DOCSLIB.ORG

Molecular Evolution of H+-Atpases. I. Methanococcus and Sulfolobus Are Monophyletic with Respect to Eukaryotes and Eubacteria

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Molecular Evolution of H+-Atpases. I. Methanococcus and Sulfolobus Are Monophyletic with Respect to Eukaryotes and Eubacteria Molecular Evolution of H+-ATPases. I. Methanococcus and Sulfolobus are Monophyletic with Respect to Eukaryotes and Eubacteria Johann Peter Gogarten, Thomas Rausch, Paul Bernasconi, Henrik Kibak, and Lincoln Taiz Biology Department, Thimann Laboratories, University of California, Santa Cruz, California 95064 Z. Naturforsch. 44c, 641—650 (1989); received April 6, 1989 Molecular Evolution, Methanobacteria, Archaebacteria, ATPase, Polymerase Chain Reaction The classification of methanogenic bacteria as archaebacteria based on 16 s rRNA sequence analysis is currently in dispute. To provide an alternative molecular marker, the polymerase chain reaction technique was used to amplify a 930 bp fragment of Methanococcus thermolithotrophicus genomic DNA corresponding to the catalytic domain of the membrane H + -ATPase. The deduced amino acid sequence was 54-58% identical to the ~ 70 kDa subunits of Sulfolobus acidocaldarius and the eukaryotic vacuolar-type H+-ATPase, and only 29% identical to the beta subunit of the eubacterial-type F{lF,-ATPases. Interestingly, a highly conserved aspartate residue in the phos­ phorylation domain of E 1 E2-ATPases (P-type) is conserved in the Methanococcus sequence, but is absent from all other known vacuolar and F0F,-ATPases. This suggests that the H +-ATPase of M. thermolithotrophicus , like that of M. voltae, may have a phosphorylated intermediate, despite belonging to the vacuolar-type class of proton pumps. Phylogenetic analysis using Felsenstein's maximum likelihood method and Lake’s evolutionary parsimony method confirmed that the H f- ATPases of the two archaebacteria, Methanococcus and Sulfolobus , when compared to eukaryo­ tic vacuolar-type ATPases and eubacterial F0Fr ATPases, form a monophyletic group. Introduction methanogens and halobacteria group with the other As first proposed by Woese, Fox and colleagues bacteria, while the sulfur-dependent thermoacid- [1—3], the Archaebacteria include the methanogens, ophiles and the eukaryotic host cell form a separate extreme halophiles and sulfur metabolizing thermo- “eocyte” branch diverging from the common ances­ acidophiles. Archaebacteria are distinguished from tor [7]. Given the conflicting results from the analysis the Eubacteria on the basis of their 16 s rRNA se­ of 16 s rRNA, phylogenetic studies of other molecu­ quences, the presence of ether-linked lipids in their lar markers are needed. membranes and other biochemical criteria. A third, H+-pumping ATPases are highly conserved, prob­ equally distant branch from the common ancestor, or ably ubiquitous enzymes which are proving to be use­ progenote, was hypothesized to lead to the eukary­ ful for evolutionary comparisons of highly divergent otes [4], Recently, Lake has challenged the concept species [8—10]. H+-ATPases have been divided into of a monophyletic archaebacterial kingdom based on three main categories: P (or ElE2-type), F (or F 0F r studies or ribosome morphology [5] and a re-analysis type) and V (or vacuolar type) [11, 12]. P-ATPases of 16 s rRNA sequences using a rate-independent function as cation pumps on the plasma membranes m ethod [ 6 , 7], According to the Lake tree, the of eukaryotes and eubacteria (e.g. E. coli [13] and Streptococcus faecalis [14]). The diagnostic feature of the P-ATPases is the formation of a phosphoenzyme intermediate during catalysis. F-ATPases are present Abbreviations: 60's, ~60 kDa noncatalytic subunits of V- ATPases; 70's, —70 kDa catalytic subunits of V-ATPases; in mitochondria and chloroplasts of eukaryotes, and F-ATPases, H 1 pumping ATPases of the eubacterial type in the plasma membranes of most eubacteria. (F0F|-ATPases) P-ATPases, ATPases that have a phos­ V-ATPases, the most recently discovered class of phorylated catalytic intermediate; PCR, polymerase chain H+-ATPases, are present on membranes of the reaction; ra^-polymerase, heat resistant DNA polymerase from Thermus aquaticus ; V-ATPases, H + pumping ATP­ vacuolar system in eukaryotic cells where they serve ases of the vacuolar type. to acidify intracellular compartments. Until now, Reprint requests to Dr. J. P. Gogarten. neither F- or the V-type ATPases have been found to Verlag der Zeitschrift für Naturforschung. D-7400 Tübingen form a phosphoenzyme catalytic intermediate [ 1 1, 0341 - 0382/89/0700 - 0641 $01.30/0 12]- 642 J . P. Gogarten et al. • Molecular Evolution of H -ATPases The membrane ATPases of a number of archae- Primer synthesis bacteria have been characterized biochemically. The design of oligonucleotide primers represent­ These studies have indicated that the H +-ATPases of ing consensus sequences in highly conserved regions Halobacterium halobium [15], H. saccharovorum of other already known H +-ATPase 70 kDa subunits [16], Sulfolobus acidocaldarius [17, 18] and is explained in detail in the Results section. Methanosarcina barkeri [19] are in some respects more similar to V-ATPases than to F-ATPases. An Polymerase chain reaction (PCR) exception seems to be the Methanococcus voltae The reaction volume was 100 (il containing 0.2 pig ATPase, which forms a phosphoenzyme interme­ genomic DNA (template), 1 |j.m each prim er, 10 mM diate and is therefore classified as a P-type ATPase Tris/HCl, pH 8.3, 50 mM KC1, 1.5 mM MgCl2, 0.01% [20]. (w/v) gelatin, 1.25 mM of each nucleotide (dATP, The sequences of the a and ß subunits of 5. acido­ dC T P, dTTP, dG T P) and2.5 unitsof Jag-polym erase. caldarius [2 1 , 2 2] were recently compared with those The mix was overlayered with mineral oil. The tem­ of the ß and a subunits, respectively, of the F-ATP­ perature program for amplification (run in a Perkin- ases, and the 70 and 60 kDa subunits, respectively, Elmer Cetus DNA Thermal Cycler, Norwalk, CT, of the V-ATPases [10]. The Sulfolobus subunits were U.S.A.) was as follows: 5 min at 94 °C (initial melt­ 50% identical to the V-ATPase subunits, and only ing) followed by 1 0 amplification cycles with a slow 25% identical to the F-ATPase subunits, clearly indi­ temperature ramp between 37 °C and 72 °C (1 min cating that the Sulfolobus A TPase is a V-type H +- 94 °C — ramp 1 °C/sec — 2 min 37 °C — ramp 7 °C/ ATPase. Moreover, since the two types of subunits min — 3 min 72 °C — ramp 1 °C/sec), and by 20 more (60's and 70's in V-, and a and ß in F-ATPases) are amplification cycles omitting the slow ramp. The homologous to each other, they presumably arose by final 72 °C step was extended to 20 min. gene duplication prior to the divergence of Archae- The reaction mixtures were directly separated by bacteria, Eubacteria and Eukaryotes from the com­ electrophoresis on 1 % agarose gels, and the am­ mon ancestor. This view is supported by the phylo­ plified products were visualized with ethidium genetic analysis of the available sequences. Based on bromide. The DNA was eluted by adsorption to glass this analysis we have proposed that the progenote powder according to [23]. diverged into two main branches: one giving rise to the Eubacteria, the other leading to Sulfolobus and Cloning and sequencing the eukaryotic host cell [ 1 0]. After Apal digestion the eluted amplified product While the above scheme is consistent with Lake’s was cloned into Apal/EcoRV-cut pBluescript tree, it leaves unanswered the question of the rela­ (pBluescript DNA sequencing system, Stratagene, tionship between Sulfolobus and the other Archae- La Jolla CA, U.S.A.). Subclones were generated bacteria. Using oligonucleotide primers directed to using the restriction sites for Hindlll (261), EcoRI the highly conserved flanking sequences of the core (580) and PstI (750). The whole sequence was cov­ region of the V-ATPase 70 kDa subunit, we ampli­ ered by at least two different subclones. Double fied and subcloned a 930 nucleotide fragment of stranded sequencing was performed with sequenase Methanococcus thermolithotrophicus genomic DNA (U .S. Biochem . C orp.) [24] using [a 35 S]thiodATP as by the polymerase chain reaction (PCR) technique. label [25]. Subclones were sequenced in both direc­ The results show that Methanococcus and Sulfolobus tions such that the final sequence was the result of belong to a monophyletic group with respect to the four independent sequencing reactions. To assess the eubacteria and eukaryotes. fidelity of the 7tfg-polymerase the products of two other independent PCRs were partially sequenced (see Results section). Materials and Methods Chemicals D N A source Tag-polymerase from Perkin-Elmer Cetus. Re­ Genomic DNA from Methanococcus thermolitho­ striction enzymes from Bethesda Research trophicus was a gift from Dr. Jordan Konisky, Uni­ Laboratories. [a 35 S]ThiodATP (specific activity versity of Illinois. 1000 Ci/mmol) from New England Nuclear. J. P. Gogarten et al. ■ Molecular Evolution of H + -ATPases 643 D . carota 4 0 8 ACACAAGCCCCTATCTGTGGAGTTGGGTCCTGG N . crassa 8 3 0 AGGCAAGCCTCTCTCTGTCGGACTTGGCCCTGG S. acidocaldarius2 0 1 TGGAGCCCCATTATCAGTAGAATTAGGTCCTGG LEFT PRIMER: 5' AGGCGGGCCCCTATCTGTCGAATTTGGTCCTGG 3 ' A p a l D . carota 1 3 8 7 TGCTGTTTCACCTCCAGGAGGAGATTTTTCT N. crassa 1 8 0 5 TGCTGTCTCTCCCCCCGGTGGTGATTTCTCT S. acidocaldarius1 1 6 7 TGCAGTTTCTCCTCCTGGAGGTGATTTTACA 5 ' TGCTGTTTCTCCTCCCGGAGGTGATTTTAAA 3 1 RIGHT PRIMER: 3 ' ACGACAAAGAGGAGGGCCTCCACTAAAATTT 5 ' D r a I Fig. 1. Sequences of the left and right primer used for the specific amplification of genomic DNA from Melhanococcus thermolithotrophicus coding for part of the catalytic subunit of the “archaebacterial-vacuolar ATPase”. The primer sequences are shown aligned to the DNA sequences from Sulfolobus acidocaldarius, Neurospora crassa and Daucus carota that were used to construct the primers. The complementary strand (bottom line) was used in the case of the right primer in order to prime the synthesis of the strand in the direction of the left primer. The conserved regions selected to design the primers are approx. 950 bp apart in the cDNA sequences. Mismatches between primers and cDNA sequences are emphasized by bold type face. A restriction site (Apal/Dral) was included at the end of each primer in order to facilitate subcloning.
Load more

Recommended publications
  • Counts Metabolic Yr10.Pdf
    Advanced Review Physiological, metabolic and biotechnological features of extremely thermophilic microorganisms James A. Counts,1 Benjamin M. Zeldes,1 Laura L. Lee,1 Christopher T. Straub,1 Michael W.W. Adams2 and Robert M. Kelly1* The current upper thermal limit for life as we know it is approximately 120C. Microorganisms that grow optimally at temperatures of 75C and above are usu- ally referred to as ‘extreme thermophiles’ and include both bacteria and archaea. For over a century, there has been great scientific curiosity in the basic tenets that support life in thermal biotopes on earth and potentially on other solar bodies. Extreme thermophiles can be aerobes, anaerobes, autotrophs, hetero- trophs, or chemolithotrophs, and are found in diverse environments including shallow marine fissures, deep sea hydrothermal vents, terrestrial hot springs— basically, anywhere there is hot water. Initial efforts to study extreme thermo- philes faced challenges with their isolation from difficult to access locales, pro- blems with their cultivation in laboratories, and lack of molecular tools. Fortunately, because of their relatively small genomes, many extreme thermo- philes were among the first organisms to be sequenced, thereby opening up the application of systems biology-based methods to probe their unique physiologi- cal, metabolic and biotechnological features. The bacterial genera Caldicellulosir- uptor, Thermotoga and Thermus, and the archaea belonging to the orders Thermococcales and Sulfolobales, are among the most studied extreme thermo- philes to date. The recent emergence of genetic tools for many of these organ- isms provides the opportunity to move beyond basic discovery and manipulation to biotechnologically relevant applications of metabolic engineering.
    [Show full text]
  • Life at High Temperatures Biotechnology in Yellowstone
    Life at High Temperatures by Thomas D. Brock Biotechnology in Yellowstone © 1994 Yellowstone Association for Natural Science, History & Education, Inc. Yellowstone National Park, Wyoming 82190. The thermophilic bacteria that live in the Yellowstone hot springs have been the foundation of impressive developments in medicine and biotechnology. The unique thermostable enzymes of these bacteria are finding wide industrial and medical use, and have become the basis of a multimillion dollar industry! When researchers began to study the biology of Yellowstone hot springs in the 1960s, the presence of these hyperthermophilic bacteria was not suspected. The upper temperature limit for life was thought to be around 73 degrees C (163 degrees F), which was actually the limit for photosynthetic organisms such as cyanobacteria. The preferred temperature for thermophilic bacteria was considered even lower, around 55 degrees C (131 degrees F). Because of the known effects of heat on biological structures such as proteins and DNA, it was thought that life at higher temperatures would be impossible. In fact, biochemists have known for over 100 years that enzymes (key cellular proteins) are destroyed by boiling. However, field observations in Yellowstone showed that in certain springs bacteria existed at much higher temperatures. Although these springs were rather small and not especially conspicuous among the impressive geysers and giant hot pools of the Yellowstone thermal basins, they were impressive microbial culture systems and turned out to be of great scientific and intellectual interest. It turns out that the enzymes of Yellowstone thermophiles are very tolerant of heat and are active even at boiling water temperatures.
    [Show full text]
  • High-Level Expression, Purification, and Thermus Aquatlcus DNA
    Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press High-level Expression, Purification, and Enzymatic Characterization of Full-length Thermus aquatlcus DNA Polymerase and a Truncated Form Deficient in 5' to 3' Exonuclease Activity Frances C. Lawyer, 1 Susanne Stoffel, 1 Randall K. Saiki, 2 Sheng-Yung Chang, 3 Phoebe A. Landre, ~ Richard D. Abrarnson, 1 and David H. Gelfand 1 1Program in Core Research and Departments of 2Human Genetics and 3Infectious Disease, Roche Molecular Systems, Alameda, California 94501 The Thermus aquaticus DNA poly- life of 9 min at 97.5~ The Stoffel I in the native host is quite low (0.01- merase I (Taq Pol I) gene was cloned fragment has a half-life of 21 min at 0.02% of total protein). The cloning and into a plasmid expression vector that 97.5~ Taq Pol I contains a polymer- expression of full-length 94-kD Taq Pol I utilizes the strong bacteriophage ization-dependent 5' to 3' exonu- in E. coli under control of the E. coli lac PL promoter. A truncated form of Taq clease activity whereas the Stoffel promoter r or the tac promoter (7~ has Pol I was also constructed. The two fragment, deleted for the 5' to 3' ex- been reported. Because polymerase constructs made it possible to com- onuclease domain, does not possess yields in these constructs were low pare the full-length 832-amino-acid that activity. A comparison is made (-0.01% of total protein in our initial Taq Pol I and a deletion derivative among thermostable DNA poly- construct; see ref.
    [Show full text]
  • Extremophiles
    Extremophiles These microbes thrive under conditions that would kill other creatures. The molecules that enable extremophiles to prosper are becoming useful to industry by Michael T. Madigan and Barry L. Marrs DEEP-SEA VENT HEAT-LOVING MICROBES (THERMOPHILES AND HYPERTHERMOPHILES) SEA ICE COLD-LOVING MICROBES (PSYCHROPHILES) Methanopyrus kandleri Polaromonas vacuolata thereby increasing efficiency and reduc- magine diving into a refreshingly ing costs. They can also form the basis of cool swimming pool. Now, think entirely new enzyme-based processes. I instead of plowing into water that tially serve in an array of applications. Perhaps 20 research groups in the U.S., is boiling or near freezing. Or consider Of particular interest are the enzymes Japan, Germany and elsewhere are now jumping into vinegar, household am- (biological catalysts) that help extremo- actively searching for extremophiles and monia or concentrated brine. The leap philes to function in brutal circumstanc- their enzymes. Although only a few ex- would be disastrous for a person. Yet es. Like synthetic catalysts, enzymes, tremozymes have made their way into many microorganisms make their home which are proteins, speed up chemical use thus far, others are sure to follow. As in such forbidding environments. These reactions without being altered them- is true of standard enzymes, transform- microbes are called extremophiles be- selves. Last year the biomedical field and ing a newly isolated extremozyme into cause they thrive under conditions that, other industries worldwide spent more a viable product for industry can take from the human vantage, are clearly ex- than $2.5 billion on enzymes for appli- several years.
    [Show full text]
  • Ionizing Radiation Resistance in Deinococcus Radiodurans
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by CSCanada.net: E-Journals (Canadian Academy of Oriental and Occidental Culture,... ISSN 1715-7862 [PRINT] Advances in Natural Science ISSN 1715-7870 [ONLINE] Vol. 7, No. 2, 2014, pp. 6-14 www.cscanada.net DOI: 10.3968/5058 www.cscanada.org Ionizing Radiation Resistance in Deinococcus Radiodurans LI Wei[a]; MA Yun[a]; XIAO Fangzhu[a]; HE Shuya[a],* [a]Institute of Biochemistry and Molecular Biology, University of South Treatment of D. radiodurans with an acute dose of 5,000 China, Hengyang, China. Gy of ionizing radiation with almost no loss of viability, *Corresponding author. and an acute dose of 15,000 Gy with 37% viability (Daly, Supported by the National Natural Science Foundation of China 2009; Ito, Watanabe, Takeshia, & Iizuka, 1983; Moseley (81272993). & Mattingly, 1971). In contrast, 5 Gy of ionizing radiation can kill a human, 200-800 Gy of ionizing radiation will Received 12 March 2014; accepted 2 June 2014 Published online 26 June 2014 kill E. coli, and more than 4,000 Gy of ionizing radiation will kill the radiation-resistant tardigrade. D. radiodurans can survive 5,000 to 30,000 Gy of ionizing radiation, Abstract which breaks its genome into hundreds of fragments (Daly Deinococcus radiodurans is unmatched among all known & Minton, 1995; Minton, 1994; Slade & Radman, 2011). species in its ability to resist ionizing radiation and other Surprisingly, the genome is reassembled accurately before DNA-damaging factors. It is considered a model organism beginning of the next cycle of cell division.
    [Show full text]
  • Thermophagetm Lysozyme
    Product number: Lys164 Lot number: 400-01 ThermoPhageTM Lysozyme Product information Table 1. Relative activity (%) Product Lys164: 100 μl enzyme solution containing 1 mg/ml Bacterial species TP Lysozyme HEWL enzyme in a storage buffer (25 mM K/PO4 pH 8.0, 50 mM KCl, 0.1% Triton X-100, 10 mM 2-mercaptoethanol, 50% glycerol Thermus thermophilus HB8 100 43 and 0.2 mM ZnSO4). Store at -80°C. Thermus aquaticus 100 41 Deinococcus radiodurans 25 21 Enzyme activity Echerichia coli 34 100 The enzyme breaks the cell wall of certain bacteria probably Salmonella panama 10 35 through hydrolysis of linkages between sugar residues and Pseudomonas fluorescence 13 40 peptides of the cell wall peptidoglycan. The enzyme has Serratia marcescens 28 35 optimum activity at pH 8.0 and >80% activity at temperatures between 40 and 99°C (Figure 1). Enterococcus faecalis 4 0 Bacillus subtilis 2 0 Description Bacillus cereus 15 75 ThermoPhage™ lysozyme originates from a thermophilic Staphylococcus aureus 0 0 bacteriophage known to infect thermophilic bacteria of the Staphylococcus intermedius 0 5 genus Thermus. The enzyme promotes lysis of certain Staphylococcus epidermis 0 0 bacterial species but has activity spectrum very different Sarcina lutea 2 48 from the commonly used Hen egg white lysozyme (HEWL). The enzyme has high activity against bacteria of the genus Streptococcus pyogenes 0 11 Thermus including Thermus thermophilus and Thermus Lactococcus lactis 0 11 aquaticus (Table 1) and is highly thermostable retaining 87% lytic activity after 6 h incubation at 95°C (Figure 2). Figure 2. Thermostability Applications The enzyme is suitable for efficient lysis of Thermus bacteria such as for increasing total DNA or plasmid DNA isolation (Figure 3).
    [Show full text]
  • Crystal Structure of a Thermus Aquaticus Diversity-Generating
    bioRxiv preprint doi: https://doi.org/10.1101/432187; this version posted October 1, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Crystal structure of a Thermus aquaticus diversity-generating retroelement variable protein Sumit Handa, Kharissa L Shaw, Partho Ghosh* Department of Chemistry & Biochemistry, University of California San Diego, La Jolla, CA 92093, USA *Correspondence: [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/432187; this version posted October 1, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Abstract Diversity-generating retroelements (DGRs) are widely distributed in bacteria, archaea, and microbial viruses, and bring about unparalleled levels of sequence variation in target proteins. While DGR variable proteins share low sequence identity, the structures of several such proteins have revealed the C-type lectin (CLec)-fold as a conserved scaffold for accommodating massive sequence variation. This conservation has led to the suggestion that the CLec-fold may be useful in molecular surface display applications. Thermostability is an attractive feature in such applications, and thus we studied the variable protein of a DGR encoded by the thermophile Thermus aquaticus. We report here the 2.8 Å resolution crystal structure of the variable protein from the T.
    [Show full text]
  • Evidence for a Phylogenetic Relationship of Thevmus Aquaticus
    INTERNATIONALJOURNAL OF SYSTEMATICBACTERIOLOGY, July 1986, p. 444453 Vol. 36, No. 3 0020-7713/86/030444-10$02 .OO/O Copyright 0 1986, International Union of Microbiological Societies Chemotaxonomic and Molecular-Genetic Studies of the Genus Thevmus: Evidence for a Phylogenetic Relationship of Thevmus aquaticus and Thevmus vubev to the Genus Deinococcus REINHARD HENSEL,’+* WILHELM DEMHARTER,’ OTTO KANDLER,l REINER M. KROPPENSTEDT,* AND ERKO STACKEBRANDT3 Botanisches Institut der Universitat, 8000 Munich 19, Federal Republic of Germany’; Deutsche Sammlung von Mikroorganismen, Gesellschaft fur Biotechnologische Forschung Braunschweig, 6100 Darmstadt, Federal Republic of Germany2;and Institut fur Allgemeine Mikrobiologie der Universitat, 2300 Kiel, Federal Republic of Germany3 For a detailed pheno- and genotypic characterization of the genus Thermus, the following seven represen- tative strains were analyzed: three extremely thermophilic strains (optimal temperature for growth, 65 to 75OC), Thermus aquaticus DSM 625, “Thermusjlavus” DSM 674, and ‘‘Thermus thermophilus” DSM 579; and four moderately thermophilic strains (optimal temperature for growth 55 to 60°C), Thermus ruber DSM 1279 and three new isolates (strains H1, H2, and H3) from sewage. All of these strains exhibited isobranched pentadecanoic and heptadecanoic acids as principal components of their fatty acids, possessed unsaturated menaquinones with eight isoprene units, and had deoxyribonucleic acid guanine-plus-cytosine contents of 59 to 65.5 mol%, and their cell walls contained a murein structure of the A3P variation (interpeptide bridge, Glyz). The clustering of the organisms into extremely and moderately thermophilic strains correlated well with molecular properties, such as the absorption spectra of their pigments and the ratio of pentadecanoic acid to heptadecanoic acid. This grouping was confirmed by the results of 16s ribosomal ribonucleic acid cataloging and deoxyribonucleic acid-deoxyribonucleic acid hybridization.
    [Show full text]
  • Description of Thermus Thermophilus (Yoshida and Oshima) Comb. Nov., a Nonsporulating Thermophilic Bacterium from a Japanese Thermal Spa
    INTERNATIONAL JOURNAL of SYSTEMATIC BACTERIOLOGY Voi. 24, No. 1 January 1974, p. 102-1 12 Printed in U.S.A. Copyright 0 1974 International Association of Microbiological Societies Description of Thermus thermophilus (Yoshida and Oshima) comb. nov., a Nonsporulating Thermophilic Bacterium from a Japanese Thermal Spa TAIRO OSHIMA' and KAZUTOMO IMAHORI Department of Agricultural Chemistry, Faculty of Agriculture, University of Tokyo, Tokyo, Japan The properties of an extremely thermophilic bacterium isolated from water at a Japanese hot spring and previously named Flavobacterium thermophihm are described. The cells are gram-negative, nonsporulating, aerobic rods containing yellow pigment. The optimum temperature for growth is between 65 and 72 C, the maximum being 85 C and the minimum being 47 C. The guanine plus cytosine content of the deoxyribonucleic acid of the thermophile is 69 mol %. This microorganism is sensitive to various antibiotics including those which are known to be rather ineffective against gram-negative bacteria. Spheroplast-like bodies are formed upon treating intact cells with egg-white lysozyme at 60 C. The spheres are osmotically more stable than mesophile protoplasts, and their rupture under hypotonic conditions is not complete unless 0.5% Brij 58 is added to the suspension. Bulk protein extracted from this thermophile is much more stable to heat than mesophile proteins, and only about 10% of the total protein is denatured by heating at 110 C for 5 min. Nevertheless, the amino acid composition of the bulk protein is similar to that of mesophile proteins. As the properties of this organism are similar to those of Thermus aquaticus (Brock and Freeze) and inasmuch as Flavobacterium is a poorly defined genus, this thermophilic microorganism is transferred to the genus Thermus as T.
    [Show full text]
  • Radiation Resistant of Native Deinococcus Spp. Isolated from the Lout Desert of Iran ‘‘The Hottest Place on Earth’’
    Int. J. Environ. Sci. Technol. (2014) 11:1939–1946 DOI 10.1007/s13762-014-0643-7 ORIGINAL PAPER Radiation resistant of native Deinococcus spp. isolated from the Lout desert of Iran ‘‘the hottest place on Earth’’ M. Mohseni • J. Abbaszadeh • A. Nasrollahi Omran Received: 27 January 2014 / Revised: 9 May 2014 / Accepted: 2 July 2014 / Published online: 23 July 2014 Ó Islamic Azad University (IAU) 2014 Abstract Two native ionizing radiation-resistant bacteria Keywords Deinococcus Á Radiation-resistant bacteria Á were isolated and identified from a soil sample collected Ionizing radiation Á Lout desert from extreme conditions of the Lout desert in Iran. The hottest land surface temperature has been recorded in the Lout desert from 2004 to 2009. Also, it is categorized as a Introduction hyper arid place. Both ionizing radiation and desiccation may cause damage on genome. Soil sample was irradiated Members of genus Deinococcus are able to live in extreme in order to eliminate sensitive bacteria then cultured in one- conditions such as arid deserts, under ionizing radiations, tenth-strength tryptic soy broth medium. Bacterial sus- ROS (reactive oxygen species) molecules and other oxi- pension used for radiation treatment. Morphological and dative stress inducing chemicals (Slade and Radman 2011). physiological characterization and phylogenetic studies This astonishing ability in Deinococcus is due to its repair based on 16S rRNA gene sequence were used for identifi- mechanisms (Minton 1994). It is well known that radiation- cation. The cells were rod shape, non-motile, non-spore resistant bacteria have evolved recombination repair and forming and gram positive. The 16S rRNA gene sequence strong antioxidant systems to survive ROS-mediated showed 99.5 % of similarity to Deinococcus ficus.
    [Show full text]
  • Biodiversity, Ecology, and Evolution of Hot Water Organisms in Yellowstone
    C ONFERENCE CORNER his story behind the 1966 discovery of Thermus aquaticus (Taq). This was the first life-form detected growing above the known upper temperature limit for life, then believed to be 720 C (1620 F) . A heat-stable enzyme from this organism, Ta q DNA polymerase, was essential in es- Codiscoverer of the polymerase tablishing the polymerase chain reaction chain reaction that is essential (PCR) process. This DNA amplification to forensic analysis and technique revolutionized DNA science detection of DNA based and earned its inventor, Kary B. Mullis, a diseases, David Gelfand Nobel prize in 1993. The gene express- collects hot water organisms from a Lower Geyser Basin hot ing Ta q polymerase was removed from spring. Researchers discovered specimen YT1-25104 (Yellowstone Type Thermus aquaticus here in 1, deposited in the American Type Cul- 1966, giving science and ture Collection as sample 25104) and in- industry the source for the serted into (“microbial livestock”) revolutionary DNA amplification E. coli technique and riches, topics of producing a genetically engineered organ- debate at the Yellowstone ism called pLSG1. Polymerase chain re- conference. action made possible a quantum leap in the DNA diagnostics industry including forensic analysis and detection of any type BIODIVERSITY, ECOLOGY, AND EVOLUTION of DNA based disease; it grosses $200 mil- lion per year for the patent holder, OF HOT WATER ORGANISMS IN Hoffmann-LaRoche, a Swiss pharmaceu- ELLOWSTONE ATIONAL ARK tical company. According to David Y N P : Gelfand (see photo this page), codiscov- erer of PCR, in his presentation on DNA Symposium and Issues Overview polymerase, “PCR generated revolutions within the revolution” in molecular biol- ogy by providing new tools in amplifying BY BOB LINDSTROM teric research field went a long way to- DNA.
    [Show full text]
  • Proceedings of the Indiana Academy of Science
    Thermal Pollution of a Small River by a Large University: Bacteriologic al Studies Thomas D. Brock and Ilse Yoder Department of Microbiology Indiana University, Bloomington, Indiana 47401 Abstract The Jordan River, which flows through the Bloomington campus of Indiana University, arises on the campus as a series of small cold-water springs. Temperature measurements indicate that one effect of the university on the river is an increased water temperature. The temperature optima of bacteria at selected stations on the river and in several cold-water springs away from the campus have been measured using an in situ radioisotope technique. It was found that the temperature optima in general parallel the temperature of the habitat. Studies also showed that Thermus aquaticus, a non-spore-forming extreme thermophile, was present in heated but not in non-heated water and might be used as an indicator of thermal pollution. Introduction The Jordan River, which flows through the Indiana University campus at Bloomington, arises on the campus as a series of small cold-water springs. This small river, with flow rate less than 1 cu ft/ sec, is now being influenced by the university complex, and tempera- ture measurements provide an excellent picture of how such a large building complex, in no significant way different from any other urban development, has increased the water temperature of the river. This has happened even though the university does not intentionally affect the river. The thermal additions arise either from unobserved leaks in steam lines, from condensate of air conditioning units, or from cooling units of distilled water systems.
    [Show full text]