulation by retinoic acid. J Lipid Res 43:1773-1808. Bankhead EJ, Colasanto MP, Dyorich KM, Jamrich M, Murtaugh LC, Fuhrmann S. 2015. Multiple requirements of the focal dermal hypoplasia gene porcupine during ocular morphogenesis. Am J Pathol 185:197-213. Basu S, Hertsenberg AJ, Funderburgh ML, Burrow MK, Mann MM, Du Y, Lathrop KL, Syed-Picard FN, Adams SM, Birk DE, Funderburgh JL. 2014. Human limbal biopsy-derived stromal stem cells prevent corneal scarring. Sci Transl Med 6:266ra172. Baulmann DC, Ohlmann A, Flugel-Koch C, Goswami S, Cvekl A, Tamm ER. 2002. Pax6 heterozygous eyes show defects in chamber angle differentiation that are associated with a wide spectrum of other anterior eye segment abnormalities. Mech Dev 118:3-17. Beebe DC, Coats JM. 2000. The lens organizes the anterior segment: specification of neural crest cell differentiation in the avian eye. Dev Biol 220:424-431. Bhatiacharya S, Chandrasekher G. 2016. Kinetics of extracellular matrix (ECM) protein release from cornea following epithelial injury and its relevance to wound repair. Investigative Ophthalmology & Visual Science 57.

119

Bi L, Lwigale P. 2019. Transcriptomic analysis of differential gene expression during chick periocular neural crest differentiation into corneal cells. 248:583-602. Bilozur ME, Hay ED. 1988. Neural crest migration in 3D extracellular matrix utilizes laminin, fibronectin, or collagen. Dev Biol 125:19-33. Blanco-Mezquita JT, Hutcheon AE, Zieske JD. 2013. Role of thrombospondin-1 in repair of penetrating corneal wounds. Invest Ophthalmol Vis Sci 54:6262-6268. Bofill-De Ros X, Gu S. 2016. Guidelines for the optimal design of miRNA-based shRNAs. Methods 103:157-166. Bonnans C, Chou J, Werb Z. 2014. Remodelling the extracellular matrix in development and disease. Nat Rev Mol Cell Biol 15:786-801. Border WA, Noble NA, Yamamoto T, Harper JR, Yamaguchi Y, Pierschbacher MD, Ruoslahti E. 1992. Natural inhibitor of transforming growth factor-beta protects against scarring in experimental kidney disease. Nature 360:361-364. Brandenberger R, Schmidt A, Linton J, Wang D, Backus C, Denda S, Muller U, Reichardt LF. 2001. Identification and characterization of a novel extracellular matrix protein nephronectin that is associated with integrin alpha8beta1 in the embryonic kidney. J Cell Biol 154:447-458. Bredrup C, Matejas V, Barrow M, Blahova K, Bockenhauer D, Fowler DJ, Gregson RM, Maruniak-Chudek I, Medeira A, Mendonca EL, Kagan M, Koenig J, Krastel H, Kroes HY, Saggar A, Sawyer T, Schittkowski M, Swietlinski J, Thompson D, VanDeVoorde RG, Wittebol-Post D, Woodruff G, Zurowska A, Hennekam RC, Zenker M, Russell-Eggitt I. 2008. Ophthalmological aspects of Pierson syndrome. Am J Ophthalmol 146:602-611. Briata P, Ilengo C, Corte G, Moroni C, Rosenfeld MG, Chen CY, Gherzi R. 2003. The Wnt/beta-catenin-->Pitx2 pathway controls the turnover of Pitx2 and other unstable mRNAs. Mol Cell 12:1201-1211. Bromberg-White JL, Webb CP, Patacsil VS, Miranti CK, Williams BO, Holmen SL. 2004. Delivery of short hairpin RNA sequences by using a replication-competent avian retroviral vector. J Virol 78:4914-4916. Brugmann SA, Tapadia MD, Helms JA. 2006. The molecular origins of species-specific facial pattern. Curr Top Dev Biol 73:1-42. Brummelkamp TR, Bernards R, Agami R. 2002. A system for stable expression of short interfering RNAs in mammalian cells. Science 296:550-553. Burton MJ. 2009. Corneal blindness: prevention, treatment and rehabilitation. Community Eye Health:22:33. Chai Y, Ito Y, Han J. 2003. TGF-beta signaling and its functional significance in regulating the fate of cranial neural crest cells. Crit Rev Oral Biol Med 14:78-88. Chao-Shern C, Me R, DeDionisio LA, Ke BL, Nesbit MA, Marshall J, Moore CBT. 2018. Post-LASIK exacerbation of granular corneal dystrophy type 2 in members of a chinese family. Eye (Lond) 32:39-43. Chen KG, Szakacs G, Annereau JP, Rouzaud F, Liang XJ, Valencia JC, Nagineni CN, Hooks JJ, Hearing VJ, Gottesman MM. 2005. Principal expression of two mRNA isoforms

120

(ABCB 5alpha and ABCB 5beta ) of the ATP-binding cassette transporter gene ABCB 5 in melanoma cells and melanocytes. Pigment Cell Res 18:102-112. Chen Y, Carlson EC, Chen ZY, Hamik A, Jain MK, Dunwoodie SL, Yang YC. 2009. Conditional deletion of Cited2 results in defective corneal epithelial morphogenesis and maintenance. Dev Biol 334:243-252. Cheng CW, Ka SM, Yang SM, Shui HA, Hung YW, Ho PC, Su YC, Chen A. 2008. Nephronectin expression in nephrotoxic acute tubular necrosis. Nephrol Dial Transplant 23:101-109. Chim SM, Qin A, Tickner J, Pavlos N, Davey T, Wang H, Guo Y, Zheng MH, Xu J. 2011. EGFL6 promotes endothelial cell migration and angiogenesis through the activation of extracellular signal-regulated kinase. J Biol Chem 286:22035- 22046. Chng Z, Peh GS, Herath WB, Cheng TY, Ang HP, Toh KP, Robson P, Mehta JS, Colman A. 2013. High throughput gene expression analysis identifies reliable expression markers of human corneal endothelial cells. PLoS One 8:e67546. Churchill A, Booth A. 1996. Genetics of aniridia and anterior segment dysgenesis. Br J Ophthalmol 80:669-673. Cook CS. 1989. Experimental models of anterior segment dysgenesis. Ophthalmic Paediatr Genet 10:33-46. Coupry I, Sibon I, Mortemousque B, Rouanet F, Mine M, Goizet C. 2010. Ophthalmological features associated with COL4A1 mutations. Arch Ophthalmol 128:483-489. Cox ML, Schray CL, Luster CN, Stewart ZS, Korytko PJ, KN MK, Paulauskis JD, Dunstan RW. 2006. Assessment of fixatives, fixation, and tissue processing on morphology and RNA integrity. Exp Mol Pathol 80:183-191. Creuzet S, Couly G, Le Douarin NM. 2005a. Patterning the neural crest derivatives during development of the vertebrate head: insights from avian studies. J Anat 207:447-459. Creuzet S, Vincent C, Couly G. 2005b. Neural crest derivatives in ocular and periocular structures. Int J Dev Biol 49:161-171. Dai F, Yusuf F, Farjah GH, Brand-Saberi B. 2005. RNAi-induced targeted silencing of developmental control genes during chicken embryogenesis. Dev Biol 285:80- 90. Dong D, Ruuska SE, Levinthal DJ, Noy N. 1999. Distinct roles for cellular retinoic acid- binding proteins I and II in regulating signaling by retinoic acid. J Biol Chem 274:23695-23698. Dottori M, Gross MK, Labosky P, Goulding M. 2001. The winged-helix transcription factor Foxd3 suppresses interneuron differentiation and promotes neural crest cell fate. Development 128:4127-4138. Dua HS, Azuara-Blanco A. 2000. Limbal stem cells of the corneal epithelium. Surv Ophthalmol 44:415-425.

121

Dupe V, Matt N, Garnier JM, Chambon P, Mark M, Ghyselinck NB. 2003. A newborn lethal defect due to inactivation of retinaldehyde dehydrogenase type 3 is prevented by maternal retinoic acid treatment. Proc Natl Acad Sci U S A 100:14036-14041. Dutton KA, Pauliny A, Lopes SS, Elworthy S, Carney TJ, Rauch J, Geisler R, Haffter P, Kelsh RN. 2001. Zebrafish colourless encodes sox10 and specifies non- ectomesenchymal neural crest fates. Development 128:4113-4125. Eghrari AO, Riazuddin SA, Gottsch JD. 2015. Overview of the Cornea: Structure, Function, and Development. Prog Mol Biol Transl Sci 134:7-23. Ehlers N, Modis L, Moller-Pedersen T. 1998. A morphological and functional study of Congenital Hereditary Endothelial Dystrophy. Acta Ophthalmol Scand 76:314- 318. Etchevers HC, Vincent C, Le Douarin M, Couly GF. 2001. The cephalic neural crest provides pericytes and smooth muscle cells to all blood vessels of the face and forebrain. Development 128:1059-1068. Evans AL, Gage PJ. 2005. Expression of the homeobox gene Pitx2 in neural crest is required for optic stalk and ocular anterior segment development. Human Molecular Genetics 14:3347-3359. Fang L, Kahai S, Yang W, He C, Seth A, Peng C, Yang BB. 2010. Transforming growth factor-beta inhibits nephronectin-induced osteoblast differentiation. FEBS Lett 584:2877-2882. Feng L, Hernandez RE, Waxman JS, Yelon D, Moens CB. 2010. Dhrs3a regulates retinoic acid biosynthesis through a feedback inhibition mechanism. Dev Biol 338:1-14. Fini ME, Stramer BM. 2005. How the cornea heals: cornea-specific repair mechanisms affecting surgical outcomes. Cornea 24:S2-S11. Fini ME. 1999. Keratocyte and fibroblast phenotypes in the repairing cornea. Prog Retin Eye Res 18:529-551. Fischer A, Schumacher N, Maier M, Sendtner M, Gessler M. 2004. The Notch target genes Hey1 and Hey2 are required for embryonic vascular development. Genes Dev 18:901-911. Fokina VM, Frolova EI. 2006. Expression patterns of Wnt genes during development of an anterior part of the chicken eye. Dev Dyn 235:496-505. Fujikawa LS, Foster CS, Gipson IK, Colvin RB. 1984. Basement membrane components in healing rabbit corneal epithelial wounds: immunofluorescence and ultrastructural studies. J Cell Biol 98:128-138. Fujiwara H, Ferreira M, Donati G, Marciano DK, Linton JM, Sato Y, Hartner A, Sekiguchi K, Reichardt LF, Watt FM. 2011. The Basement Membrane of Hair Follicle Stem Cells Is a Muscle Cell Niche. Cell 144:577-589. Fujiwara M, Uchida T, Osumi-Yamashita N, Eto K. 1994. Uchida rat (rSey): a new mutant rat with craniofacial abnormalities resembling those of the mouse Sey mutant. Differentiation 57:31-38.

122

Gage PJ, Kuang C, Zacharias AL. 2014. The homeodomain transcription factor PITX2 is required for specifying correct cell fates and establishing angiogenic privilege in the developing cornea. Dev Dyn 243:1391-1400. Gage PJ, Qian M, Wu DQ, Rosenberg KI. 2008. The canonical Wnt signaling antagonist DKK2 is an essential effector of PITX2 function during normal eye development. Developmental Biology 317:310-324. Gage PJ, Suh HY, Camper SA. 1999. Dosage requirement of Pitx2 for development of multiple organs. Development 126:4643-4651. Gain P, Jullienne R, He Z, Aldossary M, Acquart S, Cognasse F, Thuret G. 2016. Global Survey of Corneal Transplantation and Eye Banking. JAMA Ophthalmol 134:167- 173. Galvis V, Tello A, Carreno NI, Berrospi RD, Nino CA, Leiva F. 2017. Keratoconus and Bowman Layer Transplantation. Cornea 36:e8. Giotis ES, Ross CS, Robey RC, Nohturfft A, Goodbourn S, Skinner MA. 2017. Constitutively elevated levels of SOCS1 suppress innate responses in DF-1 immortalised chicken fibroblast cells. Sci Rep 7:17485. Good DJ, Polverini PJ, Rastinejad F, Le Beau MM, Lemons RS, Frazier WA, Bouck NP. 1990. A tumor suppressor-dependent inhibitor of angiogenesis is immunologically and functionally indistinguishable from a fragment of thrombospondin. Proc Natl Acad Sci U S A 87:6624-6628. Greene CA, Kuo C, Sherwin T. 2017. Aberrant Patterns of Key Epithelial Basement Membrane Components in Keratoconus. Cornea 36:1549-1555. Gullberg D. 2007. Neuronal pathways leading to the kidney. Matrix Biol 26:407-408. Gupta S, Rodier JT, Sharma A, Giuliano EA, Sinha PR, Hesemann NP, Ghosh A, Mohan RR. 2017. Targeted AAV5-Smad7 gene therapy inhibits corneal scarring in vivo. PLoS One 12:e0172928. Hamburger V, Hamilton HL. 1951. A series of normal stages in the development of the chick embryo. J Morphol 88:49-92. Harpavat S, Cepko CL. 2006. RCAS-RNAi: A loss-of-function method for the developing chick retina. Bmc Developmental Biology 6. Hashimoto K, Noshiro M, Ohno S, Kawamoto T, Satakeda H, Akagawa Y, Nakashima K, Okimura A, Ishida H, Okamoto T, Pan H, Shen M, Yan W, Kato Y. 1997. Characterization of a cartilage-derived 66-kDa protein (RGD-CAP/beta ig-h3) that binds to collagen. Biochim Biophys Acta 1355:303-314. Hassell JR, Birk DE. 2010. The molecular basis of corneal transparency. Exp Eye Res 91:326-335. Hassell JR, Schrecengost PK, Rada JA, SundarRaj N, Sossi G, Thoft RA. 1992. Biosynthesis of stromal matrix proteoglycans and basement membrane components by human corneal fibroblasts. Invest Ophthalmol Vis Sci 33:547-557. Hay ED, Revel JP. 1969. Fine structure of the developing avian cornea. Monogr Dev Biol 1:1-144.

123

He Z, Forest F, Gain P, Rageade D, Bernard A, Acquart S, Peoc'h M, Defoe DM, Thuret G. 2016. 3D map of the human corneal endothelial cell. Sci Rep 6:29047. Heanue TA, Reshef R, Davis RJ, Mardon G, Oliver G, Tomarev S, Lassar AB, Tabin CJ. 1999. Synergistic regulation of vertebrate muscle development by Dach2, Eya2, and Six1, homologs of genes required for Drosophila eye formation. Genes Dev 13:3231-3243. Hendrix MJ, Hay ED, von der Mark K, Linsenmayer TF. 1982. Immunohistochemical localization of collagen types I and II in the developing chick cornea and tibia by electron microscopy. Invest Ophthalmol Vis Sci 22:359-375. Hill RE, Favor J, Hogan BL, Ton CC, Saunders GF, Hanson IM, Prosser J, Jordan T, Hastie ND, van Heyningen V. 1991. Mouse small eye results from mutations in a paired- like homeobox-containing gene. Nature 354:522-525. Hiranuma K, Yamada A, Kurosawa T, Aizawa R, Suzuki D, Saito Y, Nagahama R, Ikehata M, Tsukasaki M, Morimura N, Chikazu D, Maki K, Shirota T, Takami M, Yamamoto M, Iijima T, Kamijo R. 2016. Expression of nephronectin is enhanced by 1alpha,25-dihydroxyvitamin D3. FEBS Open Bio 6:914-918. Hiscott P, Armstrong D, Batterbury M, Kaye S. 1999. Repair in avascular tissues: fibrosis in the transparent structures of the eye and thrombospondin 1. Histology and Histopathology 14:1309-1320. Hiscott P, Paraoan L, Choudhary A, Ordonez JL, Al-Khaier A, Armstrong DJ. 2006. Thrombospondin 1, thrombospondin 2 and the eye. Progress in Retinal and Eye Research 25:1-18. Huang da W, Sherman BT, Lempicki RA. 2009. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat Protoc 4:44-57. Huang JT, Lee V. 2005. Identification and characterization of a novel human nephronectin gene in silico. Int J Mol Med 15:719-724. Hughes SH. 2004. The RCAS vector system. Folia Biologica 50:107-119. Ide T, Nishida K, Yamato M, Sumide T, Utsumi M, Nozaki T, Kikuchi A, Okano T, Tano Y. 2006. Structural characterization of bioengineered human corneal endothelial cell sheets fabricated on temperature-responsive culture dishes. Biomaterials 27:607-614. Iezumi Y, Yamada A, Minami E, Ikehata M, Yoshida Y, Kato T, Morimura N, Ogata H, Sakashita A, Iijima T, Chikazu D, Kamijo R. 2017. IL-1 beta suppresses nephronectin expression in osteoblasts via ERK1/2 and JNK. Biochemical and Biophysical Research Communications 493:773-775. Ikehata M, Yamada A, Morimura N, Itose M, Suzawa T, Shirota T, Chikazu D, Kamijo R. 2017. Wnt/beta-catenin signaling activates nephronectin expression in osteoblasts. Biochem Biophys Res Commun 484:231-234. Inomata T, Ebihara N, Funaki T, Matsuda A, Watanabe Y, Ning L, Xu Z, Murakami A, Arikawa-Hirasawa E. 2012. Perlecan-deficient mutation impairs corneal epithelial structure. Invest Ophthalmol Vis Sci 53:1277-1284.

124

Isaacson A, Swioklo S, Connon CJ. 2018. 3D bioprinting of a corneal stroma equivalent. Exp Eye Res 173:188-193. Ishii M, Han J, Yen HY, Sucov HM, Chai Y, Maxson RE, Jr. 2005. Combined deficiencies of Msx1 and Msx2 cause impaired patterning and survival of the cranial neural crest. Development 132:4937-4950. Ittner LM, Wurdak H, Schwerdtfeger K, Kunz T, Ille F, Leveen P, Hjalt TA, Suter U, Karlsson S, Hafezi F, Born W, Sommer L. 2005. Compound developmental eye disorders following inactivation of TGFbeta signaling in neural-crest stem cells. J Biol 4:11. Jasrapuria-Agrawal S, Lwigale PY. 2014. Chapter 10 - Neural Crest Cells in Ocular Development A2 - Trainor, Paul A. In: Neural Crest Cells. Boston: Academic Press. pp 189-203. Jin EJ, Burrus LW, Erickson CA. 2002. The expression patterns of Wnts and their antagonists during avian eye development. Mech Dev 116:173-176. Johnston MC, Noden DM, Hazelton RD, Coulombre JL, Coulombre AJ. 1979. Origins of avian ocular and periocular tissues. Exp Eye Res 29:27-43. Jun AS, Larkin DF. 2003. Prospects for gene therapy in corneal disease. Eye (Lond) 17:906-911. Kabosova A, Azar DT, Bannikov GA, Campbell KP, Durbeej M, Ghohestani RF, Jones JC, Kenney MC, Koch M, Ninomiya Y, Patton BL, Paulsson M, Sado Y, Sage EH, Sasaki T, Sorokin LM, Steiner-Champliaud MF, Sun TT, Sundarraj N, Timpl R, Virtanen I, Ljubimov AV. 2007. Compositional differences between infant and adult human corneal basement membranes. Invest Ophthalmol Vis Sci 48:4989-4999. Kadler KE, Holmes DF, Trotter JA, Chapman JA. 1996. Collagen fibril formation. Biochem J 316 ( Pt 1):1-11. Kahai S, Lee SC, Lee DY, Yang J, Li M, Wang CH, Jiang Z, Zhang Y, Peng C, Yang BB. 2009. MicroRNA miR-378 regulates nephronectin expression modulating osteoblast differentiation by targeting GalNT-7. PLoS One 4:e7535. Kahai S, Lee SC, Seth A, Yang BB. 2010. Nephronectin promotes osteoblast differentiation via the epidermal growth factor-like repeats. FEBS Lett 584:233- 238. Kam RK, Shi W, Chan SO, Chen Y, Xu G, Lau CB, Fung KP, Chan WY, Zhao H. 2013. Dhrs3 protein attenuates retinoic acid signaling and is required for early embryonic patterning. J Biol Chem 288:31477-31487. Kanakubo S, Nomura T, Yamamura K, Miyazaki J, Tamai M, Osumi N. 2006. Abnormal migration and distribution of neural crest cells in Pax6 heterozygous mutant eye, a model for human eye diseases. Genes Cells 11:919-933. Kanehisa M, Goto S, Sato Y, Furumichi M, Tanabe M. 2012. KEGG for integration and interpretation of large-scale molecular data sets. Nucleic Acids Res 40:D109-114. Kato T, Yamada A, Ikehata M, Yoshida Y, Sasa K, Morimura N, Sakashita A, Iijima T, Chikazu D, Ogata H, Kamijo R. 2018. FGF-2 suppresses expression of nephronectin via JNK and PI3K pathways. FEBS Open Bio 8:836-842.

125

Kattan JM, Serna-Ojeda JC, Sharma A, Kim EK, Ramirez-Miranda A, Cruz-Aguilar M, Cervantes AE, Frausto RF, Zenteno JC, Graue-Hernandez EO, Aldave AJ. 2017. Vortex Pattern of Corneal Deposits in Granular Corneal Dystrophy Associated With the p.(Arg555Trp) Mutation in TGFBI. Cornea 36:210-216. Kalluri R. 2003. Basement membranes: structure, assembly and role in tumour angiogenesis. Nat Rev Cancer 3:422-433. Kenney MC, Nesburn AB, Burgeson RE, Butkowski RJ, Ljubimov AV. 1997. Abnormalities of the extracellular matrix in keratoconus corneas. Cornea 16:345-351. Kim D, Langmead B, Salzberg SL. 2015. HISAT: a fast spliced aligner with low memory requirements. Nat Methods 12:357-360. Kinoshita S, Koizumi N, Ueno M, Okumura N, Imai K, Tanaka H, Yamamoto Y, Nakamura T, Inatomi T, Bush J, Toda M, Hagiya M, Yokota I, Teramukai S, Sotozono C, Hamuro J. 2018. Injection of Cultured Cells with a ROCK Inhibitor for Bullous Keratopathy. N Engl J Med 378:995-1003. Kioussi C, Briata P, Baek SH, Rose DW, Hamblet, NS, Herman T, Ohgi KA, Lin C , Gleiberman A, Wang J, Brault V, Ruiz-Lozano P, Nguyen HD, Kemler R, Glass CK, Wynshaw-Boris A, Rosenfeld MG. 2002. Identification of a Wnt/Dvl/beta-Catenin –>Pitx2 pathway mediating cell-type-specific proliferation during development. CELL 111: 673-685. Kitamura K, Miura H, Miyagawa-Tomita S, Yanazawa M, Katoh-Fukui Y, Suzuki R, Ohuchi H, Suehiro A, Motegi Y, Nakahara Y, Kondo S, Yokoyama M. 1999. Mouse Pitx2 deficiency leads to anomalies of the ventral body wall, heart, extra- and periocular mesoderm and right pulmonary isomerism. Development 126:5749- 5758. Kiyozumi D, Takeichi M, Nakano I, Sato Y, Fukuda T, Sekiguchi K. 2012. Basement membrane assembly of the integrin alpha8beta1 ligand nephronectin requires Fraser syndrome-associated proteins. J Cell Biol 197:677-689. Klausner EA, Peer D, Chapman RL, Multack RF, Andurkar SV. 2007. Corneal gene therapy. J Control Release 124:107-133. Kliewer SA, Umesono K, Heyman RA, Mangelsdorf DJ, Dyck JA, Evans RM. 1992. Retinoid X receptor-COUP-TF interactions modulate retinoic acid signaling. Proc Natl Acad Sci U S A 89:1448-1452. Knecht AK, Bronner-Fraser M. 2002. Induction of the neural crest: a multigene process. Nat Rev Genet 3:453-461. Knupp C, Pinali C, Lewis PN, Parfitt GJ, Young RD, Meek KM, Quantock AJ. 2009. The architecture of the cornea and structural basis of its transparency. Adv Protein Chem Struct Biol 78:25-49. Ko MK, Kay EP. 2001. Subcellular localization of procollagen I and prolyl 4-hydroxylase in corneal endothelial cells. Exp Cell Res 264:363-371. Kon S, Honda M, Ishikawa K, Maeda M, Segawa T. 2020. Antibodies against nephronectin ameliorate anti-type II collagen-induced arthritis in mice. Febs Open Bio 10:107-117.

126

Kong BW, Lee JY, Bottje WG, Lassiter K, Lee J, Foster DN. 2011. Genome-wide differential gene expression in immortalized DF-1 chicken embryo fibroblast cell line. BMC Genomics 12:571. Kong M, Munoz N, Valdivia A, Alvarez A, Herrera-Molina R, Cardenas A, Schneider P, Burridge K, Quest AF, Leyton L. 2013. Thy-1-mediated cell-cell contact induces astrocyte migration through the engagement of alphaVbeta3 integrin and syndecan-4. Biochim Biophys Acta 1833:1409-1420. Kruegel J, Miosge N. 2010. Basement membrane components are key players in specialized extracellular matrices. Cell Mol Life Sci 67:2879-2895. Kruse SW, Suino-Powell K, Zhou XE, Kretschman JE, Reynolds R, Vonrhein C, Xu Y, Wang L, Tsai SY, Tsai MJ, Xu HE. 2008. Identification of COUP-TFII orphan nuclear receptor as a retinoic acid-activated receptor. PLoS Biol 6:e227. Ksander BR, Kolovou PE, Wilson BJ, Saab KR, Guo Q, Ma J, McGuire SP, Gregory MS, Vincent WJ, Perez VL, Cruz-Guilloty F, Kao WW, Call MK, Tucker BA, Zhan Q, Murphy GF, Lathrop KL, Alt C, Mortensen LJ, Lin CP, Zieske JD, Frank MH, Frank NY. 2014. ABCB5 is a limbal stem cell gene required for corneal development and repair. Nature 511:353-357. Kuek V, Yang Z, Chim SM, Zhu S, Xu H, Chow ST, Tickner J, Rosen V, Erber W, Li X, An Q, Qian Y, Xu J. 2016a. NPNT is Expressed by Osteoblasts and Mediates Angiogenesis via the Activation of Extracellular Signal-regulated Kinase. Sci Rep 6:36210. Kuek V, Yang ZF, Chim SM, Zhu SP, Xu HZ, Chow ST, Tickner J, Rosen V, Erber W, Li XC, An Q, Qian Y, Xu JK. 2016b. NPNT is Expressed by Osteoblasts and Mediates Angiogenesis via the Activation of Extracellular Signal-regulated Kinase. Scientific Reports 6. Kume T, Seo S. 2010. The Forkhead Transcription Factor Foxc1 is Required for Corneal Avascularity. Investigative Ophthalmology & Visual Science 51. Kuphal S, Wallner S, Bosserhoff AK. 2008. Loss of nephronectin promotes tumor progression in malignant melanoma. Cancer Sci 99:229-233. Kurosawa T, Yamada A, Suzuki D, Morimura N, Sasagane Y, Itabe H, Kamijo R. 2016. Nephronectin Expression Is Up-Regulated by BMP-2. Biol Pharm Bull 39:1211- 1215. Kwiatkowski SC, Ojeda AF, Lwigale PY. 2016. PlexinD1 is required for proper patterning of the periocular vascular network and for the establishment of corneal avascularity during avian ocular development. Dev Biol 411:128-139. Labosky PA, Kaestner KH. 1998. The winged helix transcription factor Hfh2 is expressed in neural crest and spinal cord during mouse development. Mech Dev 76:185- 190. Langmead B, Salzberg SL. 2012. Fast gapped-read alignment with Bowtie 2. Nat Methods 9:357-359. Le Douarin NM, Creuzet S, Couly G, Dupin E. 2004. Neural crest cell plasticity and its limits. Development 131:4637-4650.

127

LeBleu VS, Macdonald B, Kalluri R. 2007. Structure and function of basement membranes. Exp Biol Med (Maywood) 232:1121-1129. Lee JG, Ko MK, Kay EP. 2012. Endothelial mesenchymal transformation mediated by IL- 1beta-induced FGF-2 in corneal endothelial cells. Exp Eye Res 95:35-39. Lee SC, Fang L, Wang CH, Kahai S, Deng Z, Yang BB. 2011. A non-coding transcript of nephronectin promotes osteoblast differentiation by modulating microRNA functions. FEBS Lett 585:2610-2616. Lehmann OJ, Sowden JC, Carlsson P, Jordan T, Bhattacharya SS. 2003. Fox's in development and disease. Trends in Genetics 19:339-344. Leyton L, Schneider P, Labra CV, Ruegg C, Hetz CA, Quest AF, Bron C. 2001. Thy-1 binds to integrin beta(3) on astrocytes and triggers formation of focal contact sites. Curr Biol 11:1028-1038. Li B, Dewey CN. 2011. RSEM: accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC Bioinformatics 12:323. Li H, Wagner E, McCaffery P, Smith D, Andreadis A, Drager UC. 2000. A retinoic acid synthesizing enzyme in ventral retina and telencephalon of the embryonic mouse. Mech Dev 95:283-289. Liem KF, Jr., Tremml G, Roelink H, Jessell TM. 1995. Dorsal differentiation of neural plate cells induced by BMP-mediated signals from epidermal ectoderm. Cell 82:969-979. Lin Z, Gao C, Ning Y, He X, Wu W, Chen YG. 2008. The pseudoreceptor BMP and activin membrane-bound inhibitor positively modulates Wnt/beta-catenin signaling. J Biol Chem 283:33053-33058. Linsenmayer TF, Fitch JM, Mayne R. 1984. Extracellular matrices in the developing avian eye: type V collagen in corneal and noncorneal tissues. Invest Ophthalmol Vis Sci 25:41-47. Linsenmayer TF, Fitch JM, Schmid TM, Zak NB, Gibney E, Sanderson RD, Mayne R. 1983. Monoclonal antibodies against chicken type V collagen: production, specificity, and use for immunocytochemical localization in embryonic cornea and other organs. J Cell Biol 96:124-132. Linsenmayer TF, Smith GN, Jr., Hay ED. 1977. Synthesis of two collagen types by embryonic chick corneal epithelium in vitro. Proc Natl Acad Sci U S A 74:39-43. Linton JM, Martin GR, Reichardt LF. 2007. The ECM protein nephronectin promotes kidney development via integrin alpha8beta1-mediated stimulation of Gdnf expression. Development 134:2501-2509. Liu JP, Jessell TM. 1998. A role for rhoB in the delamination of neural crest cells from the dorsal neural tube. Development 125:5055-5067. Liu YH, Tang Z, Kundu RK, Wu L, Luo W, Zhu D, Sangiorgi F, Snead ML, Maxson RE. 1999. Msx2 gene dosage influences the number of proliferative osteogenic cells in growth centers of the developing murine skull: a possible mechanism for MSX2- mediated craniosynostosis in humans. Dev Biol 205:260-274.

128

Lwigale PY, Bronner-Fraser M. 2007. Lens-derived Semaphorin3A regulates sensory innervation of the cornea. Dev Biol 306:750-759. Lwigale PY, Bronner-Fraser M. 2009. Semaphorin3A/neuropilin-1 signaling acts as a molecular switch regulating neural crest migration during cornea development. Developmental Biology 336:257-265. Lwigale PY, Conrad GW, Bronner-Fraser M. 2004. Graded potential of neural crest to form cornea, sensory neurons and cartilage along the rostrocaudal axis. Development 131:1979-1991. Lwigale PY, Cressy PA, Bronner-Fraser M. 2005. Corneal keratocytes retain neural crest progenitor cell properties. Dev Biol 288:284-293. Lwigale PY. 2015. Corneal Development: Different Cells from a Common Progenitor. Prog Mol Biol Transl Sci 134:43-59. Maden M, Sonneveld E, van der Saag PT, Gale E. 1998. The distribution of endogenous retinoic acid in the chick embryo: implications for developmental mechanisms. Development 125:4133-4144. Maden M. 2007. Retinoic acid in the development, regeneration and maintenance of the nervous system. Nat Rev Neurosci 8:755-765. Marcos-Ramiro B, Garcia-Weber D, Barroso S, Feito J, Ortega MC, Cernuda-Morollon E, Reglero-Real N, Fernandez-Martin L, Duran MC, Alonso MA, Correas I, Cox S, Ridley AJ, Millan J. 2016. RhoB controls endothelial barrier recovery by inhibiting Rac1 trafficking to the cell border. J Cell Biol 213:385-402. Mardon G, Solomon NM, Rubin GM. 1994. dachshund encodes a nuclear protein required for normal eye and leg development in Drosophila. Development 120:3473-3486. Martinez-Morales PL, Diez del Corral R, Olivera-Martinez I, Quiroga AC, Das RM, Barbas JA, Storey KG, Morales AV. 2011. FGF and retinoic acid activity gradients control the timing of neural crest cell emigration in the trunk. J Cell Biol 194:489-503. Martino VB, Sabljic T, Deschamps P, Green RM, Akula M, Peacock E, Ball A, Williams T, West-Mays JA. 2016. Conditional deletion of AP-2beta in mouse cranial neural crest results in anterior segment dysgenesis and early-onset glaucoma. Dis Model Mech 9:849-861. Massoudi D, Malecaze F, Galiacy SD. 2016. Collagens and proteoglycans of the cornea: importance in transparency and visual disorders. Cell Tissue Res 363:337-349. Matsuba M, Hutcheon AE, Zieske JD. 2011. Localization of thrombospondin-1 and myofibroblasts during corneal wound repair. Exp Eye Res 93:534-540. Maurice DM. 1957. The structure and transparency of the cornea. J Physiol 136:263- 286. Matt N, Dupe V, Garnier JM, Dennefeld C, Chambon P, Mark M, Ghyselinck NB. 2005. Retinoic acid-dependent eye morphogenesis is orchestrated by neural crest cells. Development 132:4789-4800.

129

McAlister JC, Joyce NC, Harris DL, Ali RR, Larkin DF. 2005. Induction of replication in human corneal endothelial cells by E2F2 transcription factor cDNA transfer. Invest Ophthalmol Vis Sci 46:3597-3603. McKenna CC, Munjaal RP, Lwigale PY. 2012. Distinct roles for neuropilin1 and neuropilin2 during mouse corneal innervation. PLoS One 7:e37175. McKeown SJ, Lee VM, Bronner-Fraser M, Newgreen DF, Farlie PG. 2005. Sox10 overexpression induces neural crest-like cells from all dorsoventral levels of the neural tube but inhibits differentiation. Dev Dyn 233:430-444. Mei M, Xiang RL, Cong X, Zhang Y, Li J, Yi X, Park K, Han JY, Wu LL, Yu GY. 2015. Claudin- 3 is required for modulation of paracellular permeability by TNF-alpha through ERK1/2/slug signaling axis in submandibular gland. Cell Signal 27:1915-1927. Merjava S, Liskova P, Sado Y, Davis PF, Greenhill NS, Jirsova K. 2009. Changes in the localization of collagens IV and VIII in corneas obtained from patients with posterior polymorphous corneal dystrophy. Exp Eye Res 88:945-952. Michalik L, Wahli W. 2007. Guiding ligands to nuclear receptors. Cell 129:649-651. Michelacci YM. 2003. Collagens and proteoglycans of the corneal extracellular matrix. Braz J Med Biol Res 36:1037-1046. Minami Y, Sugihara H, Oono S. 1993. Reconstruction of cornea in three-dimensional collagen gel matrix culture. Invest Ophthalmol Vis Sci 34:2316-2324. Miner JH. 2001. Mystery solved: discovery of a novel integrin ligand in the developing kidney. J Cell Biol 154:257-259. Miyazono A, Yamada A, Morimura N, Takami M, Suzuki D, Kobayashi M, Tezuka K, Yamamoto M, Kamijo R. 2007. TGF-beta suppresses POEM expression through ERK1/2 and JNK in osteoblasts. FEBS Lett 581:5321-5326. Mohan RR, Gupta R, Mehan MK, Cowden JW, Sinha S. 2010. Decorin transfection suppresses profibrogenic genes and myofibroblast formation in human corneal fibroblasts. Exp Eye Res 91:238-245. Molotkov A, Molotkova N, Duester G. 2006. Retinoic acid guides eye morphogenetic movements via paracrine signaling but is unnecessary for retinal dorsoventral patterning. Development 133:1901-1910. Monsoro-Burq AH, Fletcher RB, Harland RM. 2003. Neural crest induction by paraxial mesoderm in Xenopus embryos requires FGF signals. Development 130:3111- 3124. Moore CB, Guthrie EH, Huang MT, Taxman DJ. 2010. Short hairpin RNA (shRNA): design, delivery, and assessment of gene knockdown. Methods Mol Biol 629:141-158. Morimura N, Tezuka Y, Watanabe N, Yasuda M, Miyatani S, Hozumi N, Tezuka Ki K. 2001. Molecular cloning of POEM: a novel adhesion molecule that interacts with alpha8beta1 integrin. J Biol Chem 276:42172-42181. Muller U, Wang D, Denda S, Meneses JJ, Pedersen RA, Reichardt LF. 1997. Integrin alpha8beta1 is critically important for epithelial-mesenchymal interactions during kidney morphogenesis. Cell 88:603-613.

130

Mundell NA, Labosky PA. 2011. Neural crest stem cell multipotency requires Foxd3 to maintain neural potential and repress mesenchymal fates. Development 138:641-652. Nakamura H, Katahira T, Sato T, Watanabe Y, Funahashi J. 2004. Gain- and loss-of- function in chick embryos by electroporation. Mech Dev 121:1137-1143. Nakamura M, Nishida T. 1999. Synergistic effects of hyaluronan and fibronectin on epithelial migration in rabbit cornea in vitro. Cornea 18:686-692. Nakatani S, Ishimura E, Mori K, Fukumoto S, Yamano S, Wei M, Emoto M, Wanibuchi H, Inaba M. 2012a. Nephronectin expression in glomeruli of renal biopsy specimens from various kidney diseases: nephronectin is expressed in the mesangial matrix expansion of diabetic nephropathy. Nephron Clin Pract 122:114-121. Nakatani S, Wei M, Ishimura E, Kakehashi A, Mori K, Nishizawa Y, Inaba M, Wanibuchi H. 2012b. Proteome analysis of laser microdissected glomeruli from formalin-fixed paraffin-embedded kidneys of autopsies of diabetic patients: nephronectin is associated with the development of diabetic glomerulosclerosis. Nephrol Dial Transplant 27:1889-1897. Nielsen NS, Juhl DW, Poulsen ET, Lukassen MV, Poulsen EC, Risor MW, Scavenius C, Enghild JJ. 2017. Mutation-Induced Deamidation of Corneal Dystrophy-Related Transforming Growth Factor beta-Induced Protein. Biochemistry 56:6470-6480. Nischal KK. 2015. Genetics of Congenital Corneal Opacification--Impact on Diagnosis and Treatment. Cornea 34 Suppl 10:S24-34. Nishida T, Nakagawa S, Awata T, Ohashi Y, Watanabe K, Manabe R. 1983. Fibronectin promotes epithelial migration of cultured rabbit cornea in situ. J Cell Biol 97:1653-1657. Noden DM. 1975. An analysis of migratory behavior of avian cephalic neural crest cells. Dev Biol 42:106-130. Ochoa SD, Salvador S, LaBonne C. 2012. The LIM adaptor protein LMO4 is an essential regulator of neural crest development. Dev Biol 361:313-325. Ohashi Y, Nakagawa S, Nishida T, Suda T, Watanabe K, Manabe R. 1983. Appearance of fibronectin in rabbit cornea after thermal burn. Jpn J Ophthalmol 27:547-555. Ojeda AF, Munjaal RP, Lwigale PY. 2017. Knockdown of CXCL14 disrupts neurovascular patterning during ocular development. Dev Biol 423:77-91. Okumura N, Minamiyama R, Ho LT, Kay EP, Kawasaki S, Tourtas T, Schlotzer-Schrehardt U, Kruse FE, Young RD, Quantock AJ, Kinoshita S, Koizumi N. 2015. Involvement of ZEB1 and Snail1 in excessive production of extracellular matrix in Fuchs endothelial corneal dystrophy. Lab Invest 95:1291-1304. Onichtchouk D, Chen YG, Dosch R, Gawantka V, Delius H, Massague J, Niehrs C. 1999. Silencing of TGF-beta signalling by the pseudoreceptor BAMBI. Nature 401:480- 485. Ordonez P, Di Girolamo N. 2012. Limbal epithelial stem cells: role of the niche microenvironment. Stem Cells 30:100-107.

131

Parikumar P, Haraguchi K, Senthilkumar R, Abraham SJ. 2018. Human corneal endothelial cell transplantation using nanocomposite gel sheet in bullous keratopathy. Am J Stem Cells 7:18-24. Patra C, Diehl F, Ferrazzi F, van Amerongen MJ, Novoyatleva T, Schaefer L, Muhlfeld C, Jungblut B, Engel FB. 2011. Nephronectin regulates atrioventricular canal differentiation via Bmp4-Has2 signaling in zebrafish. Development 138:4499- 4509. Patra C, Ricciardi F, Engel FB. 2012. The functional properties of nephronectin: an adhesion molecule for cardiac tissue engineering. Biomaterials 33:4327-4335. Petroll WM, Hsu JK, Bean J, Cavanagh HD, Jester JV. 1999. The spatial organization of apical junctional complex-associated proteins in feline and human corneal endothelium. Curr Eye Res 18:10-19. Pickens BS, Teets BW, Soprano KJ, Soprano DR. 2013. Role of COUP-TFI during retinoic acid-induced differentiation of P19 cells to endodermal cells. J Cell Physiol 228:791-800. Polisetti N, Zenkel M, Menzel-Severing J, Kruse FE, Schlotzer-Schrehardt U. 2016. Cell Adhesion Molecules and Stem Cell-Niche-Interactions in the Limbal Stem Cell Niche. Stem Cells 34:203-219. Powell SK, Lisanti MP, Rodriguez-Boulan EJ. 1991. Thy-1 expresses two signals for apical localization in epithelial cells. Am J Physiol 260:C715-720. Quantock AJ, Young RD. 2008. Development of the corneal stroma, and the collagen- proteoglycan associations that help define its structure and function. Dev Dyn 237:2607-2621. Rada JA, Cornuet PK, Hassell JR. 1993. Regulation of corneal collagen fibrillogenesis in vitro by corneal proteoglycan (lumican and decorin) core proteins. Exp Eye Res 56:635-648. Rama P, Bonini S, Lambiase A, Golisano O, Paterna P, De Luca M, Pellegrini G. 2001. Autologous fibrin-cultured limbal stem cells permanently restore the corneal surface of patients with total limbal stem cell deficiency. Transplantation 72:1478-1485. Ramachandran C, Srinivas SP. 2010. Formation and disassembly of adherens and tight junctions in the corneal endothelium: regulation by actomyosin contraction. Invest Ophthalmol Vis Sci 51:2139-2148. Reis LM, Semina EV. 2011. Genetics of anterior segment dysgenesis disorders. Curr Opin Ophthalmol 22:314-324. Ren G, Song C, Liang P, Zhang Z. 1994. The effect of fibronectin on re-epithelialization of rabbits cornea after alkali burn. Yan Ke Xue Bao 10:138-143. Reneker LW, Silversides DW, Xu L, Overbeek PA. 2000. Formation of corneal endothelium is essential for anterior segment development - a transgenic mouse model of anterior segment dysgenesis. Development 127:533-542. Richterich P. 1998. Estimation of errors in "raw" DNA sequences: a validation study. Genome Res 8:251-259.

132

Robinson MD, McCarthy DJ, Smyth GK. 2010. edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 26:139-140. Sahar DE, Longaker MT, Quarto N. 2005. Sox9 neural crest determinant gene controls patterning and closure of the posterior frontal cranial suture. Dev Biol 280:344- 361. Saika S, Miyamoto T, Ishida I, Shirai K, Ohnishi Y, Ooshima A, McAvoy JW. 2002. TGFbeta-Smad signalling in postoperative human lens epithelial cells. Br J Ophthalmol 86:1428-1433. Saika S, Saika S, Liu CY, Azhar M, Sanford LP, Doetschman T, Gendron RL, Kao CW, Kao WW. 2001. TGFbeta2 in corneal morphogenesis during mouse embryonic development. Dev Biol 240:419-432. Saint-Jeannet JP, He X, Varmus HE, Dawid IB. 1997. Regulation of dorsal fate in the neuraxis by Wnt-1 and Wnt-3a. Proc Natl Acad Sci U S A 94:13713-13718. Sakai Y, Luo T, McCaffery P, Hamada H, Drager UC. 2004. CYP26A1 and CYP26C1 cooperate in degrading retinoic acid within the equatorial retina during later eye development. Dev Biol 276:143-157. Sakai Y, Meno C, Fujii H, Nishino J, Shiratori H, Saijoh Y, Rossant J, Hamada H. 2001. The retinoic acid-inactivating enzyme CYP26 is essential for establishing an uneven distribution of retinoic acid along the anterio-posterior axis within the mouse embryo. Genes Dev 15:213-225. Salie R, Kneissel M, Vukevic M, Zamurovic N, Kramer I, Evans G, Gerwin N, Mueller M, Kinzel B, Susa M. 2010. Ubiquitous overexpression of Hey1 transcription factor leads to osteopenia and chondrocyte hypertrophy in bone. Bone 46:680-694. Sato A, Yamamoto H, Sakane H, Koyama H, Kikuchi A. 2010. Wnt5a regulates distinct signalling pathways by binding to Frizzled2. EMBO J 29:41-54. Sato Y, Shimono C, Li S, Nakano I, Norioka N, Sugiura N, Kimata K, Yamada M, Sekiguchi K. 2013. Nephronectin binds to heparan sulfate proteoglycans via its MAM domain. Matrix Biol 32:188-195. Sato Y, Uemura T, Morimitsu K, Sato-Nishiuchi R, Manabe R, Takagi J, Yamada M, Sekiguchi K. 2009. Molecular basis of the recognition of nephronectin by integrin alpha8beta1. J Biol Chem 284:14524-14536. Schultz-Cherry S, Ribeiro S, Gentry L, Murphy-Ullrich JE. 1994. Thrombospondin binds and activates the small and large forms of latent transforming growth factor- beta in a chemically defined system. J Biol Chem 269:26775-26782. Secker GA, Daniels JT. 2008. Limbal epithelial stem cells of the cornea. In: StemBook. Cambridge (MA). Serbedzija GN, Bronner-Fraser M, Fraser SE. 1992. Vital dye analysis of cranial neural crest cell migration in the mouse embryo. Development 116:297-307. Shah NM, Groves AK, Anderson DJ. 1996. Alternative neural crest cell fates are instructively promoted by TGFbeta superfamily members. Cell 85:331-343. Shaw LM, Olsen BR. 1991. FACIT collagens: diverse molecular bridges in extracellular matrices. Trends Biochem Sci 16:191-194.

133

Simoes-Costa M, Bronner ME. 2015. Establishing neural crest identity: a gene regulatory recipe. Development 142:242-257. Simoes-Costa M, Tan-Cabugao J, Antoshechkin I, Sauka-Spengler T, Bronner ME. 2014. Transcriptome analysis reveals novel players in the cranial neural crest gene regulatory network. Genome Res 24:281-290. Skonier J, Neubauer M, Madisen L, Bennett K, Plowman GD, Purchio AF. 1992. cDNA cloning and sequence analysis of beta ig-h3, a novel gene induced in a human adenocarcinoma cell line after treatment with transforming growth factor-beta. DNA Cell Biol 11:511-522. Smith CA, Roeszler KN, Sinclair AH. 2009. Robust and ubiquitous GFP expression in a single generation of chicken embryos using the avian retroviral vector, RCASBP. Differentiation 77:473-482. Smith RS, Zabaleta A, Kume T, Savinova OV, Kidson SH, Martin JE, Nishimura DY, Alward WLM, Hogan BLM, John SWM. 2000. Haploinsufficiency of the transcription factors FOXC1 and FOXC2 results in aberrant ocular development. Human Molecular Genetics 9:1021-1032. Soh YQ, Mehta JS. 2018. Regenerative Therapy for Fuchs Endothelial Corneal Dystrophy. Cornea 37:523-527. Southard-Smith EM, Kos L, Pavan WJ. 1998. Sox10 mutation disrupts neural crest development in Dom Hirschsprung mouse model. Nat Genet 18:60-64. Sowden JC. 2007. Molecular and developmental mechanisms of anterior segment dysgenesis. Eye (Lond) 21:1310-1318. Spigelman AV, Vernot JA, Deutsch TA, Peyman GA, Molnar J. 1985. Fibronectin in alkali burns of the rabbit cornea. Cornea 4:169-172. Spurlin J, 3rd, Lwigale P. 2013. A technique to increase accessibility to late-stage chick embryos for in ovo manipulations. Dev Dyn 242:148-154. Spurlin JW, 3rd, Lwigale PY. 2013b. Wounded embryonic corneas exhibit nonfibrotic regeneration and complete innervation. Invest Ophthalmol Vis Sci 54:6334- 6344. Stabuc-Silih M, Ravnik-Glavac M, Glavac D, Hawlina M, Strazisar M. 2009. Polymorphisms in COL4A3 and COL4A4 genes associated with keratoconus. Mol Vis 15:2848-2860. Steigedal TS, Toraskar J, Redvers RP, Valla M, Magnussen SN, Bofin AM, Opdahl S, Lundgren S, Eckhardt BL, Lamar JM, Doherty J, Hynes RO, Anderson RL, Svineng G. 2018. Nephronectin is Correlated with Poor Prognosis in Breast Cancer and Promotes Metastasis via its Integrin-Binding Motifs. Neoplasia 20:387-400. Steinfeld J, Steinfeld I, Bausch A, Coronato N, Hampel ML, Depner H, Layer PG, Vogel- Hopker A. 2017. BMP-induced reprogramming of the neural retina into retinal pigment epithelium requires Wnt signalling. Biol Open 6:979-992. Stepp MA. 2006. Corneal integrins and their functions. Exp Eye Res 83:3-15.

134

Sui H, Han BG, Lee JK, Walian P, Jap BK. 2001. Structural basis of water-specific transport through the AQP1 water channel. Nature 414:872-878. Sun Y, Kuek V, Qiu H, Tickner J, Chen L, Wang H, He W, Xu J. 2018. The emerging role of NPNT in tissue injury repair and bone homeostasis. J Cell Physiol 233:1887- 1894. Talbot JC, Nichols JT, Yan YL, Leonard IF, BreMiller RA, Amacher SL, Postlethwait JH, Kimmel CB. 2016. Pharyngeal morphogenesis requires fras1-itga8-dependent epithelial-mesenchymal interaction. Dev Biol 416:136-148. Taneyhill LA, Coles EG, Bronner-Fraser M. 2007. Snail2 directly represses cadherin6B during epithelial-to-mesenchymal transitions of the neural crest. Development 134:1481-1490. Tang J, Saito T. 2017a. Nephronectin Stimulates the Differentiation of MDPC-23 Cells into an Odontoblast-like Phenotype. Journal of Endodontics 43:263-271. Tang J, Saito T. 2017b. The Role of Nephronectin on Proliferation and Differentiation in Human Dental Pulp Stem Cells. Stem Cells Int 2017:2546261. Tarazona S, Furio-Tari P, Turra D, Di Pietro A, Nueda MJ, Ferrer A, Conesa A. 2015. Data quality aware analysis of differential expression in RNA-seq with NOISeq R/Bioc package. Nucleic Acids Research 43. Tarazona S, Garcia-Alcalde F, Dopazo J, Ferrer A, Conesa A. 2011. Differential expression in RNA-seq: a matter of depth. Genome Res 21:2213-2223. Thomas BL, Tucker AS, Qui M, Ferguson CA, Hardcastle Z, Rubenstein JL, Sharpe PT. 1997. Role of Dlx-1 and Dlx-2 genes in patterning of the murine dentition. Development 124:4811-4818. Tiveron MC, Nosten-Bertrand M, Jani H, Garnett D, Hirst EM, Grosveld F, Morris RJ. 1994. The mode of anchorage to the cell surface determines both the function and the membrane location of Thy-1 glycoprotein. J Cell Sci 107 ( Pt 7):1783- 1796. Tolsma SS, Stack MS, Bouck N. 1997. Lumen formation and other angiogenic activities of cultured capillary endothelial cells are inhibited by thrombospondin-1. Microvasc Res 54:13-26. Torricelli AA, Singh V, Santhiago MR, Wilson SE. 2013. The corneal epithelial basement membrane: structure, function, and disease. Invest Ophthalmol Vis Sci 54:6390- 6400. Tran P, Zhang XK, Salbert G, Hermann T, Lehmann JM, Pfahl M. 1992. COUP orphan receptors are negative regulators of retinoic acid response pathways. Mol Cell Biol 12:4666-4676. Tritschler I, Gramatzki D, Capper D, Mittelbronn M, Meyermann R, Saharinen J, Wick W, Keski-Oja J, Weller M. 2009. Modulation of TGF-beta activity by latent TGF-beta- binding protein 1 in human malignant glioma cells. Int J Cancer 125:530-540. Trousse F, Esteve P, Bovolenta P. 2001. Bmp4 mediates apoptotic cell death in the developing chick eye. J Neurosci 21:1292-1301.

135

Tsukasaki M, Yamada A, Yoshimura K, Miyazono A, Yamamoto M, Takami M, Miyamoto Y, Morimura N, Kamijo R. 2012. Nephronectin expression is regulated by SMAD signaling in osteoblast-like MC3T3-E1 cells. Biochem Biophys Res Commun 425:390-392. Tuori AJ, Virtanen I, Aine E, Kalluri R, Miner JH, Uusitalo HM. 1997. The immunohistochemical composition of corneal basement membrane in keratoconus. Curr Eye Res 16:792-801. Tzortzaki EG, Tischfield JA, Sahota A, Siafakas NM, Gordon MK, Gerecke DR. 2003. Expression of FACIT collagens XII and XIV during bleomycin-induced pulmonary fibrosis in mice. Anat Rec A Discov Mol Cell Evol Biol 275:1073-1080. Usui T, Takase M, Kaji Y, Suzuki K, Ishida K, Tsuru T, Miyata K, Kawabata M, Yamashita H. 1998. Extracellular matrix production regulation by TGF-beta in corneal endothelial cells. Invest Ophthalmol Vis Sci 39:1981-1989. van Dijk K, Parker J, Tong CM, Ham L, Lie JT, Groeneveld-van Beek EA, Melles GR. 2014. Midstromal isolated Bowman layer graft for reduction of advanced keratoconus: a technique to postpone penetrating or deep anterior lamellar keratoplasty. JAMA Ophthalmol 132:495-501. Villanueva S, Glavic A, Ruiz P, Mayor R. 2002. Posteriorization by FGF, Wnt, and retinoic acid is required for neural crest induction. Dev Biol 241:289-301. Vincent AL, Jordan CA, Cadzow MJ, Merriman TR, McGhee CN. 2014. Mutations in the zinc finger protein gene, ZNF469, contribute to the pathogenesis of keratoconus. Invest Ophthalmol Vis Sci 55:5629-5635. Vithana EN, Aung T, Khor CC, Cornes BK, Tay WT, Sim X, Lavanya R, Wu R, Zheng Y, Hibberd ML, Chia KS, Seielstad M, Goh LK, Saw SM, Tai ES, Wong TY. 2011. Collagen-related genes influence the glaucoma risk factor, central corneal thickness. Hum Mol Genet 20:649-658. Vrana NE, Builles N, Justin V, Bednarz J, Pellegrini G, Ferrari B, Damour O, Hulmes DJ, Hasirci V. 2008. Development of a reconstructed cornea from collagen- chondroitin sulfate foams and human cell cultures. Invest Ophthalmol Vis Sci 49:5325-5331. Wagner GP, Kin K, Lynch VJ. 2012. Measurement of mRNA abundance using RNA-seq data: RPKM measure is inconsistent among samples. Theory in Biosciences 131:281-285. Waring GO, 3rd, Bourne WM, Edelhauser HF, Kenyon KR. 1982. The corneal endothelium. Normal and pathologic structure and function. Ophthalmology 89:531-590. Waring GO, 3rd, Rodrigues MM, Laibson PR. 1978. Corneal dystrophies. I. Dystrophies of the epithelium, Bowman's layer and stroma. Surv Ophthalmol 23:71-122. Watany MM, El-Horany HE. 2018. Nephronectin (NPNT) and the prediction of nephrotic syndrome response to steroid treatment. Eur J Hum Genet.

136

Wurdak H, Ittner LM, Lang KS, Leveen P, Suter U, Fischer JA, Karlsson S, Born W, Sommer L. 2005. Inactivation of TGFbeta signaling in neural crest stem cells leads to multiple defects reminiscent of DiGeorge syndrome. Genes Dev 19:530- 535. Yamaguchi Y, Mann DM, Ruoslahti E. 1990. Negative regulation of transforming growth factor-beta by the proteoglycan decorin. Nature 346:281-284. Yamanaka H, Moriguchi T, Masuyama N, Kusakabe M, Hanafusa H, Takada R, Takada S, Nishida E. 2002. JNK functions in the non-canonical Wnt pathway to regulate convergent extension movements in vertebrates. EMBO Rep 3:69-75. Yazdanpanah G, Jabbehdari S, Djalilian AR. 2017. Limbal and corneal epithelial homeostasis. Curr Opin Ophthalmol 28:348-354. Yokoyama M, Narita T, Sakurai H, Katsumata-Kato O, Sugiya H, Fujita-Yoshigaki J. 2017. Maintenance of claudin-3 expression and the barrier functions of intercellular junctions in parotid acinar cells via the inhibition of Src signaling. Arch Oral Biol 81:141-150. Yue B. 2014. Biology of the extracellular matrix: an overview. J Glaucoma 23:S20-23. Zamore PD, Tuschl T, Sharp PA, Bartel DP. 2000. RNAi: double-stranded RNA directs the ATP-dependent cleavage of mRNA at 21 to 23 nucleotide intervals. Cell 101:25- 33. Zhang K, Pang K, Wu X. 2014. Isolation and transplantation of corneal endothelial cell- like cells derived from in-vitro-differentiated human embryonic stem cells. Stem Cells Dev 23:1340-1354. Zhao JJ, Afshari NA. 2016. Generation of Human Corneal Endothelial Cells via In Vitro Ocular Lineage Restriction of Pluripotent Stem Cells. Invest Ophthalmol Vis Sci 57:6878-6884. Zhao Q, Eberspaecher H, Lefebvre V, De Crombrugghe B. 1997. Parallel expression of Sox9 and Col2a1 in cells undergoing chondrogenesis. Dev Dyn: 209, 377–386. Zhao XC, Nakamura H, Subramanyam S, Stock LE, Gillette TE, Yoshikawa S, Ma X, Yee RW. 2007. Spontaneous and inheritable R555Q mutation in the TGFBI/BIGH3 gene in two unrelated families exhibiting Bowman's layer corneal dystrophy. Ophthalmology 114:e39-46. Zieske JD, Guimaraes SR, Hutcheon AE. 2001. Kinetics of keratocyte proliferation in response to epithelial debridement. Exp Eye Res 72:33-39. Zlotogora J, BenEzra D, Cohen T, Cohen E. 1990. Syndrome of brittle cornea, blue sclera, and joint hyperextensibility. Am J Med Genet 36:269-272.

137

Appendix A: Supplemental tables for RNA- seq experiment

Table A1 Top 20 differentially expressed transcription factors in En/pNC and KEn/pNC. Minus signs indicate downregulation. (Bi L and Lwigale P, 2019)

Log2FC Log2FC Gene ID Name (En/pNC) q-value Gene ID Name (KEn/pNC) q-value Upregulated Upregulated 101750712 ZNF750 9.86 2E-18 100857422 POU3F4 8.77 1E-121 418669 SHOX 8.22 2E-224 100858556 DMRT2 7.09 2E-135 396546 HMX1 8.03 2E-19 426886 TWIST3 6.69 5E-142 396346 SOHO-1 7.85 5E-20 418669 SHOX 6.67 5E-128 100858556 DMRT2 7.59 3E-160 101748749 ZNF469 6.12 6E-108 419863 IRF6 6.99 2E-30 101750712 ZNF750 5.46 7E-05 395943 PAX6 6.69 4E-14 107051987 POU3F3 5.29 3E-36 100857422 POU3F4 5.65 2E-58 396158 MYBL1 5.28 2E-226 424652 GLIS1 5.34 1E-167 395405 TWIST2 5.12 0 777244 SHOX2 5.30 1E-91 396346 SOHO-1 4.86 1E-08 395714 BARX2 4.69 9E-19 423315 NPAS3 4.56 2E-156 101748749 ZNF469 4.66 3E-71 777244 SHOX2 4.34 2E-58 395590 DLX3 4.53 6E-19 373990 TBX2 4.10 1E-240 421416 FOSL2 4.45 6E-61 768789 FOXE1 4.08 1E-43 374101 SCX 4.05 2E-194 100859610 CREB3L1 3.86 2E-120 429506 GRHL2 3.98 3E-22 396210 NFIA 3.79 3E-159 373990 TBX2 3.97 8E-228 419631 TFAP2E 3.61 3E-82 428651 GRHL1 3.71 3E-41 395713 TFAP2B 3.50 2E-240 423923 EMX2 3.64 9E-114 427171 PIK3R1 3.44 3E-113 419631 TFAP2E 3.42 1E-74 374101 SCX 3.41 1E-139 Downregulated Downregulate 418313 TBX15 -10.53 7E-38 418313 TBX15 -10.53 2E-41 373932 NKX3-2 -8.69 6E-65 107053847 DLX2 -10.44 5E-65 396383 ISL1 -7.84 2E-15 428534 SOX17 -10.25 4E-37 396391 GATA5 -7.35 8E-12 419106 GATA3 -9.68 6E-123 396129 SIM1 -7.33 2E-30 724086 SIX2 -9.55 3E-137 396109 FOXD1 -7.00 2E-119 428021 ZIC2 -9.30 4E-94 419106 GATA3 -6.89 2E-100 395573 SOX10 -8.93 5E-147 503512 FOXL2 -6.75 1E-90 396109 FOXD1 -8.18 1E-138 395752 NKX6-1 -6.60 9E-50 395191 OTX2 -7.86 2E-19 395176 EBF2 -6.12 5E-72 395633 MYF5 -7.81 4E-16 395794 FOXD3 -5.98 3E-49 395794 FOXD3 -7.69 1E-61 374137 MEOX2 -5.93 2E-36 421786 LIN28B -7.65 0 374127 PAX3 -5.74 2E-81 374127 PAX3 -7.46 7E-103 107053847 DLX2 -5.68 3E-47 503512 FOXL2 -7.46 4E-102 395795 FOXD2 -5.57 5E-133 396391 GATA5 -7.35 1E-13 419388 PRDM16 -5.56 7E-155 395752 NKX6-1 -7.19 5E-57 100857760 FOXF2 -5.54 5E-100 395596 EPAS1 -7.05 8E-174 395961 NR5A2 -5.42 5E-25 373932 NKX3-2 -6.98 8E-67 724086 SIX2 -5.35 4E-94 395977 GFI1B -6.97 1E-25 428021 ZIC2 -4.68 4E-57 374137 MEOX2 -6.93 8E-44

138

Table A2 Differential expression of corneal endothelium related genes in En/pNC and KEn/pNC. Data are arranged to show the top 5 (or all) upregulated and downregulated genes in each category. Bold values indicate differentially expressed genes between the two groups. Minus signs indicate downregulation. Genes labeled in * are chosen from Chng et al., 2013. (Bi L and Lwigale P, 2019)

Log2FC Log2FC Gene ID Name (En/pNC) q-value (KEn/pNC) q-value Membrane transporters 420384 AQP1 9.24 0 10.34 0 420606 ABCB5 8.04 8E-114 7.12 5E-89 417849 BEST3 7.29 4E-34 6.78 1E-27 776258 SLC35F4 6.21 4E-60 7.21 1E-91 769904 FAM26E 5.65 3E-167 7.19 2E-268 395443 SLC1A3 -5.16 7E-135 -4.38 7E-121 428653 KCNS3 -4.43 2E-11 -4.76 7E-14 396532 SLC4A1 -4.34 1E-19 -7.32 5E-35 770954 KCNK2 -4.26 1E-70 -5.07 1E-90 414871 KCNH6 -3.27 4E-29 -0.78 0.0012 Cell polarity 378897 THY1 3.70 6E-180 4.87 1E-293 Tight junction 395144 CLDN4 7.16 6E-20 2.57 0.0308 374029 CLDN3 5.76 1E-18 0.72 0.3202 429506 GRHL2 3.98 3E-22 -0.13 0.8131 424910 CLDN1 3.00 1E-05 -1.79 0.0112 769245 CLDN19 2.93 1E-07 2.80 2E-07 420022 RAMP2 -3.27 2E-32 -5.47 3E-59 374028 CLDN5 -2.73 2E-29 -3.35 3E-41 396047 SNAI1 -1.61 9E-10 -0.85 0.0011 422858 PPP2R2C -1.38 6E-05 3.56 2E-54 420481 MPP7 -1.23 7E-18 -1.49 7E-26 Gap junction 374196 PDGFA 4.78 7E-35 3.18 5E-17 395771 GJB6 3.61 9E-11 0.53 0.4574 374128 PDGFB 1.93 9E-12 0.86 0.0035 395581 HTR2B 1.81 0.001 3.40 6E-11 408035 EGF 1.75 5E-04 -2.32 0.0024 430991 ADRB3 -3.71 3E-11 -3.08 1E-09 771678 GUCY1A2 -3.47 8E-26 -4.19 6E-35 396502 GJA5 -3.04 2E-11 -7.27 2E-35 404529 GJA4 -2.11 1E-12 -5.78 2E-43 422407 GUCY1A3 -2.08 1E-14 -5.46 2E-50 Adherens junction 414745 CDH2 3.31 1E-100 1.59 4E-27 414849 CDH13 3.14 0.444 3.61 2E-15 423718 CDH23 2.37 0.107 1.68 3E-10 419222 CDH4 1.90 9E-13 -0.45 5E-09 415797 CDH11 1.49 5E-36 0.01 1E-36 374068 CDH5 -8.37 4E-32 -4.73 3E-97 374007 CDH7 -6.90 9E-61 -1.72 1E-79 Expressed in adult corneal endothelium* 770869 MGARP 6.35 0 5.75 0 424391 MYOC 5.00 5E-23 1.07 0.0282 428221 COL8A2 3.12 2E-69 3.69 1E-92 396221 LDHA 1.88 2E-24 3.26 1E-65 418425 CD200 -3.08 3E-42 -4.47 3E-71 396092 ALCAM -2.00 1E-41 -1.57 5E-28 374110 PTGDS -1.44 0.009 -0.41 0.4664

139

Table A3 Differential expression of ECM related genes in En/pNC and KEn/pNC. Data are arranged to show the top 5 (or all) upregulated and downregulated genes in each category. Bold values indicate differentially expressed genes between the two groups. Minus signs indicate downregulation. (Bi L and Lwigale P, 2019)

Gene ID Name Log2FC q-value Log2FC q-value (En/pNC) (KEn/pNC) Collagens 428448 COL6A6 2.72 2E-17 11.03 0 396292 COL6A2 6.41 0 10.60 0 396000 COL6A1 4.51 8E-137 7.71 1E-306 416696 LOC416696 8.85 9E-29 7.14 4E-21 101747382 LOC101747382 4.86 6E-120 7.04 2E-218 107056318 LOC107056318 0.19 0.763 -4.18 3E-11 421873 COL19A1 0.16 0.7209 -3.16 9E-14 101751793 LOC101751793 -1.79 5E-13 -2.93 4E-29 422350 COL4A6 -0.11 0.5729 -2.03 2E-32 422348 COL4A5 0.00 0.9913 -1.60 2E-21 Glycoproteins 396387 NTN3 1.75 4E-07 6.03 7E-127 421471 VIT 10.87 5E-30 5.67 2E-11 422905 SPON2 3.62 4E-44 5.61 5E-96 424366 OLFML2B 5.59 0 5.41 0 414837 THBS2 2.97 7E-99 4.69 3E-215 419031 VWF -2.75 8E-25 -10.87 6E-102 395935 VTN -5.57 3E-35 -5.70 4E-39 417180 LAMC3 -3.01 4E-67 -5.70 2E-161 427850 RELN -2.02 5E-14 -5.26 4E-53 395531 NID1 -1.49 1E-48 -3.49 2E-212 Proteoglycans 374039 OGN 6.04 2E-295 8.13 0 373995 KERA 4.86 1E-160 6.42 1E-242 107056545 LOC107056545 4.55 1E-05 6.20 1E-08 417892 DCN 2.58 3E-33 4.25 4E-77 395798 ACAN 0.23 0.6479 3.46 5E-20 414143 LEPREL1 -3.90 7E-71 -6.99 1E-128 396475 HAPLN1 -2.51 8E-18 -6.31 1E-70 770863 GPC3 -1.29 3E-08 -4.51 8E-64 419184 SDC4 0.01 0.9846 -2.37 2E-16 Other ECM proteins 418637 EGFL6 4.31 8E-96 8.18 3E-307 422535 NPNT 0.65 0.0021 6.25 1E-151 418125 PTN 4.32 2E-290 5.52 0 421461 LTBP1 2.17 2E-76 3.21 3E-153 428888 LTBP2 2.23 1E-66 2.82 7E-104 395912 MGP 0.69 0.0939 -3.23 4E-10 Enzymes and Regulators 395850 MMP27 8.15 3E-158 9.07 8E-209 416291 ADAMTS2 0.82 0.0511 7.57 1E-120 769222 ADAMTS8 5.08 8E-271 4.54 8E-219 424447 COLGALT2 2.36 3E-44 4.28 3E-131 427971 ADAMTS5 5.14 1E-174 4.09 3E-112 422488 CSGALNACT1 -1.49 2E-08 -3.95 1E-34 423834 HPSE2 -3.12 2E-19 -1.42 2E-05

140

More detailed tables and original data can be visited at: https://doi.org/10.1002/dvdy.43

141

Appendix B: Supplemental Figures for NPNT Project

Figure B1 Knockdown of NPNT by NPkd1 in the chick cornea. (A, A’) In situ hybridization of control or knockdown E5 cornea. Blue arrows indicate NPNT-expressed lens and RPE. The expression level of NPNT in the lens epithelium and RPE is lower in the Npkd1 embryo compared to the control embryo. (B, B’) H&E staining of the E7 central cornea in control or Npkd1 embryos. Blue double-headed arrow indicates the thickness of the corneal stroma. The corneal stroma is thinner in the knockdown embryo.

142

Figure B2 Npnt is expressed and maintained in mouse adult cornea. (A) Npnt is express in the adult mouse corneal endothelium by in situ hybridization. (B) Npnt is localizes to the Descemet’s membrane (Dm) in the adult mouse corneal endothelium by immunostaining. (Justin Ma, unpublished)

Figure B3 NPNT is expressed in E19 wound healing chick corneal epithelium. The protocoal of corneal debridement experiment was developed by Ruda Cui. Briefly, E19 corneas were collected and wounded at the epithelium, then cultured with control non-wounded corneas in the complete media for 24 hours. Epithelial regions that are proximate to the wound healing regions were collected. RT-PCR was performed to check for expression of NPNT at 12, 18, 24 hours post wounding. The preliminary results confirmed that there is little or no expression of NPNT in the unwounded E19 corneal cornea. NPNT is upregulated 12 hours post-wound and lasted until 24 hour post-wounding. In the unwounded corneal epithelium that has been cultures under the same conditions, NPNT is not expressed.