Molecular Evolution of H+-ATPases. I. Methanococcus and Sulfolobus are Monophyletic with Respect to Eukaryotes and Eubacteria Johann Peter Gogarten, Thomas Rausch, Paul Bernasconi, Henrik Kibak, and Lincoln Taiz Biology Department, Thimann Laboratories, University of California, Santa Cruz, California 95064 Z. Naturforsch. 44c, 641—650 (1989); received April 6, 1989 Molecular Evolution, Methanobacteria, Archaebacteria, ATPase, Polymerase Chain Reaction The classification of methanogenic bacteria as archaebacteria based on 16 s rRNA sequence analysis is currently in dispute. To provide an alternative molecular marker, the polymerase chain reaction technique was used to amplify a 930 bp fragment of Methanococcus thermolithotrophicus genomic DNA corresponding to the catalytic domain of the membrane H + -ATPase. The deduced amino acid sequence was 54-58% identical to the ~ 70 kDa subunits of Sulfolobus acidocaldarius and the eukaryotic vacuolar-type H+-ATPase, and only 29% identical to the beta subunit of the eubacterial-type F{lF,-ATPases. Interestingly, a highly conserved aspartate residue in the phos­ phorylation domain of E 1 E2-ATPases (P-type) is conserved in the Methanococcus sequence, but is absent from all other known vacuolar and F0F,-ATPases. This suggests that the H +-ATPase of M. thermolithotrophicus , like that of M. voltae, may have a phosphorylated intermediate, despite belonging to the vacuolar-type class of proton pumps. Phylogenetic analysis using Felsenstein's maximum likelihood method and Lake’s evolutionary parsimony method confirmed that the H f- ATPases of the two archaebacteria, Methanococcus and Sulfolobus , when compared to eukaryo­ tic vacuolar-type ATPases and eubacterial F0Fr ATPases, form a monophyletic group. Introduction methanogens and halobacteria group with the other As first proposed by Woese, Fox and colleagues bacteria, while the sulfur-dependent thermoacid- [1—3], the Archaebacteria include the methanogens, ophiles and the eukaryotic host cell form a separate extreme halophiles and sulfur metabolizing thermo- “eocyte” branch diverging from the common ances­ acidophiles. Archaebacteria are distinguished from tor [7]. Given the conflicting results from the analysis the Eubacteria on the basis of their 16 s rRNA se­ of 16 s rRNA, phylogenetic studies of other molecu­ quences, the presence of ether-linked lipids in their lar markers are needed. membranes and other biochemical criteria. A third, H+-pumping ATPases are highly conserved, prob­ equally distant branch from the common ancestor, or ably ubiquitous enzymes which are proving to be use­ progenote, was hypothesized to lead to the eukary­ ful for evolutionary comparisons of highly divergent otes [4], Recently, Lake has challenged the concept species [8—10]. H+-ATPases have been divided into of a monophyletic archaebacterial kingdom based on three main categories: P (or ElE2-type), F (or F 0F r studies or ribosome morphology [5] and a re-analysis type) and V (or vacuolar type) [11, 12]. P-ATPases of 16 s rRNA sequences using a rate-independent function as cation pumps on the plasma membranes m ethod [ 6 , 7], According to the Lake tree, the of eukaryotes and eubacteria (e.g. E. coli [13] and Streptococcus faecalis [14]). The diagnostic feature of the P-ATPases is the formation of a phosphoenzyme intermediate during catalysis. F-ATPases are present Abbreviations: 60's, ~60 kDa noncatalytic subunits of V- ATPases; 70's, —70 kDa catalytic subunits of V-ATPases; in mitochondria and chloroplasts of eukaryotes, and F-ATPases, H 1 pumping ATPases of the eubacterial type in the plasma membranes of most eubacteria. (F0F|-ATPases) P-ATPases, ATPases that have a phos­ V-ATPases, the most recently discovered class of phorylated catalytic intermediate; PCR, polymerase chain H+-ATPases, are present on membranes of the reaction; ra^-polymerase, heat resistant DNA polymerase from Thermus aquaticus ; V-ATPases, H + pumping ATP­ vacuolar system in eukaryotic cells where they serve ases of the vacuolar type. to acidify intracellular compartments. Until now, Reprint requests to Dr. J. P. Gogarten. neither F- or the V-type ATPases have been found to Verlag der Zeitschrift für Naturforschung. D-7400 Tübingen form a phosphoenzyme catalytic intermediate [ 1 1, 0341 - 0382/89/0700 - 0641 $01.30/0 12]- 642 J . P. Gogarten et al. • Molecular Evolution of H -ATPases The membrane ATPases of a number of archae- Primer synthesis bacteria have been characterized biochemically. The design of oligonucleotide primers represent­ These studies have indicated that the H +-ATPases of ing consensus sequences in highly conserved regions Halobacterium halobium [15], H. saccharovorum of other already known H +-ATPase 70 kDa subunits [16], Sulfolobus acidocaldarius [17, 18] and is explained in detail in the Results section. Methanosarcina barkeri [19] are in some respects more similar to V-ATPases than to F-ATPases. An Polymerase chain reaction (PCR) exception seems to be the Methanococcus voltae The reaction volume was 100 (il containing 0.2 pig ATPase, which forms a phosphoenzyme interme­ genomic DNA (template), 1 |j.m each prim er, 10 mM diate and is therefore classified as a P-type ATPase Tris/HCl, pH 8.3, 50 mM KC1, 1.5 mM MgCl2, 0.01% [20]. (w/v) gelatin, 1.25 mM of each nucleotide (dATP, The sequences of the a and ß subunits of 5. acido­ dC T P, dTTP, dG T P) and2.5 unitsof Jag-polym erase. caldarius [2 1 , 2 2] were recently compared with those The mix was overlayered with mineral oil. The tem­ of the ß and a subunits, respectively, of the F-ATP­ perature program for amplification (run in a Perkin- ases, and the 70 and 60 kDa subunits, respectively, Elmer Cetus DNA Thermal Cycler, Norwalk, CT, of the V-ATPases [10]. The Sulfolobus subunits were U.S.A.) was as follows: 5 min at 94 °C (initial melt­ 50% identical to the V-ATPase subunits, and only ing) followed by 1 0 amplification cycles with a slow 25% identical to the F-ATPase subunits, clearly indi­ temperature ramp between 37 °C and 72 °C (1 min cating that the Sulfolobus A TPase is a V-type H +- 94 °C — ramp 1 °C/sec — 2 min 37 °C — ramp 7 °C/ ATPase. Moreover, since the two types of subunits min — 3 min 72 °C — ramp 1 °C/sec), and by 20 more (60's and 70's in V-, and a and ß in F-ATPases) are amplification cycles omitting the slow ramp. The homologous to each other, they presumably arose by final 72 °C step was extended to 20 min. gene duplication prior to the divergence of Archae- The reaction mixtures were directly separated by bacteria, Eubacteria and Eukaryotes from the com­ electrophoresis on 1 % agarose gels, and the am­ mon ancestor. This view is supported by the phylo­ plified products were visualized with ethidium genetic analysis of the available sequences. Based on bromide. The DNA was eluted by adsorption to glass this analysis we have proposed that the progenote powder according to [23]. diverged into two main branches: one giving rise to the Eubacteria, the other leading to Sulfolobus and Cloning and sequencing the eukaryotic host cell [ 1 0]. After Apal digestion the eluted amplified product While the above scheme is consistent with Lake’s was cloned into Apal/EcoRV-cut pBluescript tree, it leaves unanswered the question of the rela­ (pBluescript DNA sequencing system, Stratagene, tionship between Sulfolobus and the other Archae- La Jolla CA, U.S.A.). Subclones were generated bacteria. Using oligonucleotide primers directed to using the restriction sites for Hindlll (261), EcoRI the highly conserved flanking sequences of the core (580) and PstI (750). The whole sequence was cov­ region of the V-ATPase 70 kDa subunit, we ampli­ ered by at least two different subclones. Double fied and subcloned a 930 nucleotide fragment of stranded sequencing was performed with sequenase Methanococcus thermolithotrophicus genomic DNA (U .S. Biochem . C orp.) [24] using [a 35 S]thiodATP as by the polymerase chain reaction (PCR) technique. label [25]. Subclones were sequenced in both direc­ The results show that Methanococcus and Sulfolobus tions such that the final sequence was the result of belong to a monophyletic group with respect to the four independent sequencing reactions. To assess the eubacteria and eukaryotes. fidelity of the 7tfg-polymerase the products of two other independent PCRs were partially sequenced (see Results section). Materials and Methods Chemicals D N A source Tag-polymerase from Perkin-Elmer Cetus. Re­ Genomic DNA from Methanococcus thermolitho­ striction enzymes from Bethesda Research trophicus was a gift from Dr. Jordan Konisky, Uni­ Laboratories. [a 35 S]ThiodATP (specific activity versity of Illinois. 1000 Ci/mmol) from New England Nuclear. J. P. Gogarten et al. ■ Molecular Evolution of H + -ATPases 643 D . carota 4 0 8 ACACAAGCCCCTATCTGTGGAGTTGGGTCCTGG N . crassa 8 3 0 AGGCAAGCCTCTCTCTGTCGGACTTGGCCCTGG S. acidocaldarius2 0 1 TGGAGCCCCATTATCAGTAGAATTAGGTCCTGG LEFT PRIMER: 5' AGGCGGGCCCCTATCTGTCGAATTTGGTCCTGG 3 ' A p a l D . carota 1 3 8 7 TGCTGTTTCACCTCCAGGAGGAGATTTTTCT N. crassa 1 8 0 5 TGCTGTCTCTCCCCCCGGTGGTGATTTCTCT S. acidocaldarius1 1 6 7 TGCAGTTTCTCCTCCTGGAGGTGATTTTACA 5 ' TGCTGTTTCTCCTCCCGGAGGTGATTTTAAA 3 1 RIGHT PRIMER: 3 ' ACGACAAAGAGGAGGGCCTCCACTAAAATTT 5 ' D r a I Fig. 1. Sequences of the left and right primer used for the specific amplification of genomic DNA from Melhanococcus thermolithotrophicus coding for part of the catalytic subunit of the “archaebacterial-vacuolar ATPase”. The primer sequences are shown aligned to the DNA sequences from Sulfolobus acidocaldarius, Neurospora crassa and Daucus carota that were used to construct the primers. The complementary strand (bottom line) was used in the case of the right primer in order to prime the synthesis of the strand in the direction of the left primer. The conserved regions selected to design the primers are approx. 950 bp apart in the cDNA sequences. Mismatches between primers and cDNA sequences are emphasized by bold type face. A restriction site (Apal/Dral) was included at the end of each primer in order to facilitate subcloning.