Comparative Assessment of Sugar and Malic Acid Composition in Cultivated and Wild Apples

Food Chemistry 172 (2015) 86–91

Contents lists available at ScienceDirect

Food Chemistry

journal homepage: www.elsevier.com/locate/foodchem

Comparative assessment of sugar and malic acid composition in cultivated and wild apples ⇑ Baiquan Ma a,d, Jie Chen b,c,d, Hongyu Zheng a,d, Ting Fang a,d, Collins Ogutu a,d, Shaohua Li a, Yuepeng Han a, , ⇑ Benhong Wu b,c, a Key Laboratory of Plant Germplasm Enhancement and Specialty Agriculture, Wuhan Botanical Garden of the Chinese Academy of Sciences, Wuhan 430074, PR China b Beijing Key Laboratory of Grape Sciences and Enology, Institute of Botany, Chinese Academy of Sciences, Beijing 100093, PR China c CAS Key Laboratory of Plant Resources, Institute of Botany, Chinese Academy of Sciences, Beijing 100093, PR China d Graduate University of Chinese Academy of Sciences, 19A Yuquanlu, Beijing 100049, PR China article info abstract

Article history: Soluble sugar and malic acid contents in mature fruits of 364 apple accessions were quantiﬁed using Received 3 May 2014 high-performance liquid chromatography (HPLC). Fructose and sucrose represented the major compo- Received in revised form 5 September 2014 nents of soluble sugars in cultivated fruits, whilst fructose and glucose were the major items of sugars Accepted 7 September 2014 in wild fruits. Wild fruits were signiﬁcantly more acidic than cultivated fruits, whilst the average concen- Available online 16 September 2014 tration of total sugars and sweetness index were quite similar between cultivated and wild fruits. Thus, our study suggests that fruit acidity rather than sweetness is likely to have undergone selection during Keywords: apple domestication. Additionally, malic acid content was positively correlated with glucose content Apple and negatively correlated with sucrose content. This suggests that selection of fruit acidity must have Sugars Organic acids an effect on the proportion of sugar components in apple fruits. Our study provides information that Sweetness could be helpful for future apple breeding. Ó 2014 Elsevier Ltd. All rights reserved.

1. Introduction of fruit tree breeding programs worldwide (Basha, Vasanthaiah, Kambiranda, Easwaran, & Queeley, 2012). Soluble sugars and organic acids are important components of Apple (Malus domestica Borkh.) is one of the most important fruit taste, and together with aromas, they have a strong impact fruit crops in temperate regions. To date, many apple cultivars on the overall organoleptic quality of fruits (Borsani et al., 2009). have been developed for various uses such as cooking, fresh eating, In fruits, soluble sugars are mainly composed of sucrose, fructose, and cider production. HPLC assessment of sugar and organic acid and glucose, whilst malic, citric, and tartaric acids are the primary composition has been conducted in many different fruits such as organic acids (Mahmood, Anwar, Abbas, Boyce, & Saari, 2012). Fruc- berries (Mikulic-Petkovsek, Schmitzer, Slatnar, Stampar, & tose, glucose, and sucrose differ signiﬁcantly in sweetness (Doty, Veberic, 2012), stone fruits (Bae et al., 2014), and apple (Wu 1976). Similarly, malic, citric, and tartaric acids are not equally et al., 2007). However, HPLC assessment of organic acid and sugar acidic. Therefore, fruit taste depends on the content and type of sol- composition has been so far conducted for a limited number of uble sugars and organic acids (Bordonaba & Terry, 2010). Moreover, varieties, and the results indicate that the sugar and organic acid organic acids also play an important role in fruit coloration by serv- accumulation in apple fruits has two distinct characteristics. One ing to stabilize anthocyanins, and extend the shelf life of fresh fruits is that apple fruits are rich in fructose, which accounts for and their processed products. It is thus clear that soluble sugars and 44–75% of the total sugars (Wu et al., 2007). Another is that malic organic acids are important indicators of fruit taste quality. The sol- acid is the dominant acid in apple fruits, accounting for up to 90% uble sugar and organic acid composition has become a major focus of the total organic acids (Wu et al., 2007; Zhang, Li, & Cheng, 2010). A more detailed knowledge of sugar and organic acid composition in apple cultivars is still needed because it will not ⇑ Corresponding authors at: Key Laboratory of Plant Germplasm Enhancement only beneﬁt the selection of apple genotypes suitable for different and Specialty Agriculture, Wuhan Botanical Garden of the Chinese Academy of kinds of utilisation, but it is also crucial for diabetics or people who Sciences, Wuhan 430074, PR China (Y. Han); Beijing Key Laboratory of Grape Sciences and Enology, Institute of Botany, Chinese Academy of Sciences, Beijing react sensitively to fruit acids. There is evidence to suggest that the 100093, PR China (B. Wu). cultivated apple was initially domesticated from Malus sieversii,a E-mail addresses: [email protected] (Y. Han), [email protected] (B. Wu). wild apple native to the Tian Shan Mountains of central Asia http://dx.doi.org/10.1016/j.foodchem.2014.09.032 0308-8146/Ó 2014 Elsevier Ltd. All rights reserved. B. Ma et al. / Food Chemistry 172 (2015) 86–91 87

(Dzhangaliev, 2003). Subsequently, hybridization and introgres- cored. Pulps were cut into small sections, immediately frozen in sion between cultivars and wild relatives have played an important liquid nitrogen, and then stored at 40 °C for sugar and acid mea- role in the evolution of domesticated apples and may continue to surement by high performance liquid chromatography (HPLC). be a factor in increasing the genetic diversity of domesticated apples (Cornille, Giraud, Smulders, Roldán-Ruiz, & Gladieux, 2.2. Measurement of sugars and malic acid 2014; Harris, Robinson, & Juniper, 2002). Wild Malus taxa are thus considered useful sources of genetic variation for apple breeding. The samples from each replicate were ground into powder in The use of these natural resources in breeding for fruit quality liquid nitrogen using an A11 basic Analytical mill (IKA, Germany). improvement requires a good understanding of their fruit quality One gram of power was extracted with 6 ml deionized water characteristics. However, little information is available concerning obtained from a Milli-Q Element water purification system the evaluation of fruit quality of wild Malus species. (Millipore, Bed ford, MA, USA). After centrifugation at 5000g China is the leading apple producer in the world, generating for 15 min, the supernatants were decanted, passed through a more than 34 million tons annually, which represents approxi- SEP-C18 cartridge (Supelclean ENVI C18 SPE), and filtered through mately half of the world apple production. In China, apples are a 0.45 lm Sep-Pak filter. grown for fresh consumption and juice processing. Recently, fruit The filtered supernatants were used to measure fructose, quality attributes such as taste, flavour and texture have gained glucose, sucrose and malic acid using a Dionex P680 HPLC system increasing attention in Chinese apple industry, and fruit quality (Dionex Corporation, CA, USA). Sugars were detected by a Shodex improvement is becoming an important part of the apple-breeding RI-101 refractive index detector with reference cell maintained at programme in China. Assessing fruit quality traits of apple germ- 40 °C. A Transgenomic CARB Sep Coregel 87C column (300 mm plasm including wild Malus species is an essential prerequisite to 7.8 mm i.d., 10 lm particle size) with a guard column cartridge a proper utilisation of apple germplasm in breeding programmes. (Transgenomic CARB Sep Coregel 87C cartridge) was used. The col- Thus, we recently initiated a programme to measure fruit quality umn was maintained at 85 °C with a Dionex TCC-100 thermostated traits in apple germplasm. In this study, we report on the assess- column compartment. Degassed, distilled, deionized water at a ment of soluble sugar and malic acid contents in mature fruits of flow rate of 0.6 ml/min was used as the mobile phase. The injection 364 apple accessions, including 321 cultivars worldwide and 43 volume was 10 lL. Malic acid was detected using a Dionex wild relatives. Sugars and organic acids are important components PDA-100 detector. The Inertsil ODS-3 column (250 mm 4.6 mm of fruit taste (Wu et al., 2007), and fruit taste is expected to be one i.d., 5 lm particle size) with a guard column cartridge (Sunchrom of the phenotypes selected by human during the domestication C18 cartridge) was used. The column was maintained at 40 °C. process (Cornille et al., 2014; Parker et al., 2010). Therefore, we Samples were eluted with 0.02 mol/L KH2PO4 solution with pH also compared the sugar and acid content between cultivated 2.4. The flow rate was 0.8 ml/min. Eluted compounds were and wild apples, and the artificial selection on fruit acidity and detected by UV absorbance at 210 nm. The Chromeleon chroma- sweetness during the process of apple domestication was dis- tography data system was used to integrate peak areas according cussed. Our study not only provides an organoleptic fruit database to external standard solution calibrations (reagents from Sigma of apple germplasm which is helpful for future apple breeding, but Chemical Co., Castle Hill, NSW, Australia). Sugar and acid concen- is also useful for understanding the anthropogenic selection during trations were expressed in mg/g fresh weight (FW). the domestication process of apple and other fruit trees. 2.3. Estimation of apple taste parameter

2. Materials and methods Total sugar content was indicated by the amount of three major sugars found in apple fruits, i.e., glucose, sucrose, and fructose. 2.1. Plant material Sweetness index for each apple accession was estimated according to a modified method as previously described by Keutgen and Three hundred and sixty-four apple accessions used in this Pawelzik (2007). Briefly, the contribution of each major sugar found study are grown at Xingcheng Institute of Pomology of the Chinese in apple fruits was calculated, considering that fructose and glucose Academy of Agricultural Sciences, Xingcheng, Liaoning, China. Of are 1.7 and 0.75 times sweeter than sucrose, respectively. As a the 364 accessions, 321 are cultivars, including 75 from China, 64 result, sweetness index = 0.75 [Glucose] + 1.0 [Sucrose] + 1.7 from United States, 33 from Japan, 22 from Russia, 12 from Canada, [fructose]. 11 from France, 10 from England, 5 from New Zealand, 3 from Bel- gium, 3 from Germany, 2 from North Korea, 1 from Australia, 1 2.4. Data analysis from Estonia, 1 from Holland, 1 from Italy, 1 from The Czech Republic, and 76 with uncertain origin. The remaining 43 are wild All statistical analyses were carried out using SPSS statistics relatives, including 6 Malus prunifolia,5Malus baccata,5Malus 17.0 (SPSS Inc., Chicago, Illinois). Correlations between experimen- robusta,4Malus hupehensis,4Malus toringoides,3Malus spectabilis, tal variables were calculated using Spearman’s rank correlations. 2 M. sieversii,2Malus ioensis,1Malus asiatica,1Malus kansuensis,1 Significant difference values were estimated using two-tailed tests. Malus manshurica,1Malus micromalus,1Malus zumi,1Malus Unless otherwise stated, significant differences were P < 0.05. The floribunda,1Malus sylvestris,1Malus angustifolia,1Malus sargentii, variation in the sugar and organic acid content was calculated 1 Malus sikkihensis,1Malus sieboldii, and 1 Malus xiaojinensis. using Origin 8.0 software (OriginLab Corp.). The dendrogram show- Approximately 5 g of young leaves were collected in the spring ing genetic relationships between wild and cultivated apples was season, and 200 mg was used for genomic DNA extraction. constructed using DARwin software 4.0 (http://darwin.cirad.fr/ Leaf samples were immediately frozen in liquid nitrogen, and darwin/Home.php). then stored at 75 °C until use. Fruits were randomly harvested in 2010 when most were considered to be mature based on back- 2.5. Genotyping of apple germplasm ground colour and blush development followed by a confirmation of the seed colour changing to brown, together with the previous A total of 17 SSR markers distributed across different linkage records of maturity date. Each accession had three replicates, con- groups of the apple genome were selected to screen apple sisting of 10 fruits. Fruit samples were mechanically peeled and germplasm (Table 1). The PCR reaction was performed using the 88 B. Ma et al. / Food Chemistry 172 (2015) 86–91 following cycling protocol: 5 min at 95 °C, followed by 35 cycles of malic acid content and its variation in this study. Like sucrose consisting of 94 °C for 30 s, 60 °C for 30 s, 72 °C for 30 s, and with and glucose contents, malic acid content showed a normal distri- a final extension of 72 °C for 10 min. A total of 5 lL of PCR products bution with skew to the right (Fig. 1). Malic acid content had a sig- were mixed with an equal volume of loading buffer (98% formam- nificant variability ranging from 0.53 to 22.74 mg/g, with an ide, 0.05% bromophenol blue, 0.05% xylene cyanol, and 10 mM average malic acid content of 4.83 mg/g. NaOH), denatured at 95 °C for 5 min, and then immediately chilled on ice. Denatured PCR products were resolved on 6% denaturing 3.2. Correlation between sugar and organic acid contents polyacrylamide gel for 1–1.5 h. Bands were visualised using silver staining, and their sizes were estimated using a 25 bp DNA ladder The Spearman correlation coefficients between sugar and standard (Promega, Madison, WI). organic acid traits are shown in Table 2. Malic acid content was positively correlated with glucose content (r = 0.43, P < 0.01), and negatively correlated with sucrose content (r = 0.39, P < 0.01). 3. Results and discussion However, malic acid content was weakly correlated with fructose content (r = 0.13, P < 0.05), total sugar content (r = 0.14, 3.1. Variation in sugar and organic acid composition amongst apple P < 0.05), and sweetness index (r = 0.15, P < 0.05). Our results germplasm are similar to previous findings that malic acid content is correlated with both glucose and sucrose contents, but no correlation between The distribution of sugar characteristics is shown in Fig. 1. Sev- malic acid content and soluble solid content (Etienne et al., 2002). eral characteristics presented a typical normal distribution, i.e., For sugars, the highest correlation was observed between glu- fructose content, total sugar content, and sweetness index. Sucrose cose and fructose contents (r = 0.65, P < 0.01). Similar correlation and glucose contents showed a normal distribution with skew to between glucose and fructose contents has also been reported in the right. Total sugar content ranged from 29.9 to 205.4 mg/g, with peach fruits (Dirlewanger et al., 1999). Glucose content was nega- an average of 92.7 mg/g (Fig. 1). The average concentrations of tively correlated with sucrose content (r = 0.28, P < 0.01). No sig- fructose, sucrose and glucose were 35.8, 40.1, and 16.8 mg/g, nificant correlation was detected between fructose and sucrose respectively. This indicates that fructose and sucrose are the major contents. Sucrose and fructose contents were significantly corre- components of apple soluble sugars, which is consistent with the lated with sweetness index, with Spearman correlation coefficients finding of a previous report (Hecke et al., 2006). However, other of 0.75 and 0.65, respectively. study has also reported that fructose and glucose are the major components of apple soluble sugars (Wu et al., 2007). This discrep- 3.3. Comparison of sugar and organic acid composition between wild ancy might be due to different genotypes used in the studies, and cultivated apples which can be inferred through a comparison of sugar composition between wild and cultivated fruits in this study. In cultivated The distributions of sugar characteristics in wild and cultivated fruits, the average concentrations of fructose (35.1 mg/g) and fruits are shown in Fig. 2. Wild fruits were significantly more acidic sucrose (44.1 mg/g) were 2–3 times higher than that of glucose than cultivated fruits, with an average malic acid content of over (14.0 mg/g). In wild fruits, however, the average contents of fruc- 2.2 times higher. Malic acid content ranged from 0.8 to 22.7 mg/g tose (41.2 mg/g) and glucose (37.1 mg/g) were over 3 times higher in wild fruits, and from 0.5 to 18.9 mg/g in cultivated fruits. This than that of sucrose (11.5 mg/g). These results clearly indicate that indicates that the variation in fruit acidity is wider in the wild sam- the major components of soluble sugars are different between cul- ple than in the cultivated sample. In contrast, the average concen- tivated and wild fruits. Moreover, 294 (81%) out of the 365 tested tration of the total sugars was slightly higher in cultivated fruits accessions had a fructose concentration of over 30 mg/g, which (93.1 mg/g) than in wild fruits (89.8 mg/g), but this difference confirms the previous report that apple fruits contain high level was not statistically significant (P = 0.55). The average sweetness of fructose (Bizjak, Mikulic-Petkovsek, Stampar, & Veberic, 2013; index (SI) was slightly higher in cultivated fruits (115.2) than in Wu et al., 2007; Zhu, Liu, Li, & Tian, 2013). wild fruits (109.5), but this difference did not reach significant Since malic acid is the principal acid in apple fruits (Wu et al., level (P = 0.31). However, the wild sample had higher variation in 2007; Zhang et al., 2010), we thus focused on the measurement both total sugar concentration and SI than the cultivated sample.

Table 1 SSR markers used for characterisation of apple germplasm.

SSR Chr. Motif Primer (50–30) Expected size (bp) Forward Reverse

Hi20b03 8 (ACA)7 AAACTGCAATCCACAACTGC GTTTAGTTGCTAATGGCGTGTCG 226

Hi08g06 10 (GAA)5 AATCGAACCAGCACAGGAAG GTTTAGATGGAGGTCGTGGTTACG 192

Hi08h03 4 (TTG)6 GCAATGGCGTTCTAGGATTC GGTGGTGAACCCTTAATTGG 153

CN868471 9 (TTC)6 TTCCTGTGAACCCAGTCCTC GATCGACAGGCAACATCCTT 281

BACSSR20 11 (GA)21 TGATACATGAAGTGTGCTTCCTC TGAGAGAACTGAATCGGGCT 229

BACSSR51 15 (TA)10 ACCAGCTGTTTCCAGTTTCC AAAGATTTATTGGCGGGCAT 134

CN893277 5 (AG)11 CACTGCAGGAACTGCAAAAA AGAAAGGGGTTGAATTTGGG 246

CN876284 17 (AGA)6 CAGCGAGGAGAAGGAAATTG GTTCCAGAACTTCACGCCAT 102

BACSSR58 3 (AT)10 ATGATCTGCATGGTGGTTCC GGCTTTGACTTCGTTTCAGC 245

CH05h05 13 (TC)19 ACATGTCACTCCTACGCGG GTGCAGTGATTAGCATTGCTGT 180

WBGCAS84 16 (AGG)6 CATGTTGTTTGGATATGGATATG TCTCACATCGGTTTCTCTGC 157

CTG1065993 10 (CT)16 AAGACGATCACCAACCAACC TGGTTGTTCTCTCCGCTTCT 102

CTG1064359 4 (GA)14 CTCGTATGCCCATCTTCCTC GGCACTGTTTCTTGTTGGGT 163

CTG1070917 9 (GCT)7 AAAAGTGGTAACGACGACGG GTGGTCACGGGAAGCAGTAT 177

CTG1063619 5 (CT)15 TTGCCAGATGATATTCCAACA TGTGGGTGGGTGTGTAGAGA 215

CTG1068442 8 (AG)23 TGTGGGGATGCCCTATAAAA TACTGATCCGCCATTCTTCC 254

AU223486 13 (GGA)6 TGACTCCATGGTTTCAGACG TGCTCAACTGCAGTCCAAAC 265 B. Ma et al. / Food Chemistry 172 (2015) 86–91 89

Fig. 1. Distribution of fruit taste parameters measured for mature fruits of apple germplasm.

Table 2 Spearman correlation coefﬁcients between sugar and organic acid contents.

Malic acid Sucrose Glucose Fructose Total sugar content Sweetness index Malic acid 1.000 Sucrose 0.390a 1.000 Glucose 0.434a 0.278a 1.000 Fructose 0.135b 0.019 0.646a 1.000 Total sugar content 0.143b 0.793a 0.324a 0.562a 1.000 Sweetness index 0.148b 0.754a 0.324a 0.649a 0.991a 1.000

a P < 0.01. b P < 0.05.

Fig. 2. Range and distribution of malic acid and soluble sugar contents (mg/g FW) and sweetness index in cultivated and wild fruits of apple. The horizontal lines in the interior of the box are the mean values. The box indicates the distribution for 50% of the data. Approximately 99% of the data fall inside the whiskers. The data outside these whiskers are indicated by solid stars. W, wild fruits; C, cultivated fruits.

Total sugar content ranged from 29.9 to 205.4 mg/g in the wild Likewise, SI ranged from 37.5 to 257.0 in the wild sample, and from sample, and from 46.0 to 184.9 mg/g in the cultivated sample. 60.2 to 215.7 mg/g in the cultivated sample. 90 B. Ma et al. / Food Chemistry 172 (2015) 86–91

It has been reported that the cultivated apple is expected to dis- and wild fruits. Glucose content ranged from 10.7 to 98.1 mg/g in play domestication syndrome traits such as larger fruits and higher the wild sample, and from 3.3 to 51.6 mg/g in the cultivated sugar content when compared to wild relatives (Cornille et al., sample. The average concentration of glucose was approximately 2014; Parker et al., 2010). In this study, we investigated the genetic three times lower in cultivated fruits (13.9 mg/g) than in wild relationship between cultivated and wild apples using a total of 17 fruits (37.1 mg/g). These results indicate that both the average SSR markers, and the result showed that the wild relatives were and variation of glucose content are significantly lower in the closely related to cultivars (Fig. 3). However, the mean values of cultivated sample than in the wild sample. Similarly, fructose con- both total sugar concentration and SI were similar between wild tent ranged from 15.1 to 100.4 mg/g in the wild sample, and from and cultivated fruits. This is not consistent with the hypothesis 10.8 to 58.5 mg/g in the cultivated sample. The average content of of artificial selection on sweetness during the process of fruit fructose was 41.2 mg/g in the wild sample, whilst 35.1 mg/g in the domestication (Parker et al., 2010). In contrast, malic acid content cultivated sample. Both the average and variation of fructose showed a significant difference between wild and cultivated fruits. content were lower in the cultivated sample than in the wild This difference cannot be attributed to an indirect effect of fruit sample. In contrast, sucrose content ranged from undetectable size selection because no significant difference in both total sugar level to 56.9 mg/g in the wild sample, and from 2.67 to concentration and SI was observed between wild and cultivated 139.8 mg/g in the cultivated sample. The average concentration fruits, and fruit size selection has little effect on sugar attributes of sucrose was approximately four times higher in the cultivated such as total sugar concentration and SI. Thus, our study clearly sample (44.1 mg/g) than in the wild sample (11.5 mg/g). Both the suggests that fruit acidity rather than sweetness is likely to have average and variation of sucrose content were significantly greater undergone selection during apple domestication. Of course, the in the cultivated sample than in the wild sample. In summary, the domestication syndrome traits are still understudied and poorly wild and cultivated apples showed significant difference in sugar known in fruit crops, and more studies are needed to address the composition. hypotheses concerning anthropogenic selection during the domes- As mentioned above, malic acid content was highly correlated tication process. with glucose and sucrose contents, and the wild and cultivated Unlike total sugar concentration and SI, the concentration of fruits showed a great difference in malic acid content. This sug- sugar components was significantly different between cultivated gests that selection of fruit acidity must have a great effect on

Fig. 3. A Neighbour-Joining dendrogram showing genetic relationships amongst 101 cultivars and 43 wild relatives of apple. Solid spots and solid triangle represent cultivars (black line) and wild relatives (red line), respectively. Apple accessions used for the construction of dendrogram are listed in Table S1. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.) B. Ma et al. / Food Chemistry 172 (2015) 86–91 91 the proportion of sugar components in apple fruits. Additionally, References the accumulation of malate is related to sugar metabolism (Borsani et al., 2009). Therefore, the difference in sugar composi- Bae, H., Yun, S. K., Jun, J. H., Yoon, I. K., Nam, E. Y., & Kwon, J. H. (2014). Assessment of organic acid and sugar composition in apricot, plumcot, plum, and peach tion between wild and cultivated fruits is likely the result of the during fruit development. Journal of Applied Botany and Food Quality, 87, 24–29. hitchhiking effect associated with artificial selection on fruit acid- Basha, S. M., Vasanthaiah, H. K., Kambiranda, D. M., Easwaran, K., & Queeley, G. ity during the process of apple domestication. (2012). Genetic variation in sugar composition among muscadine, Florida hybrid bunch and bunch grape genotypes. International Journal of Wine Research, 4, 15–23. 4. Conclusions Bizjak, J., Mikulic-Petkovsek, M., Stampar, F., & Veberic, R. (2013). Changes in primary metabolites and polyphenols in the peel of ‘‘Braeburn’’ apples (Malus domestica Borkh.) during advanced maturation. Journal of Agricultural and Food To our knowledge, this study represents the first report of a Chemistry, 61, 10283–10292. large-scale HPLC assessment of sugar and malic acid contents in Bordonaba, J. G., & Terry, L. A. (2010). Manipulating the taste-related composition of wild and cultivated apples. Our study indicates that apple fruits strawberry fruits (Fragaria ananassa) from different cultivars using deficit irrigation. Food Chemistry, 122(4), 1020–1026. are a good resource of fructose. In apple fruits, glucose content Borsani, J., Budde, C. O., Porrini, L., Lauxmann, M. A., Lombardo, V. A., Murray, R., was highly positively correlated with fructose content, but nega- et al. (2009). Carbon metabolism of peach fruit after harvest: Changes in tively correlated with sucrose content. Malic acid content was pos- enzymes involved in organic acid and sugar level modifications. Journal of itively correlated with glucose content and negatively correlated Experimental Botany, 60(6), 1823–1837. Cornille, A., Giraud, T., Smulders, M. J., Roldán-Ruiz, I., & Gladieux, P. (2014). The with sucrose content. Overall, wild fruits were significantly more domestication and evolutionary ecology of apples. Trends in Genetics, 30(2), acidic than cultivated fruits, and wild apples showed greater vari- 57–65. ation in sugar and malic acid contents than cultivated apples. This Dirlewanger, E., Moing, A., Rothan, C., Svanella, L., Pronier, V., Guye, A., et al. (1999). Mapping QTLs controlling fruit quality in peach (Prunus persica (L.) Batsch). indicates that wild Malus species are useful sources of genetic var- Theoretical and Applied Genetics, 98(1), 18–31. iation for apple breeding. Doty, T. E. (1976). Fructose sweetness: A new dimension. Cereal Foods World, 21, On the other hand, increasing evidence demonstrates introgres- 62–63. Dzhangaliev, A. D. (2003). The wild apple tree of Kazakhstan. Horticultural reviews. sion between cultivated apple and its wild relatives, but the history John Wiley & Sons, Inc., pp. 63–303. of apple domestication is still poorly understood. In this study, we Etienne, C., Rothan, C., Moing, A., Plomion, C., Bodénès, C., Svanella-Dumas, L., et al. have demonstrated a consequence of domestication: reduced fruit (2002). Candidate genes and QTLs for sugar and organic content in peach [Prunus persica (L.) Batsch]. Theoretical and Applied Genetics, 105(1), 145–159. acidity that is typically associated with domestication relative to Harris, S. A., Robinson, J. P., & Juniper, B. E. (2002). Genetic clues to the origin of the wild relatives. The average concentration of total soluble sugars apple. Trends in Genetics, 18(8), 426–430. and sweetness index were quite similar between cultivated and Hecke, K., Herbinger, K., Veberic, R., Trobec, M., Toplak, H., Stampar, F., et al. (2006). Sugar-, acid- and phenol contents in apple cultivars from organic and integrated wild fruits. However, a significant difference in malic acid concen- fruit cultivation. European Journal of Clinical Nutrition, 60, 1136–1140. tration was detected between cultivated and wild apple fruits. We Keutgen, A., & Pawelzik, E. (2007). Modifications of taste-relevant compounds in attribute this difference to the effect of human selection associated strawberry fruit under NaCl salinity. Food Chemistry, 105(4), 1487–1494. with the process of domestication. In addition, selection of malic Mahmood, T., Anwar, F., Abbas, M., Boyce, M. C., & Saari, N. (2012). Compositional variation in sugars and organic acids at different maturity stages in selected acid content has a strong impact on sugar composition in apple small fruits from Pakistan. International Journal of Molecular Sciences, 13, fruits, resulting in the difference in sugar composition between 1380–1392. wild and cultivated fruits. Mikulic-Petkovsek, M., Schmitzer, V., Slatnar, A., Stampar, F., & Veberic, R. (2012). Composition of sugars, organic acids, and total phenolics in 25 wild or cultivated berry species. Journal of Food Science, 77(10), C1064–C1070. Acknowledgements Parker, I. M., López, I., Petersen, J. J., Anaya, N., Cubilla-Rios, L., & Potter, D. (2010). Domestication Syndrome in Caimito (Chrysophyllum cainito L.): Fruit and Seed Characteristics. Economic Botany, 64(2), 161–175. This work was supported by the National Basic Research Wu, J., Gao, H., Zhao, L., Liao, X., Chen, F., Wang, Z., et al. (2007). Chemical Program of China (Grant No. 2011CB100600) and the National compositional characterization of some apple cultivars. Food Chemistry, 103(1), Natural Science Foundation of China (Grant Nos. 31420103914 88–93. Zhang, Y., Li, P., & Cheng, L. (2010). Developmental changes of carbohydrates, and 31372048). organic acids, amino acids, and phenolic compounds in ‘Honeycrisp’ apple flesh. Food Chemistry, 123(4), 1013–1018. Appendix A. Supplementary data Zhu, Z., Liu, R., Li, B., & Tian, S. (2013). Characterisation of genes encoding key enzymes involved in sugar metabolism of apple fruit in controlled atmosphere storage. Food Chemistry, 141(4), 3323–3328. Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.foodchem.2014. 09.032.