DOCSLIB.ORG

Transcriptomic Changes Throughout Post-Hatch Development in Gallus Gallus Pituitary

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Transcriptomic Changes Throughout Post-Hatch Development in Gallus Gallus Pituitary 58:1 E M PRITCHETT and others Chicken pituitary transcriptome 58: 1 43–55 Research Open Access Transcriptomic changes throughout post-hatch development in Gallus gallus pituitary Correspondence 1 2 1 Elizabeth M Pritchett , Susan J Lamont and Carl J Schmidt should be addressed 1Animal and Food Science, University of Delaware, Newark, Delaware, USA to E M Pritchett 2Animal Science, Iowa State University, Ames, Iowa, USA Email [email protected] Abstract The pituitary gland is a neuroendocrine organ that works closely with the hypothalamus to affect multiple processes within the body including the stress response, metabolism, Key Words growth and immune function. Relative tissue expression (rEx) is a transcriptome analysis f chicken method that compares the genes expressed in a particular tissue to the genes expressed f pituitary in all other tissues with available data. Using rEx, the aim of this study was to identify f gene expression genes that are uniquely or more abundantly expressed in the pituitary when compared f development to all other collected chicken tissues. We applied rEx to define genes enriched in the chicken pituitaries at days 21, 22 and 42 post-hatch. rEx analysis identified 25 genes shared between all time points, 295 genes shared between days 21 and 22 and 407 genes unique to day 42. The 25 genes shared by all time points are involved in morphogenesis and general nervous tissue development. The 295 shared genes between days 21 and 22 are involved in neurogenesis and nervous system development and differentiation. Journal of Molecular Endocrinology The 407 unique day 42 genes are involved in pituitary development, endocrine system development and other hormonally related gene ontology terms. Overall, rEx analysis indicates a focus on nervous system/tissue development at days 21 and 22. By day 42, in addition to nervous tissue development, there is expression of genes involved in the endocrine system, possibly for maturation and preparation for reproduction. This study defines the transcriptome of the chicken pituitary gland and aids in understanding the Journal of Molecular expressed genes critical to its function and maturation. Endocrinology (2017) 58, 43–55 Introduction The avian pituitary gland is a neuroendocrine organ that (i.e. adrenocorticotropic hormone (ACTH)). The posterior works closely with the hypothalamus to regulate multiple pituitary gland, or the neurohypophysis, is composed processes within the body including the stress response, of nervous tissue and is connected to the hypothalamus reproduction, metabolism, growth and immune function. via the median eminence. Neurosecretory terminals The hypothalamus receives neuronal and endocrine within the posterior pituitary store and release arginine, signals from the brain and body and synthesizes releasing vasotocin (AVT) and mesotocin that are synthesized in hormones that are sent to the pituitary gland to either the supraoptic nucleus and paraventricular nucleus of inhibit or stimulate the production of several hormones the hypothalamus, respectively. Releasing hormones that will directly affect other tissues (i.e. growth hormone synthesized by the hypothalamus are transported to the (GH)) or stimulate the release of further protein products anterior pituitary gland through the hypophyseal blood http://jme.endocrinology-journals.org © 2017 The authors This work is licensed under a Creative Commons DOI: 10.1530/JME-16-0186 Published by Bioscientifica Ltd. Attribution 3.0 Unported License. Printed in Great Britain Downloaded from Bioscientifica.com at 09/28/2021 10:49:08PM via free access 10.1530/JME-16-0186 Research E M PRITCHETT and others Chicken pituitary transcriptome 58:1 44 portal system and regulate the production and release of Total RNA quantity was measured using a Qubit various endocrine hormones (ACTH, GH, LH, FSH and Fluorometer, and quality was assessed by fragment TSH). Relative tissue expression analysis (rEx) was used analysis. A total of 15 pituitary glands from day 21, 10 to compare the chicken pituitary gland transcriptome to from day 22 and 10 from day 42 were used for individual the transcriptome of all other tissues our laboratory has Rnaseq library preparation using the Illumina Stranded analyzed in the broiler chicken across three time points: RNAseq kit (San Diego, CA, USA). All 35 samples were days 21, 22 and 42 post-hatch. Previous work focusing on sequenced at the Delaware Biotechnology Institute (DBI) the morphometric changes of broiler chickens post-hatch Sequencing and Genotyping center using the Illumina identified two distinct growth periods: one from day of HiSeq 2500 sequencer. All libraries were sequenced to a hatch through day 14, and one from day 14 to day 42 or depth of 20–30 million reads per library. The reads were typical market age (Schmidt et al. 2009). The days discussed aligned to the Gallus gallus, ver 4 genome sequence, fall into the second growth phase. These days were also identified and counted using software packages Bowtie, chosen as part of a larger heat stress study conducted in Tophat and Cufflinks, and expression levels were reported our laboratory. The pituitary gland is a complex tissue in as fragments per kilobase of gene per million mapped reads that it contains many different cell types, and signals are (FPKM) values for further analysis (Trapnell et al. 2009, sent through neural endocrine, paracrine and autocrine Langmead & Salzberg 2012). Three biological replicates networks. The messages received by the pituitary gland for each day (day 21, 22 and 42) were used for cDNA lead to many changes within the tissue and results in synthesis using the SuperScript First-Strand Synthesis tissue plasticity. The results of this analysis identify the System for RT-PCR (Invitrogen). cDNA concentration expression levels of genes in the pituitary gland that are was determined using the Qubit Fluorometer and diluted either more abundant or are unique to this particular to 30 ng/µL for PCR. qRT-PCR was performed using Fast tissue at specific points in development. These data confer SYBR green master mix (Applied Biosystems) on the a better understanding of the genes and pathways that are Applied Biosystems 7500 Fast Real-Time PCR system critical to the function of the pituitary gland. for the following genes: glycoprotein alpha subunit (CGA), follicle-stimulating hormone beta (FSHB), growth hormone (GH), proopiomelanocortin (POMC), prolactin Materials and methods (PRL) and thyroid-stimulating hormone beta (TSHB). Each Animal housing and tissue collection qRT-PCR (Table 1) was performed in triplicate, and analysis was completed using the delta Ct method. All sequencing Journal of Molecular Endocrinology Male Ross 708 broiler chickens (Gallus gallus) were data generated in the current project have been uploaded obtained on the day of hatch from Mountaire Hatchery in the NCBI Gene Expression Omnibus application and (Millsboro, DE, USA) and placed in large-colony houses are accessible through GEO series, accession number on the University of Delaware farm (Newark, DE, USA). GSE89297. Husbandry and management followed all standards and procedures as approved by the Animal Care and Use Committee (AACUC #(27) 03-12-14R). Standard broiler Relative tissue expression analysis feed (corn-soy), which met all NRC requirements (National Research Council 1994), and water were supplied, and The gene expression of the pituitary gland was compared animals had ad libitum access throughout the trial. Birds to the expression of other tissues (abdominal fat pad, were humanely killed and the pituitaries were collected heart fat pad, breast muscle, cerebellum, heart, liver, on 21, 22 and 42 days post-hatch as part of a larger study. duodenum, jejunum, ileum, spleen, retina, pineal and Whole pituitaries were placed into liquid nitrogen and hypothalamus) analyzed by our laboratory following the stored at −80°C until further analysis. relative tissue expression (rEx) protocol outlined by Bailey and coworkers (Bailey et al. 2009). Each day the expression was analyzed independently, and maximum FPKM values RNA isolation, cDNA synthesis, Rnaseq library for each gene in the pituitary gland were compared to the preparation and qRT-PCR validation median FPKM value of each gene in all other collected tissues with the following calculation: Total RNA was extracted from whole pituitary glands (8–20 mg depending on age) from individual birds using Maximum FPKMfor each genein pituitary gland log (1) the Qiagen RNeasy Mini Kit (Germantown, MD, USA). 2 Median FPKMfor eachhgeneinall othercollected tissues http://jme.endocrinology-journals.org © 2017 Society for Endocrinology Published by Bioscientifica Ltd. DOI: 10.1530/JME-16-0186 Printed in Great Britain Downloaded from Bioscientifica.com at 09/28/2021 10:49:08PM via free access Research E M PRITCHETT and others Chicken pituitary transcriptome 58:1 45 Table 1 Primer sequences used for qRT-PCR transcriptome validation. Gene Forward primer Reverse primer CGA 5′ GCAACGTGCTGTGTAGCAAAG 3′ 5′ TGGTTCTCTATCTTCACATTGCCTT 3′ FSHB 5′ CGTACAGGGTAGAGCCAACGA 3′ 5′ GGCCCTCAAAAGGCTGAAC 3′ GH 5′ GCTTCAAGAAGGATCTGCACAA 3′ 5′ GCGCCGGCACTTCATC 3′ POMC 5′ GCTACGGCGGCTTCATGA 3′ 5′ CGATGACGTTTTTGAACAGA 3′ PRL 5′ TTGGGCGGGTTCATTCTG 3′ 5′ GGCCGTCCCAGTGAGAGTAA 3′ TSHB 5′ TGGCCATCAACACCACCAT 3′ 5′ CGTTGCTGTCCCGTGTCA 3′ Primer sequences used in qRT-PCR validation of transcriptomic data comparing expression levels between days 21, 22 and 42. Alpha subunit of glycoproteins (CGA), follicle-stimulating hormone,
Load more

Recommended publications
  • Selective Estrogen Receptor Modulators: Discrimination of Agonistic Versus Antagonistic Activities by Gene Expression Profiling in Breast Cancer Cells
    [CANCER RESEARCH 64, 1522–1533, February 15, 2004] Selective Estrogen Receptor Modulators: Discrimination of Agonistic versus Antagonistic Activities by Gene Expression Profiling in Breast Cancer Cells Jonna Frasor,1 Fabio Stossi,1 Jeanne M. Danes,1 Barry Komm,2 C. Richard Lyttle,2 and Benita S. Katzenellenbogen1 1Department of Molecular and Integrative Physiology, University of Illinois and College of Medicine, Urbana, Illinois, and 2Women’s Health Research Institute, Wyeth Research, Collegeville, Pennsylvania ABSTRACT tures in these women; however, some detrimental side effects such as an increased risk of endometrial cancer, stroke, and pulmonary embolism Selective estrogen receptor modulators (SERMs) such as tamoxifen are were also associated with tamoxifen treatment (7). Ral was examined in effective in the treatment of many estrogen receptor-positive breast cancers the Multiple Outcomes of Raloxifene Evaluation trial and found to be and have also proven to be effective in the prevention of breast cancer in women at high risk for the disease. The comparative abilities of tamoxifen effective in reducing the incidence of osteoporosis in postmenopausal versus raloxifene in breast cancer prevention are currently being compared in women, as well as the incidence of breast cancer but, unlike tamoxifen, the Study of Tamoxifen and Raloxifene trial. To better understand the actions without the increased risk of endometrial cancer (8, 9). On the basis of the of these compounds in breast cancer, we have examined their effects on the positive outcome of these trials, the Study of Tamoxifen and Raloxifene expression of ϳ12,000 genes, using Affymetrix GeneChip microarrays, with trial was begun in 1999 to directly compare the effects of these two quantitative PCR verification in many cases, categorizing their actions as SERMs, tamoxifen and Ral, in prevention of breast cancer (10, 11).
    [Show full text]
  • Single-Cell Sequencing of Human Ipsc-Derived Cerebellar Organoids Shows Recapitulation of Cerebellar Development
    bioRxiv preprint doi: https://doi.org/10.1101/2020.07.01.182196; this version posted July 1, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Single-cell sequencing of human iPSC-derived cerebellar organoids shows recapitulation of cerebellar development Samuel Nayler1*, Devika Agarwal3, Fabiola Curion2, Rory Bowden2,4, Esther B.E. Becker1,5* 1Department of Physiology, Anatomy and Genetics; University of Oxford; Oxford, OX1 3PT; United Kingdom 2Wellcome Centre for Human Genetics; University of Oxford; Oxford, OX3 7BN; United Kingdom 3Weatherall Institute for Molecular Medicine; University of Oxford; Oxford, OX3 7BN; United Kingdom 4Present address: Walter and Eliza Hall Institute of Medical Research, Parkville Victoria 3052; Australia 5Lead contact *Correspondence: [email protected], [email protected] Running title: hiPSC-derived cerebellar organoids 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.01.182196; this version posted July 1, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. ABSTRACT Current protocols for producing cerebellar neurons from human pluripotent stem cells (hPSCs) are reliant on animal co-culture and mostly exist as monolayers, which have limited capability to recapitulate the complex arrangement of the brain. We developed a method to differentiate hPSCs into cerebellar organoids that display hallmarks of in vivo cerebellar development. Single- cell profiling followed by comparison to an atlas of the developing murine cerebellum revealed transcriptionally-discrete populations encompassing all major cerebellar cell types.
    [Show full text]
  • Intrinsic Specificity of DNA Binding and Function of Class II Bhlh
    INTRINSIC SPECIFICITY OF BINDING AND REGULATORY FUNCTION OF CLASS II BHLH TRANSCRIPTION FACTORS APPROVED BY SUPERVISORY COMMITTEE Jane E. Johnson Ph.D. Helmut Kramer Ph.D. Genevieve Konopka Ph.D. Raymond MacDonald Ph.D. INTRINSIC SPECIFICITY OF BINDING AND REGULATORY FUNCTION OF CLASS II BHLH TRANSCRIPTION FACTORS by BRADFORD HARRIS CASEY DISSERTATION Presented to the Faculty of the Graduate School of Biomedical Sciences The University of Texas Southwestern Medical Center at Dallas In Partial Fulfillment of the Requirements For the Degree of DOCTOR OF PHILOSOPHY The University of Texas Southwestern Medical Center at Dallas Dallas, Texas December, 2016 DEDICATION This work is dedicated to my family, who have taught me pursue truth in all forms. To my grandparents for inspiring my curiosity, my parents for teaching me the value of a life in the service of others, my sisters for reminding me of the importance of patience, and to Rachel, who is both “the beautiful one”, and “the smart one”, and insists that I am clever and beautiful, too. Copyright by Bradford Harris Casey, 2016 All Rights Reserved INTRINSIC SPECIFICITY OF BINDING AND REGULATORY FUNCTION OF CLASS II BHLH TRANSCRIPTION FACTORS Publication No. Bradford Harris Casey The University of Texas Southwestern Medical Center at Dallas, 2016 Jane E. Johnson, Ph.D. PREFACE Embryonic development begins with a single cell, and gives rise to the many diverse cells which comprise the complex structures of the adult animal. Distinct cell fates require precise regulation to develop and maintain their functional characteristics. Transcription factors provide a mechanism to select tissue-specific programs of gene expression from the shared genome.
    [Show full text]
  • Entinostat Augments NK Cell Functions Via Epigenetic Upregulation of IFIT1-STING-STAT4 Pathway
    www.oncotarget.com Oncotarget, 2020, Vol. 11, (No. 20), pp: 1799-1815 Research Paper Entinostat augments NK cell functions via epigenetic upregulation of IFIT1-STING-STAT4 pathway John M. Idso1, Shunhua Lao1, Nathan J. Schloemer1,2, Jeffrey Knipstein2, Robert Burns3, Monica S. Thakar1,2,* and Subramaniam Malarkannan1,2,4,5,* 1Laboratory of Molecular Immunology and Immunotherapy, Blood Research Institute, Versiti, Milwaukee, WI, USA 2Division of Pediatric Hematology-Oncology-BMT, Department of Pediatrics, Medical College of Wisconsin, Milwaukee, WI, USA 3Bioinformatics Core, Blood Research Institute, Versiti, Milwaukee, WI, USA 4Divson of Hematology-Oncology, Department of Medicine, Medical College of Wisconsin, Milwaukee, WI, USA 5Department of Microbiology and Immunology, Medical College of Wisconsin, Milwaukee, WI, USA *Co-senior authors Correspondence to: Monica S. Thakar, email: [email protected] Subramaniam Malarkannan, email: [email protected] Keywords: NK cells; histone deacetylase inhibitor; Ewing sarcoma; rhabdomyosarcoma; immunotherapy Received: September 10, 2019 Accepted: March 03, 2020 Published: May 19, 2020 Copyright: Idso et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License 3.0 (CC BY 3.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT Histone deacetylase inhibitors (HDACi) are an emerging cancer therapy; however, their effect on natural killer (NK) cell-mediated anti-tumor responses remain unknown. Here, we evaluated the impact of a benzamide HDACi, entinostat, on human primary NK cells as well as tumor cell lines. Entinostat significantly upregulated the expression of NKG2D, an essential NK cell activating receptor. Independently, entinostat augmented the expression of ULBP1, HLA, and MICA/B on both rhabdomyosarcoma and Ewing sarcoma cell lines.
    [Show full text]
  • Transcription Factor IRF4 Drives Dendritic Cells to Promote Th2 Differentiation
    ARTICLE Received 30 May 2013 | Accepted 21 Nov 2013 | Published 20 Dec 2013 DOI: 10.1038/ncomms3990 Transcription factor IRF4 drives dendritic cells to promote Th2 differentiation Jesse W. Williams1, Melissa Y. Tjota2,3, Bryan S. Clay2, Bryan Vander Lugt4, Hozefa S. Bandukwala2, Cara L. Hrusch5, Donna C. Decker5, Kelly M. Blaine5, Bethany R. Fixsen5, Harinder Singh4, Roger Sciammas6 & Anne I. Sperling1,2,5 Atopic asthma is an inflammatory pulmonary disease associated with Th2 adaptive immune responses triggered by innocuous antigens. While dendritic cells (DCs) are known to shape the adaptive immune response, the mechanisms by which DCs promote Th2 differentiation remain elusive. Herein we demonstrate that Th2-promoting stimuli induce DC expression of IRF4. Mice with conditional deletion of Irf4 in DCs show a dramatic defect in Th2-type lung inflammation, yet retain the ability to elicit pulmonary Th1 antiviral responses. Using loss- and gain-of-function analysis, we demonstrate that Th2 differentiation is dependent on IRF4 expression in DCs. Finally, IRF4 directly targets and activates the Il-10 and Il-33 genes in DCs. Reconstitution with exogenous IL-10 and IL-33 recovers the ability of Irf4-deficient DCs to promote Th2 differentiation. These findings reveal a regulatory module in DCs by which IRF4 modulates IL-10 and IL-33 cytokine production to specifically promote Th2 differentiation and inflammation. 1 Committee on Molecular Pathogenesis and Molecular Medicine, University of Chicago, 924 E. 57th Street, Chicago, Illinois 60637 USA. 2 Committee on Immunology, University of Chicago, 924 E. 57th Street, Chicago, Illinois 60637 USA. 3 Medical Scientist Training Program, University of Chicago, 924 E.
    [Show full text]
  • Hes6 Inhibits Astrocyte Differentiation and Promotes Neurogenesis Through Different Mechanisms
    The Journal of Neuroscience, October 25, 2006 • 26(43):11061–11071 • 11061 Cellular/Molecular Hes6 Inhibits Astrocyte Differentiation and Promotes Neurogenesis through Different Mechanisms Sumit Jhas, Sorana Ciura,* Stephanie Belanger-Jasmin,* Zhifeng Dong, Estelle Llamosas, Francesca M. Theriault, Kerline Joachim, Yeman Tang, Lauren Liu, Jisheng Liu, and Stefano Stifani Center for Neuronal Survival, Montreal Neurological Institute, McGill University, Montreal, Quebec, Canada H3A 2B4 The mechanisms regulating the generation of cell diversity in the mammalian cerebral cortex are beginning to be elucidated. In that regard, Hairy/Enhancer of split (Hes) 1 and 5 are basic helix-loop-helix (bHLH) factors that inhibit the differentiation of pluripotent cortical progenitors into neurons. In contrast, a related Hes family member termed Hes6 promotes neurogenesis. It is shown here that knockdown of endogenous Hes6 causes supernumerary cortical progenitors to differentiate into cells that exhibit an astrocytic morphol- ogy and express the astrocyte marker protein GFAP. Conversely, exogenous Hes6 expression in cortical progenitors inhibits astrocyte differentiation. The negative effect of Hes6 on astrocyte differentiation is independent of its ability to promote neuronal differentiation. We also show that neither its proneuronal nor its anti-gliogenic functions appear to depend on Hes6 ability to bind to DNA via the basic arm of its bHLH domain. Both of these activities require Hes6 to be localized to nuclei, but only its anti-gliogenic function depends on two short peptides, LNHLL and WRPW, that are conserved in all Hes6 proteins. These findings suggest that Hes6 is an important regulator of the neurogenic phase of cortical development by promoting the neuronal fate while suppressing astrocyte differentiation.
    [Show full text]
  • Bioinformatic Analysis Reveals the Importance of Epithelial-Mesenchymal Transition in the Development of Endometriosis
    www.nature.com/scientificreports OPEN Bioinformatic analysis reveals the importance of epithelial- mesenchymal transition in the development of endometriosis Meihong Chen1,6, Yilu Zhou2,3,6, Hong Xu4, Charlotte Hill2, Rob M. Ewing2,3, Deming He1, Xiaoling Zhang1 ✉ & Yihua Wang2,3,5 ✉ Background: Endometriosis is a frequently occurring disease in women, which seriously afects their quality of life. However, its etiology and pathogenesis are still unclear. Methods: To identify key genes/ pathways involved in the pathogenesis of endometriosis, we recruited 3 raw microarray datasets (GSE11691, GSE7305, and GSE12768) from Gene Expression Omnibus database (GEO), which contain endometriosis tissues and normal endometrial tissues. We then performed in-depth bioinformatic analysis to determine diferentially expressed genes (DEGs), followed by gene ontology (GO), Hallmark pathway enrichment and protein-protein interaction (PPI) network analysis. The fndings were further validated by immunohistochemistry (IHC) staining in endometrial tissues from endometriosis or control patients. Results: We identifed 186 DEGs, of which 118 were up-regulated and 68 were down-regulated. The most enriched DEGs in GO functional analysis were mainly associated with cell adhesion, infammatory response, and extracellular exosome. We found that epithelial-mesenchymal transition (EMT) ranked frst in the Hallmark pathway enrichment. EMT may potentially be induced by infammatory cytokines such as CXCL12. IHC confrmed the down-regulation of E-cadherin (CDH1) and up-regulation of CXCL12 in endometriosis tissues. Conclusions: Utilizing bioinformatics and patient samples, we provide evidence of EMT in endometriosis. Elucidating the role of EMT will improve the understanding of the molecular mechanisms involved in the development of endometriosis. Endometriosis is a frequently occurring gynaecological disease characterised by chronic pelvic pain, dysmenor- rhea and infertility1.
    [Show full text]
  • Supplementary Table 1
    Supplementary Table 1. 492 genes are unique to 0 h post-heat timepoint. The name, p-value, fold change, location and family of each gene are indicated. Genes were filtered for an absolute value log2 ration 1.5 and a significance value of p ≤ 0.05. Symbol p-value Log Gene Name Location Family Ratio ABCA13 1.87E-02 3.292 ATP-binding cassette, sub-family unknown transporter A (ABC1), member 13 ABCB1 1.93E-02 −1.819 ATP-binding cassette, sub-family Plasma transporter B (MDR/TAP), member 1 Membrane ABCC3 2.83E-02 2.016 ATP-binding cassette, sub-family Plasma transporter C (CFTR/MRP), member 3 Membrane ABHD6 7.79E-03 −2.717 abhydrolase domain containing 6 Cytoplasm enzyme ACAT1 4.10E-02 3.009 acetyl-CoA acetyltransferase 1 Cytoplasm enzyme ACBD4 2.66E-03 1.722 acyl-CoA binding domain unknown other containing 4 ACSL5 1.86E-02 −2.876 acyl-CoA synthetase long-chain Cytoplasm enzyme family member 5 ADAM23 3.33E-02 −3.008 ADAM metallopeptidase domain Plasma peptidase 23 Membrane ADAM29 5.58E-03 3.463 ADAM metallopeptidase domain Plasma peptidase 29 Membrane ADAMTS17 2.67E-04 3.051 ADAM metallopeptidase with Extracellular other thrombospondin type 1 motif, 17 Space ADCYAP1R1 1.20E-02 1.848 adenylate cyclase activating Plasma G-protein polypeptide 1 (pituitary) receptor Membrane coupled type I receptor ADH6 (includes 4.02E-02 −1.845 alcohol dehydrogenase 6 (class Cytoplasm enzyme EG:130) V) AHSA2 1.54E-04 −1.6 AHA1, activator of heat shock unknown other 90kDa protein ATPase homolog 2 (yeast) AK5 3.32E-02 1.658 adenylate kinase 5 Cytoplasm kinase AK7
    [Show full text]
  • Cbx3 Maintains Lineage Specificity During Neural Differentiation
    Downloaded from genesdev.cshlp.org on September 27, 2021 - Published by Cold Spring Harbor Laboratory Press RESEARCH COMMUNICATION et al. 2013). However, Cbx3 is also enriched at promoters Cbx3 maintains lineage of mouse embryonic fibroblast (MEF)-derived pre-iPSCs specificity during neural (preinduced pluripotent stem cells), where it does not cor- relate with H3K9 methylation (Sridharan et al. 2013). differentiation RNAi knockdown of Cbx3 promotes reprogramming of fi- broblasts to iPSCs (Sridharan et al. 2013). Chengyang Huang,1,2 Trent Su,1 Yong Xue,1 1 3 1 Cbx3 plays important roles in developmental processes Chen Cheng, Fides D. Lay, Robin A. McKee, (Morikawa et al. 2013). In model systems, Cbx3 promotes Meiyang Li,2 Ajay Vashisht,1 James Wohlschlegel,1 neuronal maturation, kidney development, differentia- Bennett G. Novitch,4 Kathrin Plath,1 tion of ESCs to smooth muscle in culture, and embryonic Siavash K. Kurdistani,1 and Michael Carey1 arteriogenesis (Xiao et al. 2011; Dihazi et al. 2015; Oshiro et al. 2015). Little is known of how Cbx3 functions in dif- 1Department of Biological Chemistry, Eli and Edythe Broad ferentiation, but its promoter localization suggested that Center for Regenerative Medicine and Stem Cell Research, David it might directly affect transcription through the preinitia- Geffen School of Medicine, University of California at Los tion complex (PIC) (Grunberg and Hahn 2013; Allen and Angeles, Los Angeles California 90095, USA; 2Department of Taatjes 2015). The PIC is assembled in response to activa- Neurobiology, Shantou University Medical College, Shantou tors and requires the Mediator coactivator complex to re- 515041, China; 3Department of Molecular, Cell, and cruit the general transcription factors and Pol II (Chen Developmental Biology, University of California at Los Angeles, et al.
    [Show full text]
  • Novel IRF6 Mutations in Honduran Van Der Woude Syndrome Patients
    MOLECULAR MEDICINE REPORTS 4: 237-241, 2011 Novel IRF6 mutations in Honduran Van Der Woude syndrome patients ANDREW C. BIRKELAND1*, YUNA LARRABEE1*, DAVID T. KENT7, CARLOS FLORES8, GLORIA H. SU2,3, JOSEPH H. LEE4,6 and JOSEPH HADDAD Jr2,5 1Columbia University College of Physicians and Surgeons; Departments of 2Otolaryngology/Head and Neck Surgery, 3Pathology, 4Epidemiology and 5Pediatric Otolaryngology; 6Gertrude H Sergievsky Center and Taub Institute, Columbia University Medical Center, New York, NY; 7Department of Otolaryngology, University of Pittsburgh Medical Center, Pittsburgh, PA, USA; 8Department of Plastic Surgery, Hospital Escuela, University of Honduras, Tegucigalpa, Honduras Received October 26, 2010; Accepted December 29, 2010 DOI: 10.3892/mmr.2011.423 Abstract. Van der Woude syndrome (VWS) is an autosomal Introduction dominant inherited disease characterized by lower lip pits, cleft lip and/or cleft palate. Missense, nonsense and frameshift Cleft lip with or without cleft palate (CL/P) is a common mutations in IRF6 have been revealed to be responsible for congenital malformation, presenting in 1/500 to 1/2000 births, VWS in European, Asian, North American and Brazilian with increased prevalence in Hispanic, Native American populations. However, the mutations responsible for VWS and Chinese populations. CL/P occurs in non-syndromic or have not been studied in Central American populations. Here, syndromic forms, with non-syndromic forms constituting the we investigated the role of IRF6 in patients with VWS in a majority (~70%) of cases. Of the syndromic forms of CL/P, previously unstudied Honduran population. IRF6 mutations Van der Woude syndrome (VWS; OMIM 119300) is the most were identified in four out of five VWS families examined, common.
    [Show full text]
  • Taste Bud Formation Depends on Taste Nerves Di Fan1,2, Zoubida Chettouh1, G Giacomo Consalez3, Jean-Franc¸Ois Brunet1*
    SHORT REPORT Taste bud formation depends on taste nerves Di Fan1,2, Zoubida Chettouh1, G Giacomo Consalez3, Jean-Franc¸ois Brunet1* 1Institut de Biologie de l’ENS (IBENS), Inserm, CNRS, E´ cole normale supe´rieure, PSL Research University, Paris, France; 2School of Life Science, East China Normal University, Shanghai, China; 3San Raffaele Scientific Institute and Universita` Vita- Salute San Raffaele, Milano, Italy Abstract It has been known for more than a century that, in adult vertebrates, the maintenance of taste buds depends on their afferent nerves. However, the initial formation of taste buds is proposed to be nerve-independent in amphibians, and evidence to the contrary in mammals has been endlessly debated, mostly due to indirect and incomplete means to impede innervation during the protracted perinatal period of taste bud differentiation. Here, by genetically ablating, in mice, all somatic (i.e. touch) or visceral (i.e. taste) neurons for the oral cavity, we show that the latter but not the former are absolutely required for the proper formation of their target organs, the taste buds. DOI: https://doi.org/10.7554/eLife.49226.001 Introduction Taste buds are onion-shaped clusters of 60–100 taste receptors and support cells, embedded in epi- dermal papillae and distributed in a punctate pattern in the tongue and soft palate epithelia. They sense nutrients in the oral cavity and transmit taste information to the termini of sensory neurons, *For correspondence: through conventional (Finger et al., 2005) and non-conventional (Ma et al., 2018; Romanov et al., [email protected] 2018) synapses. Taste receptors and their support cells have a limited life span of 8 to 20 days depending on cell types (Perea-Martinez et al., 2013) and are constantly renewed from progenitors Competing interests: The situated outside (Okubo et al., 2009; Ohmoto et al., 2017; Perea-Martinez et al., 2013) and, for a authors declare that no competing interests exist.
    [Show full text]
  • ACE2 and FURIN Supplemental Figure S1
    ACE2 and FURIN Supplemental Figure S1. Expression in human cells, tissues, and organs RNA-Seq Expression Data from GTEx (53 Tissues, 570 Donors) RNA-Seq Expression Data from GTEx (53 Tissues, 570 Donors) RNA-Seq Expression Data from GTEx (53 Tissues, 570 Donors) RNA-Seq Expression Data from GTEx (53 Tissues, 570 Donors) Jensen TISSUES ARCHS4 Human Tissues ACE2 and FURIN Supplemental Figure S2. Effects of viral challenges on expression Virus Perturbations from GEO up Profile: FURIN expression in peripheral blood mononuclear cells (PBMCs) GDS1028 / 201945_at Title Severe acute respiratory syndrome expression profile Organism Homo sapiens FURIN expression in peripheral blood mononuclear cells (PBMCs) p = 0.002 Sample Title Value GSM30361 N1 264.2 GSM30362 N2 241.7 GSM30363 N3 298.1 GSM30364 N4 268.5 GSM30365 S1 295.5 GSM30366 S2 464 GSM30367 S3 309.7 GSM30368 S4 564.1 GSM30369 S5 674.4 GSM30370 S6 588 GSM30371 S7 830.2 GSM30372 S8 818.8 GSM30373 S9 385.1 GSM30374 S10 771.2 ACE2 and FURIN Supplemental Figure S3. Effects of common human diseases on expression changes Distinct patterns of diseases associated with increased expression of the ACE2 and FURIN genes Disease Perturbations from GEO up Distinct patterns of diseases associated with expression changes of the ACE2 and FURIN genes DisGeNET Profile: ACE2 expression GDS4855 / 222257_s_at Title Pandemic and seasonal H1N1 influenza virus infections of bronchial epithelial cells in vitro Organism Homo sapiens Effects of pandemic and seasonal H1N1 influenza virus infections on ACE2 expression
    [Show full text]