Supplemental Material Placed on This Supplemental Material Which Has Been Supplied by the Author(S) J Med Genet

BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) J Med Genet

Supplement

Supplementary Table S1:

GENE MEAN GENE NAME OMIM SYMBOL COVERAGE CAKUT CAKUT ADTKD ADTKD aHUS/TMA aHUS/TMA TUBULOPATHIES TUBULOPATHIES Glomerulopathies Glomerulopathies Polycystic kidneys / Ciliopathies Ciliopathies / kidneys Polycystic METABOLIC DISORDERS AND OTHERS OTHERS AND DISORDERS METABOLIC

x x ACE angiotensin-I converting enzyme 106180 139 x ACTN4 actinin-4 604638 119

x ADAMTS13 von Willebrand cleaving protease 604134 154 x ADCY10 adenylate cyclase 10 605205 81

x x AGT angiotensinogen 106150 157 x x AGTR1 angiotensin II receptor, type 1 106165 131

x AGXT alanine-glyoxylate aminotransferase 604285 173 x AHI1 Abelson helper integration site 1 608894 100

x ALG13 asparagine-linked glycosylation 13 300776 232 x x ALG9 alpha-1,2-mannosyltransferase 606941 165

centrosome and basal body associated x ALMS1 606844 132 protein 1 x x APOA1 apolipoprotein A-1 107680 55

x APOE lipoprotein glomerulopathy 107741 77 x APOL1 apolipoprotein L-1 603743 98

x x APRT adenine phosphoribosyltransferase 102600 165 x ARHGAP24 Rho GTPase-Activation protein 24 610586 215

x ARL13B ADP-ribosylation factor-like 13B 608922 195 x x ARL6 ADP-ribosylation factor-like 6 608845 215

ATPase, H+ transporting, lysosomal V0, x ATP6V0A4 605239 90 subunit a4 ATPase, H+ transporting, lysosomal x x ATP6V1B1 192132 163 56/58, V1, subunit B1 x ATXN10 ataxin 10 611150 177 x x B2M beta2-microglobulin 109700 141

x B9D1 B9 protein domain 1 614144 145 x B9D2 B9 protein domain 2 611951 60

x BBS1 Bardet-Biedl syndrome 1 209901 118 chromosome 12 open reading frame x BBS10 610148 221 58 x BBS12 Bardet-Biedl syndrome 12 610683 177

x BBS2 Bardet-Biedl syndrome 2 606151 126 x BBS4 Bardet-Biedl syndrome 4 600374 110

x BBS5 Bardet-Biedl syndrome 5 603650 102 x BBS7 Bardet-Biedl syndrome 7 607590 181

x BBS9 parathyroid hormone-responsive B1 607968 92

x x BMP4 bone morphogenetic protein 4 112262 114 x BSND barttin 606412 87

x x C3 complement component 3 120700 140

Münch J, et al. J Med Genet 2021; 58:140–144. doi: 10.1136/jmedgenet-2019-106633 BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) J Med Genet

x C5ORF42 chromosome 5 open reading frame 42 614571 271 x CA2 carboanhydrase II 611492 187

x CASR calcium sensing receptor 601199 136 coiled-coil and C2 domain containing x CC2D2A 612013 146 2A x CD2AP CD2 associated potein 604241 124 x x CD46 membrane cofactor protein 120920 131

x CEP290 centrosomal protein 290kDa 610142 139 x CEP41 centrosomal protein 41 610523 104

x x CFB complement factor B 138470 123 x x CFH complement factor h 134370 155

x x CFHR1 complement factor h related protein 1 134371 199 x CFHR2 complement factor h related protein 2 600889 193

x CFHR3 complement factor h related protein 3 605336 193 x CFHR4 complement factor h related protein 4 605337 204

x CFHR5 complement factor h related protein 5 608593 128 x x CFI complement component I 217030 145

chromodomain helicase DNA binding x CHD1L 613039 166 protein 1-like x x CHRM3 muscarinic acetycholin receptro type 3 118494 219

x x CLCN5 H+/Cl- exchanging receptor 300008 207 x CLCNKB chloride channel, voltage sensitive Kb 602023 148

x CLDN16 claudin 16 603959 197 x CLDN19 claudin 19 610036 78

x COL4A1 collagen type 4 α1 120130 161 x COL4A3 120070 135 collagen type 4 α3 x COL4A4 collagen type 4 α4 120131 181 x COL4A5 303630 206 collagen type 4 α5 x COL4A6 collagen type 4 α6 303631 234 coenzyme Q2 4-hydroxybenzoate x COQ2 609825 188 polyprenyltransferase x COQ6 coenzyme Q6 monooxygenase 614647 154 x CTNS cystinosin 606272 94

x CUBN cubilin 602997 105 x x CUL3 cullin 3 603136 123

cytochrome P450, subfamily 11B, x CYP11B1 610613 139 polypeptide 1 cytochrome P450, family 17, subfamily x CYP17A1 609300 97 A, polypeptide 1 cytochrome P450, family 24, subfamily x x CYP24A1 126065 96 A, polypeptide 1 x DCDC2 doublecortin domain containing 2 605755 266

x DIS3L2 exoribonuclease 2 614184 137 x DMP1 dentin matrix acidic phosphoprotein 1 600980 140

x DYNC2H1 dynein, cytoplasmic 2, heavy chain 1 603297 106 ectonucleotide x x ENPP1 173335 122 pyrophosphatase/phosphodiesterase 1 x EYA1 eyes absent homolog 1 601653 126 x FAM20A pseudokinase FAM20A 611062 93

x x FGA fibrinogen alpha polypeptide 134820 155 x FGF20 fibroblast growth factor 20 605558 118

x x FGFR1 fibroblast growth factor receptor 1 136350 140 x FN1 fibronectin 1 135600 149

x FRAS1 extracellular matrix protein FRAS1 607830 176 FRAS1 related extracellular matrix x FREM1 608944 167 proteins 1

FRAS1 related extracellular matrix x FREM2 608945 122 proteins 2 x x GATA3 GAT binding protein 3 131320 89

x GLA alpha-galactosidase A 300644 181 x GLIS2 GLIS family zinc finger 2 608539 130

x x GPC3 glypican 3 300037 233 glyoxylate reductase/hydroxypyruvate x GRHPR 604296 161 reductase glutamate receptor interacting protein x GRIP1 604597 194 1 x x x HNF1B HNF1 homeobox B 189907 176

x HNF4A hepatocyte nuclear factor 4α 600281 97 x HOGA1 4-hydroxy-2-oxoglutarate aldolase 1 613597 175

hypoxanthine x HPRT1 308000 163 phosphoribosyltransferase 1 x HPSE2 inactive heparinase 2 613469 127

11-beta-hydroxysteroid dehydrogenase x HSD11B2 614232 191 type 2 x IFT122 intraflagellar transport 122 606045 217

x IFT140 intraflagellar transport 140 614620 139 x IFT43 intraflagellar transport 43 614068 112

x IFT80 intraflagellar transport 80 homolog 611177 138 inverted formin-2 (alt: HBEBP2-binding x INF2 610982 128 protein C) x INPP5E inositol polyphosphate-5-phosphatase 613037 67 x INVS inversin 243305 141

x IQCB1 IQ motif containing B1 609237 194 x ITGA3 integrin alpha 3 605025 126

x ITGB4 integrin beta 3 147557 141 x JAG1 jagged 1 601920 141

x KAL1 anosmin 1 300836 231 Kn motif and ankyrin repeat domain x KANK1 607704 123 containing proteins 1 ATP-sensitive inward rectifier x KCNJ1 600359 236 potassium channel 1 potassium channel inwardly rectifying, x x KCNJ5 600734 164 subfamily J, member 5 x KIF7 kinesin family member 7 611254 140 x x KLHL3 kelch-like 3 605775 122

x LAMB2 laminin beta 2 150325 132 x LMX1B LIM homebox transcription factor 1 602575 154 β low density lipoprotein receptor- x LRP4 604270 113 related portein x x LYZ lysozyme 153450 258

leucine zipper transcription factor like x LZTFL1 606568 157 1 membrane-associated guanylate x MAGI2 606382 100 kinase x MKKS McKusick-Kaufman syndrome 604896 121 x MKS1 Meckel syndrome, type 1 609883 105

methylmalonic aciduria (cobalamin x MMACHC deficiency) cblC type, with 609831 219 homocystinuria x MPV17 mitochondrial inner membrane protein 137960 107

x MUC1 mucin 1 158340 136 x MYH9 myosin heavy chain 9 160775 114

x MYO1E myosin 1E 601479 140 never in mitosis gene A-related kinase x NEK1 604588 114 1 never in mitosis gene A-related kinase x NEK8 609799 168 8 x NPHP1 nephrocystin-1 607100 120

x NPHP3 nephrocystin-3 608002 132 x NPHP4 nephroretinin 607215 140

x NPHS1 nephrin 602716 162 x NPHS2 podocin 604766 185

nuclear receptor subfamily 3 groub C x NR3C2 600983 144 member 2 x NXF5 nuclear RNA export factor 5 300319 191

inositol polyphosphate-5-phosphatase x x OCRL 300535 286 OCRL-1 x OFD1 oral-facial-digital syndrome 1 300170 262

x x PAX2 homo sapiens paired box 2 167409 126 decaprenyl-diphosphate synthase x PDSS2 610564 159 subunit2 phosphat-regulating endopeptidase x PHEX 300550 216 homolog x PKD1 polycystin 1 601313 143

x PKD2 polycystin 2 173910 98 polycystic kidney and hepatic disease 1 x PKHD1 606702 149 (fibrocystin) x PLCE1 phospholipase C epsilon 1 608414 120 receptor-type tyrosine-protein x PTPRO 600579 142 phosphatase 2 x REN renine 179820 122 proto-oncogene tyrosine-protein x x RET 164761 129 kinase receptor Ret x ROBO2 roundabout guidance receptor 2 602431 169 x RPGRIP1L RPGRIP1-like 610937 130

x SALL1 Sal-like protein 1 602218 199 x SCARB2 lysosome membrane protein 2 602257 140

sodium channel nonvoltage-gated 1, x x SCNN1B 600760 98 beta subunit sodium channel nonvoltage-gated 1, x x SCNN1G 600761 120 gamma subunit serologically defined colon cancer x SDCCAG8 613542 114 antigen 8 succinate dehydrogenase complex x SDHA 600857 145 subunit A succinate dehydrogenase complex x SDHAF2 613019 158 assembly factor 2 succinate dehydrogenase complex x x SDHB 185470 143 subunit B succinate dehydrogenase complex x SDHC 602413 307 subunit C succinate dehydrogenase complex x SDHD 602690 166 subunit D x SIX1 SIX homeobox 1, 2 and 5 601205 79 x SIX2 SIX homebox 2 604994 114

x SIX5 SIX homeobox 5 600963 194 x SLC12A1 solute carrier family 12, member 1 600839 81

x SLC12A3 solute carrier family 12, member 3 600968 148 x x SLC1A1 solute carrier family 1, member 1 133550 107

x SLC22A12 solute carrier family 22, member 12 607096 128 x SLC26A1 solute carrier family 26, member 1 610130 70

x x SLC2A2 solute carrier familiy 2, member 2 138160 117 x SLC2A9 solute carrier family 2, member 9 606142 171

x x SLC34A1 solute carrier family 34, member 1 182309 134 x SLC34A3 solute carrier family 34, member 3 609826 110

x x SLC3A1 solute carrier family 3, member 1 104614 93 solute carrier family 4, anion x x SLC4A1 109270 118 exchanger, member 1 x SLC4A4 solute carrier family 4, member 4 603345 171 x x SLC5A2 solute carrier family 5, member 2 182381 118

x SLC7A7 solute carrier family 7, member 7 603593 156 x SLC7A9 solute carrier family 7, member 9 604144 120

solute carrier family 9, member 3, x SLC9A3R1 604990 140 receptor 1 SWI/SNF related, matrix associated, x SMARCAL1 actin dependent regulator of 606622 109

chromatin, subfamily a like 1 x SOX17 transcription factor for SOX17 610928 60 x TCTN1 tectonic family member 1 609863 88

x TCTN2 tectonic family member 2 613846 106 x x THBD thrombomodulin 188040 86

x TMEM138 transmembrane protein 138 614459 156 x TMEM216 transmembrane protein 216 613277 183

x TMEM237 transmembrane protein 237 614423 152 x TMEM67 transmembrane protein 67 609884 160

x TNXB tenascin XB 600985 153 TNF receptor-associated factor 3- x TRAF3IP1 607380 125 interacting x X TRIM32 tripartite motif containing 32 602290 270 transient receptor potential cation x TRPC6 603652 120 channel, subfamily C, member 6 x TSC1 tuberous sclerosis complex 1 605284 112 x TSC2 tuberous sclerosis complex 2 191092 111

x TTC21B tetratricopeptide repeat domain 21B 612014 125 x x TTC8 tetratricopeptide repeat domain 8 608132 116

x x x UMOD uromodulin 191845 130 x UPK3A uroplakin 3A 611559 180

x VDR vitamin D receptor 601769 159 x VHL von Hippel-Lindau 608537 52 WD repeat containing planar cell x WDPCP 613580 130 polarity effector x WDR19 WD repeat domain 19 608151 167 x WDR35 WD repeat domain 35 613602 193

x x WNK1 protein kinase lysine-deficient 1 605232 169 x x WNK4 protein kinase lysine-deficient 4 601844 107

x WNT4 protein WNT-4 603490 120 x WT1 wilms tumor 1 607102 127

x XDH xanthine dehydrogenase 607633 131 x XPNPEP3 X-prolyl aminopeptidase 3 613553 257

Supplementary Table S1: Detailed list of covered genes with gene code, associated OMIM number, and mean coverage per gene. Abbreviations: ADTKD, autosomal dominant tubulointerstitial kidney disease; aHUS, atypical hemolytic-uremic syndrome; CAKUT, congenital anomalies of the kidney and urinary tract; TMA, thrombotic microangiopathy.

Supplementary Figure S1:

B A Wt1 -KTS Wt1(-KTS)Wt1 +KTS 5 Wt1(+KTS) 8 2

*** 0 4 2

2-5 2 **

-10 1 2 rel. mRNA level vs. actin vs. level rel. mRNA rel. mRNA level vs. actin vs. level rel. mRNA -15 0.5 2 s s i O i o mis M o m M S S M S T m T S T S K S K T K T + T + K + +K K + 1 1 t11+ t11 T T WT T W W W W W Supplementary Figure S1: Knockdown of Wt1(+KTS) was verified by quantitative PCR on cDNA of embryonic murine organ cultures by using specific reverse primers for the Wt1(-KTS) (A) and Wt1(+KTS) (B) isoforms. Knockdown of Wt1(+KTS) results in significantly increased mRNA levels of Wt1(-KTS) mRNA (A) whereas mRNA levels of Wt1(+KTS) are decreased (B).

Supplementary Figure S2:

A B n=6 n.s. n.s. 10 n.s. n=5 10

8 8

6 6

4 4 dCt (Pkd1-Actin) dCt (Pkd1-Actin) 2 2

0 0 l ) ) A A o S S N N tr T T R n i iR o -K K s s c ( (+ 1 g 1 1 T n 1 T T ti T W W e W g dW + + r 5 1 a T 1 -t 1 T n M W W o d d n 5 5 1 1 M M C D Wt1 knockout (clone #1) Wt1 knockout (clone #2) 2.5 2.5

2.0 2.0

1.5 1.5

1.0 1.0

0.5 0.5 rel. mRNA level vs. actin vs. level rel. mRNA rel. mRNA level vs. actin vs. level rel. mRNA 0.0 0.0

control control

WT1(-KTS) WT1(+KTS) WT1(-KTS) WT1(+KTS) empty vector empty vector

Supplementary Figure S2: (A) In Wt1 containing M15 cells derived from mouse mesonephros, Wt1 knockdown with short inhibitory RNA did not affect Pkd1 mRNA expression compared to control (non-targeting siRNA). (B) Likewise, overexpression of the Wt1(+KTS) and Wt1(-KTS) isoforms did not significantly change Pkd1 transcript levels in M15 cells with targeted deletion of Wt1 by Crispr/Cas9 genome editing. (C, D) In two independent M15 clones with CRISPR/Cas9-induced Wt1 knockout, Pkd1 expression was measured in comparison to M15 cells with normal Wt1 levels. Furthermore, M15 cells with Wt1 knockout were transfected with expression constructs encoding the WT1(-KTS) and WT1(+KTS) isoforms, respectively. Pkd1 mRNA levels in these cells were measured by RT-qPCR. In these clones Pkd1 expression was not significantly decreased (C, n=4; D n=6). For statistical analysis, we used ANOVA with Tukey post-hoc test.

Supplementary Materials & Methods

CRISPR/Cas9 genome editing of murine mesonephros-derived M15 cells Crispr/Cas9 genome editing was applied to abolish WT1 expression in M15 cells, which are derived from the murine mesonephros.1 The target sequence was located immediately downstream of the ATG start codon in the Wt1 gene. The oligonucleotides for the guide RNA (CACCGACAGCACGGTCACTTTCGAC) were annealed and ligated into the BpiI restriction site of the pSpCas9(BB)-2A-GFP (PX458) plasmid (Addgene). M15 cells were grown in DMEM/Ham’s F-12 (1:1) nutrient with stable L-glutamine (PAA Laboratories, Pasching, Austria) supplemented with 10% FCS (Sigma, Germany). At approximately 50% confluence, the cells were transfected with either the targeting construct or the empty pSpCas9(BB)-2A-GFP (PX458) vector as control using the Fugene6® reagent (Promega). Two days after transfection, the cells were sorted as single cells into 96 well plates by FACS. Knockout of Wt1 was confirmed by WT1 immunoblotting and Sanger sequencing of genomic DNA. M15 cells with deleted Wt1 gene (M15delWt1) were transiently transfected with expression constructs for the Wt1(-KTS) and Wt1(+KTS) isoforms, respectively, using the Fugene6® reagent according to the supplier’s protocol (Promega), selected for 1 week with puromycin (3 µg/µl) and subsequently analyzed by immunoblotting of WT1.

RNA isolation and reverse transcription (RT) quantitative PCR Total RNA was isolated from different cell lines with the TRIzol LS reagent (Thermo Fisher Scientific). First-strand cDNA synthesis and real-time PCR were carried out with the SYBR Green Master mix (Roche) on the StepOnePlus™system (Life Technologies, Thermo Fisher Scientific) as described previously. 2 The PCR primers had the following sequences: mPkd1 (ENSMUST00000035565.4): GCAAAATGGAG- CCAGCCAG (fwd), GAGAGCTTGAAGATGGCAGC (rev); mβ-Actin (ENSMUST00000100497): CCGCGAGCACAGCTTCT (fwd), GGGTACTTCAGGGT- CAGGAT (rev).

Ex vivo culture of murine embryonic kidney explants All procedures were performed according to the Animal Protection Law guidelines and approved by the legal authorities represented by the Landesamt für Gesundheit und Soziales Berlin (permit no. T0308/12). Kidneys were removed from mouse embryos (E12.5) and cultured ex vivo as described in detail previously.2 The following antisense vivo-morpholino was used at a concentration of 10 µM for selective knockdown of the Wt1(+KTS) isoform: 5- AACGTGAAGAAAAGTTTACGCACT (Gene Tools, Pilomath, OR, USA). The sequence of the corresponding mismatch vivo-morpholino was: 5’- AACGAGAACAAAACTTTAGGCTCT. Incubation of the embryonic kidney explants with vivo-morpholinos was performed as reported elsewhere.2 The knockdown was verified by quantitative PCR on cDNA of the organ cultures by using specific reverse primers for the Wt1(-KTS) and Wt1(+KTS) isoforms (GAAGGGCTTTTCACCTGTAT and AAGGGCTTTTCACTTGTTTT, respectively). The forward primer was the same for both isoforms (ACTCTTGTCCGGTCAGCATC). (Supplementary Figure S1)

SUPPLEMENTARY REFERENCES: 1 Larsson SH, Charlieu JP, Miyagawa K, Engelkamp D, Rassoulzadegan M, Ross A, Cuzin F, van Heyningen V, Hastie ND. Subnuclear localization of WT1 in splicing or transcription factor domains is regulated by alternative splicing. Cell 1995; 81: 391–401. 2 Jacobi CLJ, Rudigier LJ, Scholz H, Kirschner KM. Transcriptional regulation by the Wilms tumor protein, Wt1, suggests a role of the metalloproteinase Adamts16 in murine genitourinary development. J Biol Chem 2013; 288: 18811– 24.

Münch J, et al. J Med Genet 2021; 58:140–144. doi: 10.1136/jmedgenet-2019-106633