Supplementary Tables and Figures Greater Pollination Generalization Is Not Associated with Reduced Con- Straints on Corolla Shap

Joly & al. Supplementary tables and ﬁgures

Supplementary tables and ﬁgures Greater pollination generalization is not associated with reduced con- straints on corolla shape in Antillean plants

Simon Joly, Fran¸coisLambert, Hermine Alexandre, Julien Clavel, Etienne´ L´eveill´e-Bourret,John L. Clark

Table S1: Pollinator information for the species included in the study.

Species Pollinator Confirmed Reference Gesneria acaulis hummingbird yes Marten-Rodriguez et al. 2009 Gesneria sylvicola unknown no Gesneria aspera hummingbird yes Marten-Rodriguez et al. 2009 Gesneria bracteosa unknown no Gesneria citrina hummingbird yes Marten-Rodriguez et al. 2008 Gesneria clarensis unknown no Gesneria cubensis hummingbird yes Marten-Rodriguez et al. 2010 Gesneria cuneifolia hummingbird yes Marten-Rodriguez et al. 2008 Gesneria duchartreoides unknown no Gesneria ekmanii unknown no Gesneria ferruginae hummingbird no Gesneria fruticosa bat yes Marten-Rodriguez et al. 2009 Gesneria glandulosa hummingbird no Gesneria harrisii hummingbird no Gesneria humilis moth yes Marten-Rodriguez et al. 2015 Gesneria lopezii hummingbird no Gesneria neglecta bat no Gesneria nipensis hummingbird no Gesneria pauciflora hummingbird no Gesneria pedicellaris hummingbird yes Marten-Rodriguez et al. 2009 Gesneria pedunculosa bat yes Marten-Rodriguez et al. 2008 Gesneria pulverulenta hummingbird yes Marten-Rodriguez et al. 2009 Gesneria purpurascens hummingbird yes Marten-Rodriguez et al. 2015 Gesneria quisqueyana bat yes Marten-Rodriguez et al. 2009 Gesneria reticulata hummingbird yes Marten-Rodriguez et al. 2015 Gesneria salicifolia hummingbird no Gesneria scabra hummingbird no Gesneria depressa unknown no Gesneria sintenisii mixed-pollination yes Marten-Rodriguez et al. 2008 Gesneria sp unknown no Gesneria ventricosa hummingbird yes Marten-Rodriguez et al. 2009 Gesneria viridiflora subsp. viridiflora mixed-pollination yes Marten-Rodriguez et al. 2015 Gesneria yamuriensis hummingbird no Rhytidophyllum auriculatum mixed-pollination yes Marten-Rodriguez et al. 2009 Rhytidophyllum berteroanum hummingbird yes Marten-Rodriguez et al. 2009 Rhytidophyllum bicolor unknown no Rhytidophyllum bullatum hummingbird no Rhytidophyllum crenulatum mixed-pollination yes Marten-Rodriguez et al. 2010 Rhytidophyllum earlei hummingbird no Rhytidophyllum exsertum mixed-pollination yes Marten-Rodriguez et al. 2010 Rhytidophyllum grandiflorum mixed-pollination yes Marten-Rodriguez et al. 2009 Rhytidophyllum intermedium unknown no Rhytidophyllum leucomallon mixed-pollination yes Marten-Rodriguez et al. 2009 Rhytidophyllum lomensis hummingbird no Rhytidophyllum minus mixed-pollination yes Marten-Rodriguez et al. 2015 Rhytidophyllum rupincola hummingbird yes Marten-Rodriguez et al. 2010 Rhytidophyllum sp unknown no Rhytidophyllum tomentosum mixed-pollination yes Marten-Rodriguez et al. 2010 Rhytidophyllum vernicosum mixed-pollination yes Marten-Rodriguez et al. 2009 Bellonia spinosa bee yes Marten-Rodriguez et al. 2008

Page 1 of 15 Joly & al. Supplementary tables and ﬁgures

Table S2: Information on the ﬂower pictures included in the study.

FileName CodeSpecies Voucher GES acaulis APR72R1 13.jpg GES acaulis no voucher GES acaulis G877 G940 G1238 1.jpg GES acaulis LHBH G877 GES acaulis JLC 11303 02.jpg GES acaulis JLC 11303 GES bracteosa JLC 10567 53.jpg GES bracteosa JLC 10567 GES citrina G888 Dec 1965 1.jpg GES citrina LHBH G888 GES citrina JLC 10021 07.jpg GES citrina JLC 10021 GES clarensis JLC 10488 117.jpg GES clarensis JLC 10488 GES cuneifolia APR 72R9 1.jpg GES cuneifolia no voucher GES cuneifolia Dunn 1.jpg GES cuneifolia no voucher GES cuneifolia G763 BH 1973 1.jpg GES cuneifolia LHBH G763 GES cuneifolia G784 G857 1.jpg GES cuneifolia LHBH GES cuneifolia G857 Puerto Rico Tapley 1965 2.jpg GES cuneifolia LHBH G857 GES cuneifolia G869 G857 G763 1.jpg GES cuneifolia LHBH GES cuneifolia G869 Puerto Rico 1963 Tapley 10 5 BH 4.jpg GES cuneifolia LHBH G869 GES cuneifolia july 1980 1.jpg GES cuneifolia no voucher GES duchartreoides JLC 12791 067.jpg GES duchartreoides JLC 12791 GES ferruginae JLC 10627 083.jpg GES ferruginae JLC 10627 GES fruticosa Cornell G1035 01.jpg GES fruticosa LHBH G1035 GES fruticosa Skog 01.jpg GES fruticosa no voucher GES glandulosa JLC 12772 023.jpg GES glandulosa JLC 12772 GES harrisii Jamaica Guaco Rock 3.jpg GES harrisii no voucher GES harrisii Tapley 1964.jpg GES harrisii no voucher GES heterochroa JLC 12800 061.jpg GES heterochroa JLC 12800 GES humilis G1365 M Stone 2.jpg GES humilis LHBH G1365 GES humilis JLC 10040 06.jpg GES humilis JLC 10040 GES humilis JLC 10472 11.jpg GES humilis JLC 10472 GES humilis JLC 10574 14.jpg GES humilis JLC 10574 GES humilis JLC 10584 01.jpg GES humilis JLC 10584 GES humilis JLC 10589 25.jpg GES humilis JLC 10589 GES humilis JLC 10624 04.jpg GES humilis JLC 10624 GES humilis JLC 10630 05.jpg GES humilis JLC 10630 GES humilis JLC 10633 13.jpg GES humilis JLC 10633 GES humilis JLC 10634 10.jpg GES humilis JLC 10634 GES lopezii Suarez Cuba Mayari 25.jpg GES lopezii no voucher GES neglecta Cornell G875 01.jpg GES neglecta LHBH G875 GES nipensis JLC 10577 30.jpg GES nipensis JLC 10577 GES nipensis JLC 10578 05.jpg GES nipensis JLC 10578 GES pauciflora G769 1.jpg GES pauciflora LHBH G769 GES pauciflora Gesneria lemondrop 3.jpg GES pauciflora no voucher GES pedicellaris domrep talpey 1.jpg GES pedicellaris no voucher GES pedicellaris G898 G883 G1231 1.jpg GES pedicellaris LHBH GES pedicellaris JLC 10635 04.jpg GES pedicellaris JLC 10635 GES pedicellaris JLC 11328 13.jpg GES pedicellaris JLC 11328 GES pedicellaris pauciflora sacatilis 1.jpg GES pedicellaris no voucher GES pedunculosa USBRG 1997 204 1.jpg GES pedunculosa USBRG GES pedunculosa USBRG 96 342 1.jpg GES pedunculosa USBRG GES pulverulenta G1034 1.jpg GES pulverulenta LHBH G1034 GES purpurascens JLC 10564 124.jpg GES purpurascens JLC 10564 GES purpurascens JLC 12769 096.jpg GES purpurascens JLC 12769 GES quisqueyana APR 72R9 11.jpg GES quisqueyana no voucher GES reticulata dominicanrepublic talpey 1972 1.jpg GES reticulata no voucher GES reticulata G784 3.jpg GES reticulata LHBH G784 GES reticulata USBRG 1997 205 2.jpg GES reticulata USBRG GES salicifolia JLC 10566 79.jpg GES salicifolia JLC 10566

Page 2 of 15 Joly & al. Supplementary tables and ﬁgures

Table S2: Continued...

FileName CodeSpecies Voucher GES scabra sphaerocarpa G881 1.jpg GES scabra LHBH G881 GES scabra sphaerocarpa jamaica talpey 1964 1.jpg GES scabra no voucher GES shaferi JLC 12773 096.jpg GES depressa JLC 12773 GES shaferi JLC 12786 012.jpg GES depressa JLC 12786 GES shaferi JLC 12788 002.jpg GES depressa JLC 12788 GES ventricosa dunn 4.jpg GES ventricosa no voucher GES ventricosa G940 3.jpg GES ventricosa LHBH G940 GES ventricosa JLC 6545 2.jpg GES ventricosa JLC 6545 GES viridiflora JLC 10509 35.jpg GES viridiflora JLC 10509 GES viridiflora JLC 10540 01.jpg GES viridiflora JLC 10540 GES viridiflora JLC 10552 21.jpg GES viridiflora JLC 10552 GES viridiflora JLC 10554 20.jpg GES viridiflora JLC 10554 GES viridiflora JLC 10555 29.jpg GES viridiflora JLC 10555 GES viridiflora JLC 12797 14.jpg GES viridiflora JLC 12797 GES yamuriensis JLC 10575 01.jpg GES yamuriensis JLC 10575 RHY auriculatum USBRG 97 113 1.jpg RHY auriculatum USBRG RHY berteroanum 77 227 4.jpg RHY berteroanum no voucher RHY berteroanum G1398 G1257 G841 1.jpg RHY berteroanum LHBH RHY berteroanum JUL81W5 16.jpg RHY berteroanum no voucher RHY crenulatum JLC 10042 38.jpg RHY crenulatum JLC 10042 RHY crenulatum JLC 10580 10.jpg RHY crenulatum JLC 10580 RHY crenulatum JLC 10582 02.jpg RHY crenulatum JLC 10582 RHY crenulatum JLC 12803 09.jpg RHY crenulatum JLC 12803 RHY earlei JLC 10458 02.jpg RHY earlei JLC 10458 RHY earlei JLC 10486 19.jpg RHY earlei JLC 10486 RHY exsertum JLC 10508 12.jpg RHY exsertum JLC 10508 RHY exsertum JLC 10538 07.jpg RHY exsertum JLC 10538 RHY exsertum JLC 10546 07.jpg RHY exsertum JLC 10546 RHY exsertum JLC 10551 03.jpg RHY exsertum JLC 10551 RHY exsertum JLC 10565 08.jpg RHY exsertum JLC 10565 RHY exsertum JLC 10569 05.jpg RHY exsertum JLC 10569 RHY exsertum JLC 10579 01.jpg RHY exsertum JLC 10579 RHY exsertum JLC 10585 18.jpg RHY exsertum JLC 10585 RHY exsertum JLC 12770 23.jpg RHY exsertum JLC 12770 RHY exsertum JLC 12787 14.jpg RHY exsertum JLC 12787 RHY grandiflorum APR72r9 8.jpg RHY grandiflorum no voucher RHY grandiflorum cornell 1.jpg RHY grandiflorum no voucher RHY intermedium JLC 10547 10.jpg RHY intermedium JLC 10547 RHY leucomallon G1232 1.jpg RHY leucomallon LHBH G1232 RHY lomensis JLC 10469 23.jpg RHY lomense JLC 10469 RHY lomensis JLC 10470 24.jpg RHY lomense JLC 10470 RHY lomensis JLC 10471 01.jpg RHY lomense JLC 10471 RHY minus JLC 10500 34.jpg RHY minus JLC 10500 RHY rupincola JLC 11308 18.jpg RHY rupincola JLC 11308 RHY rupincola JLC 11957 36.jpg RHY rupincola JLC 11957 RHY tomentosum apr72r1 11.jpg RHY tomentosum no voucher RHY tomentosum jlc 10477 06.jpg RHY tomentosum JLC 10477 GES aspera 2014-011.jpg GES aspera Lambert 2014-011 GES cubensis 2014-008.jpg GES cubensis Lambert 2014-008 GES viridiflora acrochordonanthe 2014-028.jpg GES sylvicola Lambert 2014-028 RHY auriculatum 2014-014.jpg RHY auriculatum Lambert 2014-014 RHY auriculatum 2014-025.jpg RHY auriculatum Lambert 2014-025 RHY bicolor 2014-001.jpg RHY bicolor Lambert 2014-001 RHY bullatum 2014-016.jpg RHY bullatum Lambert 2014-016

Page 3 of 15 Joly & al. Supplementary tables and ﬁgures

Table S2: Continued...

FileName CodeSpecies Voucher RHY ekmanii 2014-020.jpg GES ekmanii Lambert 2014-020 RHY ekmanii 2014-024.jpg GES ekmanii Lambert 2014-024 RHY nov.sp. 2014-010.jpg GES sp Lambert 2014-010 RHY sp 2014-022.jpg RHY sp Lambert 2014-022 RHY bicolor 2014-002.jpg RHY bicolor Lambert 2014-002 GES cuneifolia JBM.jpg GES cuneifolia JBM GES pedicellaris JBM.jpg GES pedicellaris JBM 932-1971 GES ventricosa JBM.jpg GES ventricosa Léveillé-BourretG4 RHY auriculatum JBM.jpg RHY auriculatum JBM 937-1971 RHY exsertum JBM.jpg RHY exsertum Léveillé-BourretG1 RHY rupincola JBM.jpg RHY rupincola JBM 113-1991 RHY tomentosum JBM.jpg RHY tomentosum Léveillé-BourretG2 RHY vernicosum JBM.jpg RHY vernicosum Léveillé-BourretG3 GES sintenisii JLC 13757 19.jpg GES sintenisii JLC 13757 GES acrochordonanthe JLC 14467 090.jpg GES sylvicola JLC 14467 GES acrochordonanthe JLC 14522 045.jpg GES sylvicola JLC 14522 GES glandulosa JLC 14572 026.jpg GES glandulosa JLC 14572 RHY auriculatum JLC 14319 34.jpg RHY auriculatum JLC 14319 RHY auriculatum JLC 14387 37.jpg RHY auriculatum JLC 14387 RHY auriculatum JLC 14434 01.jpg RHY auriculatum JLC 14434 RHY auriculatum JLC 14499 10.jpg RHY auriculatum JLC 14499 RHY auriculatum JLC 14523 028.jpg RHY auriculatum JLC 14523 RHY bicolor JLC 14321 109.jpg RHY bicolor JLC 14321 RHY bicolor JLC 14364 05.jpg RHY bicolor JLC 14364 RHY bicolor JLC 14493 07.jpg RHY bicolor JLC 14493 RHY leucomallon JLC 14338 031.jpg RHY leucomallon JLC 14338 RHY leucomallon JLC 14497 09.jpg RHY leucomallon JLC 14497 RHY leucomallon JLC 14498 10.jpg RHY leucomallon JLC 14498 RHY nov.sp. JLC 14460 081.jpg GES sp JLC 14460

Page 4 of 15 Joly & al. Supplementary tables and ﬁgures GU323232 GU323235 AY423156 GU323242 Voucher information for the specimens sequenced in the study. Table S3: Gesneria clarensisGesneria cubensisGesneria cubensisGesneria cuneifoliaGesneria depressaGesneria Clark, ekmanii J.Gesneria Lambert, ekmanii FGesneria Marten-Rodriguez, ekmanii S. Marten-Rodriguez,Gesneria S. ferruginaeGesneria Clark, fruticosa J.Gesneria fruticosa Lambert, FGesneria humilis Lambert, FGesneria humilis Lambert, F Clark, J.Gesneria humilisGesneria Lambert, humilis F 1232Gesneria Marten-Rodriguez, humilis 1247 S.Gesneria nipensis Chautems, 10488 A. 2014-008Gesneria pedicellaris Clark, J.Gesneria pedicellaris Clark, J.Gesneria pedunculosa Clark, J.Gesneria UNA pedunculosa Clark, 13070 J.Gesneria 2014-018 MT pulverulenta Clark, Clark, J. J. UNAGesneria 2014-020 pumila Marten-Rodriguez, 1227 S. Clark,Gesneria 2014-024 J. purpurascens Marten-Rodriguez,Gesneria S. 10627 quisqueyana MF318850 MF318860 2014-012 Marten-Rodriguez,Gesneria S. MT reticulata MF318714 MF318674 UNAGesneria MT reticulata 1179 Clark, MF318650 J. MT Marten-Rodriguez, Marten-Rodriguez, MF318737 S. UNA S. MF318863 MT MF318588 10040 UNA MF318865 MF318718 1229 Clark, J. 10472 MF318864 MF318719 Marten-Rodriguez, MF318738 S. 10574 1251 MF318720 MF318643 10626 1237 MF318861 MF318851 MF318741 10635 10577 MF318681 MF318711 MF318580 UNA MF318644 10644 1194 MF318797 US UNA 1230 MF318743 MF318597 UNA GU323234 MF318581 MF318742 MF318834 UNA MF318651 US UNA UNA MF318835 10564 MF318699 1221 MF318758 MF318756 MF318837 MF318700 MF318614 UNA MF318589 MF318836 MF318616 MF318744 US US MF318840 MF318684 MF318745 10558 MF318601 MF318675 MF318615 MF318602 MF318852 MF318747 UNA MF318701 US GU323238 MF318603 MF318710 MF318831 UNA MF318716 MF318749 MF318647 MF318612 MF318750 MF318746 MF318751 MF318832 MF318582 MF318587 MF318680 MF318748 GU323241 GU323243 MF318755 MF318598 GU323244 GU323245 GU323246 SpeciesBellonia spinosaBellonia spinosaGesneria acaulisGesneria acaulisGesneria asperaGesneria bracteosa Clark, J.Gesneria christii Leveille-Bourret, E.Gesneria christii Collector Clark, J.Gesneria christii Marten-Rodriguez,Gesneria S. citrina Lambert, Clark,Gesneria F J. citrina Clark, J. Leveille-Bourret, E. Smithsonian Institution living collection G8 Clark, J. 94-507 Marten-Rodriguez, S. 1188 10573 Collection number 11303 Herbarium 2014-011 G6 MT CHI 10567 US UNA 1248 10025 F3H MF318807 UNA MT MF318654 MF318806 10020 UNA MT GAPDH MF318829 MF318849 MF318715 UNA gCYC MF318682 MF318646 MF318869 MF318839 MF318730 MF318705 MF318613 MF318673 UF3GT MF318838 UNA MF318642 MF318728 MF318649 MF318672 MF318732 MF318735 MF318605 MF318579 MF318731 MF318561 MF318734 AY363923 GU323229 MF318679 MF318736

Page 5 of 15 Joly & al. Supplementary tables and figures GU323258 Continued... Table S3: Rhytidophyllum lomenseRhytidophyllum lomenseRhytidophyllum minus Clark, J. Clark, J. Clark, J. 10466 10469 10500 UNA UNA UNA MF318821 MF318823 MF318691 MF318692 MF318626 MF318815 MF318628 MF318785 MF318666 MF318786 MF318572 MF318787 MF318577 SpeciesGesneria salicifoliaGesneria sintenisiiGesneria sintenisiiGesneria sylvicolaGesneria sylvicola Clark,Gesneria J. ventricosaGesneria Clark, ventricosa J.Gesneria Marten-Rodriguez, ventricosa S. CollectorGesneria Lambert, viridiflora FGesneria Lambert, viridiflora F Clark, J.Gesneria viridiflora Leveille-Bourret, E.Gesneria viridiflora Marten-Rodriguez, S.Gesneria viridiflora Clark,Gesneria J. yamuriensis Clark,Henckelia J. malayana 1252 Clark,Kohleria J. trinidad Clark,Rhytidophyllum J. auriculatum 10566 Clark,Rhytidophyllum J. Clark, auriculatum J. Joly, 13757 S.Rhytidophyllum auriculatum Leveille-Bourret, Lambert, Collection G4 E. F 2014-027 numberRhytidophyllum 1112A auriculatum Lambert, F 2014-028 HerbariumRhytidophyllum US berteroanum Joly, Marten-Rodriguez, S. S. CHIRhytidophyllum 6545 bicolor Marten-Rodriguez, S. UNARhytidophyllum bicolor UNARhytidophyllum MT bullatumRhytidophyllum MT F3H crenulatum Lambert, 10041 F MF318862 MTRhytidophyllum crenulatum Lambert, 10509 F Lambert, MF318676 MF318841 F Clark,Rhytidophyllum J. earlei 10524 MF318842 G11 MF318645 MF318708 UNA Clark,Rhytidophyllum John GAPDH earlei L. 10540 MF318843 MF352013 MF318757 1222Rhytidophyllum MF318853 exsertum 10561 MF318722 10575 1226 gCYCRhytidophyllum MF318712 2014-014 exsertum 1100 UNA Clark, J.Rhytidophyllum MF318640 2014-025 exsertum Clark, UNA Clark, J. J.Rhytidophyllum MF318762 UF3GT exsertum Clark, UNA J.Rhytidophyllum MT grandiflorum MF318759 MF318583 1102 MF318845 Leveille-Bourret, UNA E. MF318764Rhytidophyllum intermedium Marten-Rodriguez, MF318611 MT MF318854 US Skog, UNA S. L. UNA MF318765 MF352011 Rhytidophyllum MF318677 leucomallon US Clark, MT MF318726 J. 2014-001 MF318585 MT MF318617 MF318867 Acevedo, P. 2014-002 MF318761 2014-016 MF318866 MF318723 10580 MF318824 MF318830 GU323250 9531 MF318725 MF318687 MF318717 MT MF352012 MF318635 MF318648 MF318706 MT MF318709 MF318775 MF318771 MF318767 MT MT G1 1224 MF318565 MF318599 MF318868 10458 UNA GU323249 10038 MF318772 MF318668 10486 MF318766 MF318858 MF318658 UNA MF318770 10585 MF318610 MF318859 MF318697 MF318847 MF318641 MF318586 MF318768 MF318698 MF318621 MF318670 MF318777 1197-14 MF318769 MF318584 MF318623 MF318778 MF318848 10549 MF318564 13966 US MF318609 UNA MT MF318779 MF318593 MF318659 UNA UNA MF318594 MF318776 MF318630 UNA MF318573 MF318781 MF318818 MF318812 MF318576 MF318810 MF318780 MF318820 MF318686 GU323253 MF318661 UNA MF318809 MF318660 MF318773 GU323254 MF318574 MF318689 MF318624 MF318637 MF318713 MF318633 MF318625 MF318739 MF318783 MF318782 MF318740 MF318563 MF318816 MF318568 MF318566 MF318595 MF318721 MF318629 MF318784 séquencé GU323255 MF318569 GU323257 GU323256

Page 6 of 15 Joly & al. Supplementary tables and ﬁgures GU323247 Continued... Table S3: Rhytidophyllum sp.Rhytidophyllum sp.Rhytidophyllum sp. nov 1Rhytidophyllum sp. nov 1Rhytidophyllum sp. Lambert, nov 1 F Lambert,Rhytidophyllum tomentosum F Lambert, F Lambert,Rhytidophyllum tomentosum F Leveille-Bourret, E. noRhytidophyllum tomentosum voucher Marten-Rodriguez, S.Rhytidophyllum vernicosum Smithsonian Institution livingRhytidophyllum collection vernicosum Leveille-Bourret, E. SI77-235 Marten-Rodriguez, S. G2 1191 2014-017 2014-009 2014-022 2014-010 G3 2014-007 1246 MT MT US MT MT MT MF318828 MF318856 MF318825 US MF318669 MF318817 MT MF318857 MF318695 MF318671 MF318663 MF318696 MF318620 MF318638 MF318622 MF318794 MF318855 MF318799 MF318844 MF318795 MF318591 MF318694 MF318570 MF318724 MF318592 MF318619 MF318796 MF318652 MF318793 MF318798 MF318800 MF318590 MF318604 AY363926 GU323260 GU323261 SpeciesRhytidophyllum onacaensisRhytidophyllum rupincolaRhytidophyllum E. rupincola CarbonoRhytidophyllum rupincola Clark, J.Rhytidophyllum rupincola Clark, J. Leveille-Bourret, E. Marten-Rodriguez, S. Collector 9085 G5 1253 11261 11957 UNA Collection number MT Herbarium UNA CHI MF318826 UNA MF318678 MF318822 MF318618 MF318819 F3H MF318690 MF318788 MF318685 MF318627 MF318575 MF318634 MF318790 GAPDH MF318791 MF318693 MF318636 gCYC MF318792 MF318596 UF3GT

Page 7 of 15 Joly & al. Supplementary tables and ﬁgures

Table S4: Primer information for the gene ampliﬁcation.

Gene Primers Sequence (5’ → 3’) Annealing temperature CYCLOIDEA gCYCf2 AAGGAGCTGGTGCAGGCTAAGA 54◦C gCYCr2 GGGAGATTGCAGTTCAAATCCCTTGA GAPDH GAPDHx1fb TGCACTACTAACTGCCTTG 47◦C GAPDHx4rb GCTGGAAGMACTTTGCCAACAGC CHI CHI1F TCTGCATCGCTGTAGGTTCC 59◦C CHI1R GACATGTCTTGCCACCCAACT UF3GT UF3GT1F TGCCAAAATCCACCGCTGTGT 51◦C UF3GT1R TGCAACTGAGGTGCCCAGGA F3H F3H2f ACGGAGGCCTACAGCGAGCA 56◦C F3H2R CCTGCAACCCACCCACCTGA Note: PCR reactions included 1 × buﬀer, 1 mM MgSO4, 1 U DreamTaq (Thermoscientiﬁc), 0.4 µM of each primer, 0.2 µM of each dNTPs, 1% PVP (M.W. 40,000), 50 µg BSA and ca. 30 ng of DNA.

Page 8 of 15 Joly & al. Supplementary tables and ﬁgures

Table S5: Number of transitions between the diﬀerent pollination strategies according to the stochastic mapping when performed on species with conﬁrmed and inferred pollination strategies. The median values obtained from the character simulations over the posterior distribution of species tree is reported as well as 95% credible intervals. Ancestral state are in rows.

bat bee hummingbird mixed-pollination moth bat – 0.25 [0.19, 0.22] 3.74 [3.07, 4.40] 3.70 [3.06, 4.30] 0.22 [0.14, 0.34] bee 0.06 [0.02, 0.10] – 0.05 [0.02, 0.10] 0.08 [0.02, 0.14] 0.03 [0.02, 0.05] hummingbird 3.32 [2.55, 3.88] 0.43 [0.37, 0.51] – 2.48 [2.00, 2.96] 0.63 [0.44, 0.78] mixed-pollination 4.47 [3.82, 5.17] 0.28 [0.20, 0.37] 6.53 [5.54, 7.15] – 0.25 [0.14, 0.33] moth 0.03 [0.02, 0.11] 0.06 [0.04, 0.10] 0.04 [0.01, 0.07] 0.04 [0.02, 0.07] –

Page 9 of 15 Joly & al. Supplementary tables and figures mix mix mix station station station hum hum hum station station station 2 2 2 mix mix mix σ σ σ 2 2 2 hum hum hum σ σ σ mix mix mix θ θ θ hum hum hum are the stationary distributions of the hummingbird and mixed-pollination strategies. θ θ θ mix station and hum Parameter values of the univariate evolutionary models fitted on the first three principal components of the morphospace when species with confirmed station PC1 ModelsBM1BMV pBM1mBMVm AICc weight 2OU1 3 3OUM 0 4 [0,0] 0.38 0OUMV [0.03,0.69] [0,0]OUMA 0.16 [0.03,0.24] 3 0.154OUMVA 4 [0.148,0.162] 5OUBMi 0 5 6 [0,0] 0.46BMOUi 0.153 0 [0.03,0.95] [0.143,0.16] [0,0] -0.129OUBM [-0.139,-0.118] 4 0 0 [0,0] [0,0]BMOU 4 0.042 [0.033,0.05] 0.015 0.169 0 0.097 [0.012,0.019] [0,0] [0.165,0.172] [0.033,0.137] 3 0PC2 [0,0] 3 -0.132 [-0.142,-0.122] 0 0.015 [0,0]Models [0.012,0.019] 0 0.031 [0,0] 0.042 -0.159BM1 [0.021,0.042] 0.097 [0.033,0.05] [-0.159,-0.158] [0.033,0.137] 0.214 [0.192,0.23]BMV 0.019 – p [0.013,0.025] 0.218 0.214 [0.198,0.247]BM1m [0.19,0.231]BMVm AICc 0.123 3.122 weight 0.031 2 [0.096,0.146] [0.916,17.092] [0.021,0.042]OU1 3 -0.053 0.028 [-0.074,-0.03] 3 0.011 0.105 -0.163 [0.016,0.13]OUM [0.009,0.014] [0.077,0.163] [-0.192,-0.075] 0 -0.159 4 0.15 [0,0] [-0.196,-0.08] [0.118,0.177] 0OUMV -0.162 [0,0] [-0.195,-0.096] 0 3.122 -0.091 [0,0] [0.916,17.092] [-0.119,-0.036]OUMA 0.123 0 3 [0.096,0.146] -0.053 [0,0] [-0.074,-0.03] 0.207OUMVA 15.291 4 [0.137,0.477] – 5 0.105 [4.636,43.424] 0.151 [0.077,0.163] 0.53OUBMi [0.059,0.285] 21.291 -0.091 17.889 5 [0.45,0.65] [12.123,39.902] 0.005 [-0.119,-0.036] 6 [4.882,42.186] 0.15 [0.005,0.005] 0.26BMOUi 0.05 [0.118,0.177] [0.23,0.32] [0.01,0.07] 24.445OUBM [10.766,50.789] -0.028 4 0.02 21.291 0.033 0.01 1.797 0.207 [-0.03,-0.026] [0,0.03] [12.123,39.902] [0.021,0.066] [0,0.02] [0.063,43.782] [0.137,0.477] 24.258 – BMOU – 4 -0.033 [10.321,52.843] – 0.188 [-0.036,-0.03] 0.005 2.25 -0.04 0.1 [0.122,0.336] -0.032 [0.005,0.005] -0.049 [1.027,5.547] -0.028 [0.01,0.06] [-0.043,-0.034] 3.587 [-0.037,-0.027] -0.018 3 [-0.055,-0.038] [2.64,4.543] [-0.03,-0.026] [-0.024,-0.012] 0.01 2.414PC3 -0.012 [0,0] [1.005,4.92] 3 0.038 [-0.02,0] 0.171 [0.018,0.119] 2.751 [0.118,0.285] 0.033 0 [0.442,33.744] -0.049 [0.031,0.034] -0.033 [0,0]Models -0.049 -0.032 [-0.056,-0.039] -0.02 [-0.036,-0.03] 0.223 [-0.056,-0.038] [-0.037,-0.027] -0.057 -0.017 0.188 0 [-0.027,-0.012] [0.075,0.99] -0.041 [-0.064,-0.051] 4.309 [-0.019,-0.014] [0.122,0.336] [0,0]BM1 [-0.047,-0.035] [1.556,7.299] 3.587 [2.64,4.543] BMV 4.403 p – [1.848,7.136] 0.014 -0.016 0.033 0.171 -0.02 [0.007,0.017] [-0.026,-0.008] [0.031,0.034] BM1m [0.118,0.285] [-0.028,-0.012] 0.029 – 0.223 -0.041 0.021 [0.02,0.055] 0.019 0.169 [-0.047,-0.035] [0.075,0.99] -0.023 -0.05 9.117BMVm [0.016,0.035] AICc [0.014,0.033] [0.075,0.662] – [-0.033,-0.017] [-0.059,-0.039] [5.89,13.777] weight 2OU1 3 3 – 6.422OUM [4.583,9.904] 0.02 0.005 4 -0.045 9.189 0.003 -0.023 [0,0.03] [0.004,0.007] 0.289 [-0.051,-0.037] [5.72,13.364] [-0.033,-0.017] [0.003,0.003] 0.01OUMV [0.11,1.407] – 0.021 [0,0.01] – 0.019 0.12 0.169 -0.024 0.009 3.756 [0.016,0.035] [0.014,0.033] [0.03,0.16] [0.075,0.662] 0.028 [-0.033,-0.017] [0.007,0.012] [2.774,5.29]OUMA [0.019,0.052] 0.05 3 [0.02,0.08] 0.003OUMVA [0.003,0.003] 4 -0.045 5 6.422 – [-0.051,-0.037] [4.583,9.904] 0.028 0.3OUBMi 3.717 -0.024 [0.019,0.049] 0.031 5 [0.13,0.45] 0.018 [2.825,5.463] [-0.033,-0.017] 6 [0.028,0.034] 0.006 [0.015,0.019] 0.1 –BMOUi – 0.003 0.035 0.12 – [0.004,0.009] [0.03,0.15] 0.017 [0.003,0.003] 0.007 [0.03,0.039] [0.03,0.16] [0.015,0.019] [0.005,0.009] 1.132OUBM 4 [0.884,1.613] 0.03 0.02 [0.01,0.04] 0.032 0.015 [0.01,0.03] [0.021,0.05]BMOU [0.014,0.016] 0.796 4 0.019 [0.7,0.974] [0.013,0.023] 0.045 0.03 1.117 0.01 [0.023,0.225] [0.021,0.051] 0.022 -0.004 [0.865,1.458] 0.003 [0,0.01] 0.018 3 0.018 [0.017,0.029] [-0.009,-0.001] 0.003 [0.003,0.003] [0.015,0.019] [0.016,0.021] [0.003,0.003] 0.13 0.008 0.482 – 0.017 0.022 [0.02,0.16] [0.006,0.011] [0.408,0.568] 0.023 3 0.015 -0.001 [0.015,0.019] [0.016,0.026] [0.019,0.029] [-0.004,0.003] [0.014,0.016] 0.01 [0,0.01] 0.032 0.486 [0.021,0.05] – 0.08 0.796 [0.411,0.583] 0.004 [0.01,0.1] [0.7,0.974] – 0.03 [0.003,0.004] 0.016 0.01 [0.021,0.051] 0.01 0.017 [0.014,0.017] [0.005,0.017] [0.009,0.013] [0.014,0.02] 0.004 0.019 0.01 [0.004,0.005] 0.005 [0.013,0.107] 0.01 [0.005,0.018] [0.004,0.006] 0.005 [0.006,0.017] [0.005,0.007] 0.018 0.015 [0.015,0.021] 0.003 [0.012,0.017] 0.004 [0.003,0.004] 0.019 [0.003,0.004] 0.016 – [0.013,0.107] – – – [0.014,0.017] 0.004 0.017 [0.004,0.005] 0.002 2.865 [0.014,0.02] [0.002,0.003] 0.02 0.003 [2.249,3.919] [0.013,0.209] [0.003,0.005] 1.359 0.002 2.135 – [1.089,1.744] [0.002,0.002] 0.018 [1.616,2.726] 0.015 [0.015,0.021] – [0.012,0.017] – 0.002 – 0.004 – [0.004,0.005] [0.002,0.002] 0.854 – [0.702,1.063] 0.02 0.015 1.359 [0.013,0.209] 0.733 [0.01,0.027] [1.089,1.744] 0.002 [0.569,0.944] [0.002,0.002] 0.005 0.006 [0.004,0.007] [0.006,0.008] 0.048 [0.02,0.229] 0.449 [0.394,0.524] 0.275 0.399 0.002 [0.249,0.301] 0.003 [0.348,0.467] [0.001,0.002] [0.002,0.004] 0.005 0.006 0.002 [0.004,0.007] [0.006,0.008] [0.002,0.002] 0.146 [0.118,0.17] – 0.275 0.148 0.002 [0.249,0.301] [0.118,0.177] [0.001,0.002] 0.002 – [0.002,0.003] 0.003 – [0.002,0. parameter indicate the global or regime means for the BM-type and OUBM-type models, whereas it indicates the stationary optimum trait for the OU-type Table S6: and inferred pollinators were includedvalues are in the given analyses. forθ the Mean values parameter from estimates. themodels. posterior Numbers distribution in of brackets species indicate trees the are 25% given and for the the AICc 75% weights, quantiles. whereas The median best model for each component is in bold. The

Page 10 of 15 Joly & al. Supplementary tables and ﬁgures

Table S7: Matrix of stationary variance estimates obtained with the OUM multivariate model, averaged over the posterior distribution of species trees with only species with conﬁrmed pollination strategies. Median values are reported and numbers in brackets indicate the 25% and the 75% quantiles.

PC1 PC2 PC3 PC1 0.0058 [0.0055, 0.0062] PC2 0.00063 [0.00053, 0.00081] 0.0029 [0.0029, 0.0030] PC3 -0.0010 [-0.0013, -0.00070] -0.00058 [-0.00064, -0.00053] 0.0020 [0.0018, 0.0022]

Page 11 of 15 Joly & al. Supplementary tables and ﬁgures

Table S8: Model performance with the multivariate evolutionary models ﬁtted on the ﬁrst three principal components of the morphospace when all species were included in the analyses, including those with inferred pollinator strategies. The mean values obtained from the posterior distribution of species trees are given; numbers in brackets indicate the 25% and the 75% quantiles. The best model is in bold.

models logLik param AICc weight BM1 108.11 [98.93,120.48] 9 0 [0,0] BMV 119.69 [112.64,128.69] 15 0 [0,0] BM1m 140.93 [133.11,152.03] 12 0 [0,0.01] BMVm 147.9 [140.66,156.66] 18 0 [0,0] OU1 136.62 [132.59,140.57] 15 0 [0,0] OUM 164.32 [162.02,166.75] 18 1 [0.99,1] OUBM 123.15 [117.04,131.4] 15 0 [0,0] BMOU 121.65 [115.22,130.89] 15 0 [0,0] OUBMr 142.66 [140.17,146.98] 21 0 [0,0] BMOUr 130.75 [123.82,139.6] 21 0 [0,0]

Page 12 of 15 Joly & al. Supplementary tables and ﬁgures

Table S9: Model parameters for the multivariate OUM model, which was the model that received the highest AICc weight (Table S8), when all species are included in the analysis. The mean values obtained from the posterior distribution of species trees are given; numbers in brackets indicate the 25% and the 75% quantiles.

parameters PC1 PC2 PC3 θhum 0.173 [0.169,0.177] -0.042 [-0.052,-0.037] 0.015 [0.008,0.019] θmix -0.16 [-0.162,-0.158] -0.017 [-0.018,-0.014] 0.011 [0.009,0.016] σ2 3.132 [0.987,10.306] 0.7 [0.232,2.32] 0.091 [0.018,0.372] phylogenetic half-life 0.001 [0,0.003] 0.013 [0.004,0.039] 0.122 [0.079,0.21] stationary variance 0.004 [0.004,0.005] 0.003 [0,0] 0.001 [-0.001,0]

Page 13 of 15 Joly & al. Supplementary tables and ﬁgures

● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● Pollination syndrome ● ● ● ● 0.28 ● ● ● ● ● ● G. bracteosa ● ● ● ● ● ● ● ● ● ● ● ● 0.31 ● ● ● ● ● ● ● ● ● ● Bat specialist ● ● ● ● ● ● ● ● ● G. nipensis ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 0.22 ● ● ● ● ● Mixed-pollination strategy ● ● ● ● ● ● ● ● ● G. viridiflora ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 0.95 ● ● ● ● Hummingbird specialist ● ● ● ● ● ● ● G. sylvicola ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● Moth specialist 0.9 ● ● 0.93 G. quisqueyana ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● Bee specialist ● ● ● ● ● G. sintenisii ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● G. ekmanii ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● Syndrome confirmed 0.8 G. aspera ● ● ● ● ● 0.76 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 0.5 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● G. cubensis ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 0.7 ● ● ● ● ● ● G. pulverulenta ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 0.76 ● G. pedunculosa ● ● ● ● ● ● ● 0.31 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● G. ventricosa ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● G. fruticosa ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 0.59 0.71 G. cuneifolia ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 0.49 ● G. reticulata ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 0.61 G. depressa ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 0.7 G. purpurascens ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 0.69 0.87 ● ● ● ● ● ● ● ● ● ● ● ● ● G. yamuriensis ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● G. acaulis ● ● ● 0.86 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 0.65 G. pedicellaris ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● G. humilis ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 0.99 G. clarensis ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 0.25 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● G. ferruginae ● ● ● ● ● ● ● ● ● ● ● ● 0.63 ● ● ● ● ● ● ● ● ● ● ● ● ● ● G. citrina ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 0.92 ● ● ● ● ● ● ● ● ● ● ● ● G. salicifolia ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 0.92 R. bicolor ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● G. sp nov ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 0.15 R. sp nov ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 0.19 R. berteroanum ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 0.63 ● ● ● ● ● ● ● ● ● ● ● ● R. bullatum ● ● ● ● ● ● ● ● ● ● 0.39 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 0.67 R. auriculatum ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● R. vernicosum ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 0.76 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 0.33 R. grandiflorum ● ● ● ● ● ● ● ● ● ● ● ● 0.75 ● ● ● ● ● ● ● ● ● ●

● ● ● ● ● ● ● ● R. leucomallon ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 0.76 R. lomense ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 1 ● ● ● ● ● ● R. rupincola ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 1 ● ● ● ● ● ● ● ● ● ● ● ● ● ● R. earlei ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●

● ● ● ● ● ● ● ● ● ● ● R. tomentosum ● ● ● ● ● 0.6 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 0.65 R. crenulatum ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●

● ● ● ● ● ● ● ● ● ● 0.96 R. exsertum ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●

● ● ● ● ● ● ● ● ● ● ● ● R. intermedium ● ● ● 0.32 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● R. minus ● ● Bellonia spinosa

0.003

Figure S1: Species phylogeny showing mean corolla shapes (after Procrustes analysis). Pollination strategies are shown with those that have been conﬁrmed indicated by a black contour. Pie charts represent the joint probability of each state at nodes as estimated by stochastic mapping from all species, that is including species with inferred pollinators. Clade posterior probabilities are shown above branches. Outgroup taxa are not shown.

Page 14 of 15 Joly & al. Supplementary tables and ﬁgures

Observed data Simulated data

● 0.5 ●

● pollination 0.0 ● ● hummingbird mixed−pollination ● ● −0.5 Phenotypic correlation

−1.0

PC1 vs. PC2 PC1 vs. PC3 PC2 vs. PC3 PC1 vs. PC2 PC1 vs. PC3 PC2 vs. PC3 Principal components compared

Figure S2: Graphical representation of the evolutionary trait correlations (from standardized evolutionary rates matrices) obtained with the BMVm multivariate model when all species were included in the analysis, for the observed data (left panel) and for data simulated under the best fitting model (OUM; right panel). Symbols represent the median correlation and the lines the 25% and 75% quantiles for both hummingbirds and mixed-pollination strategies. No artifactual differences are detected between the two groups when fitting models on traits simulated with the OUM model and thus with a common evolutionary covariance (right panel, see text).

Page 15 of 15