A Novel Microbial Transglutarninase Derived from Streptoverticillium Baldaccii
A Novel Microbial Transglutarninase Derived From Streptoverticillium baldaccii
A Thesis submitted in fulfilment of the requirements of the degree of DOCTOR OF PHILOSOPHY of Griffith University
by Suzanne Schleehauf Negus B.Sc, M.ScSt
School of Biomolecular and Biomedical Science Faculty of Science Griffith University, Nathan Campus Queensland, Australia
July 2001 STATEMENT OF ORIGINALITY
This thesis contains original material that to the best of my knowledge has not been previously written or published by another person, except where due acknowledgment has been given in this thesis, nor has the material previously been submitted for a degree or diploma in any University.
Suzanne Schleehauf Negus ACKNOWLEDGMENTS
There are a number of people to whom I wish to acknowledge for their help, advice and friendship during the course of these studies.
Firstly I would like to thank my supervisors, Dr. Peter Rogers, Dr. Kathryn Tonissen and Associate Professor Frank Clarke for the opportunity to undertake this research and for their support, advice and helpful guidance which has made my PhD a memorable experience.
I would like to thank my colleagues in the laboratory, past and present, Michael Batzloff, Kelly Bloomfield, Simone Osborne, Ben Baldwin and Colm Cahill for their support, advice and friendship.
I would also like to thank the Meat and Livestock Australia (MLA) for their generous contributions to this project and Ajinomoto for providing the partially purified microbial transglutaminase from Streptoverticillium S-8 112.
Finally I would like to thank my husband Paul for his patience and support throughout my PhD. Transglutaminase (TGase; protein-glutamine y-glutamyltransferase, E.C. 2.3.2.13) is an enzyme that catalyses the acyl transfer reaction by introducing covalent cross-links between proteins, peptides and various primary amines. Until recently, commercial TGase has been derived from mammalian origin. Calcium-dependent TGase extracted from guinea-pig liver and blood plasma have been investigated for the purpose of their application in the food industry. However, supply, complicated separation and purification procedures as well as the requirement for calcium have made it almost impossible to apply mammalian TGase in food processing on an industrial scale.
Microbial transglutaminase (MTGase) was first purified from the culture filtrate of Streptoverticillium S-8112, a variant of Stv. mobaraense and subsequently the extracellular enzyme has been purified from the culture filtrate of other Streptoverticillit~m and Streptomyces species. This enzyme is easily obtained by microbial fermentation and has been found to have the ability to induce cross-linking and gelation of food proteins. In addition, MTGase does not require calcium for activation which is of great advantage for the food industry as many food-proteins are easily precipitated in the presence of ca2+ thus rendering them less sensitive to the enzymatic reaction.
A commercial source of MTGase derived from Stv. mobaraense is available, however the optimum temperature range of this enzyme is 50 to 55 OC. Important to the food industry is the requirement of catalytic activity at low temperatures so the need for a low temperature variant is desirable. This thesis explores the possibility of finding a bacterial source which retains MTGase activity at low temperatures and can be produced on an industrial scale. Thus provided the MTGase functions at the required temperature the reduced catalytic activity can be offset by using more enzyme.
Psychrophilic, psychrotrophic and mesophilic bacteria were screened for the presence of a related TGase gene. A PCR strategy which amplified the region of the gene encoding the putative active site of MTGase was utilised for the selection and cloning of the gene. This successful screening strategy led to the cloning of the entire coding sequence of the mature form of MTGase from mesophilic actinomycetes including several Streptoverticillit~mspecies (Stv. mobnmerzse, Stv. griseocnmeum, Stv. cinnnmoneum ssp. cinrznmorzeum) and Streptomyces lnvendt~laeand also from a previously unreported mesophilic bacteria, Stv. bnldaccii. Structural relationships of the gene and protein were analysed by Southern and western blotting, respectively.
MTGase derived from Stv. bnldaccii was examined to determine the optimal growth conditions for maximum enzyme activity and whether this enzyme could function at low temperatures. Sm. baldaccii TGase exhibits characteristics of cold-adapted enzymes found in psychrophilic bacteria. Stv. bnldnccii TGase has a lower temperature optimum, higher specific activity at low temperatures and thermal instability at moderately high temperatures.
Industrial applications often require continuous large volumes of enzyme product. In this study a purification scheme was developed for the isolation of endogenous MTGase from the culture filtrate of Stv. baldnccii. However for commercial applications a recombinant source would overcome problems with supply, production time and complex and expensive growth requirements. MTGase gene encompassing the entire coding region for the protein from Stv. baldaccii was expressed in E. coli and produced an active enzyme. The recombinant MTGase shared similar immunological and enzymatic characteristics as the endogenous enzyme.
The findings of this thesis are: (i) A PCR method was developed for selection and cloning of the gene based on the sequence encoding the mature active form and the putative active site encoding region of the TGase gene from Stv. mobarnense;
(ii) The entire coding sequence of the mature form of MTGase from mesophilic acti~omycetes including several Streptoverticillium species (Stv. mobarnense, Stv. griseocnmeum, Stv. cinnamonetlm ssp. cinnanzo~zeum and Stv. balclnccii) and Streptomyces lavendulne were compared;
(iii) Structural analysis of the protein by western blotting revealed that there is a related protein produced within the Streptoverticillium species with both the Pro-TGase and the IV active mature enzyme detected in the culture filtrate. Southern blot hybridisation revealed that MTGase produced within Streptoverticillizlm species is related by genomic organisation, with only one copy of the gene detected;
(iv) Stv. baldaccii TGase production was optimised by a systematic analysis of growth conditions: TGase production was favoured by growth at low temperatures with maximum growth and enzyme activity occurring when cultured cells changed from exponential phase to stationary phase;
(v) Stv. baldaccii TGase exhibits characteristics of cold-adapted enzymes found in psychrophilic bacteria with its low temperature optimum, higher specific activity at low temperatures and thermal instability at 55 OC;
(vi) Comparison of the deduced amino acid sequences of the TGase gene cloned from Stv. rnobaraense and Stv. baldaccii showed approximately 80 % identity. This difference in the protein sequence of the two MTGases may be responsible for the lower activity optima and heat instability of Stv. baldaccii TGase;
(vii) The MTGase gene encompassing the entire coding region for the protein from Stv. baldaccii was expressed in E. coli. The recombinant MTGase showed immunological and enzymatic characteristics similar to the endogenous form of the enzyme and therefore the same purification conditions were applied.
Taken together I have shown that MTGase from Stv. baldaccii has high specific activity at low temperatures and the enzyme is produced at comparable levels to Stv. mobaraense under a variety of conditions. The enzyme can be over-expressed in E. coli thus providing a convenient production pathway since E. coli media has been optimised as a result of many studies to minimise the cost of production. A recombinant source wou,ld overcome supply, reduce production time and produce the enzyme cheaply and in abundant amounts. This thesis provides detailed proof of concept for the development of a commercial, high activity, temperature desensitised enzyme for use in biofilm production and protein manipulation with potential application in the food and beverage industry. TABLE OF CONTENTS
STATEMENT OF ORIGINALITY I ACKNOWLEDGMENTS i1 ABSTRACT i11 TABLE OF CONTENTS VI LIST OF FIGURES XIV LIST OF TABLES XIX
CHAPTER 1 General Introduction 1.1 Introduction 1.2 Enzymology of TGase 1.3 TGase Family 1.3.1 Mammalian TGase 1.3.2 Other varieties of TGase 1.4 Bacterial TGase 1.5 TGase from Streptoverticillium 5-8 112 1.6 Factors Affecting Activity of MTGase and Mammalian TGase 1.6.1 Influence of calcium and various metal ions 1.6.2 Secondary structural analysis and inhibition of catalytic activity 1.6.3 Thermal stability 1.7 Comparison of the Active Sites of TGases 1.8 Application of TGase in the Food Industry 1.8.1 Mammalian TGase 1.8.2 Microbial TGase 1.8.2.1 Benefits of using MTGase 1.8.2.2 Practical industrial uses of MTGase 1.8.2.3 Recombinant MTGase 1.9 Aims of this Study CHAPTER 2 Materials And Methods 2.1 Materials 2.1.1 List of Abbreviations 2.1.2 Culture Collections 2.1.3 Bacterial Strains and Plasmids 2.1.3.1 E. coli K12 strains 2.1.3.2 Streptoverticillium and Streptomyces species 2.1.3.3 Other bacteria 2.1.3.3a Psychrophilic and psychrotrophic bacteria (ACAM) 2.1.3.3b Actinomycete isolates (DRLMD) 2.1.3.4 Plasmids and constructs 2.1.4 Chemicals, Reagents and Kits 2.1.5 Enzymes 2.1.6 Growth Media 2.1.6.1 Streptoverticillium media 2.1.6. la Spore production 2.1.6. lb Production of TGase 2.1.6. lc Extraction of genomic DNA 2.1.6.2 E. coli media 2.1.6.3 Other bacteria media 2.1.6.3a Actinomycete isolates 2.1.6.3b Psychrophilic and psychrotrophic bacteria 2.1.7 Antibiotics and Buffers 2.1.7.1 Antibiotics 2.1.7.2 Commonly used buffers 2.1.8 Molecular Weight Markers 2.1.8.1 DNA markers 2.1.8.2 Protein markers 2.1.9 Oligonucleotides 2.1.9.1 PCR oligonucleotides 2.1.9.2 Sequencing oligonucleotides 2.2 Methods 2.2.1 Bacterial Spore Suspension 2.2.2 Culture Growth 2.2.2.1 Streptoverticillium species 2.2.2.2 Actinomycete isolates 2.2.2.3 Psychrophilic and psychrotrophic bacteria 2.2.3 Culture Storage 2.2.3.1 Spore suspensions 2.2.3.2 Recombinant bacteria 2.2.3.3 Other bacteria 2.2.4 Genomic DNA Extraction from Bacterial Cells 2.2.5 Polymerase Chain Reaction (PCR) 2.2.6 Isolation of Plasmid DNA 2.2.6.1 Small scale plasmid preparation 2.2.6.2 Large scale plasmid preparation 2.2.7 Restriction Enzyme Digestion and DNA Analysis 2.2.7.1 Restriction enzyme digests 2.2.7.2 Preparation of vector 2.2.7.3 DNA quantitation 2.2.7.4 Agarose gel electrophoresis 2.2.8 Subcloning of DNA Fragments into Plasmid Vectors 2.2.8.1 Isolation of DNA fragments from agarose gels 2.2.8.2 Ligation of DNA 2.2.8.3 Competent cells preparation 2.2.8.4 Transformation 2.2.9 Automated Sequencing 2.2.10 Ethanol Precipitation 2.2.11 TE Saturated Pheno1:Chloroform Extraction 2.2.12 Expression of Recombinant TGase 2.2.13 Scaled-up Growth and Cell Disruption 2.2.14 Southern Blotting 2.2.14.1 Transfer of DNA 2.2.14.2 Preparation of probe 2.2.14.3 Hybridisation and detection VIII 2.2.15 SDS-Polyacrylamide Gel Electrophoresis 2.2.16 Production of TGase 2.2.17 Enzyme Activity Assay 2.2.17.1 TGase colorimetric assay 2.2.17.2 In vivo plate assay for measurement of TGase activity 2.2.18 Western Blotting 2.2.18.1 Transfer of protein 2.2.18.2 ECL detection 2.2.19 Protein Estimation 2.2.19.1 Whole cell protein estimation 2.2.19.2 Solubilised protein estimation 2.2.20 Chromatography 2.2.20.1 Ion-Exchange chromatography 2.2.20. la Bio-Cad purification system 2.2.20.1b Purification on Fractogel EMD SO3 2.2.20.2 Size-Exclusion chromatography 2.2.20.2a High Performance Liquid Chromatogrpahy (HPLC) 2.2.20.2b Gel filtration chromatography 2.2.20.3 Affinity chromatography on His-Bind resin 2.2.20.4 HiTrap NHS-activated affinity chromatography 2.2.21 Ammonium Sulphate Precipitation 2.2.22 Production of Polyclonal Antibody CHAPTER 3 Sequence and Structural Relationships of TGase Produced by Streptoverticillium and Related Species 3.1 Introduction 3.2 Results 3.2.1 Genomic DNA Isolation 3.2.2 Design of Primers 3.2.3 Cloning and Sequencing Comparison 3.2.3.1 Cloning of the TGase gene 3.2.3.2 Sequence comparison of Streptoverticillium TGase genes 3.2.4 Analysis of Streptoverticillium TGase Proteins 3.2.5 Screening of Isolates for TGase by Western Blot 3.2.6 Analysis of the Gene Encoding TGase 3.2.7 Detection of a Related TGase Gene by PCR Analysis 3.2.7.1 Isolation of a related TGase gene from S. griseus and M. fortuitum 3.2.7.2 Screening of cold-adapted microorganisms by PCR 3.3 Discussion CHAPTER 4 Effect of Temperature on Growth Rates, TGase Specific Activity and Precursor Processing of Stv. baldaccii and Stv. mobaraense TGases 4.1 Introduction 4.2 Results 4.2.1 Cultures Conditions 4.2.2 Culture Growth and TGase Activity 4.2.3 The Effect of Culture Conditions on the Properties of Secreted TGase 4.2.4 Western Blot Analyses 4.3 Discussion CHAPTER 5 Purification and Characterisation of Endogenous and Recombinant Stv. baldaccii TGase 5.1 Introduction 5.2 Results 5.2.1 Expression Vector 5.2.2 Preparation of TGase Expression Constructs 5.2.2.1 Preparation of recombinant Stv. mobamense TGase constructs 5.2.2.2 Preparation of recombinant Stv. baldaccii TGase construct 5.2.3 Analysis of Recombinant Protein Expression 5.2.4 Protein Purification of Microbial TGase 5.2.4.1 Purification of endogenous TGase from Stv. mobaraense 5.2.4.2 Purification of endogenous TGase from Stv. bnldaccii 5.2.4.3 Partial purification of recombinant Stv. mobaraense TGase 5.2.4.4 Partial purification of recombinant Stv. baldaccii TGase 5.2.5 Characterisation of MTGase from Stv. bnldaccii 5.2.5.1Molecular weight 5.2.5.2 Enzymatic properties 5.2.5.2a Temperature and pH optima 5.2.5.2b Effect of inhibitors 5.2.5.2~Effect of metal ions 5.3 Discussion CHAPTER 6 Final Discussionn
REFERENCES
APPENDIX 1 APPENDIX 2 APPENDIX 3 APPENDIX 4 APPENDIX 5 LIST OF FIGURES
Figure 1.1: Enzymology of transglutaminase.
Figure 3.1 : DNA sequence of the entire Streptoverticillium sp. S-8112 TGase gene showing the predicted amino acid sequence.
Figure 3.2A: Comparison of the deduced amino acid sequence of the gene encoding the TGase gene from Stv. mobaraerzse, Stv. cinnamoneum ssp. cinnamoneum, Stv. griseocameum and S. lavenduae.
Figure 3.2B: Comparison of the deduced amino acid sequence of the gene encoding the TGase gene from Stv. mobaraerzse and Stv. balrEnccii.
Figure 3.2C: Comparison of the deduced amino acid sequence of the gene encoding the TGase gene from Stv. cinnamoneum ssp. cinnainoneum and Stv. cinrzainoneum CBS 683.68.
Figure 3.3A: Western blot analysis of Streptoverticilliz~mspecies and other actinomycete isolates.
Figure 3.3B: Western blot analysis of day 6 pellets from Streptoverticillium species.
Figure 3.4: Suprageneric relationship of actinomycetes based on partial sequencing of 16s ribosomal ribonucleic acids. 65 Figure 3.5A, B and C: Deiection of TGase gene in Stv. mobnmense, Stv. bnldnccii and Stv. cinnnmoneum ssp. cintznmoneum by Southern blotting.
Figure 3.5D and E: Detection of TGase gene in S. griseus and M. fortuitum by Southern blotting.
Figure 3.6A: Comparison of the nucleotide sequence of Stv. mobaraense and S. griseus. 74
Figure 3.6B : Compariosn of the nucleotide sequence of Stv. mobaraense and M. fortuitum 75
Figure 3.7: Phylogenetic tree of bacteria derived from 16s robosomal RNA sequences. 77
Figure 3.8: Phylogenetic dendrogram showing clustering of Streptoverticillium and Streptomyces species based on the analysis of ribosomal protein AT-L30. 84
Figure 3.9: Proposed lineage for evolution of microbial and mammalian TGases from a common ancient protease.
Figure 4.1 : Growth and TGase secretion by Stv. bnldaccii in liquid culture at 12 to 28 "C.
Figure 4.2: Growth and TGase secretion by Stv. mobnraense. in liquid culture at 12 to 28 OC. Figure 4.3: The apparent specific activity of TGase from Stv. balclnccii and Stv. mobaraense cultures grown at different temperatures
Figure 4.4: Temperature dependence of TGase activity in cell-free supernatant of Stv. baldaccii cultures grown 12 OC, 16 OC, 20 OC and 28 OC.
Figure 4.5: Temperature dependence of TGase activity in cell-free supernatant of Stv. mobaraense cultures grown at 12 OC, 16 OC, 20 OC and 28 OC.
Figure 4.6: Temperature dependence of partially purified and endogenous TGase from Stv. baldaccii T12 cultures.
Figure 4.7: Western blot analyses of the production of TGase from Stv. bnllrEnccii grown at different temperatures.
Figure 4.8: Western blot analyses of the production of TGase from Stv. mobaraerzse grown at different temperatures. 100
Figure 4.9: Secretion of Pro-TGase and production of TGase by Stv. baldaccii and Stv.mobaraense.
Figure 5.1: An overview of the expression system used for the production of recombinant TGase.
Figure 5.2A: Recombinant Stv. mobaraense TGase constructs. XVI Figure 5.2B: Recombinant Stv. baldaccii TGase construct.
Figure 5.3A, B, C, D and E: Schematic representation of microbial TGase constructs used for recombinant protein expression.
Figure 5.4: Expression of recombinant Stv. mobaraense TGase.
Figure 5.5: Expression of recombinant Stv. baldaccii and recombinant Stv. mobaraense TGase.
Figure 5.6: Chromatographic separation of culture filtrate from Stv. baldaccii containing microbial TGase on Fractogel EMD SO3-.
Figure 5.7: Purification of microbial TGase from the culture filtrate of Stv. baldaccii 119
Figure 5.8: Chromatographic separation of cell lysate from pET28mmt.his construct expressed in E. coli on POROS 20HS.
Figure 5.9: Purification of recombinant Stv. mobaraense TGase.
Figure 5.10: Chromatographic separation of cell lysate from pET28mbt.his' construct expressed in E. coli on POROS 20HS.
Figure 5.11 : Purification of recombinant Stv. baldaccii TGase. XVIl Figure 5.12: p~~optimaof endogenous and recombinant TGase from Stv. bnl~lnccii.
Figure 5.13 : Temperatures dependence of endogenous and recombinant TGase from Stv. bnldaccii.
XVIII LIST OF TABLES
Table 1.1: The enzyme transglutaminase.
Table 1.2: Mammalian TGase terminology.
Table 1.3: Biochemical properties of mammalian TGases.
Table 1.4: Characteristics of MTGase from Streptoverticillium S-8112.
Table 1.5: Comparison of amino acid sequences in the putative active site region of TGases from various species.
Table 2.1 : Plasmids and constructs.
Table 2.2: Antibiotics.
Table 2.3: PCR oligonucleotides.
Table 2.4: Sequencing oligonucleotides
Table 2.5: Psychrophilic and psychrotrophic bacteria growth conditions. Table 3.1: Primers used to amplify the active mature region encoded by the gene for TGase.
Table 3.2: Molecular weight of Pro-TGase and TGase from Streptoverticillium species.
Table 3.3: Actinomycete genera screened for TGase by western blot.
Table 3.4: Primers used to amplify the active site region encoded by the gene for TGase.
Table 3.5: Cold-adapted bacteria screened by PCR.
Table 3.6: Results from a BLAST search against Streptoverticillium S-8112 mature TGase amino acid sequence.
Table 4.1 :
Specific activities of TGase - endogenous and purified.
Table 4.2: Detection of Pro-TGase and TGase in Stv. baldaccii and Sh. mobaraense cultures grown at different temperatures using Western blot analysis.
Table 5.1: Molecular weight comparison from the predicted sequence with recombinant and endogenous microbial TGases. Table 5.2: ~udficationdata for microbial TGase from Stv. mobnrnense and Stv. bnldnccii after ion-exchange chromatography on Fractogel EMD SO3-. 118
Table 5.3: Comparison of the effects of various inhibitors on microbial TGase from Streptoverticillium species.
Table 5.4: Effect of varying the concentration of inhibitors on microbial TGase.
Table 5.5: Comparison of the effects of metal ions on microbial TGase from Streptoverticillium species.
Table 5.6: List of inhibitors which affect both mammalian and microbial TGase activity.
Table 6.1 : Microbial TGase patents. CHAPTER 1
General Introduction 1.1 Introduction Transglutaminase (TGase, E.C. 2.3.2.13) catalyses an acyl-transfer reaction in which y- carboxyamide groups of protein-bound glutamine residues are the acyl donors. Primary amino groups in a variety of compounds can function as acyl acceptors. When r-amino groups of protein-bound lysine residues are the acceptors, protein cross linlung via r-(y- glutamyl) lysine bridges occur. The action of these enzymes results in the formation of cross-linked, often insoluble supramolecular structures. TGases form a large protein family in vertebrates with members specialised for protein cross-linking in different biological systems. These enzymes are distributed in the plasma, tissues and extracellular fluids and are evident throughout the body, for example, in the fibrin network of blood clots, cell membranes, extracellular matrices and the cornified features of the epidermis and it's appendages (Greenberg et al., 1991).
Various applications utilising the catalytic property of TGase have been reported in medical, nutritional and food processing areas. TGase is an important component of "Fibrin Glue", a haemostatic agent that is used in surgery. European surgeons have used fibrin glue extensively during thoracic, cardiovascular and general surgical operations. The fibrin glue can be prepared from the cryoprecipitate of the patient's plasma eliminating the risk of viral transmission (Hartman et al., 1992). Pasteurised Factor XI11 concentrate of human plasma origin has been used to treat Factor XI11 deficiencies, resulting in no haemorrhagic episodes (Daly and Haddon, 1988). TGase has been recently reported to stimulate repair processes in the treatment of optic nerve damage (Eitan et al., 1994).
With increasing global population there is a corresponding increasing demand for highly nutritious food products. Since the majority of this increasing population lives in developing countries, there is commercial pressure for the development and use of cheap proteins previously not used or under utilised in food products. Often these proteins need functional modification before processing to be palatable. Effective nutritional and commercial utilisation of potential food proteins is dependant upon tailoring the protein's functional characteristics to meet the complex needs of manufactured food products. Enzymatic modification of food proteins is desirable due to increased safety and specificity over non-enzymatic methods. Ikura et al. (1980a; 1980b) and Motolu and Nio (1983) have examined the crosslinlung by TGase of proteins of biological interest. Guinea-pig liver TGase has been used to crosslink several food proteins, including q,- casein, p-casein, K-casein, P-lactoglobulin and the 11s and 7s soybean globulins. Kurth and Rogers (1984) reported crosslinking of myosin to soybean protein, casein and gluten by using bovine plasma TGase.
Biochemical applications of mammalian TGase for food production have been limited by the cost of commercially available TGase and the difficulty of producing it in large quantities. Furthermore, mammalian TGase is calcium-dependent so that its application is limited by the requirement of ca2+ for activation and the taste-bitterness effect of calcium chloride in food products (Baker et al., 1994). However, Ajinomoto have produced a commercial preparation of mammalian TGase which has been used for surirni production in Japan. In addition the use of plasma as a source of TGase for the manufacture of a restructured meat product has been applied (Kurth and Rogers, 1984; Paardekooper, 1987). To open the way for mass production of TGase by fermentation, microorganisms were screened for TGase activity. Ando et al. (1989) purified a bacterial TGase from the culture filtrate of the genus Streptoverticillium. This enzyme, like mammalian TGases, is capable of catalysing an acyl transfer reaction of the y- carboxyamide group of a glutamine residue in a peptide chain. However, unlike mammalian TGase, bacterial TGase does not require calcium for activation. TGase from Streptoverticilli~tm sp. has been shown to produce polymers of casein and soybean proteins (Nonaka et a1.,1989), gelatinise sodium caseinate and skim milk gels (Nonaka et al., 1992) and form cross-linking of contractile proteins from skeletal muscle (Huang et al., 1992). Since Streptoverticilli~tmsecrete the enzyme into the culture medium, enrichment of TGase from the culture broth is comparatively straight forward and presents a pathway for commercial production.
1.2 Enzymology of TGase TGases which are also known as protein-glutarnine: arnine y-glutamyltransferase have been found and isolated from a wide range of sources and masquerade under many different titles. The term TGase is mostly used in the literature and refers to a category of enzymes which can modify proteins post-translationally through the exchange of primary arnines for ammonia at the y-carboxamide group of glutamine residues. Table 1.1 lists the systematic name, classification, alternative names and the reaction catalysed by TGase.
3 Peptide bound lysine residues or polyamines serve as the primary amines to form either E- (y-glutamyl) lysine cross-links or (y-glutamyl) polyamine bonds between proteins (Folk and Finlayson, 1977). TGase uses a modified double-displacement mechanism to carry out the acyl transfer reaction between the y-carboxamide of a peptide bound glutamine residue and the &-aminogroup of a peptide-bound lysine or the primary amino group of a polyarnine (Figure 1.1). This bond forming reaction proceeds through several intermediary acylation and deacylation steps. The active site cysteine (Cys) residue reacts with the y-carboxamide of the glutamine residue in a protein forming a y-glutamyl thioester and releasing ammonia. The transient acyl-enzyme intermediate then reacts with the &-aminogroup of the acyl acceptor, lysine, yielding a 8-(y-glutamyl) lysine bond. The resulting bonds are covalent, stable and resistant to proteolysis.
SYSTEMATIC NAME: PROTEIN-GLUTAMINE: AMIN3 GAMMA- GLUTAMYLTRANSFERASE CLASSIFICATION: E.C. 2 TRANSFERASE E.C. 2.3 ACYLTRANSFERASE E.C. 2.3.2 AMINOACYLTRANSFERASE E.C. 2.3.2.13 PROTEINGLUTAMINEGAMMAGLUTAMYLTRANSFERASE ALTERNATIVE NAMES: TRANSGLUTAMINASE FACTOR XIIIa FIBRINOLIGASE TGASE REACTION CATALYSED: PROTEIN GLUTAMINE + ALKYLAMINE +-+ PROTEIN N5-ALKYLGLUTAMINE + NH3
Table 1.1: The enzyme transglutaminase protein- CH2 -C -NHZ a HS - Enzyme glutamine
0 I protein - CH2 -C - S - Enzyme NH3
H2N - (CH,), - protein ly sine 0 I I protein -CH2- C- NH- (CH,), - protein ' HS -
Figure 1.1: Enzymology of transglutaminase. This reaction scheme shows the TGase- catalysed transfer reaction between the y-carboxamide group of the peptide-bound glutamine residue and a primary arnine. 1.3 TGase Family TGases are widely distributed in both eucaryotic and procaryotic organisms, however, the best characterised TGases are from mammalian sources.
1.3.1 Mammalian TGase TGase activity has been found to be widespread in plasma, tissues and the extracellular fluids of a number of mammals, and TGase modified proteins are also present throughout the body. The TGase enzymes can be divided into five major groups: Factor XI11 (plasma and placental), tissue TGase, keratinocyte TGase, epidermal TGase and prostate TGase. Table 1.2 lists the five best characterised TGases and the terms used to describe them (Greenberg et al., 1991; Aeschilman and Paulsson, 1994). Factor XIII is a proenzyme which is activated to Factor XIIIa during blood coagulation and impedes blood loss by stabilising the fibrin clot; keratinocyte and epidermal TGase form the squamous epithelium constituting the protective callus layer of slun; tissue TGase is a cytoplasmic enzyme present in many cells including those in the blood vessel wall; and prostate TGase forms the copulatory plug in rodents (Greenberg et al., 1991; Aeschilman and Paulsson, 1994). These TGases differ in molecular weight and biochemical properties, but share the requirement for calcium activation. Table 1.3 lists their major biochemical and functional properties. The high degree of conservation and widespread occurence of TGases suggests that covalent protein cross-linking may have an even more pervasive role and distribution in nature then even the current state of knowledge suggests.
1.3.2 Other varieties of TGase The finding of E-(y-glutamyl) lysine bonds in a wide range of different organisms implies a wide distribution of enzymes capable of catalysing formation of this bond. TGase activity has been found in fish (Aralu and Selu, 1993), lobster (Myhrman and Bruner-Lorand, 1970), horseshoe crab, Tachypleus tridentatus (Tokunaga et al., 1993), grasshopper (Singer et al., 1992), acellular slime mold, Physarum polycephalum (Klein et aL., 1992), filarial nematode, Brugia malayi (Singh and Mehta, 1994), in the yeast Caizdida albicans (Ruizherrer et al., 1995), the bacteria Bacillus subtilus (Ramanujam and Hageman, 1991; Kobayashi et al., 1996a, 1998a), Streptoverticillium sp. (Ando et al., 1989; Motolu et al., 1990; Tsai et al., 1996) and Streptomyces sp. (Andou et al., 1993; Faergemand et al., 1997) and in the plant Medicago sativa L. (alfalfa) (Margosiak et nl., 1990). With the exception of bacteria and plants, TGase activity in these orghnisms is ca2' dependent.
TGase Other Nomenclature
Plasma Fibrin-stabilising factor, Laki-Lorand, Fibrinoligase, Factor XIIIa
Tissue TGc, erythrocyte, cellular, endothelial, cytoplasmic, type 11, liver, tTG
Keratinocyte TGK,particulate, type I
Epidermal TGE,callus, bovine snout, hair follicle, type I11
Prostate TGp, dorsal prostate protein I, major androgen-regulated prostate secretory protein, vesiculase
Table 1.2: Mammalian TGase terminology
TGase Molecular Subunit Protease Calcium Weight (kDa) Structure Activation Dependence Factor XI11 -Plasma 360 a2b2 Yes Yes -Placental/Platelet 166 a2 Yes Yes Tissue 85 monomer no Yes Keratinoc yte 90 monomer no Yes Epidermal 80 monomer Yes Yes Prostate 150 homodimesic no Yes
Table 1.3: Biochemical properties of mammalian TGases 1.4. Bacterial TGase TGase has only been purified, characterised and cloned from the sporulating, Gram positive bacteria, Streptoverticillium sp. and B. stlbtilis. These enzymes do not require calcium for activity, however, the Streptoverticillium TGase is an extracellular enzyme whereas Bacilltis TGase is localised intracellularly. The DNA sequences of the two TGases share little similarity except for a highly conserved Cys residue in the active site region (Kanaji et al., 1993; Kobayashi et al., 1998).
The E-(y-glutamyl) lysine bond has been identified in the asporogenic, Gram negative bacteria, Escherichia coli (Matacic and Loewy, 1979). Recently Cytotoxic Necrotizing Factor 1 (CNF 1) from E. coli has been shown to possess TGase activity, and a catalytic Cys residue has been identified in the protein sequence (Schmidt et nl. 1998). This seems to suggest that TGase is widespread in procaryotes and although they do not have a highly conserved active site like mammalian TGase, they have in reports to date, a Cys residue in common within the active site region (Kanaji et al., 1993).
1.5 TGase from Streptoverticillium S-8112 Enzymes with a similar function to vertebrate TGases have been found in invertebrates, plants, unicellular eucaryotes and bacteria. While TGases in higher animals always require calcium for activity, this is not the case in plants and microorganisms as already noted (Aeschilmann and Paulsson, 1994). Kanaji et al. (1993) determined the primary structure of microbial TGase derived from the genus Streptoverticilliurn, and suggested that this enzyme evolved as a separate lineage from the eucaryotic TGase and that acyl transfer activity was acquired during the evolutional process.
Ando et al. (1989) screened 5000 microorganisms for hydroxamate-forming activity and found that several lunds of microorganisms exhibited TGase activity, although strong enzyme activity was only found in an actinomycete strain from the genus Streptoverticilliurn. This microorganism was subsequently found to secrete TGase into the culture medium. Microbial TGase (MTGase) was first purified from Streptoverticillium S-8112, a variant of Stv. mobaraense (Ando et al., 1989) and subsequently from other species of Streptoverticillium (Motolu et al., 1990; Tsai et al., 1996; Duran et. al., 1998;) and Streptomyces (Tsai et al., 1996; Faergemand et nl., 1997). Streptoverticilliurn and Streptomyces belong to the family Streptomycetacae, order Actinomycetales and are characterised by the formation of chains of arthrospores on the aerial mycelium (Locci, R., 1989). Although the role of MTGase is unknown in these bacteria, enzyme activity increases with development of mycelium growth and morphological differentiation.
MTGase is a monomeric enzyme consisting of a single polypeptide chain (Ando et al., 1989). Characteristics of MTGase such as molecular weight, isoelectric point (PI) and primary structure have been reported (Table 1.4). Compared to mammalian tissue TGase, also a monomeric enzyme, which has a molecular weight of 85000 Da and pI of 4.5, MTGase is approximately half the molecular weight and has a substantially different pI of 8.9. Kanaji et aZ. (1993) determined the complete amino acid sequence of MTGase produced by S-8 112 comprised of 33 1 amino acid residues with a single Cys residue at position 64 and a chemical molecular weight of 37863 Da.
Washizu et al. (1994) cloned the gene for MTGase from S-8112 and found that the TGase gene is synthesised as a precursor protein consisting of 406 amino acid residues which comprises a prepro region of 75 amino acid residues and the mature region of 331 amino acid residues. MTGase is first synthesised as the inactive Pro-TGase and diffuses out of the cell wall where proteolytic cleavage occurs to form an active mature enzyme (Pasternack et a1.,1998). Recently, Pasternack et al. (1998) have found that in vitro, activated MTGase from Stv. mobamense consisted of 333 residues instead of 33 1 residues and that the cleavage site was closer to the N-terminus of the precursor protein.
Molecular Weight approximately 38000 Da Subunit Structure monomer Amino Acid Composition 33 1 amino acid residues containing a single Cys residue
Extinction Coefficient nm (1 mglml) = 1.71 cm-' Isoelectric Point (PI) 8.9 Optimal pH range 6.0 to 7.0 Optimal temperature 45 to 55 'C
Table 1.4: Characteristics of MTGase from Streptoverticillium S-8112 (Ando et al., 1989; Kanaji et al., 1993). 1.6 Factors Affecting Activity of MTGase and Mammalian TGase 1.63 Influence of calcium and various metal ions The Stv. mobnrnense MTGase does not require calcium as a cofactor for activation but it will act in both the presence and absence of calcium ions. zn2+and cu2+inhibited activity while other metal ions had no effect (Ando et nl., 1989).
Calcium is required for activation of mammalian TGase. The specificity of cation- binding is high as only sr2+can replace ca2' although at 25-fold higher concentrations (Folk and Cole, 1966). Several other metal ions including ~e~',cu2', zn2' and H~~~ strongly inhibit TGase activity even in the presence of ca2'. zn2+has been shown to inhibit Factor XIIIa in the presence of ca2+ in a competitive manner (Lorand and Conrad, 1984). Inhibition of mammalian transglutaminase by CU" is due to oxidation of free sulfhydryl groups to intramolecular disulfide bonds (Boothe and Folk, 1969).
1.6.2. Secondary structural analysis and inhibition of catalytic activity Kanaji et nl. (1993) reported that MTGase has a globular conformation, typical of secretory proteins. The active site Cys residue is predicted to be located in a p-turn connecting the a-helix and P-sheet structures as found in mammaljan TGases. Comparison of the hydropathy profile surrounding the active site Cys residue for both mammalian and Streptoverticillium TGases suggests that the secondary structural environment in the active site region is similar. Both TGases are inhibited by the addition of parachloromercuribenzoic acid (PCMB), N-eth yl-maleimide (NEM) and monoiodoacetate (MIA) which is evidence that a sulfhydryl group is participating in the reaction (Ando et nl., 1989).
1.6.3. Thermal stability The optimal temperature for MTGase activity is between 45 to 55 "C, depending on the species of Streptoverticillium. Stv. rnobnmerzse TGase has an optimum temperature at 55 "C, whereas the optimal temperature for Stv. griseocameum and Stv. cinnamoneum ssp. cinnnmoneurn is 45 OC. The stability of the enzyme decreases with increased temperature, based on activity measurements. Sb. mobaraense retains 100 % activity at 40 "C and 74 % activity at 50 "C (Ando et al., 1989). The optimal temperature for mammalian TGase is significantly higher than body temperature. Jiang and Lee (1992) reported an optimum temperature of 55 OC; above this temperature activity decreased rapidly.
1.7 Comparison of the Active Site of TGases The mammalian TGase has a highly conserved active site region (YGQCWVF) which includes an essential Cys residue. Comparison of the amino acid sequences of mammalian TGase with MTGase from Srv. mobaraense shows no overall structural relationship except in the regions around the single Cys residue (YGCVG) (Kanaji et al., 1993). Bacillus TGase has little overall sequence similarity with MTGase or mammalian TGase except for the Cys residue in the active site (Kobayashi et al., 1998b) (Table 1.5).
Mammalian TGases have high sequence homology in the vicinity of their putative active Cys residue. This Cys is believed to play a role in acyl transfer reaction catalysis based on amino acid substitution involving erythrocyte band 4.2 protein. This protein has the same active site region as mammalian TGase except the Cys residue has been replaced by alanine (Ala). Substitution of the amino acids in this conserved region resulted in loss of TGase activity (Kanaji et nl., 1993). MTGase catalyses an acyl transfer reaction, but its catalytic activity was lost when treated with NEM (Ando et al., 1989), which suggests that this thiol group of Cys was also essential for enzymatic activity and that the physiochemical environment around this Cys residue is similar to those of other TGases. The amino acid sequence of MTGase from Stv. mobaraense bears no significant similarity to any other proteins. Aeschilman and Paulsson (1994) used the active site sequence of mammalian TGases as probes for a computer search in protein databases. They reported that the catalytic regions of various thiol proteases were identified as the most closely homologous domains.
In addition to the highly conserved active site region, mammalian TGases require calcium for activation. The amino acid sequence of the putative calcium-binding domain of factor XIIIa is thought to be highly conserved in other mammalian TGases. The, similarities of the conserved sequences suggest that these regions are closely related to the function of mammalian TGases. For Streptoverticilli~lmTGase, there is little similarity in the amino acid sequence of the active site region except for the single Cys residue and there is no sequence homology with the calcium binding domain a.s microbial TGase catalyses a cazc-independent acyl transfer reaction (Kanaji et n1.,1993).
* Stv. mobnraense WLSYGCVGVTWVNSGQYPTNR
:i: B. subtilis FYAFECATAIVIIYYLALID * Factor XIIIa VRYGQCWVFAGVFNTFLRCLG
TGk-human * TGk-rat VPYGQCWVFAGVTTTVLRCLG TGk-rabbit
TG,-guinea pig + TG,- human VKYGQCWVFAAVACTVLRCLG TGc-mouse TGc-bovine
Band 4.2 VYDGQAWVLAAVACTVLRCLG
Table 1.5: Comparison of amino acid sequences in the putative active site region of TGases from various species. (Kanaji et al., 1993; Kobayashi et al., 1998b). The active site of TGases is underlined. * : Active site Cys residue; TGk: Keratinocyte TGase; TG,: Tissue TGase 1.8 Applications of TGase in the Food Industry l.8h Mammalian TGase TGase post-translationally crosslinks soluble precursor proteins into large polymers which are chemically, enzymatically resistant and mechanically strong. TGase has potential application in the food processing area for cross-linlung food proteins and for covalent attachment of essential amino acids to nutritionally inferior proteins. The majority of applications of TGase in the food processing area have been carried out with mammalian TGase generally of low activity. It is difficult to obtain more purified and more active animal derived TGase at low cost and in large quantities. Calcium chloride was found to be the best gelling agent, although a negative effect is its resultant bitter taste. To avoid supply problems the recombinant enzyme could be obtained successfully from E. coli (Ikura et al, 1990). However, the application of this recombinant enzyme may be limited because of its moderate stability resulting from the high content of Cys residues, none of which contain disulfide bonds (Ikura et nl, 1988), nonacetylation of the recombinant enzyme (Ikura et al, 1990) and the requirement of calcium for activation.
1.8.2 Microbial TGase 1.8.2.1 Benefits of using MTGase Many investigators have shown that microbial TGase can be applied to a variety of food processes. Nonaka et nl. (1989) demonstrated that the ca2'-independent extracellular MTGase produced by Sm. mobarae~zsecould be used to produce polymers in several food proteins including a,,-casein and soybean globulins as performed by mammalian TGase. Further work by Nonaka et al. (1992) has shown that skm milk gelatinised by MTGase have increased breaking strength and hardness, whereas Soeda et al. (1995) have shown that MTGase increased the brealung strength of tofu. MTGase is also capable of incorporating desired amino acids into food proteins (Nonaka et nl., 1996); conjugating ovomucin-food proteins (Kato et al., 1991b), cross-linking of contractile proteins from skeletal muscle (Huang et nl., 1992) and enzymatic biotinylation of antibodies (Josten et nl., 2000).
Fish. muscle contains substantial quantities of TGase. The minced fish product is used as a raw material for surimi, which is used in many food products. Sakamoto et al. (1995) found that the addition of MTGase during onshore surirni manufacture enhanced gel strength and increased E-(y-glutamy1)lysine crosslinks. Seguro et al. (1995) have sho'wn that the addition of 0.03 % MTGase improved gel properties of Kamaboko gels prepared from Alaska pollock surimi. Changes in the gel forming ability of MTGase containing surimi during twelve months of frozen storage was investigated by Atsumi et al. (1995). Results show that the gel forming ability of surimi gradually decreased during frozen storage, however, the addition of MTGase did not effect the decrease profile. This shows that MTGase can be added to surimi at the time of production without affecting surimi quality.
1.8.2.2 Practical industrial uses of MTGase There has been considerable activity in applying MTGase in the food processing area. For example, in meat processing there has been interest in the application of MTGase for restructuring of low-value cuts (Matsui et al., 1990) and improvement in the elasticity, texture, taste and flavour of minced meat products (Sakamoto and Soeda, 1991). The addition of MTGase in other food processes also results in improved flavour, appearance and texture. MTGase treatment maintains the texture and quality of fish products (Kumazawa et nl., 1996) and improves the water-holding capacity of milk gels during yoghurt production (Motoki and Seguro, 1998). Futhermore, MTGase has applications in improving the shelf- life of tofu by treating soya bean milk solutions with coagulating agents and MTGase (Kato et nl., 1991a), coating of vegetables and fruits with a membrane containing MTGase and proteins to increase food preservation (Takagaki et al., 1991) and reducing allergenicity of some food proteins by cross- linlung with MTGase (Yamauchi et nl., 1991).
1.8.2.3 Recombinant MTGase MTGase can be produced by industrial fermentation therefore providing a calcium independent TGase which is free of problems such as supply, cost and purification. Recombinant technology has enable the MTGase gene to be cloned and expressed in E. coli ,(Takehana et al., 1994; Kawai et nl. 1997; Yokoyama et al., 2000) and S. liviclclns (Washizu et al., 1994). The synthesised gene product has the same properties as the native MTGase and provides a method for producing the enzyme efficiently in a large quantity. Industrial applications often require the maintenance of low temperature, so the need for a low temperature variant is desirable. At present there are commercial sources of microbial TGase available in the market place and there has been considerable patent activity in the area and the use of Stv. mobnrnense TGase in the food industry. These applications require catalytic activity at low temperatures. In our laboratory we have explored the possibility of finding bacterial and fish sources which exhibit high TGase activity or show minimum loss of activity with decreasing temperature. Hence, provided the TGase still functions at the required temperature, the reduced catalytic activity can be offset by using more enzyme. It is therefore important that the enzyme be produced cheaply and in abundant amounts. Therefore this project aims to develop an organism in which the enzyme can be over-expressed, and recovered economically.
1.9 Aims of this Study My aims were to: (1) screen cold-adapted and mesophilic bacteria for the presence of TGase genes; (2) identify organisms with TGase enzyme activity and determine temperature stability of the enzyme; (3) identify a source of a temperature desensitised enzyme; (4) clone the target TGase gene and (5) purify and characterise recombinant microbial TGase to undertake comparative enzymatic and immunological analysis with endogenous TGase.
The first chapter (Chapter 3) describes the selection and cloning of the gene encoding TGase from either cold-adapted or mesophilic bacteria by utilising a PCR strategy which amplified the region of the gene encoding the putative active site of TGase. Cloning and sequencing of this region determined the degree of similarity between various species. Structural relationships of the gene and protein were also analysed by Southern and Western blotting, respectively.
The successful screening strategy led to the cloning of the entire coding sequence of the mature form of microbial TGase from a previously unreported mesophilic bacteria. Chapter 4 examined this psychrotolerant bacteria and identified the optimal growth conditions for maximum TGase activity and determined whether this enzyme could function at low temperatures.
In Chapter 5, the enzyme was expressed in E.coli and analysed to determine whether it would be a worthwhile system for efficient production of microbial TGase. This included developing purification procedures for both the endogenous and the recombinant forms of TGase and characterisation of the expressed gene product as a viable source for industrial application. CHAPTER 2
Materials and Methods 2.1 MATERIALS 2.1.1' List of Abbreviations Axxx absorbance at xxx nm Amp ampicillin Bisacrylamide N,N'-methylene-bisacrylamide BME P-mercaptoethanol bp basepairs BS A Bovine serum albumin CBZ-L-gln-glu Benzyloxycarbonyl-L-glutarninyl glycine Cm chloramphenicol CSPD Disodium 3-(4-methoxyspiro { l,2-dioxetane-3,2'-(5'- chloro) tricyclo[3.3.1. 1337]decan}-4-yl)phenylphosphate Da Daltons DNA deoxyribonucleic acid dNTP deoxynucleoside triphosphate DMF N,N-(dimethyl formamide) EDTA ethylenediaminetetraacetic acid EtBr ethidium bromide FPLC fast protein liquid chromatography GSH Reductive glutathione HEPES N-2-Hydroxyethylpiperazine-N1-2-ethane-sulfonic acid 1P intellectual property IPTG isopropylthio-P-D-galactoside ISP International Streptomyces Project kDa kiloDalton kb lulobase Km kanamycin LB Luria broth log phase logarithmic phase MES 2-(N-Morpho1ino)ethanesulfonic acid nm nanometre PAGE polyacrylamide gel electrophoresis PCR polymerase chain reaction RNase ribonuclease rPm revol~ltionsper minute sdHzO sterile distilled water SDS sodium dodecyl sulphate TAE Tris-acetate EDTA buffer TEMED N,N,N',Nf-tetramethylethylenediamine TES Tris EDTA Salt buffer TGase transglutaminase Tris Tris(hydroxymethy1)aminomethane X-gal 5-Bromo-4-chloro-3-indolyl-~-~-galactoside
2.1.2 Culture Collections ACAM: Australian Collection of Antarctic Microorganisms CRC for Antarctic and Southern Ocean Environment and the Department of Agricultural Science University of Tasmania, Hobart
ACM: Australian Collection of Microorganisms Centre for Bacterial Diversity and Identification Department of Microbiology University of Queensland, Brisbane
ATCC: American Type Culture Collection Rockville, Maryland USA
DRLMD: Queensland Health Diagnostic Reference Laboratory for Mycobacteriae Diseases The Prince Charles Hospital, Brisbane 2.1.3 Bacterial Strains and Plasmids 2.1.3.1 E. coli K12 strains ED8799: hsdS,metB7,supE,(glnV)44,~~1pF,(tyrT)58,A(IacZ)M15, rk-, mk-(Biotech Australia) JM109: [DE3],recAl ,supE44,endAl ,hsdR17,gyrA96,relAl ,thi, AF'[traD36,proAB~,lacI~lacZAM15](Stratagene) BL21: [DE3]pLysS,F,ompT,rB-,mB-(Studier et al., 1990)
2.1.3.2 Streptoverticillium and Streptomyces species Stv. mobaraense ATCC No. 29032 (ACM) Stv. cinnamoneum ssp. cinnamoneum ATCC No. 11874 (ACM) Stv. griseocameum ATCC No. 12628 (ACM) Stv. baldaccii ATCC No. 23654 (ATCC) Streptomyces lavendulae ATCC No. 14158 (ACM)
2.1.3.3 Other bacteria 2.1.3.3a Psychrophilic and psychrotrophic organisms (ACAM) Flectobacill~isglomeratzis (ACAM 171), F. xanthum (ACAM 81), Flavobncterium gondwarzense (ACAM 44), F. salegens (ACAM 48), Halomonas meridiana (ACAM 246), H. subglaciescola (ACAM 12), Carnobacteriumfunditum (ACAM 312) and C. alterjfunditum (ACAM 3 13)
2.1.3.3b Actinomycetes isolates (DRLMD) Nocnrdia sp., Nocardiopsis sp., Pseudonocardia sp., Streptomyces sp. and Mycobacterium sp. 2.1.3.4 Plasmids and constructs
Plasmid Description pGemT EASY Cloning Vector, ampf (Promega) pET28b: Expression Vector, kan' (Novagen) pmt. lA12B Whole TGase gene from Stv. mobaraerzse in pGemT Easy (This thesis) pmmt.6/2B Mature TGase gene from Stv. mobaraense in pGemT Easy (This thesis) pET28mmt. his' Mature TGase gene from Sb. mobaraense in pET28b plus His.Tag (This thesis) pET28mmt.his+(wo) Mature TGase gene from Stv. mobaraense in pET28b plus %s.Tag, wrong orientation (This thesis) pET28mmt.his- Mature TGase gene from Stv. mobnraense in pET28b minus His.Tag (This thesis) pmbt .6/2b Mature TGase gene from Stv. baldaccii in pGemT Easy (This thesis) pET28mbt.his- Mature TGase gene from Stv. baldaccii in pET28b minus His.Tag (This thesis) pET28mbt.his-(wo) Mature TGase gene from Stv. baldaccii in pET28b minus HisTag, wrong orientation (This thesis) pmgt.612b Mature TGase gene from Stv, griseocanzeum in pGemTEasy (This thesis) pmct.612b Mature TGase gene from Stv. cinnamoneum ssp. cinnamorzeum in pGemT Easy (This thesis) pmlt.612b Mature TGase gene from S. lavendulae in pGemT Easy (This thesis) --
Table 2.1: Plasmids and constructs. 2.1.4 Chemicals, Reagents and Kits All reagents and chemicals were from commercial sources and of the highest grade available from a range of suppliers. Suppliers of the more important 'chemicals and reagents are listed below:
Acrylamide, bisacrylamide: Sigma Agar: Gibco BRL Agarose: Promega Ammonium Sulphate: BDH Ampicillin, chloramphenicol: Progen CBZ-L-gln-glu: Novochem DIG High Prime DNA Labelling and Detection Kit: Roche DMF: Ajax chemicals ECL Western Blotting Reagents: Amersham
Ethidium bromide, Formamide: BDH
Fractogel EMD SO3-:Merck L-glutamic acid y-monohydroxamic acid: Sigma HRP conjugated goat anti-rabbit IgG: Bio-Rad Hydroxylamine, GSH: Sigma IPTG, X-gal: Progen Kanamycin: nbl Gene Science Lumni Film Chemiluminescent Detection Film: Roche Microbial TGase from S-8112: Amano Pharmaceutical Co. Nitrocellulose: Schleicher and Schuell PRISM Ready Reaction DyeDeoxy Terminator Cycle Sequencing Kit: Perkin Elmer Salmon sperm DNA, silica: Sigma Tryptose: Oxoid Taq Polymerase (5U), 25 mM MgCI2, lox Reaction Buffer, 1.25 mM dNTP1s: Fisher Biotech 2.1.5 Enzymes Enzjlmes were obtained from the following sources: Calf intestinal phosphatase (CIP): Integrated Sciences DNA-polymerase I (Klenow fragment): Promega Proteinase K: Qiagen Restriction endonucleases: New England Biolabs Pharmacia Promega Ribonuclease A: Pharmacia Ribonuclease T1: Roche T4 DNA ligase: Promega
2.1.6 Growth Media All buffers and media were prepared with distilled, reverse osmosis purified water and sterilised by autoclaving or filter sterilised.
2.1.6.1 Streptoverticilliz~mmedia 2.1.6.la Spore production (Gerber et al., 1994) ISP Medium 2 (pH 7.3): 0.4 % (wlv) yeast extract 1.0 % (w/v) malt extract 4.0 % (wlv) glucose 2.0 % (wlv) bacto agar
2.1.6.lb Production of TGase (Gerber et al., 1994) TGase media (pH 7.0): 2.0 % (wlv) tryptose 0.2 % (wlv) yeast extract 0.2 % (wh) Kzm04 0.1 % (wlv) MgSO4.7H20 2.0 % (wlv) potato starch 0.5 % (wlv) glucose 2.1.6.1~Extraction of Genomic DNA (Takagi et al., 1995) Glycerol Peptone Media: 0.4 % (v/v) glycerol (GP Media) 0.1 % (w/v)peptone 0.4 % (wlv) yeast extract 0.05 % (w/v) MgS04.7H20 0.2 % (w/v) KH2P04 0.5 % (wlv) Na21-IP04 0.1 % (w/v) glycine
2.1.6.2 E. coli media L-broth: 1.0 % (w/v)peptone 0.5 % (w/v) yeast extract 1.0 % (w/v) NaCl For plates 1.5 % (w/v) bacteriological agar was added.
2.1.6.3 Other bacteria 2.1.6.3a Actinomycetes isolates Nutrient broth (Oxoid): 28 g U' distilled water Nutrient agar (Oxoid): 13 g L-' distilled water
2.1.6.3b Psychrophilic and psychrotrophic bacteria Media recipes recommended by the ACAM are listed in Appendix 1. 2.1.7 Antibiotics and Buffers 2.1.7.1 Antibiotics For the selection of plasmids antibiotics were added to the media.
Stock Final Antibiotic Concentration Prepared in Concentration mg/ml yglml Ampicillin 100 70 % (vlv) ethanol 100 Chloramphenicol 30 70 % (vlv) ethanol 30 Kanamycin 30 sdH20 30
Table 2.2: Antibiotics.
2.1.7.2 Commonly used buffers Agarose Gel Load Buffer: 0.25 % (wlv) bromophenol blue 40 % (wlv) sucrose
Blotto: 5 % (wlv) low fat dried milk dissolved in TBS-T
5 x Electrode Buffer: 1.5 % (wlv) Tris base 7.2 % (w/v) glycine 0.5 % (wlv) SDS
Hybridisation Buffer: 5 X SSC 50 % (vlv) Formamide 0.1 % (w/v) N-lauroylsarcosine 0.02 % (wlv) SDS 2.0 % Blocking Reagent (Roche)
PBS: 7.5 mM NazHPO4 2.5 mM NaH2P04.2H20 145 rnM NaCl 5 x SDS Sample Buffer: 40 % (vlv) glycerol 10 % (w/v) SDS 50 mM DTT 0.2 M Tris-HC1 pH 6.8
20 x SSC: 3 M NaCl 0.3 M Trisodium citrate
50 x TAE: 2 MTris 1 M glacial acetic acid 1 mM EDTA pH 8.0 5 x TBE: 0.5 M Boric acid 0.5 M Tris 10 mM EDTA
TBS pH 7.6: 20 mM Tris base 137 mM NaCl Adjust pH with HC1
TBS-T: 0.1% (v/v)Tween 20 in TBS
TE: 10 mM Tris-HC1 pH 7.4 1 mM EDTA
Towbin Transfer Buffer: 25 mM Tris 192 mM glycine 20 % (vlv) methanol 2.1.8 Molecular Weight Markers 2.1.8.1 DNA markers DIG-labelled DNA molecular weight marker 111: Roche hlHind 111 DNA Standard: Bio-Rad Ready-Load 100 bp DNA Ladder: Gibco BRL
2.1.8.2 Protein markers Low Range Molecular Weight Markers: Bio-Rad Pre-stained low range Molecular Weight Markers: Bio-Rad
2.1.9 Oligonucleotides 2.1.9.1 PCR oligonucleotides All oligonucleotides were synthesised by Derek Slngle at Southern Cross University (Lismore). These oligonucleotides were either desalted and used for PCR amplification or HPLC purified and used as primers for sequencing. The sequence of the oligonucleotides used in this work are as follows in Table 2.3.
Primer Nucleotide Sequence (5'+3') Tm ("C) PTGase. 1A dGCA GGT TTC CAT ATG CGC TAT AC 59.1 PTGase.2B dTCA CGG CCA GCC CTG CTT TAC 68.8 PTGase.4 dTAC GGC TGC GTC GGT GTC AC 58.3 PTGase.4R dGTG ACA CCG ACG CAG CCG TA 58.3 PTGase.5 dGAC GGG TCG TGA TTG CCT CC 67.4 PTGase.6 dGAC TCC GAC GAC AGG GTC AC 63.1 PTGase.7R dTGG AAC CCC TTC TCT TCA TC 62.0 PTGase.8R dCTC TCG TCG TGG GCG TTC TC 65.7 PTGase.9R dGCG CCG AAC CAG CCG TAG TC 69.5
Table 2.3: PCR Oligonucleotides. 2.1.9.2 Sequencing oligonucleotides The following oligonucleotides used for sequencing were obtained from New England Biolabs and are as follows in Table 2.4.
Primer Nucleotide Sequence (5'-+3') RSP dAGC GGA TAA CAA TTT CAC ACA GGA USP dGTT TTC CCA GTC ACG AC T7 dTAA TAC GAC TCA CTA TAG GG SP6 dATT TAG GTG ACA CTA TAG T3 dATT AAC CCT CAC TAA AGG GA
Table 2.4: Sequencing Oligonucleotides. 2.2 METHODS All recombinant DNA techniques, unless stated otherwise, were the same as those described bv Sambrook et al. (1989)
2.2.1 Bacterial Spore Suspension Freeze-dried cultures of Streptoverticillitlm sp. and Streptomyces sp. were reconstituted in 0.3 ml sterile water following the procedure recommended by ATCC. Spores were produced as described by Gerber et al. (1994). An inoculum of spores were spread onto Petri dishes containing ISP Medium 2 agar (2.1.6.la) and incubated at 30 OC for 6 to 8 days.
2.2.2 Culture Growth 2.2.2.1 Streptoverticillium species Streptoverticilliz~mspecies were cultivated as described by Gerber et al. (1994). In 250 ml Erlenmeyer flask, 100 p1 of spore suspension was inoculated into 100 ml of TGase media (2.1.6.lb) and grown aerobically at 28OC for the production of TGase (2.2.16).
2.2.2.2 Actinomycete isolates For the growth of actinomycete isolates to be used as starter cultures, a loopfiil of culture was inoculated into Nutrient broth and grown until stationary phase at the 37 OC. These cultures are referred to as starter cultures. Isolates were also grown on ISP Medium 2 agar for 6 to 8 days at 37 OC for the production of spores. 2.2.2.3 Psychrophilic and psychrotrophic bacteria (Appendix 1)
ACAM Media Growth Culture Temperature ACAM 171 112 Strength seawater agar (112 SWA) 15 OC ACAM 81 Peptone yeast glucose agar (PYGA) 15 "C ACAM 44 Zobells 2216 agar (ZA) 25 "C ACAM 48 ACAM 12 Artificial Organic Lake petone Agar (AOLPA) 30 OC ACAM 246 AOLPA 3% 25 "C ACAM 3 12 TSA-artificial marine salts (low sulphate) 23 OC ACAM 3 13
Table 2.5: Psychrophilic and Psychrotrophic Bacteria.
2.2.3 Culture Storage 2.2.3.1 Spore suspensions Spores were collected from agar plates using a sterile spatula and stored in sterile gl ycerollwater (1 : 1 vlv) at -20 OC.
2.2.3.2 Recombinant bacteria A single bacterial colony was inoculated into L-broth containing the appropriate antibiotic and grown aerobically overnight (16 hours) at 37 OC. To 1 ml of culture was added 1 ml of sterile glycerol, mixed and the sample was stored at -20 OC. For long term storage, the bacterial culture was grown on L-broth agar plates containing the appropriate antibiotic and the culture removed using a sterile spatula and placed into 900 1-11 of sterile 80 % (vlv) glycerol. The sample was then stored at -70 OC.
2.2.3.3 Other bacteria Cultures from actinomycete isolates, psychrophillic and psychrotrophic bacteria were grown in liquid media and 500 pl aliquots were mixed with equal volume of sterile glycerol and stored at -20 OC. Cultures were also grown on agar media, removed using a sterile spatula and placed into 900 pl of sterile 80 % (vlv) glycerol. These samples were stored at -70 OC.
2.2.4 Genomic DNA Extraction from Bacterial Cells (Takagi et al., 1995) In a 250 ml Erlenmeyer flask 100 yl of either Streptoverticillium or Streptomyces spore suspension was inoculated into 100 ml of sterile GP media (2.1.4) and grown aerobically for 5 days at 30 OC, 200 rpm. The culture was centrifuged at 10000 rpm for 10 minutes (Sorvall, SS34 rotor) and the pellet resuspended in sterile TES (50 mM Tris pH 8.0, 5 rnM EDTA, 50 mM NaC1) and centrifuged at 2500 rprn for 10 minutes (Sigma, rotor 11150). The pellet was resuspended in 500 pl sterile TES supplemented with 2 mg ml-' lysozyrne (Roche) and incubated at 37 OC for 1 hour. The cell suspension was frozen rapidly in liquid nitrogen and 4.2 ml of sterile Tris-SDS (100 mM Tris pH 9.0, 1 % (wlv) SDS, 100 mM NaC1) was added and mixed thoroughly, incubated at 60 OC for 20 minutes and immediately frozen in liquid nitrogen for 10 minutes. The cell suspension was then re-incubated at 60 OC for 20 minutes, extracted twice with TE saturated phenol:chloroform, two volumes of cold absolute ethanol added and incubated overnight at -20 "C to precipitate DNA. The cell suspension was centrifuged for 5 minutes at 2500 rpm after which the supernatant was discarded. The pellet was washed with 70 % (vlv) ethanol and dried in a desiccator under vacuum. The pellet was resuspended in 500 pl TE and transferred to an Eppendorf tube. Following the addition of 50 pl of 10X RNase Stock Solution (100 pl of 1 mg ml-' RNase A, 500p1 of lOOOU ml-' RNase TI) the solution was incubated for 1 hour at 37 OC, pheno1:chloroform extracted and ethanol precipitated. The DNA pellet was dissolved in 400 p1 of TE and stored at -20 OC.
2.2.5 Polymerase Chain Reaction (PCR) Polymerase chain amplification reactions were set up in a Class I1 hood to prevent airborne contamination and Gilson pipettes specifically set aside for the addition of PCR reaction components were used. Reactions were set up in thin walled PCR tubes and consisted of 1X Reaction Buffer, 2 or 4 mM MgC12, 1 U p1-' Taq Polymerase, 0.2 mM dNTPfs, 100 ng pl-' of each primer, 0.1-10 ng of template DNA and sdH20 to give the final volume of 50 p1. 31 The PCR process contained 35 cycles which consisted of a denaturing step at 94 OC, an annealing step which depended on the calculated annealing temperatures of the primers being used (40 to 60 OC) and an extension step by Tnq polymerase at 72 OC.
2.2.6 Isolation of Plasmid DNA 2.2.6.1 Small scale plasmid preparation A single bacterial colony containing the plasmid of interest was picked using a sterile toothpick into 5 ml of L-broth containing the appropriate antibiotic and grown overnight in 10 ml sterile culture tubes (Starstedt) at 37 "C, 180 rpm. The cells were harvested by centrifugation for 5 minutes at 2500 rpm (Sigma, rotor 11150), the pellet resuspended in 200 p1 of Plasmid prep solution (15 % (wlv) sucrose, 25 mM Tris pH 8.0, 10 rnM EDTA) and transferred to a sterile Eppendorf tube, followed by the addition of 500 pl of a fresh solution containing 0.2 M NaOH and 1 % (wlv) SDS. The sample was mixed thoroughly by inversion and incubated on ice until the solution became clear. While on ice, 400 p1 of 3 M Na acetate pH 4.6 was added. After mixing vigorously, the chromosomal DNA and cellular debris was removed by centrifugation for 5 minutes at 13000 rpm (Eppendorf). The supernatant was collected and DNA precipitated by adding 0.6 volumes of cold isopropanol and centrifugation for 5 minutes at 13000 rpm (Eppendorf). The DNA pellet was resuspended in 200 pl TE to which 200 p1 of 5 M LiCl was added, vortexed and placed on ice for a minimum of 10 minutes. The solution was centrifuged for 10 minutes at 13000 rpm (Eppendorf) to precipitate RNA. The supernatant was collected and precipitated by the addition of 300 p1 of cold isopropanol and centrifugation for 10 minutes at 13000 rprn (Eppendorf ). The resulting pellet was resuspended in 100 pl of TE buffer and 1 pl RNase A (10 mg ml-') was added to remove the RNA in the sample by incubation at 37 "C for 15 minutes. The solution was pheno1:chloroform extracted and ethanol precipitated. Purified DNA was resuspended in 25 pl HzO. The plasmid DNA was checked for size by agarose gel electrophoresis.
If the plasmid DNA was to be used as template for sequencing, the aqueous phase after pheno1:chloroform extraction was precipitated by adding 55 pl of 2.5 M NaCl, 20 % (w/v) PEG 6000 and incubating on ice for a minimum of 1 hour. The DNA was pelleted by centrifugation for 15 minutes and the pellet washed with 80 % (vlv) ethanol to remove all traces of PEG. Purified DNA was resuspended in 25 pl of water and stored at -20 OC. Larger quantities of DNA were prepared by the large scale procedure.
2.2.6.2 Large scale plasmid preparation This procedure is the same as the small scale procedure except that the starting volume of culture is 50 ml. The amount of solutions used in the procedure have been proportionally increased.
Either a single bacterial colony containing the plasmid of interest or 1 ml of starter culture was added to 50 ml of L-broth containing the appropriate antibiotic and grown overnight in sterile 250 ml Erlenmeyer flasks at 37 "C, 180 rpm. The cells were harvested by centrifugation for 5 minute at 5000 rprn (Sorvall, rotor SS34) in Oak Ridge tube (Nalgene) and resuspended in 2.5 ml of Plasmid prep solution, followed by 5 ml of a fresh solution containing 0.2 M NaOH and 1 % (wlv) SDS. The sample was mixed thoroughly by inversion and incubated on ice until the solution became clear. While on ice, 4 ml of 3 M Na acetate, pH 4.6 was then added. After vigorously mixing, the chromosomal DNA and cellular debris was removed by centrifugation for 10 minutes at 10000 rprn (SS34 rotor). The supernatant was collected and the DNA precipitated by adding 10 ml of cold isopropanol and centrifugation for 10 minutes at 10000 rprn (SS34 rotor). The DNA pellet was resuspended in 400 p1 TE and 400 yl of 5 M LiCl was added, vortexed and placed on ice for a minimum of 10 minutes. The solution was centrif~~gedfor 10 minutes at 13000 rprn (Eppendorf) to precipitate RNA. The supernatant was precipitated by the addition of 400 yl of cold isopropanol and centrifuged for 10 minutes at 13000 rprn (Eppendorf). The resulting pellet was resuspended in 200 y1 of TE and 2 p1 of RNase A (10 rng ml-') was added to remove RNA in the sample and incubated at 37 "C for 15 minutes. The solution was pheno1:chloroform extracted, PEG and ethanol precipitated. Purified DNA was resuspended in 50 yl H20and stored at -20 OC.
2.2.7 Restriction Enzyme Digestion and DNA Analysis 2.2.7.1 Restriction enzyme digests Digestion of DNA with restriction enzymes was carried out according to the manufacturer's directions, usually in 20 y1 reaction volume containing an appropriate
33 amount of DNA, 1 x reaction buffer (supplied) and 1 pl enzyme. The reaction was incubated at the appropriate temperature for 3 hours and then an aliquot was analysed by agarose gel electrophoresis. For double digests with incompatible buffers, pheno1:chloroform extraction and ethanol precipitation were performed after the first digestion.
2.2.7.2 Preparation of vector Vector DNA was linearised with a suitable restriction enzyme then dephosphorylated with calf intestinal phosphatase (CIP). Following the manufacturer's instructions 1 unit of CIP was used per pmole of DNA ends, and incubated at 37 OC for 30 minutes. The linearised dephosphorylated vector was purified from uncut vector by passaging the DNA through an agarose gel.
2.2.7.3 DNA quantitation Determination of DNA concentrations in aqueous solutions was accomplished by measuring the absorbance of these solutions at 260 nm. One A260unit is equivalent to 50 pg ml-I of double stranded DNA, 40 pg ml-' single stranded DNA and 20 yg ml-' for single stranded oligonucleotides. Purity of samples was confirmed by measuring A26dA280.
2.2.7.4 Agarose gel electrophoresis Analysis of size and quantity of DNA was achieved by agarose gel electrophoresis using 0.8 % to 2.0 % (wlv) agarose gels. The electrophoresis buffer and the gel contained 1 X TAE buffer, with the gel also containing 0.5 pg ml-' of the fluorescent intercalating dye ethidium bromide. The gels were cast into a gel mould and the appropriate comb inserted. Once the gel had set, the comb was removed and DNA samples containing 3 pl of dye mix (0.25 % (wlv) bromophenol blue, 40 9% (wlv) sucrose) was loaded into the wells. Molecular weight markers were run along side the samples (either 3LIHirzd I11 or 100 bp ladder were used depending on the size of DNA being run) to estimate the size of the bands. Electrophoresis was carried out at 100 volt at room temperature, until the desired separation of DNA fragments was achieved. Electrophoresed DNA samples were visualised by placing the gel on a UVP white/UV transilluminator. A digital image was obtained using Grab-IT 2.0 Annotating Grabber Software (UVP Incorporated).
34 2.2.8 Subcloning of DNA Fragments into Plasmid Vectors 2.2.8.1 Isolation of DNA fragments from agarose gels The DNA fragments were isolated from agarose gels by the method of Boyle and Lew (1995). DNA sample was run on an agarose gel in 1 X TAE buffer and the desired band excised from the gel and placed in a sterile eppendorf tube. Two to three volumes of 6 M sodium iodide was added and the tube heated at 55 "C for 5 minutes or until agarose had melted. To this, 1 p1 of well-vortexed silica solution (Appendix 2) was added per pg DNA, mixed and incubated at room temperature for 5 minutes. The silica and bound DNA was centrifuged (Eppendorf) briefly to pellet silica and the supernatant was discarded. The silica pellet was resuspended in 400 pl of Wash buffer (10 mM Tris- HCl pH 7.6, 50 mM NaC1, 2.5 mM EDTA, 50% (vlv) Ethanol) and centrifuged (Eppendorf) briefly to pellet silica. This was repeated twice. After the last centrifugation (Eppendorf), all the wash buffer was removed and the pellet resuspended in 10 to 50 pl H20 and incubated at 37 "C for 5 minutes to elute the DNA. The silica was centrifuged briefly and the supernatant containing the DNA collected and stored at -20 "C.
2.2.8.2 Ligation of DNA Following extraction and isolation of the desired DNA fragment from agarose gel, ligations were set up. Each ligation mixture was carried out in 1X T4 Ligase Buffer (Promega) and 1 unit of T4 DNA ligase (Promega) was added. A ratio of 3:l of insertvector was chosen to maximise the number of recombinants. Sticky end ligations were incubated for 3 to 16 hours at 16 "C, whereas blunt end ligations were incubated for 3 hours at room temperature.
When the DNA fragment had unsuitable protruding 5' or 3' temini, it was treated with DNA polymerase I (Klenow fragment) to end-fill or digest back the single-stranded regions to blunt ends. The reaction was set up in 20 pl containing digested DNA, 1 x reaction buffer (supplied), 30 pM of each dNTP and 1 unit of Klenow per pg of DNA. The reaction was incubated at room temperature for 30 minutes before pheno1:chloroform extraction and ethanol precipitation. 2.2.8.3 Competent cells preparation One ml of an overnight culture of E. coli strain ED8799 or BL21 was grown aerobically at 37 "C in 50 ml of L-broth to log phase (A600 = 0.5). The culture was centrifuged at 2500 rpm (Sigma, rotor 11 150) for 5 minutes and the pellet resuspended in 30 ml of ice- cold 0.1 M MgCI2, incubated on ice and centrifuged as above. The pellet was resuspended in 1 ml of ice-cold 0.1 M CaClz and incubated on ice for at least 1 hour before use. Competent cells were stored at 4 OC and transformed within 48 hours. The procedure for E. coli strain JM109 competent cells was the same except both resuspensions were in ice-cold 0.1 M CaC12.
2.2.8.4 Transformation Plasmid DNA solution, usually between 2 and 10 pl of the ligation mixture, was added to 50 pl of competent cells and incubated on ice for 30 minutes. The cells were heat shocked at 37 "C for 2 minutes and incubated on ice for a further 30 minutes. The transformed cells were spread onto L-broth plates containing the appropriate antibiotic that selected for the recombinant plasmid. The following day, visible colonies were picked off using a sterile toothpick, inoculated into 5 ml L-broth with appropriate antibiotic added and incubated overnight at 37 "C. The transformations were confirmed by conducting DNA plasmid preparations and verified by restriction enzyme(s) digests.
When using pGemT EASY vector, the detection of the recombinant was accomplished by the addition of 40 p1 of 8 % (wlv) X-gal (in DMF) to the plate (with antibiotic selection) before the transformed cells were added. The insertion of the recombinant into the vector inactivated the a-peptide coding region of the enzyme P-galactosidase which allowed the recombinant clones to be directly identified by bluelwhite colour screening. Lac' colonies (non-recombinants) were blue, whereas Lac- colonies (recombinants) were white.
2.2.9 Automated Sequencing Sequencing reactions were carried out using the ABI PRISM^" Dye Terminator Cycle sequencing Ready Reaction Kit, according to manufacturer's instructions. Each reaction contained 8 pl Terminator Ready Reaction Mix, 200-500 ng double stranded DNA, 3.2 pmoles primer and made to a final volume of 20 p1 with dsH20. Linear 36 amplification was achieved under the following conditions: 96 OC for 30 seconds, 50 OC for 15 seconds and 60 OC for 4 minutes, repeated for 25 cycles with a ramp time of 1 OC sec-I. The extension products were purified by ethanol precipitation and incubated for 1 minute at 95 OC to remove all traces of ethanol, then analysed using an Applied Biosystems (ABI) 377 Automated Sequencer (Perlun Elmer) at the Griffith University Sequencing Facility operated by Ms Brenda Cheung or Mr Angelo Fallanno.
2.2.10 Ethanol Precipitation Ethanol precipitation was performed by the addition of 2.5 volumes of cold absolute ethanol and 1/10 volume of 3 M sodium acetate, pH 5.3 and centrifuged for 5 minutes at 13000 rpm (Eppendorf). The resulting pellet was washed with 200 p1 cold 70 % (vlv) ethanol and centrifuged twice to remove all traces of ethanol. Purified DNA was resuspended in sterile water and stored at -20 OC.
2.2.11 TE Saturated Pheno1:Chloroform Extraction Extraction of DNA was achieved by adding an equal volume of TE saturated pheno1:chloroform to the solution containing the DNA and centrifuged for 2 minutes at 13000 rpm (Eppendorf). The upper aqueous layer was collected and ethanol precipitated.
2.2.12 Expression of Recombinant Transglutaminase The target gene was cloned into pET28b expression vector in E. coli strain ED8799, which does not carry the gene for T7 RNA polymerase. For protein expression, BL21(DE3)pLysS was used as this strain contains the gene for T7 RNA polymerase under the control of the IPTG inducible lacUV5 promoter. BL21(DE3)pLysS also contains a plasmid, pLysS, which carries the gene encoding T7 lysozyme. T7 lysozyme inhibits T7 RNA poymerase and therefore lowers the background expression level of target genes under the control of the T7 promoter but does not interfere with the level of expression achieved following the induction by IPTG. The recombinant DNA plasmid was transformed into BL21(DE3)pLysS competent cells (2.2.8iv), spread onto L-broth plates containing 30 yg kanamycin ml-I and incubated overnight at 37 "C. A recombinant colony was picked off the plate using a sterile toothpick and grown overnight at 37 "C in 2 ml of L-broth containing 30 pg kanamycin ml-I. The next day, lml of the starter culture was inoculated into 50 ml of L-broth containing kanamycin and incubated at 37 "C until log phase (AGo0= 0.3 to 0.6). One ml of the culture was removed, labelled BI (before induction) and stored on ice. 1 M PTG was added to the log phase culture to a final concentration of 1 mM and the culture incubated for 3 hours at 37 "C. One ml of the induced culture was removed, labelled A1 (after induction) and stored on ice. The culture was then incubated overnight and a third one ml sample was removed and labelled A1 (overnight). Both the BI sample and the two A1 sample were analysed by SDSIPAGE (2.2.15).
The induced culture was centrifuged for 5 minutes at 2500 rpm, supernatant removed and the pellet stored at 4 "C. The recombinant transglutaminase was expressed by BL21(DE3)pLysS in the cytosol, therefore the pellet was resuspended in 2 ml H20 and sonicated for 3 x 30 seconds at 12 microns and assayed for activity.
2.2.13 Scaled-up Growth and Cell Disruption
For scaled-up growth, transformants containing the TGase gene were grown in 6 litres of L-broth containing 30 pg kanarnycin ml-' and incubated at 37 "C until log phase. IPTG was added to the log phase culture to a final concentration of 1 mM and the culture incubated at 37 "C for either three hours (Sm. mobaraense constructs) or overnight (Sfv. baldaccii construct). After cultivation, the pellet was collected by centrifugation and resuspended in buffer required for chromatography (1 g cell pellet in 20 ml buffer); His- transformants were resuspended in equilibration buffer (50 mM cation buffer, pH 6) whereas His' transformants were resuspended in 1 x Binding Buffer (5 mM imidazole, 0.5 M NaC1, 20 mM Tris-HC1, pH 7.9). The resuspended pellet was disrupted by French Pressure Cell Press (SLM-AMINCO) and the lysed cells centrifuged at 40000 rpm (Beckman L8-55 Ultracentrifuge, rotor Ti60) for 30 minutes. The supernatant was collected for further purification. 2.2.14 Southern Blotting 2.2.14.1 Transfer of DNA A suitable sized 0.7 % (wlv) agarose gel was made using 0.5 X TBE Buffer, which was also used as the running buffer. Restriction enzyme digested DNA along with Dig- labelled DNA markers were electrophoresed for 16 hours at 10 volts to achieve desired separation. Before southern transfer, the DNA fragments were firstly depurinated by washing the gel in 0.25 M HCl for 5 minutes, rinsed in dH20, then denatured in 0.5 M NaOH, 1.5 M NaCl for 20 minutes. The gel was next rinsed in dH20 and neutralised in 0.5 M Tris pH 7.0, 3 M NaCl for 20 minutes, before blotted by capillary transfer to a positively charged, nylon membrane (Roche).
The assembly of the sandwich for capillary transfer was as follows. The nylon membrane and several pieces of 3MM (Whatman) blotting paper were pre-cut to the same size as the gel. A large piece of plastic wrap was placed first followed by 2 pieces of blot paper soaked in 20 X SSC. The gel was carefully placed well side down on top of the blot paper followed by the nylon membrane and 1 piece of blot paper both soaked in 5 X SSC. Dry blot paper (10 to 15 pieces) was placed on top and the whole sandwich was wrapped in plastic wrap. A glass plate and a weight were placed on top and the DNA was transferred overnight. Following capillary transfer, the DNA was cross- linked onto the membrane by incubating at 120 OC for 30 minutes.
2.2.14.2 Preparation of probe A plasmid preparation of pmmt.612B (2.1.3 4) was digested with EcoR I to obtain the 1 kb insert. Preparation of the probe was set up as per DIG High Prime DNA Labelling and Detection Kit instructions. In a sterile eppendorf tube 1 pg of purified template DNA plus sdHzO was added to give a final volume of 16 p1. The DNA was denatured by heating at 100 OC for 10 minutes and quickly chilled in an icelethanol bath. To the denatured DNA was added 4 p1 of DIG-High Prime and the tube mixed and briefly centrifuged (Eppendorf). The DIG-High Prime labelling reaction was incubated at 37 OC for 20 hours. The reaction was stopped by adding 2 pl of 0.2 M EDTA and heated at 65 OC for 10 minutes. The quantity of newly synthesised labelled DNA was assayed using DIG quantification and DIG Control Teststrips. To determine the optimal probe concentration, a mock hybridisation without DNA was performed with increasing concentrations of labelled probe to find the highest probe concentration which gave acceptable background.
2.2.14.3 Hybridisation and detection All volumes used in hybridisation and immunological detection were intended for 100 cm2 membranes and volumes were adjusted accordingly for smaller or larger membranes. Prior to prehybridisation, prehybridisation buffer was prewarmed to hybridisation temperature of 42 OC. Membranes were placed in a glass hybridisation chamber with 20 ml of prehybridisation buffer and incubated in a rotating hybridisation oven for 2 hours at 42 OC. The prehybridisation buffer was removed and replaced with 2.5 ml of hybridisation buffer containing freshly denatured DIG labelled probe. The probe was denatured by boiling for 5 minutes and cooled on ice immediately prior to use. Hybridisation was performed in a glass hybridisation chamber overnight at 42 OC with gentle rotation. After hybridisation was complete, membranes were washed twice for 5 minutes with 50 ml of 2 X SSC, 0.1 % (w/v) SDS at room temperature, followed by two 15 minute washes with 50 ml of 0.1 X SSC, 0.1 % (w/v) SDS at 68 OC. Membranes were then air dried and stored until use or directly used for immunological detection.
All incubations for immunological detection were performed at room temperature with gentle agitation as per DIG High Prime DNA Labelling and Detection Kit instructions (Roche). Membranes were briefly washed in maleic acid buffer (0.1 M maleic acid, 0.15 M NaCl, pH adjusted to 7.5 with solid NaOH) and incubated for 30 minutes with blocking solution. The bloclung solution was then removed and replaced with 20 ml of Anti-DIG-AP conjugate diluted 1:10 000 in bloclung solution and incubated for 30 minutes. The membranes were then washed twice for 15 minutes with 100 ml of maleic acid buffer and equilibrated for 2 minutes with 20 ml of detection buffer (0.1 M Tris- HC1 pH 9.5, 0.1 M NaCl, 50 mM MgC12). Membranes with DNA side facing up, were placed in a plastic bag and 20 drops (1 ml) of the chemiluminescence substrate CSPD, ready to use solution (supplied with kit) was applied. The substrate was spread evenly and without air bubbles over the membrane and after 5 minutes incubation, excess liquid was squeezed out and the bag sealed. The damp membrane was incubated for 15 minutes at 37 OC to enhance luminescent reaction, exposed to Lumni Film (Roche) at room temperature for the required length of time and developed using the automatic Kodak Film Processor (SRX-101A).
2.2.15 SDS-PolyacrylamideGel Electrophoresis Electrophoresis of proteins on SDS-polyacrylamide gels consisting of 10 % (wlv) separating gel, with a 4 % (wlv) staclung gel, was performed using a Bio-Rad Mini-Gel System as per the manufacturer's instructions. Samples containing solubilised protein were diluted 4:l in 5 X SDS(+) sample buffer, whereas crude cell fractions were resuspended in 10 % (vlv) BME, 2 % (wlv) SDS. After sample preparation, the protein samples were heated at 100 OC for 5 minutes and 15 pl was loaded onto the gel. Electrophoresis was carried out in 1 X Electrode buffer at a constant voltage of 180 volts. The gels were stained with 0.2 % (wlv) Coomassie Brilliant Blue R250 (Sigma) made up in 40 % (vlv) methanol, 50 % (vlv) H20 and 10 % (vlv) acetic acid for at least 60 minutes. Gels were destained in destaining solution consisting of 20 % (vlv) methanol, 70 % (vlv) H20 and 10 % (vlv) acetic acid for one to two hours. Molecular weight protein markers were used as standards.
2.2.16 Production of TGase Streptoverticillium species and actinomycete isolates were cultivated in duplicate as described by Gerber et al. (1994). In a 250 ml Erlenmeyer flask, 100 pl of either spore suspension or starter culture was added to 100 ml of sterile TGase media (2.1.6.lb) and cultured at 28OC, 200 rpm for 15 days. Samples were taken at day 4,6, 8, 10, 12 and 15 and the culture fluid and cell pellets were separated by centrifugation and stored at -20
2.2.17 Enzyme Activity Assay 2.2.17.1 TGase colorimetric assay Enzyme activity of solubilised transglutaminase was assayed in duplicate by the colorimetric procedure described by Grossowicz et al. (1950). This method measured the activity of TGase by performing a reaction using CBZ-L-gln-glu and hydroxylamine as substrates in the absence of ca2+. An iron complex was formed with the resulting hydroxamic acid in the presence of TCA, which produced a colour change from yellow to red. To 100 p1 of sample was added 100 p1 of Buffer A (0.03 M CBZ-L-gln-glu, 0.01 M GSH and 0.1 M Hydroxylamine in 0.2 M Tris-HC1, pH 6.0), mixed and incubated at 37 OC for 10 minutes. To stop the reaction 100 p1 of Reagent B (equal volume of 3 M HCl, 12 % (wlv) TCA and 5 % (wlv) FeC13 (in 0.1 M HCl)) was added. The samples were centrifuged (Eppendorf) briefly to pellet the precipitate. Samples were pipetted into a microtitre plate, 200 p1 of supernatant per well, and the absorbance read at 525 nm. A calibration curve was prepared using L-glutamic acid y- monohydroxamate instead of the enzyme solution. An enzyme activity which produced 1 pmol of hydroxamic acid per one minute was defined as one unit.
2.2.17.2 In vivo plate assay for measurement of TGase activity TGase activity was measured directly from cultures growing on agar plates using a modified colorimetric measurement procedure. The colorimetric assay described in section 2.2.17.1 was modified to avoid lulling the colonies on the agar plates. An agarose overlay was placed on top of the agar plate after the addition of the substrates.
After overnight incubation at 37 OC, the agarose overlay was removed and the acid ferric chloride reagent was added to the overlay. Streptoverticillium species secrete TGase into the media. The presence of TGase activity was indicated by the formation of the red coloured complex in the agarose overlay. Inhibition of TGase activity was achieved by the addition of ZnC12 at a final concentration of 1 mM to the substrates.
2.2.18 Western Blotting 2.2.18.1 Transfer of protein After electrophoresis of protein samples, gels were equilibrated in Towbin Buffer for 15 minutes. Nitrocellulose membranes and 3MM filter paper (Whatmann), both cut to the same dimensions of the gels, were also soaked in Towbin Buffer for 15 minutes. The protein was then transferred to nitrocellulose membranes using a semi-dry blotting apparatus (Bio-Rad) assembled in the following manner. Three pieces of pre-soaked filter paper were layered onto the platinum anode, followed by pre-soaked membrane. Bubbles were removed between each layer. The equilibrated gel was placed carefully on top of the membrane, aligning the gel on the centre of the membrane and all bubbles removed. Three pieces of pre-soaked filter paper were positioned on top, with bubbles removed between each layer. The cathode was placed on top, followed by the lid. A voltage was then applied (15 volts, current limit, 5.5 mA cm-') for 15 minutes. Efficiency of the transfer could be estimated by staining the gel with Coomassie Blue stain (2.2.15).
2.2.18.2 ECL detection For ECL detection, all incubations were performed at room temperature with gentle agitation unless specified. Following transfer of proteins to nitrocellulose membrane, the membrane was blocked overnight at 4 OC in Blotto. After rinsing twice in TBS-T the membrane was further washed once for 15 minutes and twice for 5 minutes with fresh changes of TBS-T. The membrane was then incubated for 1 hour in rabbit anti- microbial TGase polyclonal antibody diluted in Blotto, followed by washing in TBS-T as previously described. Next, the membrane was incubated for 1 hour in I-FRP conjugated goat anti-rabbit IgG diluted in Blotto. Thorough washing of the membrane after incubation with the secondary antibody minimises background. Therefore, the membrane was washed once for 15 minutes and four times 5 minutes in fresh changes of TBS-T.
All steps of the detection protocol were carried out in the dark room; it was only necessary to turn off the lights when exposing the membrane to autoradiography film. The detection reagent was prepared by mixing equal volume of detection solution 1 (ECL Western Blotting detection reagents, Amersham) with detection solution 2 (ECL Western Blotting detection reagents, Amersham) to give a final volume of 0.125 ml cm-' membrane. The washed membrane was placed on plastic wrap, protein side up and sufficient detection reagent was added to the protein side of the membrane so that the reagent was held by surface tension on the surface of the membrane. The membrane was incubated for precisely 1 minute without agitation and then excess detection reagent drained. The membrane was placed inside a plastic bag with all air bubbles removed. The membrane was exposed to Lumni Film (Roche) for the required length of time and the film developed using the automatic Kodak Film Processor (SRX-101A). 2.2.19 Protein Estimations Protein estimations were performed using microtitre plate protocols. Comparison to a standard curve using bovine serum albumin (BSA) allowed measurement of protein concentration.
2.2.19.1 Whole cell protein estimation The protein assay by Lowry et nl. (1951) was less sensitive to interfering buffer components and more sensitive to low levels of protein than using the Bio-Rad Protein Assay. To determine the concentration of protein in cell pellets, the cells were resuspended in Lysis buffer (0.1 % (wlv) SDS, 0.1 M Tris, pH 7.0, 1 mM DTT SDS). The components of the Lysis buffer were within the concentration limits and therefore did not interfere with the assay.
The pellets were first washed twice in dH20 and resuspended in 200 p1 of Lysis buffer. After heating at 100 OC for 1 minute, the samples were centrifuged for 5 minute at 13000 rpm (Eppendorf), and the supernatant assayed for protein concentration. An alkaline copper solution consisting of 50 ml of 2 % (wlv) Na~C03(in 0.1 M NaOH), 0.5 ml of 1 % (wlv) CuS04.5H20and 0.5 ml of 2 % sodium of potassium tartrate was freshly prepared. In a microtitre plate, 10 pl of standards and blank, setup in triplicate, were added to each well. Samples with unknown protein concentration were added to the plate in duplicate, at several different volumes. To this 180 p1 of alkaline copper solution was added to each well, thoroughly mixed and let stand for 1 minute. Folin- Ciocalteau reagent (BDH) was diluted (I part to 3 parts H20), and 20 pl added to each well, mixed thoroughly and incubated at room temperature for 15 minutes. The absorbance was read at 750 nm using a SpectraMAX 250 platereader (Molecular Devices) and the protein concentration of the samples were determined from the standard curve run in parallel and analysed by SOFTmaxPRO.
2.2.i9.2 Solubilised protein estimation The Bio-Rad Protein Assay, based on the method by Bradford (19761, determined the concentration of solubilised protein. This procedure involves the addition of an acidic dye to protein solution, and measurement of colour development at A.jg5. Bradford Reagent was diluted (1 part to 4 parts of dH20) and filtered with Whatman # 1 filter paper. In a microtitre plate 10 p1 of standards and blanks, setup in triplicate, were added to each well. Samples with unknown protein concentration were added to the plate in duplicate, at several different volumes. 200 p1 of diluted Bradford Reagent was added to each well, thoroughly mixed and the absorbance read at 595 nm using SpectraMAX 250 platereader (Molecular Devices). Protein concentration of the samples were determined from the standard curve run in parallel with the samples and anal ysed by SOFTmaxPRO.
2.2.20 Chromatography 2.2.20.1 Ion-exchange Chromatography 2.2.20.1a Bio-Cad Purification System The Bio-Cad (PerSeptive Biosystems) chromatography system was used for ion- exchange chromatography and to optirnise the purification process. This unit is designed to perform rapid separations using a novel open matrix and a novel programmable parameter matrix. Flow rates are typically 15 ml minute-' with small bed volumes of 10 ml. Srv. bulduccii was cultured for 8 days at 28 OC and the c~llturefiltrate removed after centrifuging. The filtrate, pH 6, was loaded onto a column packed with POROS2OHS (PerSeptive Biosystems) equilibrated with 50 mM Cation Buffer, pH 6 (33 mM MES, 33 mM HEPES, 33 mM Na acetate). After loading the sample the column was washed with the equilibration buffer was applied. A linear gradient from 0 to 0.5 M NaCl in equilibration buffer. Fractions were collected and assayed for TGase activity
2.2.20.1b Purification on Fractogel EMD SO3- Purification of MTGase by ion-exchange chromatography on Fractogel EMD SO3-, a strong acid ion exchanger, was carried out according to the method of Gerber et al. (1994) using a low pressure apparatus (Isco). Clarified culture filtrate was loaded directly onto the Fractogel EMD SO3-,equilibrated with 50 mM sodium phosphate, pH 6. The column was washed with 2 column volumes of the same buffer. Bound proteins were eluted using a stepwise gradient of 0.1 M, 0.2 M and 0.3 M NaCl in 50 mM sodium phosphate, pH 6. Fractions were assayed for TGase activity. 2.2.20.2 Size-Exclusion Chromatography 2.2:20.2a High Performance Liquid Chromatography (HPLC) HPLC was used to purify partially-purified TGase from Streptoverticillium S-8112. A 5 % (w/v) solution of enzyme material in PBS pH 7.4 was filtered through a 0.22 pm filter (Millipore). 400 p1 was loaded onto a 30 ml FPLC column (Pharmacia Biotech) containing Superdex 200 (Pharmacia Biotech) equilibrated with PBS pH 7.4 buffer. Two column volumes of PBS pH 6.8 buffer were passed through the column at 0.5 ml min-' and 1 ml fractions were collected. Fractions eluted at a point which corresponded to molecular weight of 40 kDa were checked for purity by SDS-PAGE.
2.2.20.2b Gel filtration chromatography After purification of Sfv. baldaccii culture fitrate by ion-exchange chromatography on Fractogel EMD SO;-, active fractions were combined and concentrated by ultrafiltration using a Centriprep-10 (Amicon) system with a 10 kDa cut-off point membrane. The enzyme solution was loaded onto a 25 ml column containing Sephadex G-100 (Pharmacia Biotech) equilibrated with dHzO. The enzyme was eluted with dH20 at a flow rate of 1 ml minute-' and active fractions were analysed by SDS-PAGE.
2.2.20.3 Affinity chromatography on His-Bind resin His-Bind Resin (Novagen) was used for affinity purification of proteins containing the His.Tag sequence produced by PET vectors and performed following manufacturer's instructions (PET System Manual, 6th Edition). A 2.5 ml column containing His-Bind Resin was equilibrated with the following: 3 column volumes of sdHzO, 5 column volumes of 1 x Charge Buffer (50 rnM NiS04) and 3 column volumes of 1 x Binding Buffer (5 mM imidazole, 0.5 M NaC1, 20 mM Tris-HC1, pH 7.9). After the prepared extract (2.2.13) of the Hisf transfonnant containing the TGase gene was loaded, the column was washed with 10 column volumes of 1 x Binding Buffer and 6 column volumes of 1 x Wash Buffer (60 rnM imidazole, 0.5 M NaCI, 20 mM Tris-HC1, pH 7.9) and ,the bound protein eluted with 6 column volumes of 1 x Elution Buffer (1 M imidazole, 0.5 M NaC1, 20 mM Tris-HC1, pH 7.9). The eluted protein was assayed for TGase activity and analysed for purity by SDS-PAGE. 2.2.20.4 NiTrap NHS-activated affinity chromatography A prepacked 1 ml column containing the matrix NHS-activated Sepharose High Performance was coupled with HPLC purified MTGase (2.2.20.2a) to purify the polyclonal antibody. Fractions obtained from WLC were dialysed overnight in coupling buffer (0.2 M NaHC03, 0.5 M NaCI, pH 8.3). The HiTrap column was then prepared as per manufacturer's instructions before the ligand (purified MTGase) was injected and incubated at room temperature for 30 minutes. The column was washed to deactivate any excess active groups that have not coupled to the ligand and to remove non-specifically bound ligands before use.
The HiTrap column coupled with MTGase was washed with 10 column volumes of equilibration buffer (0.05 M Tris-C1 pH 7.5, 0.15 M NaCl) before the polyclonal antibody was loaded and incubated at room temperature for 30 minutes. The column was then washed with 10 column volumes of wash buffer (0.05 M Tris-C1 pH 7.5, 0.6 M NaCI) followed by 10 column volumes of 0.3 % (w/v) NaCI. To elute the bound sample, 2 column volumes of 0.5 M acetic acid were passed through the column and fractions were collected and absorbance readings taken at 280 nm. The peak fractions corresponded to the purified polyclonal antibody. After use, the column was washed with 10 column volumes of equilibration buffer and stored at 4 OC.
2.2.21 Ammonium Sulphate Precipitation Ammonium sulphate precipitation was used to partially purify and concentrate TGase from the culture filtrate of Streptoverticillium species. Extracellular TGase from Stv. lndaknnum has been purified by ammonium sulphate fractionation using 55 to 75 % saturation and Blue Sepharose Fast Flow chromatography (Tsai et al., 1996). Using this range of ammonium sulphate saturation for precipitation of TGase, culture filtrates with maximum TGase activity were subjected to 65 % saturation.
The weight of solid ammonium sulphate needed to bring the volume of starting material to 65 % saturation was determined to be 3988 litre-' (Englard and Seifter, 1990). Therefore for 10 ml of culture filtrate 3.98 g ammonium sulphate was added, mixed until dissolved and placed on ice for 5 minutes. The mixture was centrifuged at 4 OC for 15 minutes at 13000 g (Eppendorf) to precipitate the protein. The supernatant was removed and the pellet was resuspended in 2 ml of 0.2 M Tris-HC1, pH 6.0 for enzyme actlv~tyanalysis (2.2.17).
2.2.22 Production of Polyclonal Antibody Crude MTGase from Streptoverticillium sp. strain S-8112, a variant of Stv. mobarnense was injected into a rabbit to produce polyclonal antibodies. An emulsion between the antigen and an adjuvant called Hunter's TiterMax Adjuvant (Sigma) was prepared by combining 400 p1 of 100 pg ml-' of antigen solution with 400 pi of adjuvant using a 2 syringe, 3 way stopcock method. The rabbit was injected subcutaneously at 4 sites over both shoulders and both hind quadriceps using 200 p1 of emulsion at each site. A total of 50 pg of antigen was injected for the primary immunisation. A pre-inoculation bleed was taken as a negative control. A test bleed (2 ml) was taken 4 weeks after inoculation and the titre was checked by western blot analysis. A second inoculation was given to the rabbit and after 4 weeks a larger volume bleed was taken.
Pre- and post-inoculation bleeds were bled into vacutainer tubes containing SST Gel and Clot Activator (Becton Diclunson) and the tubes incubated at room temperature for 5 minutes until the blood had clotted. The tubes were centrifuged for 5 minutes at 2000 rpm (Sigma rotor 11150) and the serum was then removed and aliquoted into 500 p1 lots for storage at -70 OC. CHAPTER 3
Sequence and Structural Relationships of TGase produced by Streptoverticillium and Related Species 3.1 Introduction Microbial transglutaminase was first isolated and purified from the culture filtrate of strain S-8112, a variant of Streptoverticillium mobaraense by Ando et al. (1989). Subsequently, extracellular TGase has been identified in Stv. griseocameum, Stv. cinnamoneum ssp. cinnamoneum (Motoh et al., 1990) and Stv. ladakanum (Tsai et al., 1996) and from the genus Streptomyces, S. laverzd~~lae,Streptomyces sp. No 83 (Andou et al., 1993), S. lydicus (Bech et al., 1996; Faergemand et al., 1997) and S. platensis (Bech et al., 1996).
Streptoverticillium sp. and Streptomyces sp. belong to the family Streptomycetacae, order Actinomycetales and are characterised by the formation of chains of arthrospores on the aerial mycelium (Locci, 1989). Recently intracellular transglutaminase activity has been detected in the sporulating cells of Bacillus subtilis and E-(y-glutamy1)lysine cross-links were found in the spore-coat fraction (Kobayashi et al., 1998a). As mentioned earlier, comparison of the amino acid sequence of procaryotic TGases from B. subtilis and strain S-8112 showed little sequence homology.
Until recently mammalian TGase was the sole source of commercial TGase. Complicated separation and purification procedures as well as calcium and thrombin requirement for activation have deterred acceptance in the food sector. Stv. mobaraense TGase which can be readily obtained by microbial fermentation, is smaller, seemingly more robust and has no activation requirements (Motolu and Seguro, 1998; Zhu et al., 1995).
Almost all the work to date has been carried out with enzymes from mesophilic organisms. The temperature profile of the bacterial enzymes in the literature invariably have been sourced from mesophiles. As a rule of thumb (P. Rogers, personal communication), the temperature optima corresponds to the preferred growth temperature plus approximately 25 "C. So for a typical mesophile the optimum temperature will be about 55 "C (25 OC plus 30 "C), which is not much different to the optimal temperature previously quoted for mammalian plasma TGase. For this study I required an enzyme that was adaptable to lower temperatures. This would provide a much broader operating temperature and as long as the enzyme had comparable catalytic activity to mammalian source, would provide a more flexible and
50 commercially-appealing enzyme preparation. The main aim of this study was to find an alteinative source of MTGase that could function at low temperatures and could be used for large scale production. This required screening and analysing a large range of closely related and cold-adapted microorganisms. In addition, this work also afforded an opportunity to examine the TGase family in a wide array of microorganisms.
Microbial TGase is first synthesised as the inactive Pro-TGase and diffuses out of the cell wall where proteolytic cleavage occurs to form an active mature enzyme. For expression of the active TGase protein, the coding region for the mature form of the TGase protein was isolated from Stv. mobaraense genomic DNA and cloned and sequenced using a PCR approach with oligonucleotides designed from the published sequence of S-8112 (Washizu et al., 1994). The TGase gene from closely related Streptoverticillium species which have been reported to contain TGase activity were also cloned and sequenced using this PCR approach. These include Stv. griseocameum, Stv. cinnamoneum ssp. cinnamoneum and S. lavendulae. Furthermore, the coding region of the TGase gene for mature active form of TGase from the type species of the genus, Stv. baldaccii was also cloned. While it has not been reported that Stv. baldaccii contains TGase activity, this strain is in the same cluster group (F) with other known TGase producing Streptoverticillium species (Williams et al., 1983). In addition, Stv. mobnmense, Stv. cinnamoneum ssp. cinnamoneum, Stv. baldaccii and other actinomycetes were screened by Western blot analyses and Southern blot hybridisation for detection of TGase-like proteins and sequences closely related to Stv. mobaraerzse TGase.
Makarova et al. (1999) has identified a superfamily of proteins homologous to eucaryotic TGase, with members found in all archaea and a sporadic distribution among bacteria. However the sequences of TGases cloned from Stv. mobaraense (Washizu et al., 1994) and B. subtilis (Kobayashi et al., 1998b) do not resemble this superfamily or each, other. To date, MTGase has only been'characterised and cloned from these two sporulating, Gram positive bacteria and activity has been shown to be related to morphological differentiation and production of spores. A study of MTGase in other procaryotes would provide further understanding of the evolution of this enzyme. Given the current minimal knowledge on MTGase, information on the protein and genetic relationship between procaryotic TGase would be beneficial for understanding the biological functions of MTGase.
In this chapter I will: (i) develop a PCR strategy for selection and cloning of the TGase gene in known TGase-producing species, other actinomycete isolates and low-temperature bacteria; (ii) analyse Streptoverticillium species known to possess the TGase gene for the ability to produce the enzyme; (iii) screen other actinomycetes for intracellular and extracellular production of TGase; (iv) analyse the genomes of Streptoverticillium species and actinomycete isolates for closely related TGase sequences. 3.2 Results 3.2.1 Genomic DNA Isolation Genomic DNA was isolated from a number of Streptoverticilliz~m species and actinomycetes isolates using the method of Takagi et al. (1995) (2.2.4). DNA purity was checked by agarose gel electrophoresis and subsequently used for PCR and Southern blot analyses.
3.2.2 Design of Primers At the commencement of this study the only TGase gene which had been isolated and sequenced was from Streptoverticillium S-8 112 (Washizu et al., 1994). From this reported DNA sequence of strain S-8112 TGase several complementary primers, 20 nucleotides in length (Figure 3.1) were designed. These primers were used in PCR reactions (2.2.5) to amplify the full length coding sequence which encodes the precursor form of TGase (Primers PTGase 1A and PTGase 2B), the sequence encoding the mature active form of TGase (Primers PTGase 6 and PTGase 2B) and a 400 bp sequence containing the active site region (Primers PTGase 4 and PTGase 5) from Stv. mobaraense genomic DNA. This strategy was successful and was subsequently used to screen other Streptoverticillium species, actinomycetes isolates and cold-adapted bacteria for the presence of a related TGase gene. .
Figure 3.1: DNA sequence of the entire Streptoverticillium S-8112 TGase gene showing the predicted amino acid sequence (Washizu et al., 1994). The oligonucleotides used in PCR reactions to amplify the gene are also indicated and the active site region of the enzyme is boxed in blue. 54 3.2.3 Cloning and Sequencing Comparison 3.2.3.1 Cloning of the TGase gene The active mature region encoded by the TGase gene from Stv. nzobnraense was amplified by PCR (2.2.5) using the primers PTGase 6 and PTGase 2B (Table 3.1). The 997 bp fragment was excised from an agarose gel (2.2.7.4), cloned into the pGemT Easy vector (Promega) and transformed and maintained in E. coli ED8799 on ampicillin at 100 pg ml-'. To confirm that the PCR fragment contained the TGase gene, small scale plasmid preparations (2.2.6. l), restriction enzyme digests and sequencing with T7 and Sp6 (universal primers) were performed. Since the PCR and cloning approach was successful in isolating the active mature region of TGase from Stv. mobarnense, this approach was used to isolate the 997 bp active, mature region of the TGase gene from Stv. griseocameum, Stv. cinnnmoneum ssp. cinnamoneum, Stv. baldaccii and S. lavendulae. However, in order to obtain the desired PCR products, the reaction needed to be optimised for each template DNA. Various magnesium concentrations and annealing temperatures were tested so as to achieve the required yield of product and specificity of the reaction.
Primer name Primer nucleotides (5'-3') Nucleotide position 11 PTGase 6 / GACTCCGACGACAGGGTCAC 1 246-265 I1 PTGase 2B TCACGGCCAGCCCTGCTTTAC 1221-1241
Table 3.1: Primers used to amplify the active mature region encoded by the gene for TGase. Refer to Figure 3.1 for location of the nucleotide positions on the published sequence of strain S-8112 (Washizu et al., 1994).
3.2.3.2 Sequence comparison of Streptoverticillium TGase genes Comparison of the DNA sequence of the 997 bp active mature region encoded by the TGase gene from Stv. mobarnense with the previously published TGase sequence from strain S-8112 cDNA showed 100% identity, and therefore, both produce the same TGase protein. Comparison of the deduced amino acid sequences of the TGase gene cloned from Stv. mobaraense with Stv. griseocnmeum, Stv. cinnamoneum ssp.
55 cinnnmoize~~mand S. lnveizdulne showed these sequences were closely related with 99% homology (Figure 3.2A). Stv. bnldaccii and Stv. mobnrnense deduced amino acid sequences were approximately 80% homologous (Figure 3.2B). The deduced amino acid sequence of the mature TGase in all 5 bacteria examined contained the active site sequence of YGCVG found in strain S-8112 with a single cysteine residue at position 64 (Figure 3.2).
Comparison of the deduced amino acid sequences of the gene encoding TGase from Stv. cinnamoneum ssp. cirznamoneum with Stv. mobnrnense showed high homology. However, comparison of this sequence with the deduced amino acid sequence from SW. cinnnmoneum CBS 683.68 (Duran et al., 1998) showed there was only approximately 80 % homology (Figure 3.2C). Although the sequences shared considerable identity, there were substitutions distributed along the amino acid sequence, however, the active site region was conserved. Using the PCR strategy described in this study, the entire coding sequence of the mature form of TGase from Stv. cinnamoneum ssp. cinnamoneum was amplified; whereas Duran et al. (1998) screened a genomic library of
Stv. cinnnmoneum 683.68 with a 32~labelled DNA fragment containing Stv. mobarnense TGase sequences. These observed amino acid changes could therefore be due to either (1) different methodologies, (2) strain variations or (3) a combination of (I) and (2). Y I RKWQQVYSHRD GRKQQMTE EQREWL~6, NNY IRKWQQVYSHRDGRKQQMTE EQREWL @ NN Y I R KWWVYSHRD GR K QQMTE tEa( EWL NNYIRKW QVYSWRDGRKQQMTEEQREWL @ ,- YGCVGBTWVNSGQYP YGCVGVTWVN SGQYP YGCVGVTWVN SGQYP CVGVTWVN SGQYP
rncb 91 120 am 3 t3D ws 9l 1x) la 91 120 ------.. mcb 121 GFQRAREVAS VMNRA LENAHDESAY LDN L am GFQRARES/ASVMNRALENAHDESAYLDN L w gls GFQRAREVASVMNRALENAHDESAYLDNL Is, ISV GFQR AREV AS VMNR A LE &.AH 9-ES-AY LR.N I, Is,
mob M KE~ANNDALRNEDARSPFT~T~TNTPSF ~s, am LB IT-""-KELAN GNDALRNERARSPFYSALRNTPSF Isn ms M KELAN GNDALRNEOARSPFYSALRN TPSF 2% la 19 ----KELAN GNDALRNEDARSPFYSALRNTPSF---- Is, mob IS1 ERNGGNHDPSRMKAVI YSKH FWSGQ 210 urn 210 gis 'B W) 121 1 ------m mob 2U ADKRK YGDPDAFRPAPGTGL VDMSRDRNI M3 ADKRK YGDPDAFRPAPGTGL VDMSRDRNI " ADKRK YGDPDAFRPAPGTGL VDMSRDRNI z* ADKRK YGDPDAFRPAPGTGL VDMSRDRNI *
RSPTSPGEGFVNFDY GWF GAQTEADADKT N
---- YSDFDRGAYVI TF I PKsTRT?~"TTKQGW'm YSDFDRGAYVI TFI PKSWNTHPDKVKQGW 3fi YSDFDRGAYVI TF I PKSWNTAPDKVKQGW m YSDFDRGAYVI TF I PKSWNTAPDKVKQGW a,
mob 33 am 3a Sis 33l 1Z-d 3?d
Figure 3.2A: Comparison of deduced amino acid sequence of the gene encoding the TGasi: gene fiom Stv. mobaraense (mob), Stv. cinnamoneum ssp. cinnamoneum (cin), Stv. griseocary1eum (gris) and S. hvendulae (lav). The single cysteine, CysG4,essential for the catalytic activity in the mature TGase is located within the active site region which is boxed. Comparison of the nucleotide sequences of the gene encoding TGase from the above Streptoverticillium species and S. lavendulae are shown in Appendix 3. mob a Md a
mob 9 bad R
mob 38 3k bid 331 3fl
Figure 3.2B: Comparison of deduced amino acid sequence of the gene encoding the TGase gene from Stv. mobaraense (mob) and Sh. baldaccii (bald). The single cysteine, cys6', essential for the catalytic activity in the mature TGase is located within the active site region which is boxed. Comparison of the nucleotide sequences of the gene encoding TGase from Shi mobaraense and Stv. baldaccii are shown in Appendix 4. GNDALRNEDARSP DINIKNN LK T IK:O-ONIAR~SLIN PSFK ERN GGNHDPSR MK AV I Y SKH FWS GQD IPSFIE LIK MKAV l YSKH FWSGQD
cin 2@ CIN* 29 rio 2% PKSWNTAPDKVK sl CIN* PKSWNTAPAKVEI
Figure 3.2C: Comparison of deduced amino acid sequence of the gene encoding the TGase gene fiom Stv. cinnamoneum ssp. cinnamoneum (cin) and Stv. cinnamoneum CBS 683.68 (CIN*) (Duran et al., 1998) deduced amino acid sequences. The single cysteine, ~~s~~,essential for the catalytic activity in the mature TGase is located within the active site region which is boxed. 3.2.4 Analysis of Streptoverticillium TGase Proteins Pasternack et al. (1998) showed that TGase from Stv. mobaraense is translated as the inactive Pro-TGase which is processed into the active mature protein and therefore both the Pro-TGase and the mature active TGase are detected in the growth medium. In the following study, I tested a number of Streptoverticillium species, known to possess the TGase gene for the ability to secrete and process the pro-enzyme of TGase. The growth of Stv. mobaraense, Stv. baldaccii and Stv. cinnamoneum ssp. cinnamoneum was optimised for the production of TGase (2.2.16) and culture filtrates were analysed by Western blotting (2.2.18). Culture samples were separated by SDS-PAGE (2.2.15) and probed with the polyclonal rabbit antibody raised against partially purified microbial TGase from strain S-8112 (2.2.22). The sensitivity and selectivity of the blotting procedure was optimised by titrating with a range of antibody titres. The titre of polyconal antibody which best detected the TGase protein secreted into the culture filtrates from Stv. mobaraense was utilised for further studies. Sera obtained from the pre-inoculation bleed was utilised as a negative control.
The results of the Western blotting experiments are shown in Figure 3.3. The results show: (1) The Pro-TGase and the mature form of the enzyme are present in the culture filtrates of all the Streptoverticillium species after 6 days of growth in liquid medium (Figure 3.3A); (2) Similarly, both the Pro-TGase and mature TGase were present in the washed cell pellets although there appeared to be less of the mature form (Figure 3.3B); (3) The molecular weight of the mature form of the enzyme for Stv. mobaraense, Stv. cinnamoneum ssp. cinnamoneum and Stv. baldaccii was 38, 40 and 39 kDa, respectively, whereas for Pro-TGase, the respective molecular weights were 42, 45 and 45 kDa, respectively (Figure 3.3A). Figure 3.3A: Western blot analysis of Streptoverticillium species and other actinomycetes isolates. Samples were electrophoresed on a 10% SDS-PAGE gel and probed with the polyclonal rabbit antibody raised against cmde microbial TGase purified from strain S-8112. Arrows indicate the cross-reacting bands detected in the pellet of M fortuitum (- - - ) and in both the culture filtrate and pellet of S. griseus
Lane 1: Day 6 culture filtrate from Stv. mobaraense Lane 2: Day 6 culture filtrate from Stv. cinnamoneum ssp. cinnarnoneum Lane 3:Day 6 culture filtrate from Stv. baldaccii Lane 4: Day 10 pellet from M fortuitum Lane 5: Partially purified MTGase from strain S-8112 Lane 6: Day 10 culture filtrate from S. griseus Lane 7:Day 10 culture filtrate from Stv. mobaraense Lane 8: Day 10 pellet from S. griseus Figure 3.3B: Western blot analysis of day 6 pellets from Streptoverticillium species. Samples were electrophoresed on a 10% SDS-PAGE gel and probed with the polyclonal rabbit antibody raised against crude microbial TGase purified fiom strain S-8112. Lanes 1: Day 6 pellet from Stv. baldaccii Lane 2: Day 6 pellet &om Stv. cinnamoneum ssp. cinnamoneum Lane 3:Day 6 pellet fiom Stv. mobaraense Lane 4: Partially purified MTGase from strain S-8112 The molec~llarweight of Pro-TGase and TGase from the three Streptoverticilliz~m species was determined by SDS-PAGE. These results agree with values obtained by other groups (Table 3.2). Pasternack et al. (1998) reported a molecular weight of 42445 Da for the Pro-TGase of Stv. mobaraense as compared to the value of 42000 Da obtained from the work described in this thesis. There is good agreement between my data and two other groups which supports a molecular weight of 38000 Da for the mature TGase. The predicted molecular weight from the sequence data (3.2.3) of the mature protein in this study was approximately the same for all three Streptoverticillium species, whereas from SDS-PAGE data, the molecular weight of the mature protein produced by Stv. cinnnrnoneum ssp. cinnamoneum and Stv. baldaccii was higher than the mature protein produced by Stv. mobaraense. This suggests that even though there is high homology between the gene encoding for the TGases, there is divergence during the processing of the inactive Pro-TGase to the active mature form.
Genus Pro-TGase (Da) TGase (Da) Stv. mobaraense 42000 (SDS-PAGE) 38000 (SDS-PAGE) 42445""(Pasternack et al., 1998) 37859* (This study) 37900 (Kanaji et al., 1993) 38000 (Motolu et al., 1990) Stv. cinnumoneum 45000 (SDS-PAGE) 40000 (SDS-PAGE) ssp. cinnamoneum 5 1170" (Duran et al., 1998) 37790* (This study) 37641* (Duran et al., 1998) 41000 (Motolu et ul., 1990) Stv. baldaccii 45000 (SDS-PAGE) 39000 (SDS-PAGE) 37603* (This study)
Table 3.2: Molecular Weight of Pro-TGase and TGase from Streptoverticillium species. * : predicted molecular weight 3.2.5 Screening of Isolates for TGase By Western Blot Having shown that the polyclonal antibody could s~~ccessfullyidentify both the Pro- TGase and the mature form, I set about using this technique to analyse a wide array of actinomycetes (Table 3.3) for intracellular and extracellular production of TGase. Figure 3.4 shows the suprageneric relationship of the groups of actinomycetes (Goodfellow, 1989) analysed by Western blot. Various actinomycetes from both starter cultures and spores were grown in liquid culture (2.2.16). Cells and culture medium samples were removed after 4, 6, 8, 10 and 12 days of growth. Extracts were analysed for TGase proteins by the Western blot method described in the last section.
Genus Family Group Streptoverticillium Streptomycetaceae Streptomycetes Streptomyces Streptomycetaceae Streptomycetes Actinomadura Thermomonosporaceae Thermomonosporas Nocardiopsis Thermomonosporaceae Thermomonosporas Nocardia Nocardiaceae Nocardioforms Pseudonocardia Pseudonocardiaceae Nocardioforms Mycobacteri~~m Mycobacteriaceae Nocardioforms
Table 3.3: Actinomycete genera screened for TGase by Western blot. Figure 3.4: Suprageneric rdationshig of ac~nonaycetes based on padial sequencing of IdS ribosomal ribonucleic acids (Goodfellow, $9891, This phylogenetic tree shows the relationship between the different groups of actinomycetes, the Bacillus-Lactobacillus-Streptococcus line and the Gram-negative bacteria line. Actinomycetes groups investigated in this thesis are in red type. No TGase activity (2.2.17.1) was detected in the extracellular medium from cultures grown from both starter cultures and spores. Stv. mobarc~erzsecultures served as positive controls. Western blot analyses of culture filtrates grown from starter cultures did not detect any cross-reacting extracellular proteins, however a cross-reacting protein band was detected in the pellet of M. fortuitum. (Figure 3.3A) This band was detected in the cell pellets recovered after 8, 10 and 12 days of growth. Maximum cross- reactivity occurred after 10 days incubation. The molecular weight of the cross- reacting, presumably intracellular protein was 42 kDa (SDS-PAGE estimate) which is close to the value for intracellular Pro-TGase of Streptoverticillium species (Table 3.2). Taken together, these observations suggest that the organism scoring positive by immunoblotting may have TGase activity. Other researchers (Pasternack et al., 1998; Taguchi et nl., 2000) suggest that TGase is required for apical cell wall extension during mycelial growth of Stv. mobnraense. There appears to be a correlation between TGase activity and the branching of mycelial mats. In this regard it is notable that M. fortuitum, for example, can produce filamentous colonial forms and branching filaments under some conditions (Koneman et al., 1992). The dimorphic models proposed for apical extension in dimorphic and filamentous fungi are probably instructive for analysing this hypothesis. Failure to detect TGase activity in culture filtrates of the positive testing organism is consistent with an intracellular localisation and functionality. It could also be the result of inappropriate assay conditions. This seems unlikely in view of the historical data on the universality of enzyme assays developed for TGase covering a wide range of organisms (Grossowicz et al., 1950).
Analysis of isolate Streptomyces griseus grown from spores showed a cross-reacting band of similar size in both the culture filtrate and cell pellet (Figure 3.3A). The molecular weight was 60 kDa (SDS-PAGE estimate) which is considerably bigger than both Pro-TGase and TGase molecular weights from Streptoverticillium species (Table 3.2). Interestingly the appearance of the 60 kDa protein from S. griseus and Streptoverticillium TGase was associated with spore differentiation. In liquid culture high expression levels are associated with slow (stationary) growth rates. Streptomyces albus culture filtrate did not cross-react with the antibody as found for S. griseus. However there was a weak reactive band in the pellet extract corresponding to a molecular weight of 60 kDa, the same as detected for S. griseus. Faint cross-reacting bands were also detected in other spore-forming actinomycetes - Nocardia farcinica, Pset~donocnrdin nutotrophicn and Actinonlad~~rnpelletieri (data not shown). Endosporation in procaryotes is a complex developmental process with over 50 identified genes involved (Brill and Wiegel, 1997). It would not be surprising if a family of proteins closely related to TGase is involved. The detection of cross-reacting bands in a number of actinomycete isolates is interesting because a role for TGase in such a wide cross-section of microorganism has not been reported previously. Makarova et al. (1999) found mammalian TGase homologs in Mycobacteria, Cyanobacteria, Bacillus subtilis, Haemophilus influenzae, Bordetella pertussis, Pseudomonas aeruginosa and Deinococcus radiodurans. Multiple homologs were detected in Mycobacteria suggesting a possible role for these proteins in the development of unusual surface structures found in these bacteria.
There are several hundred Streptornyces species and extracellular TGase has been purified to date from only four species: S. lavendulae, Streptomyces sp. No. 83 (Andou et al., 1993), S. lydicus (Bech et al., 1996; Faergemand et al., 1997) and S. platensis (Bech et al., 1996). S. lydicus, S. platensis. S. griseus and S. albus all belong to cluster group A whereas S. lavendulae belongs to the same cluster group as known TGase producing Streptoverticllium species (Williams et al., 1983). Bech et al.. (1996) analysed S. lydicus TGase for immunological cross-reactivity with Stv. mobnraense TGase. Using an Ouchterlony immunodiffusion assay with a polyclonal antibody raised against Stv. mobaraense TGase, no cross-reactivity was detected between the TGases from S. lydicus and Stv. mobaraense. Hence it is likely that TGases from other Streptomyces species belonging to the same cluster group as S. lydicus would not cross- react with Stv. mobaraense TGase as shown by the failure to detect TGase in S. griseus and S. albus by Western blotting. Furthermore, conditions established for the production of TGase from Streptoverticilliz~m species, for example, incubation temperatures, test media and source and size of inoculum may not have been optimal for other actinomycetes, as well as appropriate assay regimes as mentioned above. As a word of caution, these isolates were obtained from Queensland Health Diagnostic Reference Laboratory for Mycobacteriae Diseases (DRLMD) and not from a culture collection and authenticity of identity has not been guaranteed, although this seems an unlikely scenario. The most pronounced cross-reacting protein bands were recorded from M. fortuitum and. S. grisetls. I will now discuss follow up experiments designed to probe the genomes of these bacteria for the presence of a closely related TGase gene by PCR and Southern blotting.
3.2.6 Analysis of the Gene Encoding TGase Southern blot analysis was chosen to examine the genomes of several Streptoverticillium species and the actinomycetes isolates for closely related sequences. At the commencement of this study MTGase had been cloned from only two bacteria. The sequences are completely different except for the catalytic cysteine residue in the active site region. Mammalian TGases on the other hand have been extensively studied. Sequence comparisons of mammalian TGases showed that there is high homology in the active site region as well as in the calcium binding region (Kanaji et al., 1993). Mammalian TGases and papain-like proteases have been classified within the same superfamily in the Structural Classification of Proteins (SCOP) database (Hubbard et al., 1999). Comparison of amino acid sequences revealed that residues around the Cys residue in the active site region of mammalian TGase are very similar to the proteases papain and cathepsin (Kanaji et al., 1993). Southern blot analyses should clarify the number of copies of the TGase gene in the genome of these Streptoverticillium species and whether there are related genes in closely related bacteria.
Genomic DNA was digested into smaller fragments by single restriction enzyme digests with NcoI, Sau3a, SmaI and Hinf I (2.2.7.1), separated by agarose electrophoresis (2.2.7.4) and the target DNA fragments transferred to a membrane (2.2.14.1) for hybridisation and detection (2.2.14.3). Southern blotting analysis was performed on Stv. mobaraense, Stv. baldnccii and Stv. cinnamoneum ssp. cinnamoneum genomic DNA using a 997 bp fragment encoding the mature active region of TGase from Stv. mobaraense (2.2.14.2) as the probe. This fragment was obtained from the plasmid pmmt.612b (2.1.3.4) after digestion with EcoRI.
After optimising the hybridisation temperature and performing high stringency washes (2.2.14.3), sequences with high homology to the probe sequence were detected as outlined in the following description. Southern blot analysis of DNA isolated from Stv. mobaraense and Stv. balclnccii detected only one band homologous to the MTGase probe sequence (Figure 3.5A and B). These results indicate that the TGase gene exists as a single copy in the genomes of these Streptoverticillium species. In some lanes the single cross hybridising band was of similar size to the probe sequence, thus indicating the presence of only a single TGase gene in the genome. For Stv. cinnamoneum ssp. cinnamoneum (Figure 3.5C), the two bands in Lane 4 obtained by Hinf I-digest can be explained by the presence of a Hinf I site within the TGase sequence, which together with a single band observed in Lane 2 suggests the presence of a single copy of the gene. Results obtained by Washizu et al. (1994) and Duran et al. (1998) also confirm that there is only one copy of the TGase gene within Sm. mobaraense and Stv. cinnamoneum genomes, respectively.
Stringency of hybridisation and washes is manipulated by varying the salt concentration and temperature. If the hybridisation and washing stringencies are reduced by decreasing the hybridisation temperature to 37 OC and salt concentration in the wash steps to 0.1 X SSC, 0.1 % (w/v) SDS, sequences with low homology to TGase can also detected. M. fortuitum and S. griseus genomic DNA were digested with NcoI, Sau3a, SmaI and Hinf I and probed with the same 997 bp fragment. No bands were detected under standard conditions. But when the hybridisation and washing stringencies were decreased as mentioned above, faint cross-reacting bands were detected, (Figures 3.5D and 3.5E) indicating that both genomes contained sequences with low homology to the TGase gene from Stv. mobaraense. These results suggest the presence of a gene related to the TGase gene in Streptoverticillium. Detection of genes with low homology to TGase in closely related bacteria in which TGase-like proteins have been detected, suggest there is a superfamily of proteins involved in morphological differentiation. This will be followed up in the discussion.
E: M. fortuitum
Figure 3.5D and E: Detection of the TGase gene in S. griseus and M. fortuitum genomes by Southern blotting. S. griseus and M. fortuitum genomic DNA was cut with the same multiple restriction enzyme digestion regime and probed with a 997 bp fragment encoding the mature active region of TGase from Stv. mobaraense. M: DIG-labelled DNA Molecular Weight Marker I11 (Roche); Lane 1: NcoI-digested DNA; Lane 2: Sau3a-digested DNA; Lane 3: SmaI-digested DNA and Lane 4: Hinf I- digested DNA. 3.2.7 Detection of a Related TGase Gene by PCR Analysis I sh'owed earlier how the PCR strategy was successful in cloning the entire coding sequence of the mature fom of TGase from a number of Streptoverticillium species (3.2.3.1). Comparison of these sequences showed high homology in the active site region and that the active site region is probably the most conserved region of the bacterial enzyme. Using this strategy, oligonucleotide PTGase 4 which spans the active site encoding region of the TGase gene from Stv. mobaraense, and another oligonucleotide PTGase 5 (Figure 3.1; Table 3.4) were used to screen closely related and cold-adapted microorganisms for the presence of a related TGase gene. When these 2 primers were used in a PCR reaction with Stv. mobaraense genomic DNA, they amplified a 400 bp fragment. Genomic DNA from closely related and cold-adapted bacteria was screened using the same 2 primers in a PCR reaction. PCR fragments of approximately 400 bp were cloned and sequenced.
So far I have shown that (i) the most highly conserved region of the bacterial TGase is the active site and (ii) oligonucleotides based on the active site region may be used to screen other bacteria for this region of the TGase gene. Using this strategy I will see if I can amplify a TGase gene fragment from S. griseus and M. fortuitum.
Primer Primer nucleotides (5'-3') Nucleotide position 11 PTGase 4 1 TACGGCTGCGTCGGTGTCAC ( 430-449 II PTGase 5 GACGGGTCGTGATTGCCTCC 819-838
Table 3.4: Primers used to amplify the active site region encoded by the gene for TGase. Refer to Figure 3.1 for location of the nucleotide positions on the published sequence of strain S-8 112 (Washizu et al., 1994).
3.2.7.1 Isolation of a related TGase gene from S. griselas and M. fortuitum As shown in section 3.2.5 Western blot analysis of closely related actinomycetes detected cross-reacting TGase-like proteins to Streptoverticillium S-8112 in the pellet of M. fortuitum and in both the culture filtrate and pellet of S. griseus. Southern blot analysis examined the genomes of these two isolates for the presence of a related TGase gene. By decreasing hybridisation and washing stringency, faint cross-reacting bands were detected (Figures 3.5D and 3.5E) indicating that both genomes contained sequences with low homology to the TGase gene from Stv. mobaraense. These results indicate the possible presence of a related TGase gene. By utilising the PCR strategy which amplifies a 400 bp fragment containing the active site encoding region of the TGase gene from Stv. mobaraense, genomic DNA from S. griseus and M. fortuitzirn was screened for the presence of a related TGase gene. PCR products of approximately 400 bp were cloned and sequenced.
The nucleotide sequences of these 400 bp fragments obtained from both S. griseus and M. fortuitum were compared to the 400 bp section of the sequence flanked by oligonucleotides PTGase 4 and PTGase 5 from the TGase gene of Stv. mobaraense. Approximately 50 % of the nucleotide residues were identical (Figure 3.6A and 3.6B) although there was no extensive homology at the amino acid level after translation of the nucleotide sequences. However the deduced amino acid sequence of the fragments from both S. grisezis and M. fortuitum did contain an open reading frame that extended the length of the fragment.
The PCR reaction uses two oligonucleotide primers that hybridise to opposite strands and flank the target DNA sequence to be amplified. Oligonucleotide PTGase 4 sequence was designed to be complementary to the nucleotide sequence of the active site encoding region of the TGase gene of Sh. mobaraense and therefore the most likely conserved region of bacterial TGase proteins whereas PTGase 5 was designed to bind 400 bases downstream of this region. Analysis of the 400 bp fragment amplified from M. fortuitum revealed the presence of the PTGase 4 oligonucleotide at both ends indicating that the PTGase 5 oligonucleotide was not able to bind to the target sequence. However both the S. griseus and M. fortuitum amplified sequences contained the PTGase 4 oligonucleotide sequence indicating that they both contain a region of DNA that is complementary to the encoded active site sequence. This result suggests they may contain a gene that encodes a protein with an active site region homologous to TGase from Sh. mobaraense. This region of DNA has little sequence similarity with either the highly conserved active site region of mammalian TGases or the B. subtilis active site. However this region may be highly conserved between S~reptoverticillium species and other closely related species.
S1v. mob 38 A
Sgv. mob 69
Shr. mob 228
Stw. mob 368 A 389 S. gris 398 G 419
Pigmr~3.6A: Comparison of the nneleotide sequence of S&* mobaraense (Stv* moQ and S. gri'seus (S. griis). By using a PCR strategy which spanned the active site encoding region of the TGase gene &om Sh? mobarae~se,PCR amplified DNA fragments were cloned and sequenced. The oligonucleotides used in the PCR reaction are indicated by red arrows with the active site encoding region of the TGase gene from Sh. mobaraense complementary to the oligonucleotide PTGase 4. Slv. mob 1 MI. fort 1
Stv. mob 38 M. fort 37
SLv. mob 75 M. fort 72
Stv. mob 113 Fn. fort 402
Stv. mob 151 M. fort 132 -----
Stv, mob 189 M. fort 160
Stv. mob 227 M. fort 497
Stv. mob 265 M, fort 231
Stv, mob 301 TACTCGGCGCT 338 M. fort 267 292
Stv. mob 339 GCGGAACACGCCGTCCTTTAAGGAGCGGAAC GCA 376
Stv. mob 377 ATCACGACCCGTC 389
Figure 3.6B: Comparison of the nacleotide sequence of Shs nzobaraense (ShT. mob) and M fortuit~mQW. fort). By using a PCR strategy which spanned the active site encoding region of the TGase gene from Stv. moburuense, PCR amplified DNA fragments were cloned and sequenced. The oligonucleotides used in the PCR reaction are indicated by red arrows with the active site region of the TGase gene from Stv. moburuense complementary to the oligonucleotide PTGase 4. Analysis of the 400 bp fragment amplif'ied from M fortuitum revealed the presence of the PTGase 4 oligonucleotide at both ends. The second binding site of PTGase 4 is underlined. 3.2.7.2 Screening of cold-adapted microorganisms by PCR A range of psychrophilic and psychrotrophic bacteria (Table 3.5) have also been screened by PCR for the presence of a related TGase gene. Genomic DNA was extracted from cold-adapted bacteria and used in a PCR reaction with oligonucleotides PTGase 4 and PTGase 5, discussed in section 3.2.7.1. Using conditions that were optimised for amplification of the Stv. mobaraense 400 bp product, cold-adapted bacterial PCR products of approximately 400 bp were cloned and sequenced.
Sequences of the 400 bp PCR products from the cold-adapted bacteria were compared to the 400 bp sequence containing the active site region from Stv. mobaraense. However none of the bands exhibited any homology to previously identified TGase sequences, indicating that a closely related TGase gene was not present in these species. At the time of designing the PCR primers, the only TGase gene which had been isolated and sequenced was from Stv. mobaraense. To date, TGase has only been purified, characterised and cloned from sporulating, Gram positive bacteria, Streptoverticillium sp. and B. subtilis. The DNA sequence of these two bacterial TGases share little similarity with each other except for a highly conserved Cys residue in the active site region. Therefore, using this PCR strategy, the active site region of Bacillus sp. would not have been amplified. The difference in the active site region suggests that bacterial TGase is heterogeneous and screening by PCR is only possible for closely related species. Figure 3.7 shows the phylogenetic relationship between the cold-adapted bacteria, Streptoverticillium species and B. subtilis.
Cold-Adapted Bacteria Description Flectobncillus glomerntus ACAM 17 1 Gram negative F. xnnth~~rnACAM 8 1 Chlorobiaceae branch Flavobncteriut~zgondwanense ACAM 44 Gram negative F. snlegetzs ACAM 48 Bacteriodeslcytophaga branch Hnlomotzas rnericlintza ACAM 246 Gram negative H. s~~bglnciescolnACAM 12 Proteobacteria branch Cnrnobncteriurn futzditurn ACAM 312 Gram positive C. alterfunditurn ACAM 3 13 Clostridium-Bacillus branch
Table 3.5: Cold-adapted bacteria screened by PCR
76 Green sulfur baderia - F;lectuhacill~ssp ~~\~~~v-~~~~-r~~~~"~~~~>
- Carnobacteraicm sp.
Figure 3.7 Phylogenetic tree of bacteria derived from 16s ribosomal mA sequences. This figure shows the relationship between the cold-adapted bacteria screened by PCR for a related TGase gene and known TGase-producing bacteria (St~epfoverticiZZimsp. and Bacillus sp.). Adapted from Madigan ef al. (2000). 3.3 Discussion The Streptomycetaceae. The genera Streptoverticillium and Streptor7iyces belong to the family Streptomycetaceae and numerous studies have been performed to analyse their similarity, relatedness and classification at the genus level. Ochi and Hiranuma (1994) anal'ysed ribosomal AT-L30 proteins from strains belonging to genera Streptonzyces and Streptoverticillit~m.Analysis of the amino acid sequences of AT-L30 proteins revealed high levels of homology among Stv. baldaccii, Stv. cirznamoneum ssp. cinnamoneum and Sh). griseocnrneum and that these organisms are relatively closely related to S. lnvendulae (Figure 3.8). Interestingly, they also found that S. lnvendulae and S. griseus exhibited 100 % homology in their amino acid sequences. In addition the phenetic study of Streptomyces and related genera by Williams et al. (1983) found that S. lavendulne shared a relatively high overall similarity to Streptoverticillium strains in Cluster Group F rather than Cluster Group A in which the majority of Streptomyces type cultures were grouped. These studies'were also performed on Stv. mobarnense and Stv. baldnccii and have shown that Stv. mobaraense (Cluster F58) is closely related to Stv. griseocarneunz and Stv. ciiznamonetlm (Cluster F55), and that Stv. baldaccii (Single Member Cluster) had a high affinity to Stv. mobaraense. However differences in their characteristics have placed these species in different groups within Cluster Group F.
Cloning the TGase Gene. My study has described the cloning of the mature active region encoded by the gene for TGase of Stv. mobaraense which showed 100% identity to TGase from strain S-8112 cDNA. Using primers designed to clone genomic sequences encoding the mature active form of TGase from Stv. mobaraense, the 997 bp gene for TGase from three Streptoverticillium species and S. lnvendulae was cloned. Comparison of the deduced amino acid sequences showed high homology between Stv. mobarnense, Stv. griseocnmeum, Stv. cinnamoneum ssp. cinnamoneum, Stv. balclaccii and S. lavendulae. Further comparison by Southern blot hybridisation on genomic DNA from Streptoverticillium species revealed these strains are related by genomic organisation since only one copy of the TGase gene was detected.
Western blot analysis revealed differences in the protein domains of these different Streptoverticillium species. Both Stv. bnldaccii and Stv. cinnamoneum ssp. cirzrzarrzoneum produced transglutaminases albeit with different structures in the pro- region compared to Pro-TGase produced by Stv. mobaraense. Duran et al. (1998) have cloned the TGase gene from Stv. cinnamorzezlm CBS 683.68. The entire coding region contained an open reading frame of 1239 bp with a deduced amino acid sequence of 41 1 residues corresponding to a signal peptide of 81 amino acids and a mature TGase of 330 amino acids. In comparison, Pasternack et al. (1998) cloned the entire coding region of Stv. mobaraense which contained an open reading frame of 1128 bp with a deduced amino acid sequence of 376 residues corresponding to a signal peptide of 45 amino acids and the active mature region of 331 amino acids. Amino acid sequence comparison of the two strains shared high identity within the mature protein domain but there was only approximately 50% homology within the putative peptide signal domain. Therefore, the difference in the molecular weight of Pro-TGase from Stv. baldaccii and Stv. cinnamoneum ssp. cinnamoneum compared to Stv, mobaraense could be due to an extended precursor sequence for Stv. baldaccii and Stv. cinnamoneurn ssp. cinnamoneum. This is also supported by additional work I carried out. A PCR strategy was designed to amplify the full length coding sequence which encodes the precursor form of TGase for Stv. mobaraense. Using primers PTG 1A and PTG 2B (Figure 3.1) in a PCR reaction with Stv. mobaraense genomic DNA amplified a 1.2 kb product. However, this strategy failed to amplify a band for Stv. balhccii DNA, which probably reflects a divergence within the Pro-TGase domain between these two species.
TGase - Ubiquitous Distribution? My work shows that Stv. cinnamoneum ssp. cinnamoneum and Stv. baldaccii have a higher molecular weight TGase protein than Stv. mobamense. This suggests that Stv. cinnamonezlm ssp. cinnamoneum and Sb. baldaccii have a cleavage site closer to the N- terminus, which would result in the production of a larger TGase protein. Recently, Pasternack et al. (1998) have found that TGase from Stv. mobaraense after in vitro activation, consisted of 333 residues instead of 331 residues and that the apparent clea~agesite was closer to the N-terminus. Purified mature, active TGase from Stv. cinnamonez~mCBS 683.68 had a relative molecular weight of approximately 38 kDa (Duran et al., 1998), which is similar to the molecular weight of the mature, active TGase from Stv. mobaraense. In addition differences in the deduced amino acid sequence and molecular weight of Stv. cinnamoneum ssp. cinnamoneum and Stv. cinnamoneum CBS 683.68 derived TGases suggest these bacteria are different strains. Ando et al. (1989) screened for extracellular TGase activity in the culture fluids of abo~it5000 strains isolated from soil and found strong enzyme activity only in the actinomycete Streptoverticillicim S-8112. Since then, extracellular TGase activity has been identified, purified and characterised from other members of the Streptonzycetaceae family. My study screened for extracellular and intracellular TGase in other actinomycete isolates by Western blot analyses and detected cross-reacting TGase-like proteins to strain S-8112 in bacteria belonging to the families Streptomycetaceae, Mycobacteriaceae, Nocardiaceae, Pseudonocardiaceae and Thermomonosporaceae. These results indicate that there is a protein with low homology to the mature active TGase protein domain. Furthermore this degree of homology might be sufficient for a functional transglutaminase. Southern hybridisation results for S. griseus (Streptomycetaceae) and M. fortuitum (Mycobacteriaceae) genomic DNA also detected low levels of homology to the strain S-8112 TGase gene. Nucleotide sequences of the PCR amplified 400 bp fragments (3.2.7) obtained from S. griseus and M. fortuitum were compared to the 400 bp sequence of Stv. mobaraense TGase gene amplified by the same oligonucleotides. Approximately 50 % of the nucleotide residues were identical with both S. griseus and M. fortuitum containing a region of DNA homologous to the active site encoding region of the TGase gene from Stv. mobaraerzse. These results indicate the possible presence of a related TGase gene. To confirm this proposition a genomic clone of these fragments would need to be sequenced across the putative active site region (ie. where the PTGase 4 oligonucleotide bound during the PCR) to assess the actual homology with the Streptoverticillium active site.
The Search for TGase Gene Sequences - Database Search. To determine if other sequences in the database might show close similarity to Stv. mobaraense TGase, computer analysis using The Institute of Genomic Research (TIGR) Microbial Database was used to detect homologous protein sequences in bacterial genomes. A BLAST search (Altschul et al., 1997) was generated against unfinished microbial genomes using Streptoverticillium S-8112 mature TGase amino acid sequence as the query. Amino acid sequences with similarity in the active site region were identified. Preliminary results from the search (Table 3.6) revealed homology to the active site region of the TGase protein in several other microbial species. Homology was detected in genomes of the gram positive bacteria M. tuberculosis H37Rv, the gram negative Escherichia coli K-12 MG1655 and three archaebacteria (Pyrococc~isabyssi; Methanobacterium themzoautotrophicn AH and Aeropyrum pemix Kl).
Makarova et al. (1999) using profiles generated by the PSI-BLAST program detected proteins homologous to eucaryotic TGase in a variety of archaea and bacteria. One of these archae proteins has been functionally characterised by Pfister et al. (1998). They have shown that Methanobacterium phage vM2 possesses protease activity. Makarova et al. (1999) proposed that many of the procaryotic homologs to animal TGase are also proteases and that this new protein superfamily has evolved from ancestral proteases. Interestingly, I identified homology to the active site region of microbial TGase in the genome of the arachaebacteria Methanobacteritlm thermoautothrophica AH. This suggests that there may be a common ancestor for both procaryotic and eucaryotic TGases. However, comparison of amino acid sequence of strain S-8112 and mammalian transglutaminase shows little homology except for the highly conserved cysteine residue in the active site region. Although the enzyme has a similar function, as mentioned several times before, ca2+is not required for microbial TGase activity. This suggests that these enzymes have evolved as a separate lineage. A proposed plan of the way microbial and mammalian TGase have evolved from a common ancient protease is shown in Figure 3.9.
Screening Cold-Adapted Bacteria for TGase. Cold-adapted bacteria were screened by PCR for the presence of a related TGase gene. Streptoverticillium species, S. lavendulae, S. griseus and M. fortuitum nucleotide sequences shared high identity in the active site encoding region of the TGase gene from Stv. mobaraense, indicating that this region would be the most likely conserved region for bacterial TGase. An oligonucleotide which spans the active site encoding region of the TGase gene from Stv. mobaraense and another oligonucleotide were utilised to amplify DNA fragments from the cold-adapted bacteria. Sequencing analysis of these fragments did not detect any homology to any active site regions of Stv. mobaraense TGase gene. These results suggest that the oligonucleotides were specific only for Streptoverticillium species and closely related bacteria and therefore may not detect any sequence similarity in other bacteria. The amino acid sequence of B. subtilis TGase (Kobayashi et al., 1998b) has little homology in the TGase active site region with the strain S-8112 apart from the fact that both contain a single Cys residue. The
81 results from the PCR and comparison of B. subtilis and Streptoverticilli~lmTGases. suggest that procaryotic TGase is heterogeneous.
Summary Transglutarninase was originally characterised and cloned from sporulating, Gram positive bacteria, Streptoverticillium and Streptornyces species and B. subtilis. Activity seems related to morphological differentiation including spore function. But it seems that transglutaminase is widespread in procaryotes. As far back as 1979 it was reported by Matacic and Loewy (1979) that E-(y-glutamyl) lysine bonds are present in asporogenic, Gram negative bacteria, E. coli. Recently E. coli Cytotoxic Necrotizing Factor 1 (CNF 1) was reported to possess TGase activity, plus a catalytic cysteine residue occurs in the protein sequence (Schmidt et al., 1998). Taken together there is no doubt the TGase protein has evolved in many directions and reflects morphological differentiation and pleomorphic development.
In this chapter I have detailed: (i) The distribution of mature and Pro-TGase in various Streptoverticillium species; (ii) I have reported on the presence of potential TGase proteins in several organisms from the Streptomycetacae, Mycobacteriaceae, Nocardiaceae, Pseudonocardiaceae and Thermomonosporaceae families; (iii) I have cloned the mature active encoding region of the TGase gene from Stv. mobaraense, Stv. baldaccii, Stv. griseocameum, Stv. cinnamoneum ssp. cinnamoneum and S. lavendulne; (iv) I have mapped some of the potential relationships between Pro-TGase and mature TGase in the Streptoverticillium family.
At the outset, I had hoped to uncover a "temperature desensitised" TGase source. Intuitively the enzyme from cold-adapted organisms seems like a good point to start. But on the other hand mesophilic organisms could possess TGase with a broad and acceptable temperature-activity profile. The Ajinomoto company markets TGase from Stv. mobaraense with reasonable success. I discovered that the closely related strain Stv. baldaccii has been reported to grow at quite low temperatures (Locci, 1989). I have turned to this organism because preliminary studies in the laboratory confirm that Stv. bnldaccii would grow at low temperatures. The active protein is present in the culture filtrate. The next chapter describes the influence of temperature on Stv. bnldnccii growth. rate,' activity and also the enzyme and its processing of TGase. The TGase gene from Stv. baldaccii has been cloned and sequenced and is thus available for recombinant studies. S&. g~iseocar~ehcm I Slv. bddnccii Slv, ehnamoneum ssp.
80 90 100 Sequence Relatedness (%)
Figure 3.8: Phylogenetic dendrograrn showing clustering of Slrep8ovedk"ciEEi~lmand Sfrepfomyces species based on the analysis of ribosomal protein AT-L3O. The dendrogram was adapted froin Ochi and Hiranma (1994). Sh? gr"iseocarizem, SIV. bcrldcdccii and Sfv. cinnamoneum ssp. cinrzamoneuwa amino acid sequences were 100 % homologous. These organisms were most closely related to S. afoliatus and were relatively closely related to S. lavendulse but distantly related to S. violaceus, S. coelicolo~and S. antibiotiicus. Table 3.6: Rwults from a BLAST search agalinst S1Peptoverh"ciEEd~dyn$8112 matanre T&se amino acid sequence. Coinparison of the active site region from Stp'eptoverticilliuwz S-8112 and B. subgilis TTGase amino acid sequences and alignment of potential active site regions from the complete genomes of M. tuberczkfosis N3?Rv7 Escherichia cola' K-12 MG1655 and three archaebacteria. The active site region for strain S-8112 and B. subtilis is underlined and the Cys residue known to be responsible for catalytic activity in these active site regions is in red. The number at the end sf the sequence represents the position of the amino acid in the respective sequence. *Kanaji et al. (1993); @Kobayashiet al., (1998b); ' '~relirninarysequence data was obtained from The Institute for Genornic Research website at "http://www. tigr.org". Proteases + Microbial TGase + Arehae Mammalian TGase Homologs Kornologs
'4' Microbial Team # Homoloas Mammalian TGase Homologs Bacteria
Mammalian TFase mm-4b
Figure 3.9: Proposed lineage for evolution of microbial and mammalian TGases from a common ancient protease. Mammalian and Streptoverticillium TGase and the archae Mefhanobacterium Phage q~M2possess protease activity as indicated by the red arrow. Mcrobial and mammalian TGase homologs are identifed by . Proteins homologous to eucaryotic TGase were detected in a variety of archaea and bacteria (Makarova et al. 1999). Homology to the active site region of the Streptoverficils'izdm TGase protein was detected in other microbial species and archaebacteria (Table3.6). Chapter 4
Effect of Temperature on Growth Rates, TGase Specific Activity and Precursor Processing of Stv. baldaccii and Stv. mobaraense TGase 4.1 Introduction At the outset, I thought it likely that psychrophiles might yield cold-tolerant TGase in the same way that thermophiles are a source of temperature-tolerant enzymes. Thermophilic enzymes are typically compact, rigid structures that resist thermal denaturation yet still present the appropriate flexibility and active site at the preferred temperature range of the originating thermophile (Jaenicke and Bohm, 1998). Judging from these observations it was expected, and this has been supported by a number of researchers (Feller and Gerday, 1997; Scandurra et al., 2000) that psychrophilic enzymes should be less compact, less rigid, with weaker or fewer stabilising interactions internally and with the environment. Presumably enzymes from psychrophiles are more likely to denature at higher temperatures than comparable enzymes from mesophiles or thermophiles. Feller et al. (1994) examined the temperature dependence of cell growth, exoenzyme formation and enzyme activity of five psychrophilic Antarctic bacteria. They found that production of lipase from Moraxella (strains TA144 and TA137), a-amylase from Alteromonas haloplanctis, P- lactamase from Psychrobacter immobilis and protease from Bacillus TA39 were inhibited as temperatures increased; maximal production of the enzymes occurred at temperatures close to their environment. All these enzymes displayed optimal activity at lower temperatures than their mesophilic counterparts.
To date TGase has only been detected in Streptoverticillium, Streptomyces and Bacillus species which are all Gram positive, spore formers. As reported in Chapter 3, there was no TGase activity in the psychrophilic organisms supplied by the ACAM. It would have been desirable to have also screened the ACAM actinomycetes collection but unfortunately this was not possible as the AMRAD organisation holds the sole rights to these cultures. Consequently I decided to pursue a comparative investigation of SW. mobaraense and Sm. balclnccii. The Stv. mobaraense TGase enzyme is well characterised. The Sm. baldaccii cells appear to prefer lower growth temperatures.
In this study TGase was recovered from batch cultures incubated at different temperatures. The distribution of mature and precursor TGase and the temperature dependence of the mature enzyme was compared. The effects of growth temperature on the maturation/activation of the enzyme were also investigated. 4.2 Results 4.2.1 Cultures Conditions Stv. bnldnccii and SIV. mobaraense were grown aerobically in liquid medium after inoculation with spores at 12 OC, 16 OC, 20 OC and 28 OC (cultures are referred to as T12, T16, T20, T28). Cultures were sampled at Day 4, 6, 8, 10, 12 and 15. Cells were recovered by centrifuging. The cell free medium was analysed for enzyme activity and by Western blot. Cell protein was estimated on pellets recovered by centrifuging. Protein was used as an indicative measure of total cell mass as the cultures consisted of a mixture of single cells and mycelia.
4.2.2 Culture Growth and TGase Activity Figure 4.1 shows the growth curves of Stv. baldnccii at temperatures between 12 and 28 OC. Figure 4.2 shows the growth curves for Stv. mobaraense. Growth of Stv. bnldnccii increased over the 15 day inoculation at temperatures between 12 to 20 OC. The cultures were dimorphic - there were single cells and cells with hyphae and more intense mat of mycelium present. The yield of cells based on the protein figures were much the same after 15 days over this temperature range. At 28 OC the growth seemed faster and the maximum yield was reached in half the time compared to the former cultures. After Day 8, ie. maximum yield (approximately 30 mg) was reached, the protein levels in the cell pellet dropped sharply. This suggests that the cells were limited by some key nutrient once the cell protein yield reached 30 mg. The enzyme activity in the clarified media correlated well with protein yield at all temperatures, even for cultures grown at 28 OC, when after Day 8 total cell protein and TGase activity decreased precipitously but in parallel.
This was the case for Stv. baldaccii cultures but not so for Stv. mobnraense. For Stv. mobaraense activity peaked at all growth temperatures and these maxima were out of phase with the timing of' maximum yield. The TGase activity peaked around Day 8 for all cultures irrespective of the cell protein level. The maximum cell protein figures were similar for temperatures between 12 to 20 OC. At 28 OC the total cell protein was only half that at the lower temperatures. This was surprising because these organisms are classified as mesophiles, which implies that optimal growth is in the mid 30's. Overall however the data shows that TGase activity increases in line with cell protein accumulation and declines in general as cell protein levels decline. 89 Broadly speaking, total TGase activity for Stv. baldaccii was comparable between 12 to. 28 k. For Stv. mobaraense, the best yield was obtained at 16 OC. The apparent specific activity of the Stv. mobaraense enzyme was highest at 16 OC (ie. total activityltotal supernatant protein). The highest apparent specific activity of the Stv. baldaccii enzyme occurred at 12 OC (Figure 4.3).
4.2.3 The Effect of Culture Conditions on the Properties of Secreted TGase The next series of experiments were undertaken to determine whether the growth temperature had any influence on the temperature dependence of the enzyme. Filtrates from Stv. baldaccii cultures exhibiting the highest TGase activity (T12, Day 15; T16, Day 15; T20, Day 15; T28, Day 8) and Stv. mobaraense cultures exhibiting the highest TGase activity (T12, Day 8; T16, Day 8; T20, Day 8; T28, Day 8) were assayed at temperatures between 4 and 55 OC and plotted in Figures 4.4 and 4.5. Stv. baldaccii TGase activity peaked at 37 OC, irrespective of the temperature of growth (Figure 4.4). However the temperature-activity profile varied depending on the original growth temperature. Significantly the TI2 enzyme retained more of its activity at temperatures below 20 OC as compared to the T16, T20 or T28 enzyme. This could be caused by the difference in the protein composition of the cell-free medium and hence changes in protein-stabilisation, activation and so on or differences in the amount of mature active enzyme relative to the precursor TGase.
In comparison the activity of the Stv. mobaraense enzyme (T12 to T28) increased over the entire temperature range from 4 to 55 OC (Figure 4.5). Separate experiment with T28 enzyme indicated the activity peaked at approximately 65 OC (compared to 55 OC reported by Motoki et al., 1990). This is in marked contrast to the Stv. baldaccii enzyme and suggests that the Sfv. baldaccii enzyme is considerably more psychrotolerant than its mesophilic relative based on its thermal stability and its activity profile. 4 6 8 10 12 15 4 6 8 ID 12 15 Days Days
(C) 20 C (D) 28 ' C
Days Days
--@- TGase Activity (Ulml) Cell Protein (mg)
Figure 4.1: Grovvkh. and TGase Secretion by Siv. bbaldacciii izn Liquid Culture at 112 to 28 "@. TGase in clarified cell medium was assayed, Inoculations and growth conditions - flask volume, geometry and agitation rates were standardised. Cells were recovered by centrifuging and total protein was estimated on the cell pellets. Cultures grew as extended mycelia, so cell protein has been used as a cell growth indicator. (B) d6 OC 3 30
2.5 25
2 20 - E 1.5 15 3 3 1 10
0.5 5
0 0 Days 4 6 8 10 12 15 Days
(C)20 OC (D) 28 OC
4 6 8 10 12 15 4 6 8 10 12 15 Days Days
~~aseActivity (Ulrnl) Cell Proleiri.(mg)
Figure 4.2: Growth and TGase Secretion by S&* mabaraense in Liquid GuIhare at 12 to 28 '6. TGase in clarified cell medium was assayed. Inoculations and growth conditions - flask volume, geometry and agitation rates were standmdised. Cells were recovered by centrifuging and total protein was estimated on the cell pellets. Cultures grew as extended mycelia, so cell protein has been used as a cell growth indicator. (A) S&. bbaldwcii
Temperature ('GI
Temperature (OC)
Figure 4.3: The apparent specific activity of TGase from $tv. bakdaccii and S&., mobavaense cultures grown at different temperatures. Specific activity (Ulrng) was calculated from the maximum TGase activity (U/rnl) (Fibwe 4.1 and Figure 4.2 data) and the corresponding cell free protein concentration. 4 10 16 22 28 37 55 Temperature (O6)
Figure 4.4: Temperature dependence of TGase aetiviGy in cell-free supernatant of Sn(. baldace6 cultures grown at 12, 16, 20 and 28 "6 (T12, TM, T20 and T28 cultures), Relative activities are plotted against highest activity values.
4 10 16 22 28 37 55 Temperature (OC)
Figure 4.5: Temperzture dependence of TGase activiv in cell-free supernatant of St%. mobnaaeme culhres grown at 12, 16,2(6 and 28 "C (IFl2, '$16, T28 and T28 cultures). Relative activities are plotted against highest activity values. The Stv. baldaccii T12 TGase was partially purified by ainmonium sulphate precipitation (2.2.21) in order to confirm the cold-tolerance activity found in the culture filtrate and to compare the activity with the Sdv. mobarcreme enzyme. Figure 4.6 compares relative TGase activity for the partially purified and concentrated TGase and endogenous TGase in Stv. baldaccki culture filtrates (T12). The highest activity for botb the endogenous and the partially purified enzyme was obtained at 37 OC. About 20 % of the endogenous activity is retained at 10 "C. Even at 4 OC, 5 % of the activity remained. On the other hand, the purified enzyme exhibited a quite different activity profile. The enzyme had two maxima, one at 37 OC and another at 16 OC. Activity was almost comparable at both temperatures. Si,pificantly the activity at 4 OCwas still 30 % of the maximurn activity. Both enzymes were inactivated at temperatures over 37 '6. The difference between the endogenous and the partially purified enzyme could be due to the removal of inhibitor substaulce(s) or some salt effect due to the fractionation procedure however this has not been pursued in any more detail.
16 22 28 37 55
Temperature (OC)
Figuqe 4.6: Temperature dependelnee of palqially purified sad endogenous TFGase from Stu, bnkdaeek'ii TI2 cultures. Enzyme activity is expressed as a % of the maximum activity. Baldl2: endogenous TGasefrom Stv. baldaccii grown at 12 "C; BaldlZ*: partially purified TGase from Sfv. baldaccii groivn at 12 OC. In Table 4.1, the apparent specific activities (s.a.) (4.2.2) of the cell-free TGase activity are compared. The activities of purified enzyme, albeit from T28 cultures, are also included for comparison. These data are discussed in more detail in Chapter 5 (Table 5.2). The apparent s.a. of the Stv. baldaccii enzyme at 12 OC is 0.23 Ulmg, which is about half the Stv. mobaraense enzyme, whereas at 28 OC, they are much the same, 0.14 and 0.2 Ulmg, respectively. Using the s.a. figures, the calculated amounts of TGase in the active form at 12 OC are 0.14 mg of Stv. baldaccii and 0.1 mg for the Stv. mobaraense TGase. Therefore the amount of enzyme produced by both strains at low temperatures is much the same. At 28 OC, however the amount of active secreted enzyme is much less for Stv. mobaraense. Furthermore, the unusual twin peaks of activity for Sm. baldaccii TGase at 16 and 37 OC beg further explanation. In Chapter 5, the recombinant Stv. baldaccii TGase activity profile (Figure 5.13) shows a temperature maxima at 22 OC, which is about halfway between these two figures. The purification of the endogenous enzyme, ie. enzyme from T28 cultures, had maximum activity at 37 "C. Taken together it appears that the activity temperature maxima is very dependent on
the growth conditions - the growth temperature - for folding and structural temperature characteristics. Further work would be needed to understand the effects of these parameters more fully.
Streptoverticillium Culture Specific species Temperatue Activity Stv. baldaccii (endogenous) 12 OC 0.23 Ulmg Stv. mobarae~zse(endogenous) 12 OC 0.60 Ulmg Sfv. baldaccii (endogenous) 28 OC 0.14 Ulmg Stv. mobaraense (endogenous) 28 OC 0.20 Ulmg
L Stv. baldaccii (purified)" 28 OC 1.57 Ulmg Stv. mobaraense (purified)" 28 OC 5.50 Ulmg SW. 'baldaccii (partially purified) 12 OC 0.48 Ulmg Stv. mobaraense (purified)"" 30 OC 11.30 Ulmg
Table 4.1: Specific activities of TGase - endogenous and purified. *: results from Chapter 5 (Table 5.2); ** Gerber et al., 1994. The work of Pasternack et nl. (1998) suggests that the Pro-TGase accumulates extracellularly and is converted to the active form by protease digestion. This suggests that the variation in the activity at different growth temperatures could be due to changes in the rate of precursor processing. This is investigated in the next section using Western blotting.
4.2.4 Western Blot Analyses Streptoverticillium cultures were grown at different temperatures (12 to 28 OC) and sampled from Day 4 to Day 15. Cell-free samples were separated by SDS-PAGE and probed by Western blotting with a polyclonal antibody raised against partially purified microbial TGase from strain S-8112 as described in Chapter 3. The data is shown in Figures 4.7 and 4.8 and Table 4.2.
After 4 days incubation, one band was detected in Stv. baldnccii T12 cultures following Western blotting (Figure 4.7A). This band had a higher molecular weight than the mature enzyme and agreed with the molecular weight of the precursor enzyme, based on my results in Chapter 3. The intensity of the Pro-TGase band peaked at Day 6. At Day 10 a lower molecular weight band was detected corresponding to the molecular weight of the mature form of the enzyme. The intensity of this band increased from Day 10 while the intensity of the Pro-TGase band decreased at later times. By Day 15 the mature enzyme was the only form of the TGase present. The T16 results showed a similar pattern (Figure 4.7B). However the results for T20 enzyme were different (Figure 4.7C). Firstly both the Pro-TGase and the mature TGase bands were present on Day 4 as compared to only one band corresponding to the Pro-TGase at T12. Secondly, the Pro-TGase band disappeared earlier from the culture (at Day 8) compared to T12 and T16 cultures. At T28 there was some Pro-TGase present initially judging from the band pattern, but most had disappeared by Day 6 (Figure 4.7D).
For Stv. rnobaraense cultures at all four temperatures, bands corresponding to the molecular weight of both the Pro-TGase and the mature form of the enzyme were pres,ent from Day 4. Intensity of the Pro-TGase band disappeared over time (T12 at Day 8; T16, Day 6; T20, DaylO; T28, Day 6) leaving only the band for the mature TGase (Figure 4.8).
97 Taken together the results indicate that Stv. baldnccii cells secrete the precursor form of TGase rather than the catalytically active entity (Figure 4.7A) and that the active TGase accumulates at the expense of the precursor. The apparent decrease in the intensity of the mature enzyme band at higher temperatures could be explained by greater protease activity under these conditions. Similar results were obtained with Stv. mobaraerzse cultures (Figure 4.8). Batch cultures initially contained both forms of TGase but as for the Stv. baldnccii cultures, the mature form became dominant over time and after 15 days of batch culture there was no indication at all of the precursor, irrespective of the growth temperature. Both sets of data can be rationalised by a simple model in which the proenzyme is cleaved to produce the smaller active form of the protein (Figure 4.9). Pasternack et al. (1998) have shown that secretion of Pro-TGase by Stv. mobaraense and its hydrolysing enzyme occurs sequentially. They found that shake flask cultures of Stv. mobaraense at 30 OC secrete the pro-enzyme after 24 hours growth. The mature enzyme subsequently started to accumulate after 48 to 64 hours. This is consistent with the results presented above (Figure 4.8). It has been suggested that TGase in Streptoverticillium may be involved in cell development. Interestingly I found in another set of data, which I haven't presented, that TGase activity was only detected in Streptoverticillium growing on solid nutrient agar after the start of spore production. In this instance, TGase activity was detected with a colorimetric plate assay (2.2.17.2). This seems to support a role of TGase in the differentiation process. Day 4 6 8 10 12 15 M - A: 3'112 -Pro-TGase
-. MatureTGase
Figure 4.7: Western blot analyses of the production of TGase from Sa'v- baldaceii grown at diflerent temperatures. A sample of each culture filtrate of Siv. baldaccii grown at T12, T16, T20 and T28 was separated by SDS-PAGE and probed with a polyclonal antibody raised against partially purified microbial TGase from strain S- 81 12, Arrows indicate both forms of the enzyme detected at different stages of growth (Day 4 to Day 15). M: partially purified MTGase fiom strain S-8 112. Day 4 6 8 10 12 15 M
A: TI2 -- Pro-TGase "wr MatureTGase
Day 4 6 8 10 12 15 M
B: TI6 - -Pro-TGase -MatureTGase
Figure 4.8: Western blot analyses of the production of TGase from Sfv* mobaraense growla at diBerent temperatures. A sample of each culture filtrate of Stv. mobaraense grown at T12, T16, T20 and T28 was separated by SDS-PAGE and probed with a polyclonal antibody raised against partially purified microbial TGase from strain S-8112. Arrows indicate both forms of the enzyme detected at different stages of growth (Day 4 to Day 15). M: partially pwified MTGase fiom strain S-8 112. Temp Max Growth Max Activity Pro-TGase Pro-TGase and TGase Only Reached Reached Appearance TGase Appearance Present By: 12 OC B: Day 12-15 B: Day 15 B: Day 4-8 B: Day 10-12 B: Day 15 M: Day 10 M: Day 8 pnd M: Day 4-8 M: Day 10-15 16 "C B: Day 15 B: Day 15 B: Day 6 B: Day 8-15 pnd M: Day 10 M: Day 8 ~nd M: Day 4-6 M: Day 8-15 20 OC B: Day 15 B: Day 15 B: Day 4 B: Day 8-12 B: Day 15 M: Day 15 M: Day 8 pnd M: Day 4-10 M: Day 12-15 28 "C B: Day 8 B: Day 8 pnd B: Day 4-10 B: Day 12-15 M: Day 8 M: Day 8 pnd M: Day 4-6 M: Day 8-15
Table 4.2: Detection of Pro-TGase and TGase in Stv. baldaccii and Stv. mobaraense cultures grown at different temperatures using Western blot analysis. The days on which the highest growth, the maximum TGase activity and Pro-TGase or TGase or both were detected by Westerns are shown for Stv. buldaccii (B) and Stv. nzobaraetzse (M); pnd: protein not detected. B
Apical eel1 wall extension during *+-.-----"-----.---,------Mature active TGase g mycellial growth Cell Developmen1 D GP
Figure 4.9: Secretion of Pro-TGase and Production of TGasdj Iby Sh,* baMaccihnnd Stv. mobllraens~ Panel A: Streptoverticillium cells growing in liquid medium in a shaking flask; B: Pro-TGase and a protease are secreted by the cell into the culture medium; C: Processing of the pro-enzyme by the protease to transform the Pro-TGase into the active form of TGase; D: Mature TGase may be involved in cell development. 4.3 Discussion Stv. mobaraense and Stv. baldaccii secrete Pro-TGase into the culture medium which is subsequently processed into the active mature enzyme. Both species are capable of producing the enzymes at culture growth temperatures ranging from 12 to 28 OC although Stv. mobaraense TGase has higher activity over all the temperatures studied. Interestingly though, Stv. baldaccii exhibits low temperature characteristics which may be more beneficial for the food industry. The specific activity profile of Stv. baldaccii indicates maximum activity occurred for cultures grown at 12 OC which suggests that the enzyme activity could increase or be retained if cultures were grown below 12 OC . As maximum activity was achieved after 15 days incubation at 12 OC, study of lower temperature growth conditions were not feasible due to the length of incubation time. In contrast, the profile for TGase activity for Stv. mobaraense indicated maximum TGase activity peaked when cultures were grown at 16 OC.
Cold-tolerant psychrophilic enzymes exhibit three broad characteristics: (I) high specific activity at low temperatures (0 to 30 OC); (2) low temperature optima and (3) a low temperature threshold for denaturation and loss of activity. Stv. baldaccii TGase if not psychrophilic, appears at least to fit the classification of psychrotolerant albeit based on comparison with the close relative Stv. mobaraense. Stv. bnldaccii TGase has a lower temperature optimum (16 to 37 OC) compared to Stv. mobnraense (55 OC), higher specific activity for cultures grown at 12 OC compared to cultures grown at 28 OC and greater thermal instability. Despite the fact that the deduced amino acid sequences of the TGase gene in Stv. baldaccii and Stv. mobaraenase show 80 % homology, the remaining differences could readily account for significant structural changes at low temperatures. In an interesting article, Gerike et al. (1997) described how they sequenced and expressed the gene encoding a cold-active citrate synthase from an Antarctic bacterium, strain DS2-3R. which exhibited characteristics of a cold-adapted enzyme. This group compared the amino acid sequence of the citrate synthase from the psyc,hrophilic bacteria with its mesophilic and thermophilic counterparts. Highest identity (59 %) was found with the mesophilic gram postive bacterium Mycobacterium smegmatis. Comparison of primary structures revealed that the psychrophilic enzyme had a large extension of the surface loop region, an increase in charged residues in the surface loop and 31 neutral-charged amino acid substitutions. This extension and increase in charged residues in the surface loop may result in a more flexible enzyme at
103 low temperatures. Consequently, comparison of the mesophilic pig enzyme with the thermophilic archaeal enzyme from Thennoplasma acidophil~~mand hyperthermophilic archaeal enzyme from Pyrococcz~sfilriosus showed a decrease in the size of the loop region which has been linked to the increased stability of the thermostable and hyperthermostable citrate synthase. It would be interesting to apply similar modelling techniques for microbial TGase.
So far the results seem to indicate that a cold-tolerant enzyme, with reasonable activity, can be recovered from Stv. baldaccii. Cultures grown at 12 "C grew reasonably well compared to those incubated at 20 OC or higher. Maturation of Pro-TGase occurred at low temperatures although higher amounts of precursor enzyme seem to be present (Figure 4.7). This may present an opportunity as Pro-TGase may be a more stable and convenient form in which to manufacture commercial quantities. Unfortunately the growth rate for Stv. baldaccii was slow at low temperatures (approximately 15 days) and with complex media requirements, probably not suitable for scale-up. Recombinant TGase offers several advantages in that it requires less time for fermentation, simple media, more reproducible preparations and the enzyme can be over-expressed and recovered economically. Furthermore, the gene may be modified to produce an enzyme tailored for different uses and the work referred to above, suggests strategies that may be fruitful. In the following chapter, recombinant Stv. baldacii enzyme is produced and the enzyme is compared to the endogenous form as well as from other sources.
In view of the IP restrictions of the use of Stv. mobaraense enzyme, these results are encouraging because the Stv. baldaccii enzyme provided an alternative path to commercialisation. The existing literature does not cover opportunities arising from the application of psychrotolerant enzyme from Streptoverticilliurn sources. In this study, it appears that the Stv. baldaccii enzyme resides at the lower limit of the mesophilic temperature range, and that the enzyme as is, has interesting temperature-tolerant activity and perhaps can be manipulated to become even better adapted for low temperature work. CHAPTER 5
Purification and Characterisation of Endogenous and Recombinant Stv. baldaccii TGase 5.1 Introduction Purified microbial TGase has many applications in the food industry, therefore it would be beneficial to develop an efficient system for production of the enzyme. As microbial TGase is secreted into the culture medium, purification procedures are rather simple. A variety of methods for the purification of TGase from different Streptoverticilliz~m species have been reported. These include ion-exchange chromatography on a weak acid material and hydrophobic chromatography (Ando et al., 1989), ion-exchange chromatography with strong acid material (Gerber et al., 1994), ammonium sulfate precipitation and absorption chromatography (Tsai et nl., 1996) and ion-exchange and affinity chromatography (Duran et nl, 1998; Ho et al., 2000).
Many investigators have reported the expression of MTGase using a bacterial expression system. The MTGase gene has been cloned and expressed in S. lividans under a tyrosinase promoter (Washizu et al., 1994). The recombinant enzyme was secreted as an active mature protein although productivity was only 0.1 mg litre-'. In addition, the MTGase gene encompassing the entire coding region for the protein was chemically synthesised and expressed in E. coli using the PIN-111-ompA vector (Takehana et nl., 1994). The induced gene product had the same pr0perties.a~native TGase although the expressed level was quite low (5 mg litre-'). The chemically synthesised MTGase gene has also been produced in inclusion bodies in E. coli as a fusion protein with a bacteriophage T7 gene 10 leader peptide in an inactive form (Kawai et al., 1997). The gene product was processed in vitro and following enzymatic cleavage by Xa, the mature enzyme was released from the fusion protein. The specific activity of the mature recombinant enzyme was only 20 % of the purified enzyme due to its poor refolding rate, however, this system would still be suitable for efficient production of MTGase. To increase expression levels the synthesised gene was designed taking the frequency of codon usage of E. coli into consideration to increase translational efficiency (Yokoyama et al., 2000). This resulted in expressing inactive MTGase at high levels as inclusion bodies in E. coli and the refolded MTGase showed activity equivalent to native MTGase. Thus recombinant MTGase could be produced efficiently in E. coli.
In this study, the TGase gene from Stv. baldaccii encompassing the entire coding region for the protein was cloned and expressed in E. coli. Initial studies with Stv. mobaraense determined the best construct for expression of recombinant TGase proteins. Using protocols developed for the purification of endogenous TGase from Stv. rrzobarnense and Stv. baldaccii, recombinant Stv. baldaccii TGase was purified and characterised to determine whether the gene product had the same properties as the endogenous form. 5-2 Results 5,2.4 Expression Vector E. ccli is the most simple expression system currently used to produce foreign proteins (Gold, 1990) and has been successfully used by other investigators for the expression of MTGase. The vector pET28 was used for the expression studies described in this thesis and contains the T7 RNA polymerase gene promoter which drives expression of the inserted TGase gene. For expression of the protein, the construct must be transfonxed into a bacterial strain which contains the T7 RNA polymerase gene within its genome under control of the lac promoter. Expression of the polymerase is then induced by .the addition of IPTG, which in turn activates transcription of the TGase gene (Figure 5.1) (Studier et al., 1990).
lac T7 RNA promoter polymerase gene
+ IPTG @ TGase gene @
polymerase T7 promoter
TGase protein
Figure 5.1: Ala overview of the expression system used for produretiona of recombinant TGase, 5.2.2 Preparation of TGase Expression Constructs 5.2.2.1 Preparation of recombinant Stv. mobaraense TGase constructs The mature form of the TGase protein is required for activity, therefore constructs containing only this part of the coding region were made (Figure 5.2A). The first construct produced was pET28mmt.hisf (Figure 5.3A), which encodes the mature form of the TGase protein. This construct was made by inserting the EcoR I fragment from the PCR clone pmmt.612B (2.1.3.4) into pET28b. This construct contains a N-terminal extension of 36 amino acids on the expressed protein, including the His.Tag oligohistidine domain which could be used to purify the protein on a nickel column. Restriction digests and sequencing were performed to identify those clones which contained the TGase gene in the desired orientation with respect to the T7 promoter. Clones in the wrong orientation (pET28mmt.his+(wo)) (Figure 5.3B) were kept as negative controls for protein expression studies.
The p~~28mmt.his+construct was also modified to remove the additional sequences. The expressed protein now only contains an additional 5 amino acids at the N-terminal end. This construct was designated pET28mmt.his- (Figure 5.3C). This expressed protein is more similar to the endogenous form but will be unable to be purified by metal affinity chromatography as the &s.Tag region is removed.
5.2.2.2 Preparation of recombinant Stv. baldaccii TGase construct Guided by optimisation and purification studies on recombinant Stv. mobaraetzse TGase which will be described in the following section (5.2.3), the gene encoding Stv. baldaccii TGase was only inserted into the pET28.his- plasmid (Figure 5.2B). The pET28mmt.his- construct was digested with EcoR I and the Stv. mobaraense TGase insert was removed. The PCR fragment containing the Stv. baldaccii TGase coding sequences previously cloned into pGemT Easy (2.1.3.4), was isolated by EcoR I digestion and ligated into the pET28.his- plasmid. Restriction digests were performed to identify the clones which contained the TGase gene in the desired orientation with respect to the T7 promoter. The clones were also sequenced to confirm that the insert was from Stv. baldaccii. Clones with Stv. baldaccii TGase insert in the desired orientation (pET28mbt.hisJ (Figure 5.3D) and in the reverse orientation (pET28mbt.his- (wo)) (Figure 5.3E) were transformed into E. coli strain BL21[DE3] and cell extracts were analysed for the presence and absence, respectively, of protein expression at the predicted molecular weight.
5 ' 3' 1. Ligation sf PCR fsagrnent into Easy
2, Digest with EcoR I and Ligation into pET281b
I EcoR I Spe
3. Digest wit%, Nco H and I to scaove His,
BamFI Nco I
pET28mmt. his-
Pigure 5.2k Recombinant Sht- mobaaaense TGase eonstruets. Cloning strategy used in the manipulation of MTGase froin SW. moba~.aensefrom FCR isolation through to cloning into pGemT Easy and then subcloning into pET28b. Step 3 modifies the construct with the His.Tag to become His-. BamH Nco I
1. Digest with EcoR I to remove mbt. 6/2b
2. Ligation of PCR frapent containing Stv. baldaccii Wase coding sequence into pET2 8bHis- plasmid
BamH Nco I
Pigupre 5.2B: Recombinant St% barldaccii TGase constmct. Cloning strategy for construction of Stv. baldaccii His- construct. Step 1 removes the PCR fragment containing the Stv. mobaraense TGase coding sequence by digestion with EcoR I. In Step 2, the PCR fragment containing the Stv. baldaccii TGase coding sequence was ligated into the pET28bhise plasmid to produce the pET1nbt.h~- constmct. Nco I*
Nco I*
Nco I*
TGase gene hinoacids from pEm8b HrIis.Tag
Figure 5.3A, B,G, D and E: Schematic representation of microbial TGase constructs used lfor recombhand. protein expression. Panels A to E show the region of each construct that encodes the TGase protein (33 1 amino acids) and additional mino acids from pET28b plasmid with the His.Tag (36 amino acids) or without the His.Tag (5 amino acids) including relevant restriction enzyme sites. Panels A to C: Stv. mobarckense conshucts; Panels D and E: Stv. bckldaccii constructs. Comparison of the nucleotide sequences are show in Appendix 5. *: ATG start codon at Nco I site; -+ : TGA stop codon 112 5.2.3 Analysis of Recombinant Protein Expression Constructs were transformed into the E. coli strain BL21[DE3] which contains the T7 RNA polymerase gene within its genome (2.2.12). A series of control experiments were performed to determine the optimum conditions based on the length of induction time, OD6()() at time of induction and temperature of induction. These conditions differed for the expression of the Stv. mobaraense and Stv. baldaccii enzymes and will be discussed later. A negative control of host cells, E. coli BL21 [DE3] was used to make sure there was no aberrant protein expression. Control cultures containing the plasmids pET28mmt.his-(wo) and pET28mbt.his'(wo) which contain the TGase gene in the wrong orientation do not contain stop codons and therefore expressed a much larger protein.
Cells were induced by the addition of IPTG and samples taken prior to induction and at various time intervals after were analysed by SDS-PAGE (2.2.15). Initial expression studies have shown that all of the constructs directed the expression of recombinant proteins of the expected size with no aberrant protein expression detected in the host strain (Table 5.1) (Figure5.4). The molecular weight of TGase expressed by pET28mmt.his- (38.4 kDa) was similar to the predicted molecular weight ~f the mature form of TGase protein (37.8 kDa), whereas the construct pET28mmt.his+ (containing the extra amino acids) directed the expression of a larger protein of 41.6 kDa. No recombinant TGase was detected in the uninduced cells. The maximum level of production of recombinant proteins from Sh. mobaraense was obtained if cells were grown to an ODGooof 0.3, with 1 mM IPTG added and the cultures grown for a further 3 hours. Overnight growth did not cause increased accumulation of protein. Constructs were also transformed into the strain JM109[DE3] and TGase activity was compared to constructs in BL21[DE3]. TGase was produced in both strains, however, the highest levels of activity were found in BL21 cells and therefore, this host was used for purification (data not shown).
The construct pET28mbt.his- expressed the recombinant Sh.baldaccii TGase protein of the expected size of 38.1 kDa (Table 5.1), while no recombinant TGase was detected in the uninduced cells (Figure 5.5). Maximum level of production of recombinant protein from Stv. baldaccii was obtained when the cells were grown at 37 OC to an OD600of 0.4 to 0.6, with 1 mM IPTG added and the cultures grown overnight to increase the accumulation of protein.
These experiments were repeated without antibiotic selection being applied for the log phase growth and induction phases. This was performed to check the stability of the strain to retain the plasrnid without continual antibiotic presence. Similar levels of recombinant protein expression was observed when the cells were grown with and without kanamycin. This result means that for larger volume cultures, antibiotics can be omitted which will significantly reduce the costs of production scale up. Purification of recombinant proteins will be discussed in sections 5.2.4.3 and 5.2.4.4 after protocols have been optimised by analysing endogenous TGases (5.2.4.1 and 5.2.4.2).
Insert Insert Predicted Recombinant TGase Endogenous TGase Sequence Molecular Weight Predicted Molecular Molecular Weight Weight rnrnt .6/2b 37.8 kDa pET28mmt.his+= 41.6 kDa 38.0 kDa (This study*) pET28mmt.his = 38.4 kDa (SDS-PAGE*) mbt.612b 37.6 kDa pET28mbt.his- = 38.1 kDa 39.0 kDa (This study*) (SDS-PAGE*)
Table 5.1: Molecular weight comparison from the predicted sequence with recombinant and endogenous microbial TGases. mmt.612b: mature form of the TGase protein from Stv. mobnmense mbt.612b: mature form of the TGase protein from Stv. bnldaccii * : results from Chapter 3. Figure 5.4: Expression of recombinant Stv. mobaraense TGase. SDS-PAGE showing the expression of TGase proteins from Stv. mobaraense which either have the His.Tag sequence (pET28mmt.his+) or the fis.Tag sequence has been removed (pET28mmt.his-). Induced bands in Lanes 2 and 4 are indicated by arrows. There is no evidence of expression in the uninduced controls (Lanes 1 and 3). Optimal expression of recombinant Stv. mobaraense TGase was obtained after 3 hours incubation following induction. Lane 1: pET28mmt.his- uninduced cells Lane 2: pET28mmt.his- induced cells after 3 hours incubation following induction Lane 3: pET28mmt.his+ uninduced cells Lane 4: pET28mmt.his' induced cells after 3 hours incubation following induction Lane 5: partially purified MTGase from strain S-8 1 12. Figure 5.5: Expression of recombinant Stv. baldaccii and recombinant Stv. mobaraense TGase. SDS-PAGE showing the expression of TGase protein without the histidine tag sequence from Sm. baldnccii and SW. mobarnense. No aberrant protein was produced in the uninduced cells or in the host cells. Optimal expression of recombinant Sm. bnlcEnccii TGase was obtained after overnight incubation following induction. Induced bands in Lanes 4 and 6 are indicated by arrows. Lane 1: E. coli BL2 1[DE3] uninduced cells Lane 2: E. coli BL21 [DE3] induced cells Lane 3: pET28mbt.his- uninduced cells Lane 4: pET28mbt.his- induced cells after overnight incubation following induction Lane 5: pET28mmt.his- uninduced cells Lane 6: pET28mmt.his- induced cells after 3 hours incubation following induction Lane 7: partially purified MTGase from strain S-8 112 5.2.4 Protein Purification of Microbial TGase 5.2.4.1 Purification of endogenous TGase from Stv. mobaraense Microbial TGase is secreted from the cells of Stv. mobaraense into the culture medium and a single step procedure for purification of the extracellular TGase by chromatography has been described (Gerber et al., 1994) using a low pressure chromatography system (2.2.20.lb). Stv. mobarnense culture conditions were optimised for the production of microbial TGase and cultures were grown for 8 days at 28 OC to obtain maximum TGase activity (4.2.3). In studies described in Chapter 4 it was shown that after 8 days incubation at 28 "C Pro-TGase had been fully processed and only the mature form of the enzyme was present in the culture filtrate of Stv. mobaraense. TGase from centrifuged and filtered culture fluid was purified by ion-exchange chromatography on Fractogel EMD SO3- which isolated the enzyme and produced a homogeneous protein (Gerber et nl., 1994). The enzyme was purified from the culture filtrate with a yield of 42 % (Table 5.2).
5.2.4.2 Purification of endogenous TGase from Stv. baldaccii Microbial TGase from Stv. baldaccii is also extracellular, therefore it was envisaged that the same purification scheme developed for Stv. mobaraense would also be successful. Stv. baldaccii was cultured for 8 days at 28 OC to obtain maximum TGase activity (4.2.3). However from studies in Chapter 4 it was shown that both the Pro-TGase and mature enzyme are present in the culture filtrate after 8 days incubation at 28 OC. The cells were separated by centrifugation and filtration and the culture filtrate was purified by chromatography. As a first step in purification, microbial TGase was separated from the culture filtrate using Fractogel EMD SO3-. Using the procedure outlined in section 2.2.20. lb, elution buffers with different concentrations of NaCl were used in a stepwise gradient. Fractions were collected and examined for enzyme activity. The maximum activity was found within the protein peak eluted at 0.3 M of NaCl (Figure 5.6). Fractions were analysed by SDS-PAGE (2.2.15) which showed that the TGase protein was1being purified. For further purification, active fractions were combined and concentrated by ultrafiltration before being run through a Sephadex G-100 gel filtration column (2.2.20.2b). Using these two methods of purification, microbial TGase from Stv. baldaccii was purified with both the mature form of the enzyme and Pro-TGase bands detected (Figure 5.7). Both forms of the enzyme are dominant bands in unpurified culture filtrate and can easily be detected on SDS-PAGE gels stained with Coomassie Blue (2.2.15) prior to purification. From the data in Table 5.2, microbial. TGase from the culture filtrate of Stv. balclnccii was purified after ion-exchange chromatography with an enzyme yield of 49 %. Following this purification step microbial TGase was purified approximately two-fold and the enzyme preparation obtained was free of other proteins as analysed by SDS-PAGE.
Purification Total Protein Total Units Specific Activity Yield Step (mg) (unitslmg) (%) Stv. mobaraense - culture filtrate - Fractogel Stv. baldaccii
- culture filtrate
- Fractogel
Table 5.2: Purification data for microbial TGase from Stv. mobaraense and Stv. baldaccii after ion-exchange chromatography on Fractogel EMD SOs-. 0.2 M NaCl
0.1 M NaCl
Fraction Number
Figure 5.6: Chromatographic separation of culture filtrate from Stv. baldacciic containing microbial TGase on Fractogel EM.SO3-. Protein was eluted by a stepwise gradient of 0.1 M, 0.2 M and 0.3 M NaCl in 50 mM sodium phosphate buffer, pH 6.0 monitored at 280 nm. TGase activity was detected within the broad peak eluted at 0.3 M NaCl (fractions 79 to 88). TGase activity is represented by:
Mature TGase
Figure 5.7: Purification of microbial TGase from the culture filtrate of Stv. baldaccii. SDS-PAGE showing fractions after gel-filtration chromatography (fractions 10 to 14). Fractions 79 to 88 obtained from ion-exchange chromatography (Figure 5.6) were combined and concentrated by ultrafiltration and further purified by gel-filtration chramatography. Both the Pro-TGase and the mature form of the enzyme were detected as indicated by the arrows. 5.2.4.3 Partial purification of recombinant Stv. mobnraense TGase Following the successful purification of endogenous TGase from culture filtrates, similar schemes were adapted to purify recombinant proteins. Purification schemes for recombinant Stv. mobaraense TGase were established for both constructs (pETmmt.his' and pETmmt.his-). Utilising the optimal conditions established for expression of recombinant TGase (5.2.3), culture growth was scaled up to obtain more protein. The cell pellet from the induced cultures was resuspended in the appropriate buffer for chromatography (2.2.13) and the cells were disrupted by French Pressure Cell Press to release the protein. Purification of both forms of recombinant TGase (with and without His.Tag) was evaluated using appropriate protocols as discussed below.
The pET28mmt.his' construct contains the &s.Tag sequence and therefore can be purified by metal affinity chromatography (2.2.20.3). This is a convenient and economical means of purification with a well established protocol. However problems were encountered with this purification procedure. The pellet did not dissolve completely which resulted in loss of sample. Following chromatography activity was only found in the wash. Therefore it was decided to stop the experiments with pET28mmt.his', since it was only produced to simply the purification. .
Recombinant TGase as expressed by the pET28mmt.his- construct is more akin to the endogenous enzyme with respect to molecular weight and sequence. Therefore it was decided to use the same purification strategy as used for the endogenous enzyme. Two different methods for purification of the mature recombinant microbial TGase from Streptoverticillium sp. S-8112 have been investigated. I was guided by the following reports. Washizu et al. (1994) applied immunoaffinity chromatography to partially purify the recombinant TGase from the culture medium, whereas Yokoyama et al. (2000) purified refolded recombinant TGase by cation-exchange chromatography using Mono S resin. With the latter procedure, recombinant TGase could be eluted with a linear gradient of salt. Activity was detected in fractions eluted between 0.05 to 0.15 M NaCl.
In this study recombinant TGase derived from pET28mmt.his- construct was purified by ion-exchange chromatography using the strong cation resin POROS 20HS on the BioCad purification system (2.2.20.1a). The BioCad system is a similar setup to the low pressure system used in section 5.2.4.1 and 5.2.4.2, however by using POROS resin a faster flow rate (15 ml minute -') can achieved. The most effective separation of bound proteins using Fractogel EMD SO3- resin was obtained with a flow rate of lml minute-' (Gerber et al., 1994). A test case was run with endogenous TGase to confirm POROS 20HS resin gave similar results to the data obtained in sections 5.2.4.1 and 5.2.4.2. For both purification procedures, the strong cation-exchange resins used gave selective separation of TGase from other proteins in the culture filtrate. Recombinant TGase derived from pET28mmt.his- was directly applied to a column containing POROS 20HS which had been previously equilibrated with 50 mM Cation Buffer, pH 6. The column was then washed with the same buffer and the bound proteins were eluted with a linear increasing gradient of 0 to 0.5 M NaCl in 50 mM Cation Buffer, pH 6. Fractions were assayed for enzyme activity and TGase was detected in fractions eluted at 0.3 M NaCl (Figure 5.8). Analysis by SDS-PAGE of the active fractions eluted from the BioCad show that the recombinant TGase produced by E. coli is only partially purified (Figure 5.9). Western blot analyses (2.2.18) detected the recombinant TGase as a single band corresponding to the endogenous mature protein indicating there was no breakdown of the recombinant TGase.
5.2.4.4 Partial purification of recombinant Stv. baldaccii TGase The same purification system, using the BioCad system, was used for the purification of recombinant Stv. baldaccii TGase as previously described (5.2.4.3). Recombinant TGase derived from cultures containing pET28mbt.hi.s- was purified on POROS 20HS (2.2.20.1a). Activity was recovered by elution with 0.3 to 0.4 M NaCl (Figure 5.10). Analysis of active fractions by SDS-PAGE indicated partial purification (Figure 5.11). Western blot analysis (2.2.18) picked a positive band corresponding to a molecular weight of approximately 38 kDa, very similar to the molecular weight of endogenous Stv. mobaraense TGase. Therefore the TGase gene from Stv. baldaccii was expressed in E. coli as an active and mature enzyme with no evidence of breakdown of the recombinant protein. Fraction Number
0 M NaCl 0.3 M NaCl 0.5 M NaCl
Figure 5.8: Chromatographic separation of cell lysate from pET28mmt.his- construct expressed in E. coli on POROS 20HS. Protein was monitored at 280 nm and 354 nm and eluted by a linear gradient of NaCl in 50 mM cation buffer, pH 6.0. TGase activity was detected within fractions 31 to 33 eluted at 0.3 M NaCI. TGase activity represented by: Figure 5.9: Purification of recombinant Stv. mobaraense TGase. SDS-PAGE showing partially purified recombinant SN. rnobaraense TGase by ion-exchange chromatography. Activity was detected in fractions 31 to 33 from chromatograph in Figure 5.8 and recombinant TGase was detected by SDS-PAGE. Recombinant TGase band is indicated with an arrow.
Lane 1: Start material (Large scale) Lane 2: Fraction 3 1 Lane 3: Fraction 32" Lane 4: Fraction 33* Lane 5: pETmmt.his- marker (Small scale). *Faint bands were detected in Lanes 3 and 4 which are not visible in the photograph. Fraction Number
0.1 M NaCl 0.3 M NaCl 0.5 M NaCl
Figure 5.10: Chromatographic separation of cell lysate from pET28mbt.his- construct expressed in E. coli on POROS 20HS. Protein was monitored at 280 nm and 354 nm and eluted by a linear gradient of NaCl in 50 rnM cation buffer, pH 6.0. TGase activity was detected within fractions 80 to 83 eluted at 0.3 M NaC1. TGase activity represented by: Figure 5.11: Purification of recombinant Stv. baldaccii TGase. SDS-PAGE of recombinant SIV. bulduccii TGase after ion-exchange chromatography. Activity was detected in fractions 80 to 83 from chromatograph in Figure 5.10. Recombinant TGase band is indicated with an arrow.
Lane 1 to 4 : Fractions 80 to 83 from Bio-Cad column containing POROS 20HS Lane 5: MTGase from strain S-8112 with active mature TGase indicated at 38 kDa 5.2.5 Characterisation of MTGase from Stv. baldaccii Endogenous TGase and partially purified recombinant TGase from Stv. baldc~cciiwere compared and characterised to determine whether the recombinant product had similar properties to the endogenous TGase.
5.2.5.1 Molecular weight SDS-PAGE analysis of both the endogenous (Figure 5.6) and recombinant (Figure 5.10) TCase preparations indicate molecular weights of approximately 39 kDa and 38 kDa respectively. The predicted molecular weight from the deduced amino acid sequence of the mature Stv. baldaccii TGase is 37.6 kDa. The predicted molecular weight of recombinant Stv. baldaccii TGase (pET28mbt.his-) is slightly higher - 38.1 kDa. The recombinant Stv. baldaccii protein includes an additional 5 amino acids which would account for the difference in the predicted molecular weights. Nethertheless, the enzyme is active and only one band is detected after immunoblotting.
5.2.5.2 Enzymatic properties 5.2.5.2~1Temperature and pH opfima To determine the optimal pH for maximum TGase activity of the endogenous and recombinant TGases, enzyme activity was measured as described in section 2.2.17.1, with some modification. Enzyme activity was examined at various pH ranging from 3.5 to 9.0 using different buffers. Thus for reaction mixes at pH 3.5 to 7.0, 5 mM citrate buffer was used and for reaction mixes at pH 7.5 to 9.0, 5 rnM Tris-HC1 buffer was used (Tsai et al., 1996).
The optimal pH for endogenous and recombinant Stv. baldaccii TGase was between pH 6 to 7 (Figure 5.12). There was no significant difference between the two. This is similar to the range preferred by other Streptoverticillium species (Motolu et al., 1990; Duran et al., 1998). On the other hand, the temperature optima for the recombinant form was lower compared to the endogenous enzyme. Figure 5.13 compares the temperature profile of endogenous and recombinant TGase. The optimal temperature for activity is 37 OC and 22 OC, respectively. There are several possible explanations for the difference. Although it seems most likely that refolding of the enzyme may have been influenced by the additional amino acids at the N-terminal and loss of the secretion process in E. coli.
Figure 5.12: pH optima of endogenous and recombinant TGase from Stveb~ldaccii*
Figure 5.13: Ternperatlare dependence of endogenous and recombhant TGase Ifram SW baldaccili. 5.2.5.2b Effect of inhibitors ~~asehas been classified together with the papain-like thiol proteases in the same superfamily in the Structural Classification of Proteins (SCOP) database (Hubbard et al., 1999). Kanaji et al. (1993) have shown that the residues around the Cys residue within the active site region of mammalian TGase are similar to those in a family of thiol proteinases represented by papain and cathepsin. Furthermore, the protease papain contains a catalytic sulfhydryl (SH) group which is inactivated by iodoacetic acid (IAA) (Jocelyn, 1972). As part of the evaluation the effects of a range of protease inhibitors on TGase activity were examined.
Reactions were set up according to section 2.2.17.1 with some modifications. Each inhibitor was added to the reaction at a final concentration between 1 to 5 mM in 0.1 M Tris-acetate buffer, pH 6.0. The reaction was incubated for 30 minutes at room temperature after which TGase activity was measured. Results with 1 mM of inhibitor are shown in Table 5.3 and compared with published data on other microbial TGases for the same conditions (Motoki et al., 1990; Ho et al., 2000).
Motoki et al., (1990) and Ho et al., (2000) (Table 5.3) showed that endogenous microbial TGase from Stv. mobaraense, Stv. cinnamoneum ssp. cinnamoneum , Stv. griseocameum and Stv. ladakanum are s.trongly inhibited by N-ethylmaleimide (NEM) and partially by IAA. As NEM and IAA are cysteine protease inhibitors, this indicates that the active site region of microbial TGase contains a catalytic Cys residue and that this residue is necessary for activation. Microbial TGase from these Streptoverticillium species was not affected by EDTA (metalloprotease inhibitor) or PMSF (serine protease inhibitor) except for Stv. ladakanurn which was partially inhibited by PMSF. Stv. ladakanum may have a different catalytic mechanism for TGase activation.
Both endogenous and recombinant TGase from Stv. baldaccii were unaffected by any of the inhibitors at 1 mM concentration (Table 5.3). In part, the Stv. baldaccii enzymes were stimulated by IAA, NEM and PMSF. At higher concentrations inhibition did occur (Table 5.4). Endogenous Stv. baldaccii TGase activity was strongly inhibited by 2.5 mM IAA, supporting the role of an active cysteine in the catalytic site. At higher concentrations of IAA, NEM and PMSF there was no significant dose dependent change in the activity of either the endogenous or recombinant enzyme. The sensitivity of enzyme from other sources (Figure 5.3 and 5.4) on the other hand, shows that the Stv. baidaccii enzyme is different structurally. There are some differences between the endogenous and recombinant Stv. baldaccii TGase, especially in response to PMSF; the data is noisy but is consistent with folding changes in line with similar changes reported for recombinant Stv. mobaraense TGase (Kawai et al., 1997; Yokoyama et al., 2000).
Table 5.3: Comparison of the effects of various inhibitors on microbial TGase from
Streptoverticillium species. * Motoki et al., 1990; "0 et al., 2000, Mob: Stv. mobaraense Cinn: Stv. cinnamoneum ssp. cinnamoneum Gris: Stv. griseocarneum Lad: Stv. ladakanum Bald-E: Stv. baldaccii (endogenous) Bald-R: Stv. baldaccii (recombinant) EDTA: ethylene diamine tetraacetic acid NEM: N-ethylmaleimide IAA: Iodoacetic acid PMSF: Phenyl methyl sulfonyl fluoride Yo: residual activity Inhibitor Concentration ad' Bald-E Bald-R (mMI (%I (%I (%I PMSF 0.0 100 100 100 1.O 61.6 156 133 2.5 62.0 110 9 1 5.0 31.1 136 7 1 IAA 0.0 100 100 100 1.O 46.4 204 140 2.5 44.5 127 95 5 .O 28.6 113 95 NEM 0.0 100 100 100 1.O 1.2 104 140 2.5 n d 120 133 5.0 n d 160 153
Table 5.4: Effect of varying the concentration of inhibitors on microbial TGase. # Ho et al., 2000 Lad: Stv. ladakanum Bald-E: Stv. baldaccii (endogenous) Bald-R: Stv. baldaccii (recombinant) nd: not done %: residual activity PMSF: Phenyl methyl sulfonyl fluoride IAA: Iodoacetic acid NEM: N-ethylmaleimide 5.2.5.2~Effect of metal ions Mammalian TGase requires ca2' for activation whereas microbial TGase activity is calcium-independent. Microbial TGase may nethertheless be sensitive to other metal ions. Since Streptoverticilliurn TGase is sensitive to IAA, a thiol-modifying agent, it is reasonable to expect heavy metals (cu2+,2n2+, pb2+ and ~e~+)which can coordinate to SH groups (Seguro et al., 1996; Jocelyn, 1972) to inhibit activity.
Consequently the effect of metal ions on TGase activity was investigated. Enzyme activity was assayed (2.2.17.1) with some modifications. Metal ions were added at a final concentration of 1 rnM in 0.1 M Tris-acetate buffer, pH 6.0, and reactions were incubated for 30 minutes at 22 OC, after which TGase activity was measured. The results are sumrnarised in Table 5.5 along with data from other workers (Motolu et al., 1990; Tsai et al., 1996).
Endogenous Stv. baldaccii TGase was strongly inhibited by 2n2+and pb2+and partially by cu2+,~a", ~a~', co2+, and Mn2'. Recombinant TGase from Stv. baldaccii was only partially inhibited by pb2", cu2+,Mn2+, ~n", Ni2' and K'. Notably, 2n2+ and pb2+ effects were only moderate. However ~a~+,ca2* and Na* addition increased activity slightly (Table 5.5). The inhibition by cu2+,2n2+ and pb2+supports the involvement of sulfhydryl groups in the catalytic reaction of microbial TGase from Stv. baldaccii. Stv. mobamense, Stv. cinnamoneum ssp. cinnamoneum, Stv. griseocameum and Stv. ladakanum responded similarly to the addition of heavy ions. Activity was inhibited by CU" and zn2+although TGase from Stv. ladnknnum was also inhibited by co2+and Ni2+. The endogenous and recombinant TGase from Stv. baldaccii have different inhibition profiles.
The data summarised in Table 5.6 show that the effects of inhibitors and metal ions on mammalian and microbial TGases are different and hence that the sulfhydryl groups perh,aps proximal (long range effects) and in the catalytic reaction are involved differently. For example Stv. mobamense TGase was strongly inhibited by NEM and partially inhibited by IAA whereas Stv. ladakanum TGase was strongly inhibited by NEM and partially inhibited by IAA and PMSF. However Factor XIIIa was completely inhibited by NEM, PCMB and IAA. Jiang and Lee (1992) compared the effect of inhibitors on both Factor XIIIa and Factor XI11 and found that Factor XI11 was only partially inhibited by these same thiol-blocking reagents which suggested that ~a'+was required to change the conformation of Factor XIIIa which caused the exposure of the masked SH to thiol reagents. Metal Ion Mob* inn* ~ris* ad' Bald-E Bald-R (1 mM) (%I (%) (%) (%) (%I (%I
I ZnClz 15 24 24 5 .O 2 1 80
Table 5.5: Comparison of the effects of metal ions on microbial TGase from
Streptoverticillium species. * Motoki et al., 1990; # Tsai et al., 1996. Mob: Stv. mobaraense Cinn: Stv. cinnamoneum ssp. cinnamorzeum Gris: Stv. griseocurneum Lad: Stv. ladakanz~m Bald-E: Stv. baldaccii (endogenous) Bald-R: Stv. baldaccii (recombinant) nd: not done %: residual activity Chloride ion was the counter ion for all metals to determine their effect on microbial TGase from Bald-E and Bald-R except for MnS04, Pb(NO& and NiS04. I/ TGase ( Inhibited By: II Stv. baldaccii-E IAA, zn2+,~b", CU", ca2+,~a~+, co2+,~n~' Stv. balcklccii-R PMSF, pb2+,cu2', ~n~',zn2+, ~i~+, K+ 1) Stv. mobaraense* I IAA, NEM, PCMB, CLI", ~n" 11 1 Stv. lndakanum*' / PCMB, NEM; IAA, PMSF, CU", zn2+,Hg2+, Ni2+, co2', cd2+ I 11 Guinea Pig ~ive? IAA, PMCB, cu2+ I 11 Factor XIII~" 1 IAA, NEM, PCMB, zn2+,cd2+, co2+, Ni2+, cu2+, Hg2+, el', ~e?+11
Table 5.6: List of inhibitors which affect both mammalian and microbial TGase activity. Activity was affected by cysteine reactive compounds which indicate that a Cys residue is present in the active site regions of mammalian and microbial TGases ** and it is required for catalytic activity. * Motoh et al., 1990; Ho et nl., 2000; # Folk, 1970; @ Jiang and Lee, 1992. E: endogenous TGase R: recombinant TGase PMSF: Phenyl methyl sulfonyl fluoride IAA: Iodoacetic acid NEM: N-ethylmaleimide PMCB: p- chloromercuribenzoate 5.3 Discussion The active mature region encoded by the TGase gene from Stv. bnldnccii has been cloned and sequenced and shown to have 80 % homology with Stv. mobnrnense cDNA. Data obtained from the deduced amino acid sequence showed that the sequences shared high identity and although there were substitutions distributed along the amino acid sequence, the active site region containing the single Cys residue was conserved. Further studies on the growth and production of microbial TGase from Stv. mobarnense and Stv. baldnccii in Chapter 4 have shown that the mature enzyme is formed from processing the pro-enzyme. Both forms of the enzyme were detected in culture fluids. The active mature protein reached maximum levels after the conversation of the Pro- TGase by hydrolytic cleavage.
There are differences between the Stv. bnldaccii and Stv. mobaraerzse enzymes with regard to size, activity and sensitivity to chemical inhibitors and heavy metal. The Sm. mobnraense TGase has a molecular weight of 38 kDa. The Stv. baldaccii TGase is slightly bigger, approximately 39 kDa by SDS-PAGE. The Pro-TGase from Stv. bnldaccii is also larger than the Stv. mobnraense equivalent. However the recombinant TGase from Stv. baldaccii based on the mature enzyme region of the Stv: mobaraense gene, dropped backed to a molecular weight of 38.1 kDa.
The subtle changes in the amino acid sequence nethertheless have a notable effect on the enzymatic characteristics of the enzyme. The Stv. bnldnccii enzyme appears to be psychrotolerant as it still retains significant activity, at least in the recombinant form, at temperatures down to 4 OC. The partially purified Sfv. baldaccii enzyme exhibits maximum activity at 16 and 37 OC, and loses activity abruptly after the 37 OC maxima is exceeded. The recombinant Stv. bnldc~cciienzyme activity peaked at 22 OC, which was remarked on earlier in Chapter 4, because it seems to be positioned midway between the twin activity peaks (Tmax) for the endogenous partially purified enzyme.
Comparison of the deduced amino acid sequences of microbial TGase from different Streptoverticillium species showed that there is high identity between species and that there is a conserved active site region containing a single Cys residue. Comparison of these sequences with mammalian TGase showed no homology except for the region around the Cys residue in the active site region (Kanaji et al., 1993). Previous studies on mammalian (Folk, 1970; Jiang and Lee, 1992) and microbial TGase from Stv. mobaraerzse (Ando et nl., 1989; Motolu et nl., 1990) and Stv. lndnknnum (Ho et nl., 2000) indicated that the Cys residue in the active site region is involved in catalytic activity as the effect of thiol-modifying agents and heavy metals notably inhibited enzyme activity (Table 5.6). Studies performed on calcium-dependent mammalian TGases have shown that these enzymes require ca2+to induce conformation change thus exposing the Cys residue within the active site region (Greenberg et nl., 1991). Similarly, B$+ has also been shown to activate mammalian TGase (Folk and Chung, 1973).
Taken together, it seems that despite the fact that the active site catalysis is strongly conserved in microbial TGase proteins, it is still possible to modify the enzymatic properties. That augers well for the development of a psychrophilic enzyme that can perform at lower temperatures at reasonable rates. Thus it should be possible to use an enzyme such as the one described in this work, as a source of new, possibly novel application. As a further step towards reaching the goal, I have been able to clone the Stv. baldnccii enzyme in E. coli. These systems clearly provide ease of fermentation, especially when compared to the slow batch culture and the more fastidious nutritional requirements of Streptoverticillium. E. coli cultures avoid the problems that can arise with complex dimorphic cultures and the potential issues with spore formers.
Results in Chapter 4 showed that Stv. baldnccii cultures grown at 12 OC had the highest specific activity. To overcome problems associated with growing cultures at low temperatures, Stv. baldaccii TGase was expressed in E. coli strain BL21[DE3]. The optimal temperature for this strain of E. coli was 37 OC which is not optimal for Stv. baldnccii TGase activity. A possible alternative is to find a compromise to allow maximum enzyme activity at mesophilic growth rates. Feller et al. (1998) expressed the heat-labile a-amylase from the antarctic psychrophile Alteromonas haloplanktis in E. coli at various temperatures. Results show that a compromise temperature is possible - one that is sufficiently low to preserve the properties of the psychrophilic enzyme and at the same time, allow good growth rate of the recombinant E. coli host at 18 OC. Alternatively it may be possible to refold the protein to raise activity. Transglutaminase is a fascinating enzyme, it shows complexity, variance and performs a range of tasks in single cell and mammalian systems. Its role is microbial physiology is by no means clear and it will be interesting to see if these novel enzymes can realise their potential commercially as adjuncts for the food processing industry and in medical science. CHAPTER 6
Final Discussion TGase reactions have been used to modify the functional properties of food proteins. Until recently, guinea-pig liver has been the sole source of commercial TGase. However the scarce source, complicated purification procedure and high price of the enzyme have hampered its application on an industrial scale (Berovici et al., 1987). The discovery of microbial TGase has provided a much needed alternative to mammalian TGase. Production of microbial TGase can be easily obtained by fermentation and a one-step purification procedure (Gerber et al., 1994). This enzyme has been shown to have many applications in the food processing industry with considerable patent activity in the area.
Microbial TCase is commercially available from the Japanese company Ajinomoto (or a trading relation, Amano Pharmaceutical) and Novo Nordisk, a Danish company. There are many patents held by these companies and Table 6.1 lists patents involving microbial TGase which covers calcium-independent TGase, applications of TGase and recombinant TGase and uses thereof. Claims held by Ajinomoto are quite broad in covering microbial TGase. For example, US Patent 5,156,956 covers in claim 1 any TGase whose catalysing action is calcium-independent; and in claim 2 that TGase is obtained from a microorganism belonging to the genus Streptoverticillium. No patents have been claimed specifically referring to Stv. baldaccii, however the enzyme is very similar to microbial TGase patented by Ajinomoto. This claim is extremely broad and therefore could be interpreted to cover all Streptoverticillium TGases including Stv. baldaccii TGase.
To date, the research and patent activity in the food industry has focused on the manufacture of food products which requires the application of microbial TGase at high temperatures. In the meat industry, there are many applications involving the restructuring and preservation of meats. These applications generally require an enzyme that is active at low temperature. Not withstanding the advice that has been received from Griffith University patent attorneys viz: that Stv. baldaccii TGase applications are covered by claims made by Ajinomoto, they are also of the opinion that an enzyme with specialised features may overcome the restrictions imposed by this broad patent. In particular our patent attorneys opinion is that the low temperature characteristics of Stv. baldaccii could satisfy the requirement for novelty. Patent searching has confirmed that there are no reports covering temperature desensitisation of TGase from microbial sources or any other
139 source. My study has identified the Stv. bnldaccii organism as a potential source of low temperature enzyme as well as providing evidence that temperature tolerance may be increased by selection of the appropriate expression conditions in the case of the recombinant enzyme.
Patent No. Assignee Title EP 0379606A1 Ajinomoto Novel Transglutaminase (Motolu et al., 1990). US 5,156,956 Ajinomoto Transglutaminase (Motoki et al., 1992). US 5,252,469 Amano Process for producing a transglutaminase derived from Streptomyces (Andou et al., 1993). US 5,420,025 Ajinomoto Recombinant Transglutaminase (Takagi et al., 1995) PCTlJP96101569 Ajinomoto Microbial process for producing transglutaminase (Kobayashi et al., 1996b). PCT/DK95/00347 Novo Nordisk Microbial transglutaminases, their production and use (Bech et nl., 1996). EP 0743 365 A2 Ajinomoto Process for efficiently producing transglutaminase through DNA recombination (Yokoyama et al., 1996).
Table 6.1: Microbial TGase patents
Microbial TGase from Stv. mobaraense (Activa TG) has been commercially available from Ajinomoto for some time. Microbial Activa TG consists of 0.6 % partially purified TGase and is available for approximately A$136 kg-'. Assuming that there is equivalent to 0.1 % of pure enzyme, the enzyme price is approximate $136,000 kg-'. This probably translates to tight margins and moreover the enzyme is being sold in markets that are traditional commodity markets with tight and widely fluctuating profit margins. Consequently production costs and the "bangs for bucks" arguments will decide commercial opportunity for any enzyme technology coupled to the profitability arrangement in the question of product marketability because of GMO-regulatory requirements in the case of the cloned 140 product, and the question of commercialisation on the other. The GMO debate has been well rehearsed. The Ajinomoto enzyme as far as can be gauged at this distance, is produced from GMO-free sources. The introduction of a GMO-TGase albeit cold- desensitised would probably be a lengthy process and also introduces high and possibly unacceptable business risk to consumers in issues revolving around labelling of products. If TGase is used for biofilm production for instance, for the protection of cut meat portions it is unclear whether that product can be classified as fresh meat, when the enzyme (and perhaps substrates) come from a bacterial source. These are not insurmountable issues but they make the pathway to market more difficult, particularly in the face of fairly substantial P protection from established market leaders such as Ajinomoto. Taken together, what can be said about the commercial issues that my work has raised.
1. Firstly, there clearly is a desire for a TGase enzyme that can be used for a variety of applications in the food processing industry. This is based on existing products in the markets after expressed opinions for a temperature desensitised enzyme, and the need to make better use of cheap commodity proteins, particularly in the light of foot and mouth outbreaks and the continuing BSE occurrence in Europe.
2. There are companies marketing product internationally. New products need to compete on price and function. My work provides 'proof of concept' for the production of a low temperature enzyme source. It does not address cost of manufacture, although the cloning work and the demonstration of a potentially better low temperature tolerant enzyme from expression in E. coli indicates a possible acceptable pathway. But no more than that as clearly optimisation of expression and activity would require pilot-scale operation.
3. The regulatory issues surrounding the use of GMOs is complicated and although the debate over GMOs has cooled, there would be difficulties using recombinant TGase in many'regional markets, for example, the surimi market in Japan.
4. This project was originally funded by the Meat Research Corporation (now Meat and Livestock Australia). The aim was to identify microbial sources of TGase with low temperature tolerance and to clone those genes if possible. These objectives have been
141 achieved in the present study. I demonstrated that the Stv. bnldaccii enzyme exhibits low temperature tolerance and also that the cloned enzyme expressed in E. coli has a significantly lower Tmax than the Stv. mobnraense counterpart. A study by Batzloff (2001) identified a low-temperature source of TGase from a deep-water fish, which was cloned and expressed in E. coli. The fish enzyme has a molecular weight of approximately 80 kDa and has significant enzyme activity at temperatures below 10 "C. Taken together there is now a choice for a commercial temperature desensitised TGase - at least there are two possibilities, and there may be more. The point is that any commercial decision to market a TGase variant will need to evaluate the enzyme prospects of the protagonists and make a judgement about their fit and acceptability to various niche markets. As a case in point, the fish enzyme on face value has a better future with the Japanese market than the bacterial enzyme. On the other hand there is the balancing question of cost. The relation between market and source is an important issue and will have a big bearing on any business opportunity.
5. I have used several enabling technologies to clone the enzyme into E. coli. Any commercial production protocol will need to consider the financial costs of accessing these methods very carefully. For instance, the IPTG-induction system would incur significant charges if it was to be used. There are alternatives to this system and better still, home- grown alternatives would provide significant commercial creditability. Parallel studies in our laboratory (Dr. Kathryn Tonissen laboratory) have developed an expression system that is unencumbered and may be suitable for the expression of TGase in E. coli systems (K. Bloomfield and K. Tonissen, personal communication).
Taken together my studies have provided some fundamental observations on the properties of Stv. bnldaccii enzyme. I have shown how the TGase gene can be cloned into an E. coli system; that the expressed enzyme has activity and a low Tmax. compared to the Stv. mobaraense equivalent; and that the enzyme properties can be modified during the expression process. The specific achievements from this study are outlined in the summary at the beginning of my thesis. REFERENCES
Aeschilman, D. and Paulsson, M. (1994). Transglutaminases: protein cross-linkng enzymes in tissues and body fluids. Thromb. Hnemost. 71 : 402-415.
Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang, Z., Mille, W. and Lipman, D.J. (1997). Gapped BLAST and PSI-BLAST: A new generation of protein data-base search programs. Nzlcleic Acids Res. 25 : 3389-3402.
Ando, H., Adacahi, M., Urneda, K., Matsuura, A., Nonaka, M. and Uchio, R. (1989). Purification and characterisation of a novel transglutaminase derived from microorganisms. Agric. Biol. Chem. 53 : 26 13-26 17.
Andou, H., Matsuura, A. and Hirose, S. (1993). Process for producing a transglutaminase derived from Streptomyces. US Patent Number 5,252,469.
Araki, H. and Seki, N. (1993). Comparison of reactivity of transglutaminase to various fish actinomysins. Nippon Suisnn Gakknishi 59 : 711-716.
Atsumi, T., Wakameda, A. and Noguchi, S.F. (1995). Frozen storage of surimi containing microbial transglutaminase made from various kinds of fish species. Fisheries Science 61 : 458-463.
Baker, R.A., Baldwin, E.A. and Nisperos-Carriedo, M.O. (1994). Edible Coatings and Films for Processed Foods. In: Krochta, J.M., Baldwin, E.A. and Nisperos- Carriedo, M.O. (ed.), Edible Coatings and Films to Improve Food Quality, Chapter 4, p89-104, Technomic Publishing Company, Inc., Lancaster.
Batiloff, M. (2001). Characterisation of native fish transglutaminase and the development of a low temperature recombinant transglutaminase for food protein manufacture. PhD Thesis. Bech, L., Norrevang, I.A., Halkier, T., Rasmussen, G., Schafer, T. and Andersen, J. (1946). Microbial transglutaminases, their production and use. International Patent PCT/DK95/00347.
Berovici, D., Gaertner, F. and Puigserver, A. J. (1987). Transglutaminase catalysed incorporation of lysing oligomers into casein. J. Agric. Food Chem. 35 : 3301-3304.
Boothe, R.L. and Folk, J.E. (1969). A reversible calcium-dependent, copper- catalysed inactivation of guinea pig transglutaminase. J. Biol. Chem. 244 : 399-405.
Boyle, J.J. and Lew, A.M. (1995). An inexpensive alternative to glassmilk DNA purification. Trends Genet. 11 : 8.
Bradford, M.M. (1976). A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72 : 248-254.
Brill, J.A. and Wiegel, J. (1997) Differentiation between spore-forming and asporogenic bacteria using a PCR and Southern hybridisation based method. J. Microbial. Methods 31 : 29-36.
Daly, H.M. and Naddon, M.E. (1988) Clinical experience with a pasteurised human plasma concentrate in factor XI11 deficiency. Thromb. Haemost. 59 (2) : 171-174.
Duran, R., Junqua, M., Schmitter, J.M., Gancet, C. and Goulas, P. (1998). Purification, characterisation and gene cloning of transglutaminase from Streptoverticillium cinnamoneum CBS 683.68. Biochemie 80 : 3 13-3 19.
Eitan, S., Arich, S., Lavie, V., Yoles, E., Hirschberg, D.L., Belkin, M. and Schwatz, M. (1994). Recovery of visual response of injured adult rat optic nerves treated with transglutaminase. Science 264 : 1764-1768. England, S. and Seifter, S. (1990). Precipitation Techniques. Methods Enzy~~zol.182 : 283-300.
Faergemand, M., Otte, J. and Qvist, K.B. (1997). Enzymatic cross-linkng of whey proteins by a ca2'-independent microbial transglutaminase from Streptomyces lydicus. Food Hydrocolloids 11 : 19-25.
Feller, G. and Gerday, C. (1997). Psychrophilic enzymes: molecular basis of cold adaptation. CMLS. 53 : 830-841.
Feller, G., Le Bussy, 0. and Gerday, C. (1998). Expression of psychrophilic genes in mesophilic hosts: assessment of the folding state of a recombinant a-amylase. Appl. Environ. Microbiol. 64 : 1163-1165.
Feller, G., Narinx, E., Arpingny, J.L., Zekhnini, Z., Swings, J. and Gerday, C. (1994). Temperature dependence of growth, enzyme secretion and activity of psychrophilic Antarctic bacteria. Appl. Microbiol. Biotechnol. 41 : 477-479.
Folk, J.E. (1970). Transglutaminase (Guinea Pig Liver). Methods Enzymol. 17 : 889- 894.
Folk, J.E. and Chung, S.I. (1973). Molecular and catalytic properties of transglutaminases. Adv. Enzymol. 38 : 109-19 1.
Folk, J.E. and Cole, P.W. (1966). Transglutaminase: mechanistic features of the active site as determined by kinentic and inhibition studies. Biochim. Biophys. Acta 122 : 244-264.
Folk, J.E. and Finlayson, J.S. (1977). -The E-(y-glutamy1)lysine crosslink and catalytic role of transglutaminase. Adv. Protein Chem. 31 : 1-133.
Gerber, U., Jucknischke, U., Putzier, S. and Fuchsbauer, H. (1994). A rapid and simple method for the purification of transglutaminase from Streptoverticillium mobaraense. Biochem. J. 299 ; 825-829. Gerike, U., Danson, M. J., Russell, N.J. and Hough, D.W. (1997). Sequencing and expression of the gene encoding a cold-active citrate synthase from an Antarctic bacterium strain DS2-3R. Eur. J. Biochem. 248 : 49-57.
Gold, L. (1990) Expression of heterologous proteins in Escherichia coli. Meth. Enzymol. 185 : 11-14.
Goodfellow, M. (1989). Suprageneric Classificationn of Actinomycetes. In: Williams, S.T., Sharpe, M.E. and Holt, J.G. (ed.). Bergey's Manual of Systematic Bacteriology. Volume 4, p2333-2339. Williams and Wilkns, Baltimore..
Greenberg, C.S., Birckbichler, P.J. and Rice, R.H. (1991). Transglutaminases: multifunctional cross-linking enzymes that stabilise tissues. FASEB J. 5 : 3071-3077.
Grossowicz, N., Wainfan, E., Borex, E. and Waelsch, H. (1950). The enzymatic formation of hydroxamic acids from glutarnine and asparagine. J. Biol. Chem. 187 : 111-125.
Hartman, A.R., Galanakis, D.K., Honig, M.P., Seifert, F.C. and Anagnostopoulos, C.E. (1992). Autologous whole plasma fibrin gel. Arch. Surg. 127 : 357-359.
Ho, M.-L., Leu, S.-Z., Hsiwh, J.-F. and Jiang, S.-T. (2000). Technincal approach to simplify the purification method and characterization of microbial transglutaminase produced from Streptoverticillium ladakarzum. J. Food Science 65 :76-80.
Huang, Y.P., Seguro, K., Motoki, M. and Tawada, K. (1992). Cross-linking of contractile proteins from skeletal muscle by treatment with microbial transglutaminase. J. Biochem. 112 : 229-234.
Hubbard, T.J.P., Ailey, B., Brenner, S.E., Murzin, A.G. and Chothia, C. (1999). SCOP: A structural classification of proteins database. Nucleic Acids Res. 27 : 254-256. Ikura, K., Kometani, T., Yoshikawa, M., Sasaki, R. and Chiba, H. (1980a). Crosslinking of casein components by transglutaminase. Agric Biol. Chem. 44 : 1567- 1573.
Ikura, K., Kometani, T., Sasaki, R. and Chiba, H. (1980b). Cross-linking of soybean 7s and 11s protein by transglutaminase. Agric. Biol. Chem. 44 : 2979-2984.
Ikura, K., Nasu, T., Yokota, H., Tsuchiya, Y., Sasaki, R. and Chiba, H. (1988). Amino acid sequence of guinea-pig liver transglutaminase from its cDNA sequence. Biochem. 27 : 2898-2905.
Ikura, K., Tsuchiya, Y., Sasaki, R. and Chiba, H. (1990). Expression of guinea-pig liver transglutaminase cDNA in Escherichia coli. EL^. J. Biochem. 187 : 705-71 1.
Jaenicke, R. and Bohm, G. (1998). The stability of proteins in extreme environments. Current Opinion Struct. Biol. 8 :738-748.
Jiang, S.T. and Lee, J.J. (1992). Purification, characterisation and utilisation of pig plasma factor XIIIa. Agric. Food Chem. 40 : 1 101-1107.
Jocelyn, P.C. (1972). Biochemistry of the SH Group, p77-85. Academic Press, London.
Josten, A., Haalck, L., Spener, F. and Meusel, M. (2000). Use of microbial transglutaminase for the enzymatic biotinylation of antibodies. J. Immun. Meth. 240 : 47-54.
Kanaji, T., Ozaki, T., Kawajiri, H., Ide, H., Motoki, M. and Shimonishi, Y. (1993). Primary structure of microbial transglutaminase from Streptoverticillium sp. strain S- 81 12. J. Biol. Chem. 268 : 11565-1 1572.
Kato, A., Tomimatsu, K. and Toba, S. (1991a). Manufacture of storage-stable retort mapuo-doufu. Jpn Kokai Tokkyo Koho JP 03 168059. Kato, A., Wado, T., Kobayashi, K., Seguro, K. and Motoki, M. (1991b). Ovomucin-food protein conjugates prepared through the transglutaminase reaction. Agric. Biol. Chem. 55 : 1027-1031.
Kawai, M., Takehana, S. and Takagi, H. (1997). High level expression of the chemically synthesised gene for microbial transglutaminase from Streptoverticillium in Escherichia coli. Biosci. Biotech. Biochem. 61 : 830-835.
Klein, J.D., Guzman, E. and Kuehn, G.D. (1992). Purification and partial characterisation of transglutaminase from Physart~mpolycephalum. J. Bacteriol. 174 : 2599-2605.
Kobayashi, K., Kumazawa, Y., Miwa, K. and Yamanaka, S. (1996a). E-(y- glutamy1)lysine cross-links of spore coat proteins and transglutaminase activity in Bacillus sz~btilis.FEMS Microbiol. Lett. 144 : 157-160.
Kobayashi, K., Yamanata, S., Tanita, Y., Tsuyoshi, N., Fudo, R., Shinozaki, J., Yokozeki, K., and Suzuki, S. (1996b). Microbial process for producing transglutaminase. International Patent PCT/JP96/01569.
Kobayashi, K., Suzuki, S., Izawa, Y., Yokozeli, K., Miwa, K. and Yamanaka, S. (1998a). Transglutaminase in sporulating cells of Bacillus subtilis. J. Gen. Appl. Microbiol. 44 : 85-91.
Kobayashi, K., Hashiguchi, K., Yokozeki, K. and Yamanaka, S. (1998b). Molecular cloning of the transglutarninase gene from Bacillus subtilis and its expression in Escherichia coli. Biosci. Biotechnol. Biochem. 62 : 1109-1114.
Koneman, E.W., Allen, S.D., Janda, W.M., Schreckenberger, P.C. and Winn, W.C. (ed.) (1992). Color Atlas and Textbook of Diagnostic Microbiology (4thedition), p505. J.B. Lippincott Company, Philadelphia. Kumazawa, Y., Nakanishi,K., Yasueda, H.. and Motoki, M. (1996). Purification and'characterization of transglutaminase from Walleye Pollack liver. Fisheries Sci. 62 : 959-964.
Kurth, L. and Rogers, P.J. (1954). Transglutaminase-catalysed cross-linlung of myosin to soya protein, casein and gluten. J. Food Science 49 : 573-589.
Locci, R. (1989). Streptomycetes and Related Genera. In: Williams, S.T., Sharpe, M.E. and Holt, J.G. (ed.). Bergey's Manual of Systematic Bacteriology. Volume 4, Section 29, p2451-2504. Williams and Willuns, Baltimore.
Lorand, L. and Conrad, S.M. (1984). Transglutaminases. Mol. Cell Biochem. 58 : 9- 35.
Lowry, O.H., Rosebrough, N.J., Farr, A.L. and Randall, R.J. (1951). Protein measurement with the Folin phenol reagent. J. Biol. Chem. 193 : 265-275.
Madigan, M.T., Martinko, J.M. and Parker, J. (2000). BROCK Biology of Microorganisms (9thEdition). Prentice Hall Inc., New Jersey.
Makarova, K.S., Aravind, L. and Koonin, E.V. (1999). A superfamily of archaeal, bacteria, and eukaryotic proteins homologous to animal transglutaminases. Protein Science 8 : 1714-1719.
Margosiak, S., Dharma, A., Bruce-Carver, M.R. Gonzales, A.P., Louie, D. and Kuehn, G.D. (1990). Identification of the large subunit of ribulose 1,s-biphosphate carboxylase/oxygenase as a substrate for transglutaminase in Medicago sativa L. (Alfalfa). Plant Physiol. 92 : 88-96.
Matacic, S.S. and Loewy, A.G. (1979). Presence of the 8-(y-g1utamic)lysinecrosslink in cellular proteins. Biochem. Biophys. Acta. 576 : 263-268.
Matsui, K., Murai, T., Motoki, M. and Toiguchi, S. (1990). Manufacture of molded meat using transglutaminase. Jpn. Kokai Tokkyo Koho JP 0279956. Miller, M.L. and Johnson, G.V. (1995). Transglutaminase cross-linking of the tau protein. J. Neurochenz. 65 : 1760- 1770.
Motoki, M. and Nio, N. (1983). Crosslinlung between different food proteins by transglutaminase. J. Food Science 48 : 56 1-566.
Motoki, M., Okiyama, A., Nonaka, M., Tanaka, H., Uchio, R., Matsuura, A,, Ando, H. and Umeda, K. (1990). Novel transglutaminase. European Patent EP 0379606Al.
Motoki, M., Okiyama, A., Nonaka, M., Tanaka, H., Uchio, R., Matsuura, A., Ando, H. and Umeda, K. (1992). Transglutaminase. US Patent Number US 5,156,956.
Motoki, M. and Seguro, K. (1998). Transglutaminase and its use for food processing. Trends Food Sci. Technol. 9 : 204-210.
Myhrman, R. and Bruner-Lorand, J. (1970). Lobster muscle transpeptidase. Meth. Enzynzol. 19 : 765-770.
Nonaka, M., Tanaka, H., Oliyama, A., Motoki, M., Ando, H., Umeda, K. and Matsuura, A. (1989). Polymerisation of several proteins by ca2+-independent transglutaminase derived from microorganisms. Agric. Biol. Chem. 53 : 2619-2623.
Nonaka, M., Matsuura, Y. and Motoki, M. (1996). Incorporation of lysine- and Lysine dipeptides into as,-casein by ca2+-independent microbial transglutaminase. Biosci. Biotech. Biochem. 60 : 13 1-133.
Nonaka, M., Sakamoto, H. Toiguchi, S., Kawajiri, H., Soeda, T. and Motoki, M. (1992). Sodium caseinate and skim milk gels formed by incubation with microbial transglutarninase. J. Food Science 57 : 1214-1218
Ochi, K. and Hiranuma, H. (1994). A taxonomic review of the genera Kitasatosporia and Streptoverticillium by analysis of ribosomal protein AT-L30. Int. J. Syst. Bacteriol. 44 : 285-292. Paardekooper, E.J.C. (1987). Recent advances in fresh meat technology. International Congress of Meat Science and Technology: European Meeting of Meat Research Workers. Proceedings Helsinki 1 : 170- 174.
Pasternack, R., Dorsch, S., Otterbach, J.T., Robenik, I.R., Wolf, S. and Fuchsbauer, H-L. (1998). Bacterial pro-transglutaminase from Streptoverticillium mobnmense. Purification, characterisation and sequence of the zymogen. Eur. J. Biochem. 257 : 570-576.
Pfister, P., Wasserfallen, A., Stettler, R. and Leisinger, T. (1998). Molecular analysis of Methanobacterium phage psiM2. Mol. Microbial. 30 : 233-244.
Ramanujam, M.V. and Hageman, J.H. (1991). Intracellular transglutaminase (E.C. 2.3.2.13) in a procaryote: evidence from vegetative and sporulating cells of Bacillus s~ibtilisl68.FASEB J. 4 : A2321
Ruizherrer, J., Iranzo, M., Elorza, M.V., Sentandreu, R. and Mormeneo, S. (1995). Involvement of transglutaminase in the formation of covalent cross-links in the cell wall of Candida nlbicans. Arch. Micro. 164 : 186-193.
Sakarnoto, H., Kurnazawa, Y., Toiguchi, S., Seguro, K., Soeda, T. and Motoki, M. (1995). Gel strength enhancement by addition of microbial transglutaminase during onshore surimi manufacture. J. Food Science 60 :300-304.
Sakamoto, H. and Soeda, T. (1991). Minced meat products containing transglutaminase. Jpn. Kokai Tokkyo Koho JP 03 175929.
Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning A Laboratory Manual (2nd Edition). Cold Spring Harbour Laboratory Press.
Scandurra, R., Consalvi, V., Chiaraluce, R., Politi, L. and Engel, P.C. (2000). Protein stability in extremophilic Archaea. Front. Biosci. 5 : d787-795. Schmidt, G., Seizer, J., Lerm, M. and Aktories, K. (1998). The Rho-deamidating Cyrotoxic Necrotizing Factor 1 from Escherichin coli possesses transglutaminase activity. J. Biol. Chem. 273 : 13669-13674.
Seguro, K., Kumazawa, Y., Ohtsuka, T., Toiguchi, S. and Motoki, M. (1995). Microbial transglutaminase and E-(y-glutamy1)lysine crosslink effects on elastic properties of kamaboko gels. J. Food Science 60 : 305-3 1 1.
Seguro, K., Nio, N. and Motoki, M. (1996). Some characteristics of a microbial protein cross-linkng enzyme: transglutaminase. In: Panis, N., Kato, A., Creamer, L.K. and Pearce, J. (ed.). Macromolecular Interactions in Food Technology (ACS Symposium Series 650), p271-280, American Chemical Society.
Singer, M.A., Hortsch, M., Goodman, C.S. and Bentley, D. (1992). Annulin, a protein expressed at limb segment boundaries in the grasshopper embryo, is homologous to protein cross-linhng transglutaminases. Dev. Biol. 154 : 143-159.
Singh, N. and Meta, K. (1984). Purification and characterisation of transglutaminase from filarial nematode, Brugia malayi. Eur. J. Biochem. 225 : 625-634.
Soeda, T., Ishii, T., Yamazaki, K. and Murase, K. (1995). The functionalities of microbial transglutaminase for food application. 1. The effect of transglutaminase on texture of tofu. J. Jpn. Soc. Food Sci. Techn.-Nippon Shokuhin Kagnku Kognku Kaishi 42 : 254-26 1.
Studier, F.W., Rosenberg, A.H., Dunn, J.J. and Dubendorff, J.W. (1990). Use of T7 RNA polymerase to direct expression of cloned genes. Meth. Enzymol. 185 : 60-89.
Taguchi, S., Nishihama, K., Igi, K., Ito, K., Taira, H., Motoki, M. and Momose, H. (2000). Substrate specificity analysis of microbial transglutaminase using proteinaceous protease inhibitors as natural model substrates. J. Biochem. 128 : 415-425. Takagaki, Y., Narakawa, K. and Uchio, R. (1991). Coating of vegetables and fruits with transglutaminase and proteins for preservation. Jpn Kokai Tokkyo Koho JP 03272639.
Takagi, H., Arafuka, S., Matsui, H., Washizu, K., Ando, K. and Koikeda, S. (1995). Recombinant transglutaminase. US Patent Number 5,420,025.
Takehana, S., Washizu, K., Ando, K., Koikeda, S., Takeuchi, K., Matsui, H., Motoki, M. and Takagi, H. (1994). Chemical synthesis of the gene for microbial transglutaminase from Streptoverticillium and its expression in Escherichia coli. Biosci. Biotech. Biochem. 58 :88-92.
Tokunaga, F., Yamada, M., Miyata, T., Ding, Y.L., Hiranaga, M., Muta, T. and Iwanaga, S. (1993). Limulus hemocyte transglutaminase. J. Biol. Chem. 268 : 252- 261.
Tsai, G., Lin, S. and Jiang, S. (1996). Transglutaminase from Streptoverticillizim ladakanum and application to minced fish product. J. Food Science 61 : 1234-1238.
Washizu, K., Ando, K., Koideda, S., Hirose, S., Matsuura, A., Takagi, H., Motoki, M. and Takeuchi, K. (1994). Molecular cloning of the gene for microbial transglutaminase. Biochem. 58 : 82-87.
Williams, S.T., Goodfellow, M., Alderson, G., Wellington, W.M.H., Sneath, P.H.A. and Sackin, M.J. (1983). Numerical classification of Streptomyces and related genera. J. Gen. Microbiol. 129 : 1743-1813.
Yamauchi, K., Uenikawa, S., Enomoto, A., Tanimoto, H., Oohata, K. and Motoki, M. (1991). Transglutaminase for reducing allergenicity of food proteins andlor peptides and method of reducing their allergenicity. Jpn Kokai Tokkyo Koho JP 0327253. Yokoyama, K., Nakamura, N., Seguro, K. and Kubota, K (2000). Overproduction of Microbial Transglutaminase in Escherichin coli, in vitro refolding, and characterization of the refolded form. Biosci. Biotechnol. Biochem. 64 : 1263-1270.
Yokoyama, K., Kikuchi, Y. and Yasueda, H. (1996). Process for efficiently producing transglutaminase through DNA recombination. European Patent EP 0 743 365 A2.
Zhu, Y., Rinzema, A., Tramper, J. and Bol, J. (1995). Microbial transglutaminase - a review of its production and application in food processing. Appl. Microbiol. Biotechnol. 44 : 277-282. APPENDIX 1
Media and Growth Conditions for Psychrophilic and Psychrotrophic Organisms As Recommended by ACAM.
ACAM Media Growth Culture Temperature Flectobacillus glomeratus 112 Strength Seawater Agar 15 OC (ACAM 171) (112 SWA) Flectobacillus xanthum Peptone Yeast Glucose Agar (PYGA) 15 "C (ACAM 81) Flavobacterium gonchvanense Zobells 22 16 Agar (ZA) 25 OC (ACAM 44) Flavobacterium salegens (ACAM 48) Halomonas subglaciescola Artificial Organic Lake Petone Agar 30 "C (ACAM 12) (AOLPA) Halomonas meridians AOLPA 3% '25 OC (ACAM 246) Carnobacteriumfunditum TSA-Artificial Marine Salts 23 OC (ACAM 3 12) (low sulphate) Carnobacterium alterfunditum (ACAM 3 13) Unless otherwise stated all solutions and media are sterilised at 121 OC for 20 minutes,
S 1. Metals 44 (M441 EDTA 2.5g ZnSo4.7H20 10.95 g FeS04.7H20 5.0 g MnS04.H20 1.54 g CuSO4.5H2O 0.392 g CoCl2.6H2O 0.203 g Na2B407.H20 0.177 g Distilled water to 1.0 L Acidify 500 ml of distilled water with a few drops of &So4. Dissolve the ingredients and make up to volume with distilled water.
S2. Hutner's modified salts solution (HMSS) Nitrilotriacetic acid 10.0 g MgS04.7H20 29.7 g CaC12.2H20 3.3 g NaMo04.2H20 12.7 mg FeS04.H20 99.0 mg Metals 44 (S 1) 50.0 ml Distilled water to 1.0 L Neutralise the nitriloacetic acid with KOH. Dissolve the remaining ingredients and adjust the pH to 7.2 with KOH or H2SO4. Sterilise and store at 4 OC.
S3. Phosphate supplement (PSI K2m04 2.5 g KH2po4 2.5 g Distilled water to 1.0 L Dissolve and sterilise. Store at 4 OC. S4. Artificial Organic- Lake vitamin solution (AOLV) Cyanocobalamin 0.1 mg Biotin 2.0 mg Calcium pantothenate 5.0 mg Folic acid 2.0 mg Nicotinaminde 5.0 mg Pyridoxine HC1 10.0 mg Riboflavin 5.0 mg Thiamine HC1 5.0 mg Distilled water to 1.0 L
Dissolve and sterilise by filtration (0.2 pm). Store at 4 OC.
M3. Artificial Organic Lake peptone agar (AOLPA) NaCl 100.0 g MgC12.6HzO 5.0 g MgS04.7HzO 9.5 g KC1 5.0 g CaCl2.2H20 0.2 g fNH4)2so4 0.1 g KNo3 0.1 g Peptone 5.0 g Yeast Extract 1.0 g Agar 15.0 g Distilled water to 960.0 ml Dissolve the ingredients, adjust pH to 7.0 and add the agar. Boil to dissolve the agar. Sterilise then cool to 50 OC. Aseptically add 20 ml of HMSS (Solution S2), 20 ml of PS (Solution S3) and 1 rnl of AOLV (Solution S4).
M3a. AOLPA 3% As in M3 but with only 30 g NaCl per litre distilled water. M6. 112 Strength seawater agar (112 SWA) Glucose 1.0 g Na acetate.3H20 1.0 g Peptone 1.0 g Yeast extract 0.1 g Distilled water 500.0 rnl Filtered seawater 15.0 g Mix, boil to dissolve the agar and sterilise without prior pH adjustment.
M9. Zobells 22 16 agar (ZA) Peptone 5.0 g Yeast extract 1.0 g FeP04 0.01 g Agar 15.0 g Aged seawater 1.0 L Store the seawater in the dark for at least three weeks before use. Sterilise without prior pH adjustment. Marine agar 2216 (Difco) prepared accordingly to manufacturer's instructions can also be used.
M12. Peptone yeast ~lucoseagar (PYGA) Peptone 10.0 g Yeast extract 5.0 g Glucose 3.0 g Distilled water 1.0 L Agar 15.0 g Adjust pH to 7.2. Add agar, boil to dissolve and sterilise. M13. TSA-artificial marine salts (low sulphate) Distilled water 1.0 L K2HP04 0.14 g KC1 0.335 g MgC12.2H20 1.0 g NH4cl 0.25 g CaC12.2H20 0.05 g NaCl 20.0 g Fem4)2(S04)2.7H20 2.0 mg Tryptic Soy Broth 30.0 g Yeast extract 3.0 g Dissolve ingredients in order given. Final pH should be 7.3. Dispense and sterilise. For solid medium add 1.5 % agar. For Carnobacterium sp., cultures grow better anaerobically than aerobically on agar but grow well in unshaken broths. Optimum temperature is 23 OC but good growth is obtained at 10 OC.
APPENDIX 2
Silica Solution ( 2.2.8.1) Suspend 10 g of silica (Sigma S-5631) in 100 ml PBS and allow to settle for approximately 2 hours. Remove and discard the supernatant containing fine particles of silica and resuspend the settled silica in 100 ml PBS. Discard supernant and resuspend the silica in 3 M NaI (Sigma S-8379) at a concentration of lOOmg ml-' and store the solution in the dark at 4 OC. mob I cinn I gris . 1 13v 1
mob 2 CAGGATGCCCGACCCGTACCGTCCCTCGTACGGCASGGCCG cion a CAGGATGCCCGkCCCGTACCGTCCCTCGTACGGCAGGGCCG gris 42 CAGGATGCCCGACCCGTACCGTCCCTCGTC.CGGCAGGGC.G Inv 42 CAGGATGCCCG~CCCGTACCGTCCCTCGT~CGGCAGGGC~G
mob 3 AGACGGTCGTCAACAACTACATACGCAAGTGGCAGCAGG~C rinn 83 ACGGTCGTCAACAAC TACATACGCAAGTGGCAGCAGGTC gris :&,tCGOiCGTCAiCiAC TACA TACGCAAGiGGCfiSCAGGTC I:IV 3 AGACGG~CGTCAACAACTACATACGCAAGTGGCGGCAGGTC mob 124 TAPAGCCACCGCGACGGCAGGAAGCAGCAGATGACCGAGGA 'inn 124 TACAGCCACCGCGACGGCAGG~~GCAGCAGATGACCGAGI:. sris 124 TACAGCCACCGCGACGGCAGGAAGCAGCAG~TGACCGAGGA Inv 124 TACAGCCACCGCGACGGCAGGAAGCAGCAGhTGACCGC.GGA
mob 165 cinn 165 gris 165 lav 165
mob 206 cinn 206 grip 206 Inv 206
mob 247 cinn 247 gris 247 lnv 247
mob 263 cinn 283 grir 283 lav 288
mob 329 cinn 329 gris 329 In v 329
mob 370 cinn 570 gris 370 IDY 370
mob 411 cinn 41 1 grin 41 1 Inv 411
mob 452 cinn 452 gris 452 lav 452 mob 493 clan 493 gris 493 lov 493 mob 534 cinn 534 gris 534 Inv 534 mob 575 cinn 575 gris 575 lav 575
mob 616 fino 616 gris 616 klv 616
mob 657 cinn 657 gri~ 657 lav 657
mob 698 cinn 698 gris 698 lav 698
mob 739 einn 739 gris 739 lav 739
mob 780 cinn 780 gris 780 klv 780
mob 821 cinn 821 gris 821 Lsv 821
mob 862 cinn 862 griB 862 lav 862
mob 903 cinn 903 grio 903 lav 903
mob 944 cinn 944 gris 944 hv 944
mob 985 cinn 985 grL4 985 lav 985
APPEm@U 3 Cornparkon of the nucleotide sequence of the gene encoding transglutram~inase from SlreptoverliciEEi~~mmobaraense (mob), S ciznanzo~e~mssp, ci~namoneum(dnn), Skv. griseocaresunz (gris) and Sl"replomyces Eavmdulae (lav). Sequence starts on page 160. mob bdd 1: F2C-mGCTCG AGGATGCCTG TGCGTACCCV~T GGCCC~C ACGG T CAACAACTACATA bdd
IW CGCAAGTGGCAGCAGGTCTACA CCACCGCGACGG W( lcGc!tAGTGGcAGcAGGTcTAcA$T/~I
Ud
",,b ",,b 246 CGCGTCCTTCGACGAGGAC GGTTCAAGAACG GC bw !n $GCGTCCTTCGACGAGI~dA~A//C~
~~~G~E.J~~-J ;, TGGCGTCC CATGAAC AGGCCCTGG A
-bdd :;; ~~~AJ~c~~T~Jc~;
+ :E ~lj~p~~~p~pa~q br~ AACAC CCGT TT CAAGG AA A A GGA GCAA
$61 TCACGACCCGTCC GATGAAGGCCGTCATCTAC XI C TI~~~lGI&-4 mob 5% CGAAGCACTTCTGGAGCGGCCAGGACC GTCGAGT wu 5% &GAAGcAcTTcTGGAGcGG/GLO.ICd~~cGGJG~c
nmb G: I~~c~c~~~~I bald CTG T C GG TCAAA G AAGCGGATGCCGAC X~I CCCAATGGC GCCTTG TGCCATGCATGTATACGA GlOTJllGElc cGIcG3 nb /IDC**OTICC~C~~PAA~T~T~C~ bdd AGCAAGTTCCGGAACTGGTCT CCG GTACGCGGAC
,& 913 baM 913
ma w9 AAGAGCTGG4ACACCGCCCCC ACAAGGTAAAOCAQ brhl 949 AAGAGCTGGAACACCGCCCCCGCCAAGGTAAAGC,AG
98s GGCTGGCCGTO wd n b.CIODCCDTOr
APPENDIX 4 Comparjson of the nucleokide sequence of the gene encoding hnsglutaminasc: from Slreptovetill nzobaraease (mob) and Slv, baldaccii (bald). Sequence starts on page 162. pETmmt.hM 1 A TGGGCAGCAGCCATCA TCA TCA TCA TCACAGCAGCGGCC TGGTGC 46 pFPmmf.bis- 1 ------..--..------.------o mmbthis- I ------.------.--.------0
pETmml.biSt 47 CGCGCGGCAGCCATATGGCTAGCATGACTGGTGGACAGCAAATGGG 92 plmnmlhk I ------..---..-..------.---0 pETrrbtgir- 1 ------.---.------o
GGATCCGAATTCGGACTCCOACGACAGGGTCACCCC7CCCGCC us GGA TCCGAA TTCGGAC 7CCCACGACAGGGTCACCCC TCCCGCC 45 pETmbt.biS- GGATCCGAATTCGGACTCCGACGACAGGGTCACCCCTCC~~~
GGGC'JGAGACGGTCGTCAACAASTACATACGCAAGTGGCAGCAGG 239 TCAACAACTACATACGCAAGTGGCGC 126 iCAACAHCTACATACGCAAGTGGC#,GCAGtj 136
pETmmLhb+ 230 TCTACAGCCACCGCGACOGCAGGAAGCAGCAGATGACCGAGGAGCA 275 pETmmt.bis- 137 TCTACLGCCACCGCGACGGCAGGAAGCAGCAGATSACCGAGGAGCA 182 pETmb1.bi.i- 137 T C TA CA G~CA C C G C G A C GG C A~G A A G C A GC A~A iG A C C G4.m~ A G C A 162
GCTGTCCTACGGCTGCGTCGGTGTCACCTGGGTCAAT 321 TGCGTCGGTGTCACCIGGGTCAAT 228 TGCGTCGG~GTCACCTGGGTCAAT22s
TACCCCACGAACAGACTGGCCTTCGCGTCCTTCGACG 367 TACCCCACGAACAGACTGGCCTTCGCGTCCTTCGACG 274 TA~~~~A~G~A~A~A~TGGC~RGCG~CCTTCGACG274
GAGACGCGGGCGGAGT?CGAGGGCCGCGTCGC GAGACGCGGGCGGAGTTCGAGGGCCGCGTCGC GAGACGCGGGC~GAGTTCGAGGGCCGC~TCGC
AAGAGAAGGGGTTCCAGCGGGCGCGTGAGGTGGCGTC AAGAGkAGGGG TTCCAGCGGGCGCGTGA ~~E~GAGAAGGG~AGCGGGCGCGTGA
pETmmt.bb 506 TGAACAGGGCCCTGGAGAACGCCCACGACGAGAGCGCTTACCTCG 551 pETmmLhk- 413 TGAACAGGGCCCTGGAGAACGCCCACGACGAGAG GC TTACCTCGA 4% ~ETmbLhb- 413 T G A A c A~GG c c c T G G A~A~CG c c c A c G A c G A G~GGC~TAC[T;ITCGA 45s p~rnmLh'b+ 552 CAACCTCAAGAAGGAACTGGCGAACGGCAACGACGCCCTGCG pETmml.hk- 459 CAACCTCAAGAAGGAACTGGCGAACGGCAACGACGCCCTGCG PET~M.WS- 459 c A A c c T c A A G A~GWC G A A c~AICG A c G CGCT G cn
pETmmLhirt 588 GAGGACGCCCGTTCCCCGTTCTACTCGGCGCTGCGGAACACG pETmmt.hi5- 505 GA GG A C CCGTTCCCCGTTCTACTCGGCGCTGCGGAACACG p~hb~hir- 50s G A G G A c CCG~TC/FZTT/TTCTAC TCGGCRCTG~GGA-
~ETmm~lrlr- 6% GGCCGTCATCTAC TCGAAGCAC TTC TGGAGCGGCCAGGAC CTACTCGAAGCAC TTCTGGAGCGGCCAGGAC CTAC TCGAAGCACTTCTGGAGCGG~CAGGAC
GACAAGAGGAAGTACGGCGACCCGGACGCTTTCCGCC 781 CCGGACGC TTTCCGCC 63s CCGGA~~TTCCGCC68s
GGACCGGCCTGGTCGACATGTCGAGGGACAGGAACAT 627 GGACCGGCCTGGTCGACA TGTCGA G~ACCGOCCTGGTCGACATGT~SA
APPENDX 5 Comparison of the nucleotide sequences of pE~28mmthis' (S&* mobaraense), pET28mml.his- (Sh,.mobari~ense) and pETmbthis- (SLY, baldacci~constructs.