DOCSLIB.ORG

Cbx3 Maintains Lineage Specificity During Neural Differentiation

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Cbx3 Maintains Lineage Specificity During Neural Differentiation Downloaded from genesdev.cshlp.org on September 27, 2021 - Published by Cold Spring Harbor Laboratory Press RESEARCH COMMUNICATION et al. 2013). However, Cbx3 is also enriched at promoters Cbx3 maintains lineage of mouse embryonic fibroblast (MEF)-derived pre-iPSCs specificity during neural (preinduced pluripotent stem cells), where it does not cor- relate with H3K9 methylation (Sridharan et al. 2013). differentiation RNAi knockdown of Cbx3 promotes reprogramming of fi- broblasts to iPSCs (Sridharan et al. 2013). Chengyang Huang,1,2 Trent Su,1 Yong Xue,1 1 3 1 Cbx3 plays important roles in developmental processes Chen Cheng, Fides D. Lay, Robin A. McKee, (Morikawa et al. 2013). In model systems, Cbx3 promotes Meiyang Li,2 Ajay Vashisht,1 James Wohlschlegel,1 neuronal maturation, kidney development, differentia- Bennett G. Novitch,4 Kathrin Plath,1 tion of ESCs to smooth muscle in culture, and embryonic Siavash K. Kurdistani,1 and Michael Carey1 arteriogenesis (Xiao et al. 2011; Dihazi et al. 2015; Oshiro et al. 2015). Little is known of how Cbx3 functions in dif- 1Department of Biological Chemistry, Eli and Edythe Broad ferentiation, but its promoter localization suggested that Center for Regenerative Medicine and Stem Cell Research, David it might directly affect transcription through the preinitia- Geffen School of Medicine, University of California at Los tion complex (PIC) (Grunberg and Hahn 2013; Allen and Angeles, Los Angeles California 90095, USA; 2Department of Taatjes 2015). The PIC is assembled in response to activa- Neurobiology, Shantou University Medical College, Shantou tors and requires the Mediator coactivator complex to re- 515041, China; 3Department of Molecular, Cell, and cruit the general transcription factors and Pol II (Chen Developmental Biology, University of California at Los Angeles, et al. 2012). Core Mediator contains 25 subunits constitut- Los Angeles, California 90095, USA; 4Department of ing three structurally distinct modules distributed into Neurobiology, Eli and Edythe Broad Center for Regenerative two major complexes: One bears Med26 and Pol II, and Medicine and Stem Cell Research, David Geffen School of the other bears a four-subunit Cdk8 module (Malik and Medicine, University of California at Los Angeles, Los Angeles Roeder 2010; Conaway and Conaway 2013; Tsai et al. California 90095, USA 2014; Allen and Taatjes 2015). The specific function of Med26 is not fully established, although it recruits the Chromobox homolog 3 (Cbx3/heterochromatin protein Pol II superelongation complex containing several ELL/ 1γ [HP1γ]) stimulates cell differentiation, but its mecha- EAF family members, whose misregulation has been asso- nism is unknown. We found that Cbx3 binds to gene pro- ciated with cancer (Takahashi et al. 2011; Zhou et al. moters upon differentiation of murine embryonic stem 2012). D. melanogaster HP1 interacts directly with cells (ESCs) to neural progenitor cells (NPCs) and recruits Med26 (Marr et al. 2014), and Cbx3 is enriched in Media- the Mediator subunit Med26. RNAi knockdown of either tor preparations from differentiated neural precursors Cbx3 or Med26 inhibits neural differentiation while up- (Sridharan et al. 2013). regulating genes involved in mesodermal lineage deci- The observation that Cbx3 enriches in ESC gene bodies and pre-iPSC promoters suggested that the switch in sions. Thus, Cbx3 and Med26 together ensure the fidelity distribution could influence gene regulation during differ- of lineage specification by enhancing the expression of entiation. To determine whether this is Cbx3’s mecha- neural genes and down-regulating genes specific to alter- nism of action, we used a model system in which ESCs native fates. were efficiently induced to differentiate into neural pre- Supplemental material is available for this article. cursor cells (NPCs) (Brustle et al. 1997). The positioning and role of Cbx3 were interrogated by chromatin immu- Received October 15, 2016; revised version accepted noprecipitation (ChIP) and RNAi. Our analysis revealed January 27, 2017. that Cbx3 and Med26 colocalize to promoters of both neu- ral and mesodermal genes during differentiation and have complementary roles in stabilizing NPC fate. Decreasing Chromobox homolog 3 (Cbx3) is a member of the hetero- Med26 or Cbx3 levels early in differentiation led to the chromatin protein 1 (HP1) family that binds to dimethy- down-regulation of neural lineage genes and up-regulation lated and trimethylated histone 3 Lys9 (H3K9) via a of mesodermal lineage genes. Increased binding of Cdk8 conserved chromodomain. Cbx3 (HP1γ) and its homologs, correlated with decreased mesodermal gene expression Cbx5 (HP1α) and Cbx1 (HP1β), have been implicated in during normal differentiation and decreased neural gene both the repression and activation of gene transcription expression upon Cbx3 depletion. (Kwon and Workman 2011; Canzio et al. 2014). In Droso- phila melanogaster, Cbx3 associates with both the his- tone chaperone FACT and RNA polymerase II (Pol II) Results and Discussion (Kwon et al. 2010). Cbx3 occupies the transcribed regions of genes in embryonic stem cells (ESCs) and cancer cell Cbx3 binds to gene promoters during differentiation lines, where it influences splicing and correlates with To address whether Cbx3 becomes enriched at promoters H3K9 methylation (Smallwood et al. 2012; Sridharan upon differentiation, we used ITSF medium to convert © 2017 Huang et al. This article is distributed exclusively by Cold Spring [Keywords: Cbx3; Med26; embryonic stem cell; neural precursor; Harbor Laboratory Press for the first six months after the full-issue publi- preinitiation complex; mesoderm] cation date (see http://genesdev.cshlp.org/site/misc/terms.xhtml). After Corresponding author: [email protected] six months, it is available under a Creative Commons License (At- Article is online at http://www.genesdev.org/cgi/doi/10.1101/gad.292169. tribution-NonCommercial 4.0 International), as described at http://creati- 116. vecommons.org/licenses/by-nc/4.0/. GENES & DEVELOPMENT 31:241–246 Published by Cold Spring Harbor Laboratory Press; ISSN 0890-9369/17; www.genesdev.org 241 Downloaded from genesdev.cshlp.org on September 27, 2021 - Published by Cold Spring Harbor Laboratory Press Huang et al. ESCs to NPCs and performed genome-wide ChIP-seq ates with gene activity, while its binding negatively corre- (ChIP combined with high-throughput sequencing) of lates with expression of genes involved in ESC growth. Cbx3 in NPCs. Differentiation was validated by im- munostaining for Oct4 in the ESCs and Nestin in the ESC-derived NPCs. Nestin-positive NPCs were able to Cbx3 knockdown decreases neural differentiation and differentiate into Tuj1+ neurons upon EGF and FGF2 with- up-regulates mesodermal genes drawal (Supplemental Fig. S1A). Statistical analyses of Cbx3 ChIP-seq peaks showed that To further explore the role of Cbx3 during differentiation, it reproducibly enriches at the promoters of genes in NPCs we used RNAi knockdown (Cbx3 knockdown) in either (Fig. 1A) and less so in gene bodies (Fig. 1B; Supplemental monolayer culture (Fig. 2A,B; Supplemental Fig. S2A)or Fig. S1B). This binding pattern is distinct from ESCs, embryoid body (EB) culture during neural differentiation where Cbx3 bound primarily within gene bodies (Srid- (Fig. 2C,D). In monolayer culture, Sox1, an early marker haran et al. 2013). Although enrichment of Pol II at the of neural fate, appeared in most cells by day 8 (Fig. 2A; promoter correlates roughly with that of Cbx3 in the cen- Pevny et al. 1998). Although the total cell number did ter of the distribution (Fig. 1A), there was only a modest not change significantly upon Cbx3 knockdown, the ex- correlation with gene expression when considering the pression of Sox1 significantly decreased (Fig. 2A,B). Anal- top, middle, and bottom Cbx3-bound genes (Fig. 1C). ysis of an earlier time point, day 7, revealed little Sox1 Therefore, Cbx3 enrichment at the promoter during expression in the control and virtually no effect of Cbx3 differentiation does not correlate with increased gene knockdown (Supplemental Fig. S2B,C). To confirm the expression. function of Cbx3, we used serum-free EBs (SFEBs), an We then investigated differentiation-regulated genes alternate system to analyze ESC neural differentiation, bound by Cbx3 at the promoter. Gene ontology (GO) and found a significant decrease in SFEBs upon Cbx3 analysis revealed that genes down-regulated during differ- knockdown (Fig. 2C,D; Watanabe et al. 2005; Huang entiation were required for cellular metabolism, a charac- et al. 2010). Collectively, these data suggest that Cbx3 teristic of rapidly growing self-renewing ESCs (Fig. 1D, top positively regulates neural fate determination. panels). In contrast, genes involved in nervous system de- To investigate the regulatory mechanisms of Cbx3 in velopment and neural differentiation were up-regulated differentiation, we performed genome-wide RNA se- (Fig. 1D, bottom panels), including signaling molecules quencing (RNA-seq) analysis on NPCs 3 d after siControl and transcription factors; i.e., Sox1 and Foxd3 (Fig. 1E). or siCbx3 treatment (Fig. 2A). We used monolayer NPCs Browser plots of select neural fate genes showed colocali- because the differentiation status in culture was more uni- zation of Pol II and Cbx3 at the promoter (Fig. 1F; Supple- form versus SFEBs. Figure 2E is an expression heat map mental Fig. S1C). We conclude that Cbx3 localizes to that plots Cbx3-bound genes down-regulated or up-regu- promoters
Load more

Recommended publications
  • Table S1. List of Proteins in the BAHD1 Interactome
    Table S1. List of proteins in the BAHD1 interactome BAHD1 nuclear partners found in this work yeast two-hybrid screen Name Description Function Reference (a) Chromatin adapters HP1α (CBX5) chromobox homolog 5 (HP1 alpha) Binds histone H3 methylated on lysine 9 and chromatin-associated proteins (20-23) HP1β (CBX1) chromobox homolog 1 (HP1 beta) Binds histone H3 methylated on lysine 9 and chromatin-associated proteins HP1γ (CBX3) chromobox homolog 3 (HP1 gamma) Binds histone H3 methylated on lysine 9 and chromatin-associated proteins MBD1 methyl-CpG binding domain protein 1 Binds methylated CpG dinucleotide and chromatin-associated proteins (22, 24-26) Chromatin modification enzymes CHD1 chromodomain helicase DNA binding protein 1 ATP-dependent chromatin remodeling activity (27-28) HDAC5 histone deacetylase 5 Histone deacetylase activity (23,29,30) SETDB1 (ESET;KMT1E) SET domain, bifurcated 1 Histone-lysine N-methyltransferase activity (31-34) Transcription factors GTF3C2 general transcription factor IIIC, polypeptide 2, beta 110kDa Required for RNA polymerase III-mediated transcription HEYL (Hey3) hairy/enhancer-of-split related with YRPW motif-like DNA-binding transcription factor with basic helix-loop-helix domain (35) KLF10 (TIEG1) Kruppel-like factor 10 DNA-binding transcription factor with C2H2 zinc finger domain (36) NR2F1 (COUP-TFI) nuclear receptor subfamily 2, group F, member 1 DNA-binding transcription factor with C4 type zinc finger domain (ligand-regulated) (36) PEG3 paternally expressed 3 DNA-binding transcription factor with
    [Show full text]
  • Single-Cell Sequencing of Human Ipsc-Derived Cerebellar Organoids Shows Recapitulation of Cerebellar Development
    bioRxiv preprint doi: https://doi.org/10.1101/2020.07.01.182196; this version posted July 1, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Single-cell sequencing of human iPSC-derived cerebellar organoids shows recapitulation of cerebellar development Samuel Nayler1*, Devika Agarwal3, Fabiola Curion2, Rory Bowden2,4, Esther B.E. Becker1,5* 1Department of Physiology, Anatomy and Genetics; University of Oxford; Oxford, OX1 3PT; United Kingdom 2Wellcome Centre for Human Genetics; University of Oxford; Oxford, OX3 7BN; United Kingdom 3Weatherall Institute for Molecular Medicine; University of Oxford; Oxford, OX3 7BN; United Kingdom 4Present address: Walter and Eliza Hall Institute of Medical Research, Parkville Victoria 3052; Australia 5Lead contact *Correspondence: [email protected], [email protected] Running title: hiPSC-derived cerebellar organoids 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.01.182196; this version posted July 1, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. ABSTRACT Current protocols for producing cerebellar neurons from human pluripotent stem cells (hPSCs) are reliant on animal co-culture and mostly exist as monolayers, which have limited capability to recapitulate the complex arrangement of the brain. We developed a method to differentiate hPSCs into cerebellar organoids that display hallmarks of in vivo cerebellar development. Single- cell profiling followed by comparison to an atlas of the developing murine cerebellum revealed transcriptionally-discrete populations encompassing all major cerebellar cell types.
    [Show full text]
  • Increased HOXA5 Expression Provides a Selective Advantage for Gain of Whole Chromosome 7 in IDH Wild-Type Glioblastoma
    Downloaded from genesdev.cshlp.org on May 11, 2018 - Published by Cold Spring Harbor Laboratory Press Increased HOXA5 expression provides a selective advantage for gain of whole chromosome 7 in IDH wild-type glioblastoma Patrick J. Cimino,1,2,17 Youngmi Kim,1,17 Hua-Jun Wu,3,4,5 Jes Alexander,1 Hans-Georg Wirsching,1,6 Frank Szulzewsky,1 Ken Pitter,7 Tatsuya Ozawa,1,8 Jiguang Wang,9,10,16 Julio Vazquez,11 Sonali Arora,1 Raul Rabadan,9,10 Ross Levine,12 Franziska Michor,3,4,5,13,14,15 and Eric C. Holland1 1Division of Human Biology, Fred Hutchinson Cancer Research Center, Seattle, Washington 98109, USA; 2Department of Pathology, Division of Neuropathology, University of Washington, Seattle, Washington 98104, USA; 3Department of Biostatistics and Computational Biology, Dana-Farber Cancer Institute, Harvard T.H. Chan School of Public Health, Boston, Massachusetts 02215, USA; 4Department of Biostatistics, Harvard T.H. Chan School of Public Health, Boston, Massachusetts 02115, USA; 5Department of Stem Cell and Regenerative Biology, Harvard University, Cambridge, Massachusetts 02138, USA; 6Department of Neurology, University Hospital Zurich, Zurich 8091, Switzerland; 7Department of Cancer Biology and Genetics, Memorial Sloan Kettering Cancer Center, New York, New York 10065, USA; 8Division of Brain Tumor Translational Research, National Cancer Center Research Institute, Tokyo 104-0045, Japan; 9Department of Biomedical Informatics, Columbia University, New York, New York 10027, USA; 10Department of Systems Biology, Columbia University, New York,
    [Show full text]
  • Functional Genomics Atlas of Synovial Fibroblasts Defining Rheumatoid Arthritis
    medRxiv preprint doi: https://doi.org/10.1101/2020.12.16.20248230; this version posted December 18, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Functional genomics atlas of synovial fibroblasts defining rheumatoid arthritis heritability Xiangyu Ge1*, Mojca Frank-Bertoncelj2*, Kerstin Klein2, Amanda Mcgovern1, Tadeja Kuret2,3, Miranda Houtman2, Blaž Burja2,3, Raphael Micheroli2, Miriam Marks4, Andrew Filer5,6, Christopher D. Buckley5,6,7, Gisela Orozco1, Oliver Distler2, Andrew P Morris1, Paul Martin1, Stephen Eyre1* & Caroline Ospelt2*,# 1Versus Arthritis Centre for Genetics and Genomics, School of Biological Sciences, Faculty of Biology, Medicine and Health, The University of Manchester, Manchester, UK 2Department of Rheumatology, Center of Experimental Rheumatology, University Hospital Zurich, University of Zurich, Zurich, Switzerland 3Department of Rheumatology, University Medical Centre, Ljubljana, Slovenia 4Schulthess Klinik, Zurich, Switzerland 5Institute of Inflammation and Ageing, University of Birmingham, Birmingham, UK 6NIHR Birmingham Biomedical Research Centre, University Hospitals Birmingham NHS Foundation Trust, University of Birmingham, Birmingham, UK 7Kennedy Institute of Rheumatology, University of Oxford Roosevelt Drive Headington Oxford UK *These authors contributed equally #corresponding author: [email protected] NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice. 1 medRxiv preprint doi: https://doi.org/10.1101/2020.12.16.20248230; this version posted December 18, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.
    [Show full text]
  • Intrinsic Specificity of DNA Binding and Function of Class II Bhlh
    INTRINSIC SPECIFICITY OF BINDING AND REGULATORY FUNCTION OF CLASS II BHLH TRANSCRIPTION FACTORS APPROVED BY SUPERVISORY COMMITTEE Jane E. Johnson Ph.D. Helmut Kramer Ph.D. Genevieve Konopka Ph.D. Raymond MacDonald Ph.D. INTRINSIC SPECIFICITY OF BINDING AND REGULATORY FUNCTION OF CLASS II BHLH TRANSCRIPTION FACTORS by BRADFORD HARRIS CASEY DISSERTATION Presented to the Faculty of the Graduate School of Biomedical Sciences The University of Texas Southwestern Medical Center at Dallas In Partial Fulfillment of the Requirements For the Degree of DOCTOR OF PHILOSOPHY The University of Texas Southwestern Medical Center at Dallas Dallas, Texas December, 2016 DEDICATION This work is dedicated to my family, who have taught me pursue truth in all forms. To my grandparents for inspiring my curiosity, my parents for teaching me the value of a life in the service of others, my sisters for reminding me of the importance of patience, and to Rachel, who is both “the beautiful one”, and “the smart one”, and insists that I am clever and beautiful, too. Copyright by Bradford Harris Casey, 2016 All Rights Reserved INTRINSIC SPECIFICITY OF BINDING AND REGULATORY FUNCTION OF CLASS II BHLH TRANSCRIPTION FACTORS Publication No. Bradford Harris Casey The University of Texas Southwestern Medical Center at Dallas, 2016 Jane E. Johnson, Ph.D. PREFACE Embryonic development begins with a single cell, and gives rise to the many diverse cells which comprise the complex structures of the adult animal. Distinct cell fates require precise regulation to develop and maintain their functional characteristics. Transcription factors provide a mechanism to select tissue-specific programs of gene expression from the shared genome.
    [Show full text]
  • Hepatitis C Virus As a Unique Human Model Disease to Define
    viruses Review Hepatitis C Virus as a Unique Human Model Disease to Define Differences in the Transcriptional Landscape of T Cells in Acute versus Chronic Infection David Wolski and Georg M. Lauer * Liver Center at the Gastrointestinal Unit, Department of Medicine, Massachusetts General Hospital and Harvard Medical School, Boston, MA 02114, USA * Correspondence: [email protected]; Tel.: +1-617-724-7515 Received: 27 June 2019; Accepted: 23 July 2019; Published: 26 July 2019 Abstract: The hepatitis C virus is unique among chronic viral infections in that an acute outcome with complete viral elimination is observed in a minority of infected patients. This unique feature allows direct comparison of successful immune responses with those that fail in the setting of the same human infection. Here we review how this scenario can be used to achieve better understanding of transcriptional regulation of T-cell differentiation. Specifically, we discuss results from a study comparing transcriptional profiles of hepatitis C virus (HCV)-specific CD8 T-cells during early HCV infection between patients that do and do not control and eliminate HCV. Identification of early gene expression differences in key T-cell differentiation molecules as well as clearly distinct transcriptional networks related to cell metabolism and nucleosomal regulation reveal novel insights into the development of exhausted and memory T-cells. With additional transcriptional studies of HCV-specific CD4 and CD8 T-cells in different stages of infection currently underway, we expect HCV infection to become a valuable model disease to study human immunity to viruses. Keywords: viral hepatitis; hepatitis C virus; T cells; transcriptional regulation; transcription factors; metabolism; nucleosome 1.
    [Show full text]
  • The Cyclin-Dependent Kinase 8 Module Sterically Blocks Mediator Interactions with RNA Polymerase II
    The cyclin-dependent kinase 8 module sterically blocks Mediator interactions with RNA polymerase II Hans Elmlund*†, Vera Baraznenok‡, Martin Lindahl†, Camilla O. Samuelsen§, Philip J. B. Koeck*¶, Steen Holmberg§, Hans Hebert*ʈ, and Claes M. Gustafsson‡ʈ *Department of Biosciences and Nutrition, Karolinska Institutet and School of Technology and Health, Royal Institute of Technology, Novum, SE-141 87 Huddinge, Sweden; †Department of Molecular Biophysics, Lund University, P.O. Box 124, SE-221 00 Lund, Sweden; ‡Division of Metabolic Diseases, Karolinska Institutet, Novum, SE-141 86 Huddinge, Sweden; §Department of Genetics, Institute of Molecular Biology, Oester Farimagsgade 2A, DK-1353 Copenhagen K, Denmark; and ¶University College of Southern Stockholm, SE-141 57 Huddinge, Sweden Communicated by Roger D. Kornberg, Stanford University School of Medicine, Stanford, CA, August 28, 2006 (received for review February 21, 2006) CDK8 (cyclin-dependent kinase 8), along with CycC, Med12, and Here, we use the S. pombe system to investigate the molecular Med13, form a repressive module (the Cdk8 module) that prevents basis for the distinct functional properties of S and L Mediator. RNA polymerase II (pol II) interactions with Mediator. Here, we We find that the Cdk8 module binds to the pol II-binding cleft report that the ability of the Cdk8 module to prevent pol II of Mediator, where it sterically blocks interactions with the interactions is independent of the Cdk8-dependent kinase activity. polymerase. In contrast to earlier assumptions, the Cdk8 kinase We use electron microscopy and single-particle reconstruction to activity is dispensable for negative regulation of pol II interac- demonstrate that the Cdk8 module forms a distinct structural tions with Mediator.
    [Show full text]
  • Long Noncoding RNA ANRIL Promotes Non–Small Cell Lung
    Published OnlineFirst December 12, 2014; DOI: 10.1158/1535-7163.MCT-14-0492 Cancer Biology and Signal Transduction Molecular Cancer Therapeutics Long Noncoding RNA ANRIL Promotes Non–Small Cell Lung Cancer Cell Proliferation and Inhibits Apoptosis by Silencing KLF2 and P21 Expression Feng-qi Nie1, Ming Sun2, Jin-song Yang3, Min Xie2, Tong-peng Xu1, Rui Xia2, Yan-wen Liu2, Xiang-hua Liu2, Er-bao Zhang2, Kai-hua Lu1, and Yong-qian Shu1 Abstract Recent evidence highlights long noncoding RNAs (lncRNA) was increased in NSCLC tissues, and its expression level was as crucial regulators of cancer biology that contribute to essen- significantly correlated with tumor–node–metastasis stages and tial cancer cell functions such as cell proliferation, apoptosis, tumor size. Moreover, patients with high levels of ANRIL and metastasis. In non–small cell lung cancer (NSCLC), several expression had a relatively poor prognosis. In addition, taking lncRNAs' expressions are misregulated and have been nomi- advantage of loss-of-function experiments in NSCLC cells, we nated as critical actors in NSCLC tumorigenesis. LncRNA ANRIL found that knockdown of ANRIL expression could impair cell was first found to be required for the PRC2 recruitment to and proliferation and induce cell apoptosis both in vitro and vivo. silencing of p15INK4B, the expression of which is induced by the Furthermore, we uncover that ANRIL could not repress p15 ATM–E2F1 signaling pathway. Our previous study showed that expression in PC9 cells, but through silencing of KLF2 and P21 ANRIL was significantly upregulated in gastric cancer, and it transcription. Thus, we conclusively demonstrate that lncRNA could promote cell proliferation and inhibit cell apoptosis by ANRIL plays a key role in NSCLC development by associating silencing of miR99a and miR449a transcription.
    [Show full text]
  • Development and Validation of a Novel Immune-Related Prognostic Model
    Wang et al. J Transl Med (2020) 18:67 https://doi.org/10.1186/s12967-020-02255-6 Journal of Translational Medicine RESEARCH Open Access Development and validation of a novel immune-related prognostic model in hepatocellular carcinoma Zheng Wang1, Jie Zhu1, Yongjuan Liu3, Changhong Liu2, Wenqi Wang2, Fengzhe Chen1* and Lixian Ma1* Abstract Background: Growing evidence has suggested that immune-related genes play crucial roles in the development and progression of hepatocellular carcinoma (HCC). Nevertheless, the utility of immune-related genes for evaluating the prognosis of HCC patients are still lacking. The study aimed to explore gene signatures and prognostic values of immune-related genes in HCC. Methods: We comprehensively integrated gene expression data acquired from 374 HCC and 50 normal tissues in The Cancer Genome Atlas (TCGA). Diferentially expressed genes (DEGs) analysis and univariate Cox regression analysis were performed to identify DEGs that related to overall survival. An immune prognostic model was constructed using the Lasso and multivariate Cox regression analyses. Furthermore, Cox regression analysis was applied to identify independent prognostic factors in HCC. The correlation analysis between immune-related signature and immune cells infltration were also investigated. Finally, the signature was validated in an external independent dataset. Results: A total of 329 diferentially expressed immune‐related genes were detected. 64 immune‐related genes were identifed to be markedly related to overall survival in HCC patients using univariate Cox regression analysis. Then we established a TF-mediated network for exploring the regulatory mechanisms of these genes. Lasso and multivariate Cox regression analyses were applied to construct the immune-based prognostic model, which consisted of nine immune‐related genes.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • Functional Diversification of the Nleg Effector Family in Enterohemorrhagic Escherichia Coli
    Functional diversification of the NleG effector family in enterohemorrhagic Escherichia coli Dylan Valleaua, Dustin J. Littleb, Dominika Borekc,d, Tatiana Skarinaa, Andrew T. Quailea, Rosa Di Leoa, Scott Houlistone,f, Alexander Lemake,f, Cheryl H. Arrowsmithe,f, Brian K. Coombesb, and Alexei Savchenkoa,g,1 aDepartment of Chemical Engineering and Applied Chemistry, University of Toronto, Toronto, ON M5S 3E5, Canada; bDepartment of Biochemistry and Biomedical Sciences, Michael G. DeGroote Institute for Infectious Disease Research, McMaster University, Hamilton, ON L8S 4K1, Canada; cDepartment of Biophysics, University of Texas Southwestern Medical Center, Dallas, TX 75390; dDepartment of Biochemistry, University of Texas Southwestern Medical Center, Dallas, TX 75390; ePrincess Margaret Cancer Centre, University of Toronto, Toronto, ON M5G 2M9, Canada; fDepartment of Medical Biophysics, University of Toronto, Toronto, ON M5G 1L7, Canada; and gDepartment of Microbiology, Immunology and Infectious Diseases, University of Calgary, Calgary, AB T2N 4N1, Canada Edited by Ralph R. Isberg, Howard Hughes Medical Institute and Tufts University School of Medicine, Boston, MA, and approved August 15, 2018 (receivedfor review November 6, 2017) The pathogenic strategy of Escherichia coli and many other gram- chains. Depending on the length and nature of the polyubiquitin negative pathogens relies on the translocation of a specific set of chain, it posttranslationally regulates the target protein’s locali- proteins, called effectors, into the eukaryotic host cell during in- zation, activation, or degradation. Ubiquitination is a multistep fection. These effectors act in concert to modulate host cell pro- process which begins with the ubiquitin-activating enzyme (E1) cesses in favor of the invading pathogen. Injected by the type III using ATP to “charge” ubiquitin, covalently binding the ubiquitin secretion system (T3SS), the effector arsenal of enterohemorrhagic C terminus by a thioester linkage.
    [Show full text]
  • UC Riverside UC Riverside Electronic Theses and Dissertations
    UC Riverside UC Riverside Electronic Theses and Dissertations Title The Role of AMPK and miR-92a in the Shear Stress Regulation of KLF2 Permalink https://escholarship.org/uc/item/25z876bc Author Wu, Wei Publication Date 2010 Peer reviewed|Thesis/dissertation eScholarship.org Powered by the California Digital Library University of California UNIVERSITY OF CALIFORNIA RIVERSIDE The Role of AMPK and miR-92a in the Shear Stress Regulation of KLF2 A Dissertation submitted in partial satisfaction of the requirements for the degree of Doctor of Philosophy in Cellular, Molecular and Developmental Biology by Wei Wu December 2010 Dissertation Committee: Dr. John Shyy, Chairperson Dr. Ameae Walker Dr. Kathryn Defea Copyright by Wei Wu 2010 ii The Dissertation of Wei Wu is approved: ------------------------------------------ ------------------------------------------ ------------------------------------------ Committee Chairperson University of California, Riverside iii Acknowledgements It is a pleasure to thank those who made this dissertation possible. First of all, I would like to thank CMDB program for giving me the opportunity to pursue my Ph.D degree in UCR. A hearty thanks to Dr. Anthony W. Norman, Dr. Helen Henry and the professors who taught and encouraged me in these past years. I owe my deepest gratitude to my major professor, Dr. John Y-J. Shyy, for his guidance and support. I am also grateful to Dr. Ameae M. Walker and Dr. Kathryn Defea for their valuable discussions and constructive suggestions. I am thankful to all of my colleagues and friends for their generous help and precious discussion on my work. My parents and parents-in-law, thanks for your support and unconditional love. Even though we are thousand of miles away, you were always there whenever I needed you.
    [Show full text]