Page 1 of 39 Diabetes

Adipocyte XBP1s Promotes Adiponectin Multimerization and Systemic

Glucose Homeostasis

Haibo Sha,1 Liu Yang,2 Meilian Liu,3 Sheng Xia,1 Yong Liu,4 Feng Liu,3 Sander Kersten,1,5 and

Ling Qi1,2

From the 1Division of Nutritional Sciences, Cornell University, Ithaca, New York; the 2Graduate Program in Biochemistry, Molecular and Cell Biology, Cornell University, Ithaca, New York; the 3Department of Pharmacology, University of Texas Health Science Center at San Antonio, San Antonio, Texas; the 4Laboratory of Metabolic Regulation and Metabolic Diseases, Institute of Nutritional Sciences, Shanghai, China; the 5Nutrition, Metabolism, and Genomics group, Division of Human Nutrition, Wageningen University, Wageningen, The Netherlands.

S.X. is currently affiliated with the Department of Immunology, School of Medical Science and Laboratory Medicine, Jiangsu University, Zhenjiang, China.

Corresponding author: Ling Qi, [email protected].

Phone: (607) 2548857; FAX: (607) 2556249.

Running title: XBP1 IN ADIPOCYTES

Word account: abstract 148, main text 4,029

Number of figures: 7

1

Diabetes Publish Ahead of Print, published online November 15, 2013 Diabetes Page 2 of 39

ABSTRACT

The physiological role of the spliced form of Xboxbinding protein 1 (XBP1s), a key

transcription factor of the endoplasmic reticulum (ER) stress response, in adipose tissue remains

largely unknown. Here we show that overexpression of XBP1s promotes adiponectin

multimerization in adipocytes, thereby regulating systemic glucose homeostasis. Ectopic

expression of XBP1s in adipocytes improves glucose tolerance and insulin sensitivity in both

lean and obese (ob/ob) mice. The beneficial effect of adipocyte XBP1s on glucose homeostasis is

associated with elevated serum levels of HMW adiponectin and indeed, is adiponectin

dependent. Mechanistically, XBP1s promotes adiponectin multimerization rather than activating

its transcription likely through a direct regulation of the expression of several ERchaperones

involved in adiponectin maturation, including Grp78, Pdia6, ERp44 and DsbA-L. Thus, we conclude that XBP1s is an important regulator of adiponectin multimerization, which may lead to a new therapeutic approach for the treatment of type 2 diabetes and hypoadiponectinemia.

Keywords: obesity; adipocytes; endoplasmic reticulum; XBP1; protein folding; adiponectin; glucose homeostasis

2 Page 3 of 39 Diabetes

INTRODUCTION

Accumulation of misfolded proteins in the ER causes ER stress and leads to the activation

of unfolded protein response (UPR). ER stress has been shown to play an important role in

obesityinduced insulin resistance (1). Of the three branches of mammalian UPR, IRE1α and its

downstream target XBP1 are most highly conserved from yeast to humans (2,3). Upon ER stress,

IRE1α undergoes transautophosphorylation and activation, and subsequently splices 26

nucleotides from Xbp1 mRNA, leading to a frameshift and the generation of an active bZIP

transcription factor, XBP1s, which translocates to the nucleus and activates gene transcription.

As deficiency in either IRE1α or XBP1 are embryonic lethal, several recent studies have used

various tissuespecific gain and lossoffunction animal models to demonstrate that the IRE1α

XBP1s pathway plays an important role in metabolic regulation, particularly in the liver (49). Its

role in adipose tissue remains poorly characterized.

In vitro, we and others have shown that XBP1s is required (1012), but not sufficient (13)

for adipocyte differentiation, i.e. adipogenesis. In vivo, Xbp1+/- mice exhibit increased IRE1α

activation in adipose tissue upon obesity, which subsequently attenuates insulin signaling by

modulating the JNKIRS1 signaling axis (4). However, using an adipocytespecific XBP1

knockout mice, a recent study showed that loss of XBP1s in adipocytes has no profound effect

on inflammation and metabolic homeostasis, suggesting a possible compensatory mechanism for

the loss of XBP1s in adipocytes (11). To further characterize the role of XBP1s in adipose tissue,

we generated an adipocytespecific XBP1s gainoffunction mouse model, where we found a

surprising link between XBP1s and adiponectin folding and maturation.

Adiponectin is a key insulinsensitizing hormone and its serum level is negatively

correlated with obesity and insulin resistance (14). It circulates at extraordinarily high

3 Diabetes Page 4 of 39

concentrations primarily in three forms: trimer, hexamer and a highmolecular weight (HMW)

complex (1517). HMW adiponectin is thought to possess the most potent insulinsensitizing

activity among the three forms (18,19). Defects in adiponectin multimerization are associated

with hypoadiponectinemia and hyperglycemia (15). In humans, the causal link between

adiponectin and insulin sensitization is less clear (20), but correlation studies have shown that the

ratio of HMW to LMW adiponectin is correlated with insulin sensitivity and HMW adiponectin

may mediate the insulinsensitizing effects of thiazolidinedione in vivo (19,2123). Interestingly, nearly 50% of the newly synthesized adiponectin protein is retained in the ER and degraded by the proteasome (24,25), suggesting a critical role of ER homeostasis in its maturation. Indeed, the formation of HMW adiponectin requires complex posttranslational modifications as well as extensive chaperone activities in the ER (26), such as ERp44 (ER protein 44) (25), ERO1Lα

(endoplasmic oxidoreductin1like) (27) and DsbAL (disulfide bond oxidoreductase Alike protein) (28).

Here we demonstrate that overexpression of XBP1s in adipocytes improves systemic glucose homeostasis in vivo, which is associated with elevated levels of HMW adiponectin in both the circulation and white adipose tissue (WAT). Indeed, XBP1s directly regulates the

expression of a subset of ER chaperones including GRP78, PDIA6, ERp44 and DsbAL in

adipocytes, all of which are known to be involved in adiponectin multimerization. Thus,

although undoubtedly XBP1s regulates other signaling pathways in vivo, XBP1s may act as an

important regulator of adiponectin maturation in adipocytes.

4 Page 5 of 39 Diabetes

RESEARCH DESIGN AND METHODS

Mice. The XBP1s cDNA fragment with N terminal 3 x HA was ligated into the pWhereaP2p

vector, which contains a 5.4 kb aP2 promoter flanked by two H19 chromatin insulators to block

position effect at the integration sites on the chromosome (29). Linearized construct by Pac I was

used to generate transgenic mice on the C57BL/6J background by the Transgenic Animal

Facility at Cornell University. Adipoq-/- mice (stock # 0028195) and ob/+ mice (stock # 000632)

on the C57BL/6J background were purchased from the Jackson Laboratory. TG-ob mice and

WT-ob littermates were generated by initially breeding ob/+ with TG mice, and then TG;ob/+ to

WT;ob/+. TG-Adipoq-/- mice were generated by three generational crosses: initially Adipoq-/-

with TG, then TG;Adipoq+/- with WT;Adipoq+/-, finally TG;Adipoq-/- with WT;Adipoq-/-. Lowfat

diet (LFD) consisted of 13% fat, 67% carbohydrate and 20% protein (Teklad 2914) was used

throughout this study. All animal procedures were approved by the Cornell IACUC (#2007

0051).

RNA extraction, RT-PCR, qPCR and Microarray. RNA extraction from WAT, RTPCR and

qPCR were carried out as described (10). Primer sequences are listed in Supplementary Table 2.

Microarray and data analysis were performed as described (30). The microarray dataset has been

submitted to the National Center for Biotechnology Information’s Gene Expression Omnibus

(GSE36033).

Primary adipocytes, SVC and macrophages separation. Primary adipocytes and stromal

vascular cells (SVC) were isolated from WAT as previously described (30). Adiposeresident

primary macrophages were purified from SVC after incubating with antiCD11bbiotin and

5 Diabetes Page 6 of 39

streptavidin magnetic beads using EasySep Magnet (Stem Cell Technologies). Isolated cells

were resuspended in appropriate buffer for RNA or protein analysis and the purity was

confirmed by flow cytometry.

Protein lysates, immunoprecipitation and Western blot. Protein lysate, cytosol and nuclear protein extraction, immunoprecipitation, and Western blots were carried out as described

(10,30). 600 g of total protein, 540 g of cytosol protein and 120 g of nuclear protein from

WAT of TG and TGob mice were subjected to immunoprecipitation with HA agarose. Eluted protein samples were analyzed by Western blot for HAXBP1s using antiXBP1 antibody (Santa

Cruz). IRE1α phosphorylation was measured by the Phostag method as we recently described

(10,31,32). Antibodies used in this study were listed in Supplementary Table 1. Quantitation of

Western blots was performed using the ImageLab software on the ChemiDOC XRS+ system

(BioRad).

Transmission electron microscopy (TEM). Epididymal fat was fixed with 4% formaldehyde,

2.5% glutaraldehyde, 0.02% picric acid in 100 mM sodium cacodylate buffer for 3 h at room temperature. After washing with 100 mM sodium cacodylate buffer, tissues were treated for 1h with 1% osmium tetroxide and 1.5% potassium ferrocyanide, and then 1 h with 1.5% aqueous uranyl acetate. The rest steps were performed by Cornell Electron Microscopy and Histology and

Optical Microscopy Core Facilities at Weill Cornell Medical College. Briefly, after dehydration in ethanol, tissues were treated through acetonitrile and then embedded in EMbed812 resin

(Electron Microscopy Sciences). Ultrathin sections were collected on EM grids, contrasted with lead citrate, and observed by using a JEOL 100 CXII transmission electron microscope at an

6 Page 7 of 39 Diabetes

operating voltage of 80 kV. Digital images were captured using a Veleta cooled CCD (SIS

Olympus).

Adipose tissue histology. Epididymal fat was fixed in 10% formaldehyde, embedded in paraffin,

sectioned by Cornell Histology Core Facility. Hematoxylineosin stained pictures were taken

using the Axiovert 200M microscope (Zeiss). Crosssectional area of each adipocyte in each

field was measured using image analysis software NISElements D (Nikon).

Metabolic phenotyping. For glucose tolerance test (GTT), mice were injected i.p. with 12 g

glucose/kg BW following an overnight fast; for insulin tolerance test (ITT), mice were injected

i.p. with 14 U insulin/kg BW following a 4 h fast. Blood glucose levels were measured using

OneTouch glucometer before injection and at 15, 30, 60, 90, 120 min post injection. Serum

hormone levels were measured using BioPlex Pro Diabetes 10Plex Assay and BioPlex

MAGPIX Multiplex Reader (BioRad) per manufacture’s protocol. Serum adiponectin and leptin

levels were measured using ELISA kits from Millipore and Crystal Chem, respectively, per

supplier’s protocol. Daily food intake was measured continuously for 6 days with mice

individually housed and rested for 1 day.

Assays of adiponectin complexes. Sucrose sedimentation was carried out as described in (15).

10 l of serum or 400 l of culture medium was loaded on 520% sucrose gradient in a total of 2

ml, which was spun at 55,000 rpm for 4 h at 4°C. Fourteen gradient fractions were sequentially

retrieved from the top of the gradient and analyzed by Western blot. Gel filtration separation of

adiponectin complexes in serum was carried out using a Superdex 200 10/30 column (GE

7 Diabetes Page 8 of 39

Healthcare BioSciences) as previously described (28). Fractions (200 l each) were collected

and analyzed by Western blot for adiponectin.

Chromatin immunoprecipitation (ChIP). ChIP assay was conducted as previously described

with some modifications (10). Briefly, minced epididymal fat was crosslinked by 1%

formaldehyde and stopped by the addition of glycine to a final concentration of 0.125 M. Fat

tissue was homogenized in buffer containing 25 mM HEPES, 1.5 mM MgCl2, 10 mM KCl, 0.5%

NP40, 1 mM DTT and protease inhibitors (Sigma). Nuclei collected by centrifugation was

resuspended in 50 mM HEPES, 140 mM NaCl, 1 mM EDTA, 1% Triton X100, 0.1% DOC,

0.1% SDS, and protease inhibitors. Samples were sonicated, precleared with protein A agarose

(Invitrogen), and incubated with 2 g of IgG (Santa Cruz) or XBP1 antibody (Santa Cruz sc

7160x). 50 l of a 30% salmonspermDNAsaturated protein A agarose (Invitrogen) was added

to recover immune complexes for 2 h. Immunoprecipitates were washed and eluted. Crosslinks

were reversed and samples were incubated in 0.5 mM EDTA, 1 mM Tris (pH 6.5), and 10 g/ml proteinase K (Invitrogen) at 45°C for 1 h. Samples were purified using PCR Purification Kit

(QIAGEN), and assayed by qPCR. Primer sequences are in Supplementary Table 2.

In vitro 3T3-L1 adipocyte assays. 3T3L1 preadipocytes were maintained in DMEM

supplemented with 10% FBS (HyClone) and 1% penicillin/streptomycin and differentiated as previously described (10). Plasmids encoding XBP1s (10) or siRNA sequences for XBP1 (10)

and DsbAL (28) were introduced into fullydifferentiated 3T3L1 adipocytes (day 7) by

electroporation based on a standard protocol (33). Briefly, mature adipocytes were trypsinized

and resuspended in DPBS. 5 x 106 cells were transfected with 100200 g plasmid expressing

8 Page 9 of 39 Diabetes

EGFP or XBP1s via electroporation. Cells were plated into collagenI coated 6well plate

(FISHER) and incubated at 37°C in complete media for 16 h. After two washes with PBS, fresh

DMEM with 0.5% BSA was added to the cell. Two hours later, medium was harvested for

adiponectin complex analysis using sucrose gradient sedimentation and cells were snap frozen

for qPCR or Western blot.

Luciferase reporter assay. Luciferase assays were performed as previously described (10).

Promoters were cloned into the pGL3 vector (Promega) from mouse genomic DNA using Pfu

polymerase (Clontech). The length of the promoter was decided based on the position of putative

XBP1s binding site ACGT: pGL3DsbA-Lpluc (300~+1); pGL3Erdj4pluc (200~+35);

pGL3Pdia6pluc (122~+35). +1 is the transcription start site.

Statistical Analysis. Comparisons between groups were made using Student’s t test. p < 0.05

was considered as statistically significant. Regression analysis was performed using Graphpad

Prism software.

RESULTS

Generation of fat-specific XBP1s transgenic mice. Both total Xbp1 and Xbp1s transcripts

were significantly reduced in WAT of ob/ob mice compared to those in lean controls (Fig. 1A);

9 Diabetes Page 10 of 39

this reduction was specific to adipocytes and was not observed in adiposederived stromal

vascular cells (SVC) (Fig. 1B). As a positive control, a key inflammatory gene Tnfa encoding

TNFα was increased in both adipocytes and SVC of WAT with obesity (Fig. 1A-B). Similar data was obtained in the dietinduced obese model (Fig. 1C). Multiple attempts to detect protein levels of XBP1s in adipose tissues of lean or obese animals have failed, even with nuclear fractionation, in line with the notion that XBP1s is highly unstable (34).

To further understand the role of XBP1s in adipose tissue, we generated adipocytespecific

XBP1s transgenic mice by placing the XBP1s coding sequence under the control of an adipose specific aP2/FABP4 promoter and flanked by the H19 chromatin insulators (Fig. 1D). We showed earlier that this targeting system with aP2 promoter effectively targets transgene expression in adipocytes with very little, if any, expression in macrophages ((29) and also see below Fig. 4B). Two transgenic lines were established with 9 and 3fold more Xbp1s mRNA in

WAT than WT littermates (Fig. 1E and F), termed TG and TGm (moderate expression), respectively. The tissuespecific expression was confirmed using RTPCR with primers specific for the transgene (Fig. 1G). XBP1s protein level remained very low in the WAT of TG mice, requiring immunoprecipitation to detect the protein (Fig. 1H). Pointing to the specificity of the transgene, known XBP1s target genes including Erdj4, P58ipk and Edem were upregulated in

WAT of TG mice, but not Chop, a target of another UPR branch PERK (Fig. 1I). Overexpression of XBP1s had no effect on IRE1α phosphorylation (Fig. 1J), suggesting that XBP1s overexpression does not affect ER homeostasis in adipocytes. This was further confirmed by

TEM analysis of epididymal adipocytes where ER morphology seemed comparable between TG and WT mice (Fig. 1K).

10 Page 11 of 39 Diabetes

Improved systemic glucose homeostasis in TG mice. Mice fed a LFD grew normally and at the

age of 16 weeks, two male cohorts exhibited no differences in body and epididymal WAT

weights (Fig. 2A and B) with comparable adipocyte cell size (Fig. 2C). TG mice demonstrated

improved systemic glucose tolerance and insulin sensitivity (Fig. 2D and 2F) while TGm mice

with much lower XBP1s expression didn’t exhibit elevated expression of known XBP1s target

genes nor significant improvement of glucose tolerance (Supplementary Fig. 1). Indeed, linear

regression analysis suggested significant positive correlation of Xbp1s expression levels with

glucose tolerance (Fig. 2E). This was further confirmed by analysis of insulinstimulated AKT

phosphorylation at serine 473, which was significantly enhanced in both the liver and WAT of

TG mice, and to a less extent in skeletal muscle (Fig. 2G-I). These metabolic changes were

uncoupled from pancreatic and gut hormones as serum levels of insulin, glucagon, ghrelin,

gastric inhibitory polypeptide (GIP) and glucagonlike peptide 1 (GLP1) were comparable

between the WT and TG littermates (Fig. 2J). Taken together, we conclude that adipocyte

specific XBP1s overexpression improves systemic glucose homeostasis and insulin sensitivity.

Increased circulating HMW adiponectin in TG mice. We reasoned that the systemic

beneficial effect of adipocyte XBP1s is likely due to altered endocrine function of adipocytes.

While leptin, resistin and plasminogen activator inhibitor1 (PAI1) showed no significant

changes (Fig. 3A), circulating adiponectin levels was significantly increased by nearly 50% in

TG mice (Fig. 3B). This increase was not due to the transcriptional upregulation of adiponectin

(Adipoq) mRNA (Fig. 3C). In line with this observation, overexpression of XBP1s in fully

differentiated 3T3L1 adipocytes didn’t increase Adipoq mRNA level (Fig. 3D), suggesting that

Adipoq is not a direct transcriptional target of XBP1s.

11 Diabetes Page 12 of 39

In serum, adiponectin exists in different forms with the HMW form being the most potent in insulin sensitization (14). We next determined the effect of XBP1s on the adiponectin complex using several complementary approaches including nonreducing SDSPAGE, gel filtration chromatography, and sucrosegradientbased velocity sedimentation followed by non reducing SDSPAGE. Indeed, all three methods consistently revealed that HMW form of adiponectin was significantly elevated by nearly 100% in the serum of TG mice (Fig. 3E-G). The increase in serum HMW adiponectin form was correlated with the elevation in HMW form of intracellular adiponectin in WAT of TG mice (Fig. 3H).

To further test the relationship between XBP1s and adiponectin, we analyzed adiponectin complex in XBP1sexpressing 3T3L1 adipocytes. In line with the in vivo observations, acute expression of XBP1s increased HMW complex in the culture medium by over 50%

(Supplementary Fig. 2A). XBP1s had no effect on adipocyte differentiation as judged by oil Red

O staining (not shown) and measured by the mRNA level of an adipocyte marker aP2

(Supplementary Fig. 2B). Taken together, these results suggest that ectopic expression XBP1s in adipocytes increases the formation of HMW adiponectin in lean mice.

Improved glucose homeostasis and increased circulating HMW adiponectin in TG obese mice. To further study the role of adipocyte XBP1s in an obese model, we crossed TG mice onto the leptindeficient background to generate adipocytespecific XBP1s transgenic ob/ob mice

(hereafter “TGob”) and their wildtype ob/ob littermates (hereafter “WTob”). Intriguingly, despite similar total protein levels, the amount of HAXBP1s in the nuclear fraction was greatly reduced in the WAT of TGob mice compared to that of lean TG mice, indicating an impairment of nuclear translocation of XBP1s in WAT of obese mice (Fig. 4A). This observation is

12 Page 13 of 39 Diabetes

reminiscent of a previous report showing that nuclear translocation of XBP1s is reduced in the

liver of obese mice (35).

Overexpression of XBP1s in TGob mice significantly increased the expression of its target

genes (Erdj4, P58ipk and Edem) specifically in adipocytes, but not in SVC or purified adipose

resident CD11b+ macrophages (Fig. 4B), further confirming that the transgene expression is

largely limited to adipocytes in WAT. At the age of 9 to 12 weeks, TGob mice had a similar

body weight to the WTob littermates, but exhibited improved glucose tolerance and insulin

sensitivity (Fig. 4C-F). Adipoq mRNA level was increased in WAT of TGob compared to WT

ob mice, but remained 50% lower than that in WT lean mice (Fig. 4G). Serum levels of HMW

adiponectin were increased by nearly 50% in the serum of TGob compared to WTob mice,

reaching a level similar to that of WT lean animals (Fig. 4H).

An earlier study showed that adiponectintransgenic ob/ob mice gain more weight than

ob/ob littermates (36). Consistently, both male and female TGob mice became more obese than

WTob littermates starting at 20 weeks of age, gaining an average of 15% more body weight

(Fig. 4I-J). Some even reached 90100 g in body weight. This difference in body weight was not

due to food intake (Fig. 4K). Taken together, we conclude that adipocytespecific XBP1s

increases circulating HMW adiponectin in ob/ob mice.

Adipocyte XBP1s promotes glucose homeostasis via adiponectin. To provide direct evidence

for the role of adiponectin in XBP1s effect in vivo, we crossed TG mice with adiponectin

deficient (Adipq-/-) mice to generate TG-Adipq-/- and WT-Adipq-/- littermates (Fig. 5A). The body

weights of WTAdipoq-/- and TGAdipoq-/- mice on LFD were comparable at the age of 14 weeks

(Fig. 5B). Strikingly, loss of adiponectin abolished the insulin sensitizing effect of adipocyte

13 Diabetes Page 14 of 39

XBP1s (Fig. 5C). Thus, the effect of adipocyte XBP1s on systemic glucose homeostasis is mediated by adiponectin.

Global transcriptional profiling of XBP1s targets in adipocytes. We next performed non biased Affymetrix analyses of global gene expression in the WAT. Out of over 21,000 genes, approximately 125 genes were significantly upregulated over 1.5 fold (p < 0.01) in WAT of TG vs. WT littermates. The Ingenuity Pathway Analysis revealed that two major categories of pathways were significantly upregulated, “response to unfolded protein” and “lipid metabolism”

(Fig. 6A). Several genes involved in the ER folding process were modestly but significantly increased, including wellknown ER chaperones and folding enzymes Erdj4 (ERlocalized DnaJ homolog 4), Pdia6 (protein disulfide isomerase family A, member 6), P58ipk/Dnajc3 (DnaJ homolog subfamily C, member 3) and Grp78/Hspa5 (glucoseregulated protein 78kDa) (Fig.

6B). In contrast, genes associated with the PERK pathway (Chop and Ero1l) were not altered.

Thus, these data demonstrate that XBP1s regulates the expression of a subset of ER chaperones in adipocytes.

XBP1s-mediated regulation of the expression of ER chaperones involved in adiponectin maturation. Intriguingly, among the top genes identified by microarray analysis included a list of genes known to be involved in adiponectin maturation in the ER (26), such as Grp78, Pdia6,

ERp44 and DsbA-L. Although XBP1s is known to control the transcription of Grp78 and Pdia6 in cultured cell lines (37), it was unknown whether these genes are bona fide targets of XBP1s in adipocytes. Indeed, qPCR and Western blot analyses confirmed that these chaperones were upregulated both at mRNA and protein levels in WAT of TG mice (Fig. 7A and B). Similar

14 Page 15 of 39 Diabetes

observation was made in TGob mice (Fig. 7C). The upregulation of these chaperones were

limited in the adipocytes but not in SVC or adiposeresident CD11b+ macrophages of TGob

mice (Fig. 7D). Linear regression analyses showed the positive association of Xbp1s level with

the expression levels of Grp78, Pdia6, ERp44 and DsbA-L in WAT (Fig. 7E). In vitro, acute

expression of XBP1s in 3T3L1 adipocytes also increased the expression of these chaperones

(Supplementary Fig. 2C and D). Moreover, XBP1s was detected at the proximal promoters of

Grp78, Pdia6 and ERp44 genes in WAT of TG mice (Fig. 7F), and activated reporter luciferase

driven by the proximal promoters of Pdia6, ERp44, and DsbA-L genes in HEK 293T cells (Fig.

7G). Lastly, as a proofofprinciple, reduction of DsbAL using siRNA attenuated the proportion

of HMW adiponectin in XBP1sexpressing 3T3L1 adipocytes (Supplementary Fig. 3),

suggesting that XBP1s effect on HMW adiponectin is mediated in part through the chaperones.

Taken together, our data demonstrate that XBP1s directly regulates the expression of Grp78,

Pdia6, ERp44, and DsbA-L, which are involved in adiponectin maturation in the ER.

DISCUSSION

Defects in the folding and secretion of HMW adiponectin are associated with

hypoadiponectinemia and insulin resistance in humans (14). Extensive efforts are currently being

made to elevate adiponectin levels to treat various human diseases (14,38). Our data demonstrate

that XBP1s may act as an important regulator of adiponectin maturation into HMW complexes.

This is the first study linking XBP1s to adiponectin maturation (Fig. 7H). Our conclusions are

15 Diabetes Page 16 of 39

further supported by the phenotypes of adiponectin gainoffunction mouse models, in which

hypoglycemia and insulinsensitizing effects have been reported in several lean and obese

models (24,36,3942).

XBP1s, a potent transcription factor, is involved in diverse cellular functions and processes.

It has been implicated in the ER expansion in differentiating plasma cells (43,44) and the pancreas and salivary glands (45), gluconeogenesis and lipogenesis in hepatocytes (57,46), adipogenesis (1012), inflammation in macrophages (47) and Paneth cells (48), and control of autophagy in the nervous system (49). Our data further highlights an important role of XBP1s in adiponectin complex formation in adipocytes. In addition, as shown in Fig. 6A, XBP1s in adipocytes may have additional roles in energy metabolism, such as lipid metabolism and brown fat cell differentiation, all of which are interesting future directions and require further investigations.

It is important to note that in WAT of our transgenic animals, ER homeostasis is not affected as judged by IRE1α phosphorylation and ER morphology. Additionally, the PERK pathway as measured by downstream target genes including Chop and Ero1l is not activated in

TG mice. Thus, the conclusions from this study cannot be extrapolated to interpret situations under ER stress condition. Indeed, druginduced ER stress activation reduces the secretion of all forms of adiponectin (50), largely due to the translational suppression by the PERK pathway.

A recent study showed that adipocytespecific XBP1deficient mice exhibit no obvious metabolic phenotypes under either low or highfat diets (11). Total adiponectin levels in the serum are not changed but whether HMW adiponectin are altered in vivo remains unclear (11).

The lack of dramatic phenotype in adipocytespecific XBP1 knockout mice is surprising, given the dramatic phenotypes of XBP1 heterozygotic mice (4) as well as XBP1 deficient mice in other

16 Page 17 of 39 Diabetes

tissues or cell types such as B cells, hepatocytes, macrophages and neurons (4547,49,51). This

points to a celltypespecific requirement of XBP1s. Nonetheless, this does not mean that XBP1s

or the IRE1αXBP1s pathway of the UPR plays no metabolic function in adipocyte or

adiponectin biology, rather we would argue that the loss of XBP1 in adipocytes may be well

tolerated in vivo likely due to the activation of other UPR branches or autophagy (49). Indeed,

knockdown of XBP1 by 90% had no effect on chaperone gene expression and the proportion of

secreted HMW adiponectin in differentiated 3T3L1 adipocytes (Supplementary Fig. 4). In

contrast to the adipocytespecific XBP1 knockout mice or cells, our gainoffunction mouse and

cell models show that XBP1s is sufficient to promote adiponectin multimerization, leading to

improved systemic glucose and insulin homeostasis in both lean and genetically obese animals.

Our gainoffunction models are not contrived as XBP1 levels, both mRNA and protein, are

highly responsive to hormones, cytokines and ER stress (3,9,34,43,5153). Hence, similar to

several recent gainoffunction studies of XBP1s (5,8,35), our data may provide key insights into

the pathophysiological role of XBP1 in mature adipocytes and as a drug target of small

molecules in metabolic syndromes.

Speculatively, we propose that the effect of adipocyte XBP1s on adiponectin may be

mediated collectively by changing the overall ER homeostasis and folding capacity. “ER

proteostasis” in adipocytes may be important for adiponectin folding and thereby, systemic

insulin sensitivity. Targeting “ER capacity” in adipocytes as a whole, a.k.a. “proteostasis” (54) in

adipocytes may be a viable means to increase circulating adiponectin in human patients with

hypoadiponectinemia and type 2 diabetes. Indeed, collapse of proteostasis is considered as a

major pathophysiological paradigm that has recently emerged in cystic fibrosis,

neurodegeneration and aging (54). As several compounds that can enhance proteostasis, i.e.

17 Diabetes Page 18 of 39

proteostasis regulators (PRs) have entered preclinical trials (54), understanding the physiological and pathological role of proteostasis in adipocytes will likely broaden our

knowledge on the pathologies of metabolic syndrome and shed light on drug design for disease

intervention.

ACKNOWLEDGMENTS

H.S. was a recipient of Genomics Scholarship from the Center for Vertebrate Genomics (CVG),

Cornell University. L.Q. is a recipient of the ADA Junior Faculty and Career Development

Awards. This study is supported by NIH R01DK08852, ADA 07JF48 and 112CD04, and a

seed grant from CVG (to L.Q.), R01DK76902 (to F.L.) and Netherlands Nutrigenomics Centre

(to S.K.).

No potential conflicts of interest relevant to this article.

H.S. and L.Q. designed the study and wrote the manuscript. H.S., L.Y., S.X., M.L., F.L., and S.K. researched data. Y.L. contributed to discussion. L.Q. is the guarantor of this work and, as such, had full access to all the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis.

The authors thank members of the Qi laboratory for helpful discussion and assistance, the

Cornell Transgenic, Histology, and Electron Microscopy Core Facilities for their assistance in processing samples.

18 Page 19 of 39 Diabetes

REFERENCES

1. Hotamisligil G. Endoplasmic reticulum stress and the inflammatory basis of metabolic disease. Cell 2010;140:900917 2. Walter P, Ron D. The unfolded protein response: from stress pathway to homeostatic regulation. Science 2011;334:10811086 3. Hetz C, Martinon F, Rodriguez D, Glimcher LH. The unfolded protein response: integrating stress signals through the stress sensor IRE1alpha. Physiol Rev 2011;91:12191243 4. Ozcan U, Cao Q, Yilmaz E, et al. Endoplasmic reticulum stress links obesity, insulin action, and type 2 diabetes. Science 2004;306:457461 5. Zhou Y, Lee J, Reno CM, et al. Regulation of glucose homeostasis through a XBP1FoxO1 interaction. Nat Med 2011;17:356365 6. So JS, Hur KY, Tarrio M, et al. Silencing of Lipid Metabolism Genes through IRE1alpha Mediated mRNA Decay Lowers Plasma Lipids in Mice. Cell Metab 2012;16:487499 7. Wang S, Chen Z, Lam V, et al. IRE1alphaXBP1s induces PDI expression to increase MTP activity for hepatic VLDL assembly and lipid homeostasis. Cell Metab 2012;16:473486 8. Deng Y, Wang ZV, Tao C, et al. The Xbp1s/GalE axis links ER stress to postprandial hepatic metabolism. J Clin Invest 2013;123:455468 9. Sha H, He Y, Yang L, Qi L. Stressed out about obesity: IRE1alphaXBP1 in metabolic disorders. Trends Endocrinol Metab 2011;22:374381 10. Sha H, He Y, Chen H, et al. The IRE1alphaXBP1 pathway of the unfolded protein response is required for adipogenesis. Cell Metab. 2009;9:556564 11. Gregor MF, Misch ES, Yang L, et al. The Role of Adipocyte XBP1 in Metabolic Regulation during Lactation. Cell Rep 2013; 12. Cho YM, Kim DH, Kwak SN, Jeong SW, Kwon OJ. Xbox binding protein 1 enhances adipogenic differentiation of 3T3L1 cells through the downregulation of Wnt10b expression. FEBS Lett 2013;587:16441649 13. Han J, Murthy R, Wood B, et al. ER stress signalling through eIF2alpha and CHOP, but not IRE1alpha, attenuates adipogenesis in mice. Diabetologia 2013;56:911924 14. Turer AT, Scherer PE. Adiponectin: mechanistic insights and clinical implications. Diabetologia 2012;55:23192326 15. Pajvani UB, Du X, Combs TP, et al. Structurefunction studies of the adipocytesecreted hormone Acrp30/adiponectin. Implications for metabolic regulation and bioactivity. J Biol Chem 2003;278:90739085 16. Tsao TS, Murrey HE, Hug C, Lee DH, Lodish HF. Oligomerization statedependent activation of NFkappa B signaling pathway by adipocyte complementrelated protein of 30 kDa (Acrp30). J Biol Chem 2002;277:2935929362 17. Waki H, Yamauchi T, Kamon J, et al. Impaired multimerization of human adiponectin mutants associated with diabetes. Molecular structure and multimer formation of adiponectin. J. Biol. Chem. 2003;278:4035240363 18. Fisher FF, Trujillo ME, Hanif W, et al. Serum high molecular weight complex of adiponectin correlates better with glucose tolerance than total serum adiponectin in IndoAsian males. Diabetologia 2005;48:10841087 19. Pajvani UB, Hawkins M, Combs TP, et al. Complex distribution, not absolute amount of adiponectin, correlates with thiazolidinedionemediated improvement in insulin sensitivity. J Biol Chem 2004;279:1215212162

19 Diabetes Page 20 of 39

20. Ye R, Scherer PE. Adiponectin, driver or passenger on the road to insulin sensitivity? Mol Metab 2013;2:133141 21. Tonelli J, Li W, Kishore P, et al. Mechanisms of early insulinsensitizing effects of thiazolidinediones in type 2 diabetes. Diabetes 2004;53:16211629 22. Basu R, Pajvani UB, Rizza RA, Scherer PE. Selective downregulation of the high molecular weight form of adiponectin in hyperinsulinemia and in type 2 diabetes: differential regulation from nondiabetic subjects. Diabetes 2007;56:21742177 23. Aso Y, Yamamoto R, Wakabayashi S, et al. Comparison of serum highmolecular weight (HMW) adiponectin with total adiponectin concentrations in type 2 diabetic patients with coronary artery disease using a novel enzymelinked immunosorbent assay to detect HMW adiponectin. Diabetes 2006;55:19541960 24. Combs TP, Pajvani UB, Berg AH, et al. A transgenic mouse with a deletion in the collagenous domain of adiponectin displays elevated circulating adiponectin and improved insulin sensitivity. Endocrinology 2004;145:367383 25. Wang ZV, Schraw TD, Kim JY, et al. Secretion of the adipocytespecific secretory protein adiponectin critically depends on thiolmediated protein retention. Mol Cell Biol 2007;27:3716 3731 26. Wang ZV, Scherer PE. DsbAL is a versatile player in adiponectin secretion. Proc Natl Acad Sci U S A 2008;105:1807718078 27. Qiang L, Wang H, Farmer SR. Adiponectin secretion is regulated by SIRT1 and the endoplasmic reticulum oxidoreductase Ero1L alpha. Mol. Cell. Biol. 2007;27:46984707 28. Liu M, Zhou L, Xu A, et al. A disulfidebond A oxidoreductaselike protein (DsbAL) regulates adiponectin multimerization. Proc Natl Acad Sci U S A 2008;105:1830218307 29. Qi L, Saberi M, Zmuda E, et al. Adipocyte CREB promotes insulin resistance in obesity. Cell Metab. 2009;9:277286 30. Sun S, Xia S, Ji Y, Kersten S, Qi L. The ATPP2X7 Signaling Axis Is Dispensable for ObesityAssociated Inflammasome Activation in Adipose Tissue. Diabetes 2012;61:14711478 31. Yang L, Xue Z, He Y, et al. A Phostagbased method reveals the extent of physiological endoplasmic reticulum stress. PLos ONE 2010;5:e11621 32. Qi L, Yang L, Chen H. Detecting and quantitating physiological endoplasmic reticulum stress. Meth Enzymol 2011;490:137146 33. Okada S, Mori M, Pessin JE. Introduction of DNA into 3T3L1 adipocytes by electroporation. Methods Mol Med 2003;83:9396 34. Calfon M, Zeng H, Urano F, et al. IRE1 couples endoplasmic reticulum load to secretory capacity by processing the XBP1 mRNA. Nature 2002;415:9296 35. Park SW, Zhou Y, Lee J, et al. The regulatory subunits of PI3K, p85alpha and p85beta, interact with XBP1 and increase its nuclear translocation. Nat Med 2010;16:429437 36. Kim JY, van de Wall E, Laplante M, et al. Obesityassociated improvements in metabolic profile through expansion of adipose tissue. J Clin Invest 2007;117:26212637 37. Lee AH, Iwakoshi NN, Glimcher LH. XBP1 regulates a subset of endoplasmic reticulum resident chaperone genes in the unfolded protein response. Mol. Cell Biol 2003;23:74487459 38. Phillips SA, Kung JT. Mechanisms of adiponectin regulation and use as a pharmacological target. Curr Opin Pharmacol 2010;10:676683 39. Berg AH, Combs TP, Du X, Brownlee M, Scherer PE. The adipocytesecreted protein Acrp30 enhances hepatic insulin action. Nat Med 2001;7:947953

20 Page 21 of 39 Diabetes

40. Combs TP, Berg AH, Obici S, Scherer PE, Rossetti L. Endogenous glucose production is inhibited by the adiposederived protein Acrp30. J Clin Invest 2001;108:18751881 41. Yamauchi T, Kamon J, Waki H, et al. Globular adiponectin protected ob/ob mice from diabetes and ApoEdeficient mice from atherosclerosis. J Biol Chem 2003;278:24612468 42. Yamauchi T, Kamon J, Waki H, et al. The fatderived hormone adiponectin reverses insulin resistance associated with both lipoatrophy and obesity. Nat Med 2001;7:941946 43. Iwakoshi NN, Lee AH, Vallabhajosyula P, et al. Plasma cell differentiation and the unfolded protein response intersect at the transcription factor XBP1. Nat. Immunol 2003;4:321329 44. Reimold AM, Iwakoshi NN, Manis J, et al. Plasma cell differentiation requires the transcription factor XBP1. Nature 2001;412:300307 45. Lee AH, Chu GC, Iwakoshi NN, Glimcher LH. XBP1 is required for biogenesis of cellular secretory machinery of exocrine glands. Embo J 2005;24:43684380 46. Lee AH, Scapa EF, Cohen DE, Glimcher LH. Regulation of hepatic lipogenesis by the transcription factor XBP1. Science 2008;320:14921496 47. Martinon F, Chen X, Lee AH, Glimcher LH. TLR activation of the transcription factor XBP1 regulates innate immune responses in macrophages. Nat Immunol 2010;11:411418 48. Kaser A, Lee AH, Franke A, et al. XBP1 links ER stress to intestinal inflammation and confers genetic risk for human inflammatory bowel disease. Cell 2008;134:743756 49. Hetz C, Thielen P, Matus S, et al. XBP1 deficiency in the nervous system protects against amyotrophic lateral sclerosis by increasing autophagy. Genes Dev 2009;23:22942306 50. Zhou L, Liu M, Zhang J, et al. DsbAL alleviates endoplasmic reticulum stressinduced adiponectin downregulation. Diabetes 2010;59:28092816 51. Hetz C. The unfolded protein response: controlling cell fate decisions under ER stress and beyond. Nat Rev Mol Cell Biol 2012;13:89102 52. Yoshida H, Matsui T, Yamamoto A, Okada T, Mori K. XBP1 mRNA is induced by ATF6 and spliced by IRE1 in response to ER stress to produce a highly active transcription factor. Cell 2001;107:881891 53. Christis C, Fullaondo A, Schildknegt D, et al. Regulated increase in folding capacity prevents unfolded protein stress in the ER. J Cell Sci 2010;123:787794 54. Powers ET, Morimoto RI, Dillin A, Kelly JW, Balch WE. Biological and chemical approaches to diseases of proteostasis deficiency. Annu. Rev. Biochem. 2009;78:959991

21 Diabetes Page 22 of 39

FIGURE LEGENDS

FIG. 1. Generation of adipocytespecific XBP1s transgenic mice. A: QPCR analysis in white adipose tissue (WAT) of 20weekold lean (+/+) and obese (ob/ob) female mice (n = 6). B: Q PCR analysis in primary adipocytes (Adipo) and stromal vascular cells (SVC) isolated from WAT of 18weekold lean (+/+) and obese (ob/ob) male mice (representative of three independent experiments). C: QPCR analysis in Adipo and SVC isolated from WAT of 25 weekold females fed LFD or HFD (n = 3 mice). D: The diagram of the transgene construct where HAXBP1s is driven by adipocytespecific aP2 promoter flanked by the H19 chromatin insulators. E: RTPCR analysis of Xbp1 transcripts in WAT. TGm, transgenic mice with moderate transgene expression compared to TG mice. F: QPCR analysis in WAT of WT (n = 6), TGm (n = 3) and TG (n = 6) females. G: RTPCR analysis of WAT and liver using transgene specific primers to demonstrate tissue specificity. H: Western blot analysis of HAXBP1s protein in WAT following immunoprecipitation with HAagarose. I: qPCR analysis of XBP1s target gene Erdj4, P58ipk and Edem, and nontarget gene Chop in WAT of WT and TG mice (n = 6). J: Western blot analysis of (p)IRE1α using Phostag gel in WAT of 17weekold males (n = 6) with quantitation shown on top. “p” and “0”, phosphorylated and nonphosphorylated IRE1α, respectively. K: TEM images of WAT of WT and TG mice. L, lipid droplet. Arrows points to the ER. Gene expression levels in qPCR analysis were normalized to ribosomal gene L32, which is also used as a loading control in the RTPCR assay. Data are shown as mean ± s.e.m. *p < 0.05, **p < 0.01, ***p < 0.001 by Student’s t test. a.u., arbitrary unit.

FIG. 2. Improved glucose homeostasis in TG mice on LFD. A-B: Body (A) and epididymal WAT weights of 16weekold WT and TG male mice (n = 6). C: Representative H&E images of WAT sections. Right: quantitation of adipocyte cell size (n = 300 cells each). D: GTT in 16weekold males (n = 6) with 1.5 g glucose/kg body weight. Right, area under the curve (AUC) analysis. E: Linear regression analysis of AUC in GTT (D) plotted to Xbp1s expression levels in WAT determined by qPCR (n = 6 each). F: ITT in 15weekold WT and TG males (n = 6) with 1.5 U insulin/kg body weight. Right, AUC analysis. G-I: Western blot analysis of pAKT (S473) in the liver (G), WAT (H) and skeletal muscle (I) of mice with or without i.p. insulin (1 U/kg body weight) for 30 min. HSP90, a loading control. Right, quantitation of pAKT/AKT with insulin

22 Page 23 of 39 Diabetes

injection (n = 4). J: Serum levels of pancreatic hormones (insulin and glucagon) and gut hormones (ghrelin, GIP and GLP1) determined by the multiplex assay (n = 45). Data are mean ± s.e.m. *p < 0.05, **p < 0.01 by Student’s t test. a.u., arbitrary unit.

FIG. 3. Elevated adiponectin multimerization in TG lean mice. A: Serum levels of adipokines, leptin, resistin and PAI1. Leptin was measured in 12weekold mice (n = 1112) while resistin and PAI1 levels was measured in 20weekold mice (n=45mice). B: Serum adiponectin levels of 17weekold males (n = 12 each). C: Adiponectin (Adipoq) mRNA levels in WAT of 17 weekold WT and TG males determined by qPCR (n = 1112). D: Western blot analysis of XBP1s in 3T3L1 adipocytes acutely overexpressing GFP (CON) or XBP1s. To visualize XBP1s, cells were treated with thapsigargin (Tg) for 6 h. Right, QPCR analysis of Adiponectin (Adipoq) mRNA levels in 3T3L1 adipocytes (without Tg treatment). E: Nonreducing Western blot analysis (left) and quantitation (right) of adiponectin (ADPN) complexes in the serum. Serum IgG levels were used as loading controls for normalization. F: Western blot analysis of adiponectin complexes in the serum following gel filtration chromatography. Relative abundance of different forms of adiponectin shown below. G: Nonreducing Western blots of adiponectin complexes in the serum following velocitybased sucrose gradient fractionation (n = 5). Quantitation shown on the right. H: Representative nonreducing Western blots of adiponectin complexes in the WAT following velocitybased sucrose gradient fractionation (n = 2). Data are shown as mean ± s.e.m. *p < 0.05, **p < 0.01 by Student’s t test. Gene expression levels in qPCR analysis were normalized to L32. a.u., arbitrary unit.

FIG. 4. Improved glucose homeostasis and elevated HMW adiponectin in TG ob/ob mice. A: Western blot analysis of HAXBP1s protein in whole cell lysates (Total), cytosol (Cyt) and nucleus (Nuc) of WAT from 13weekold TG and TGob males following immunoprecipitation with HAagarose. Quantitation shown below with total and cytosol HAXBP1s normalized to HSP90 and nuclear HAXBP1s normalized to CREB. *, a nonspecific band and l.e., longer exposure. B: QPCR analysis in primary adipocytes (Adipo), stromal vascular cells (SVC) and macrophages (MΦ) isolated from WAT of 12weekold females as determined by qPCR (n = 3). C: Body weights of 9weekold males (n = 58). D: GTT of mice in (C) with 1 g glucose/kg body weight. Right, AUC analysis. E: Body weights of 12weekold females (n = 4). F: ITT of mice in

23 Diabetes Page 24 of 39

(E) with 4 U insulin/kg body weight and AUC analysis (right). G: Adiponectin (Adipoq) mRNA levels in WAT of 14weekold females (n=46 each). H: Nonreducing Western blots of adiponectin complexes in the serum following velocitybased sucrose gradient fractionation with quantitation shown on the right (n=3). Fractions were pooled together as indicated. I: Regression analysis of growth curves of males (left) and females of WTob and TGob mice. J: Representative picture of mice at the age of 40 weeks. K: Daily food intake of 35weekold WT ob (n = 5) and TGob (n = 7) males. Data are shown as mean ± s.e.m. *p < 0.05, **p < 0.01 by Student’s t test. a.u., arbitrary unit.

FIG. 5. Adipocyte XBP1s affects systemic glucose tolerance via adiponectin. A: QPCR analysis of Xbp1s in WAT of 14weekold males (n = 4). B: Body weights of 14weekold males (n = 6). C: GTT of mice in (B) with 1 g glucose/kg body weight and AUC analysis (right). Data are shown as mean ± s.e.m. ***p < 0.001, N.S., not significant by Student’s t test.

FIG. 6. XBP1smediated global transcriptional regulation in WAT. A: Gene ontology analysis of top 10 pathways that are upregulated by XBP1s in WAT of 16weekold WT and TG males on LFD under ad libitum. B: Heat map showing changes in UPR genes organized by the ratio of signals in TG to signals in WT in each functional category with average level of WT signals set as 1. Genes increased over 1.2fold in TG mice are shown. n = 4 mice per cohort.

FIG. 7. XBP1s regulates the expression of genes involved in adiponectin maturation. A-B: Q PCR (A) and Western blot (B) analyses in WAT of 18weekold WT and TG males (n = 6). Quantitation after normalization to HSP90 shown on right. C: QPCR analysis in WAT of 14 weekold females (n = 46). # p < 0.05 comparing WTob vs. WTlean. * p < 0.05 comparing TGob vs. WTob. D: QPCR analysis in primary adipocytes (Adipo), stromal vascular cells (SVC) and macrophages (MΦ) purified from WAT of 12weekold WTob and TGob females (n = 3). N.D., not detected. E: Linear regression analysis of mRNA levels plotted to Xbp1s expression levels in WAT as determined by QPCR. n = 6 for WT and 12 for TG mice. F: ChIP PCR analysis of XBP1s targets in WAT of TG mice using the antiXBP1 antibody. Nonspecific IgG and 3’ UTR were included as negative controls. G: Luciferase assays showing XBP1s mediated transactivation of target gene promoters in HEK 293T cells. Data are shown as mean ±

24 Page 25 of 39 Diabetes

s.e.m. *p < 0.05, **p < 0.01, ***p < 0.001 by Student’s t test. Gene expression levels in qPCR analysis were normalized to L32. a.u., arbitrary unit. H: The working model for XBP1s mediated adiponectin multimerization and glucose homeostasis.

25 Diabetes Page 26 of 39

A WAT B Xbp1 Xbp1s Xbp1u Tnfa 2.0 2.5 1.5 3 4 +/+ ob/ob +/+ *** 1.5 2.0 3 ob/ob 1.0 2 ** *** 1.5 ** *** 1.0 *** 2 1.0 0.5 1 0.5 *** *** 1 ** 0.5 mRNA levels (a.u.) mRNA mRNA levels (a.u.) mRNA 0.0 0.0 0.0 0 0 Xbp1 Xbp1s Xbp1u Tnfa Adipo SVC Adipo SVC Adipo SVC Adipo SVC

C Xbp1 Xbp1s Xbp1u Tnfa D 3 2.0 2.0 25 LFD 1.5 1.5 20 3 x HA 2 HFD 15 * 1.0 1.0 H19 aP2 promoter XBP1s H19 1 10 0.5 0.5 ** 5 mRNA levels (a.u.) mRNA 0 0.0 0.0 0 Adipo SVC Adipo SVC Adipo SVC Adipo SVC

E WAT F 15 *** G WT TG H WAT * WT TGm TG WT TG WAT WAT 10 Liver Liver kD u * HA-XBP1s s Xbp1 HA-Xbp1s mRNA (a.u.) mRNA 5 HA IP: 50 100 L32 L32 HSP90 Xbp1s 0 Input WT TGm TG

I J 15 K

(%) WT TG WT ! 2.5 10 TG

2.0 ** /IRE1 ** ! 5 1.5 * 1.0 0 p-IRE1 L WT TG 0.5 L L L mRNA levels (a.u.) mRNA p 0.0 0 IRE1α 500 nm

Erdj4 Chop HSP90 P58ipk Edem Phos-tag Page 27 of 39 Diabetes

A B C WT TG 30 WT 30 0.8 TG 20 0.6 20 0.4 10 10

0.2 % of total counts WAT WAT weight (g)

Body weight (g) 0 0 0.0 100 µm 100020003000400050006000700080009000 WT TG WT TG ! Adipocyte area (µm2)

D GTT E F ITT ** 500 WT 5 ** 5 p = 0.0037 100 WT 3000 min) min) ! TG ! TG 400 4 4 75 2000 300 3 3 mg/dl * * mg/dl 4 4 50 200 2 2 10 10 1000 ! ! * 25 ** AUC (min) 100 ** ** 1 1 (% baseline) *

0 0 0 Blood glucose levels 0 0 Blood glucose (mg/dl) AUC ( 0 30 60 90 120 AUC ( WT TG 0 4 8 12 16 0 15 30 WT TG Time post i.p. (min) Xbp1s mRNA (a.u.) Time post i.p. (min)

G Liver H WAT + Insulin + Insulin WT TG 4 WT TG 1.5 ** ** - + - + Insulin 3 - + - + Insulin 1.0 kD p-AKT 2 kD p-AKT 50 50 0.5 1 50 AKT 50 AKT p-AKT/AKT (a.u.) p-AKT/AKT 100 0 100 (a.u.) p-AKT/AKT 0.0 HSP90 WT TG HSP90 WT TG

I J Skeletal Muscle + Insulin Insulin Glucagon Ghrelin GIP GLP-1 WT TG 1.5 p = 0.10 8 0.4 15 0.4 0.15 - + - + Insulin 6 0.3 0.3 kD 1.0 N.S. 10 0.10 p-AKT 50 4 0.2 0.2 0.5 5 0.05 50 AKT 2 0.1 0.1

100 (a.u.) p-AKT/AKT 0 0.0 0 0.0 0.00

HSP90 0.0 Serumlevels (ng/ml) WT TG WT TG WT TG WT TG WT TG WT TG Diabetes Page 28 of 39

A B C D 3T3-L1 adipocytes Leptin Resistin PAI-1 Adiponectin 4 300 6 20 1.5 p = 0.12 1.5 ** CON XBP1s 3 15 1.0 200 4 kD XBP1s 1.0 2 10 50 mRNA (a.u.) mRNA

50 (a.u.) mRNA 100 2 0.5 0.5 1 5 CREB Nuclear extracts Adipoq Adipoq

Serum levels (ng/ml) 0.0

0 0 0 ADPN (µg/ml) Serum 0 0.0 WT TG WT TG WT TG Serumlevels (µg/ml) WT TG WT TG (Tg 6 h) CON E Serum F XBP1s WT TG

) 6 Gel filtration of serum adiponectin kD WT HMW 5 250 a.u. TG WT ( 4 150 TG Hexamer 3 2 * 100 HMW Hexamer Trimer 1 WT 0.5 : 1 : 0.1 75 Trimer ADPN / IgG 0 HMW Hexamer Trimer TG 0.8 : 1 : 0.1 anti-IgG 150 G Serum WT TG 100 1 2 3 4 5 6 7 8 9 10111213 1 2 3 4 5 6 7 8 9 10111213 Fraction (#) WT 80 kD TG HMW 60 250 150 40 Hexamer 20 * 100 * 0 75 Trimer % of total adiponectin HMW Hexamer Trimer

H WAT WT TG 100 1 2 3 4 5 6 7 8 9 10111213 1 2 3 4 5 6 7 8 9 10111213 Fraction (#) WT 80 kD HMW TG 250 60 * 150 40 * Hexamer 100 20 0 75 Trimer % of total adiponectin HMW Hexamer Trimer Page 29 of 39 Diabetes

A Total Cyt Nuc B TG TG TG Erdj4 P58ipk Edem Chop TG-ob TG-ob TG-ob kD 2.5 WT-ob 1.5 1.5 1.5 HA-XBP1s * WT-ob 2.0 TG-ob 50 * * TG-ob 1.0 1.0 ** 1.0 2.2 2.0 1.2 1.7 1.0 0.2 1.5 IP: HA IP: HA-XBP1s 1.0 (l.e.) 0.5 0.5 0.5 50 * 0.5 100 HSP90 levels (a.u.) mRNA 0.0 0.0 0.0 0.0 Adipo SVC M! Adipo SVC M! Adipo SVC M! Adipo SVC M!

Input CREB 37 C D E F GTT ITT 9 wk ** 12 wk * 40 600 WT-ob 5 60 125 WT-ob 12000 min) 500 TG-ob ! TG-ob 4 100 9000 30 400 40 * 3 75 mg/dl 6000 300 4 2 50 * 20 200 ** 10 20 * AUC (min) * ! * 3000 100 *** 1 (% baseline) 25 Body weight (g) Body weight (g)

10 0 0 0 Blood glucose levels 0 0 Blood glucose (mg/dl) 0 30 60 90 120 AUC ( 0 30 60 90 120 Time post i.p. (min) Time post i.p. (min) WT-ob TG-ob WT-ob TG-ob WT-ob TG-ob WT-ob TG-ob G H Serum WT-lean WT-ob TG-ob 4 1.5 *** * Fraction (#) * * 11 11 11 12 12 12 10 10 10 13 13 13 1-5 6-7 8-9 1-5 6-7 8-9 1-5 6-7 8-9 3 kD HMW 1.0 250 2

mRNA (a.u.) mRNA 0.5 1 150 Hexamer

Adipoq 0 100 0.0

WT-lean WT-ob TG-ob ADPN (a.u.) HMW/LMW WT-lean WT-ob TG-ob Trimer 75

I Males Females J K 40 wk 100 100 5 80 80 4 60 60 3

40 40 WT-ob 2 20 20 TG-ob 1 Body weight (g)

0 0 Daily food intake (g) 0 0 5 10 15 20 25 30 35 40 45 0 10 20 30 40 50 60 70 WT-ob TG-ob Age (wk) Age (wk) WT-ob TG-ob Diabetes Page 30 of 39

A B C GTT 15 30 N.S. 500 5 min) !

(a.u.) *** 400 4 10 20 300 3 mg/dl 4 5 10 200 2 10

WT-Adipoq-/- !

Body weight (g) 100 1

Xbp1s / L32 -/- 0 0 TG-Adipoq 0 0 Blood glucose (mg/dl) -/- -/- -/- -/- AUC ( 0 30 60 90 120 -/- -/- Time post i.p. (min)

WT-AdipqTG-Adipq WT-AdipoqTG-Adipoq WT-AdipqTG-Adipq Page 31 of 39 Diabetes

A B WAT WT TG Ratio .0 4.5-5.0 3.1 .0 5 Gene Ontology Dnajb9 (Erdj4) 5 .5 .5 1 4.25-4.5 Pdia61 2.4 .0 .0 4 4.0-4.25 Dnajc3 (P58ipk) 1.8 4 .5 .5 4 3.75-4.0 Hspa13 1.71 4 3.5-3.75 Hspa5 (Grp78) 1.59 .5 .5 3 3 .0 3.25-3.5 Dnajb11 1.52 .0 4 4 3-3.25 Herpud1 1.35 2.75-3.0 Fkbp2 1.35 .0 .0 .5 .5 3 3 3 2.5-2.75 Gstk1 (DsbA-L) 1.35 3 .0 2.25-2.5 ERp44.0 1.25 1 1 .0 2-2.25 Pdia3 1.25 .0 ) ) .5 .5 3 3 2 2 e 1.75-2 Hspd1 1.24 e e e u u l l r r a a o 1.75-1.6 Tgoln1 o 1.23 v v c c .5 .5 - - Analysis Analysis 2 2 s 1.6-1.4 Trappc10 s 1.23 P P

.0 .0 ( ( ES ES 2 2 w w g 1.4-1.3 Canx 1.23 g N N a a o o l l - - R R .0 1.3-1.25 Srp9 1.22 .0 2 2 1.25-1.2 ER(co-)chaperones foldases& Dnaja3 1.21 .5 .5 1 1 .5 .5 1.2-1.15Rawscore Serp1 1.21 0 0 .5 .5 1 1.1-1.15 Hspe1 1.2 1 1.1-1.05 .0 .0 1 1.05-1 Xbp1 1.67 1 .0 .0 1 1 Ingenuity 1-0.95 Atf6b Ingenuity 1.42 0.95-0.9 Atf6 1.24 UPR .5 .5 .5 .5 0 0 Gene Ontology Gene Gene Ontology Gene Gene Set Enrichment Enrichment Set Gene 0.9-0.85 Eif2ak3 1.23 Enrichment Set Gene 0 0 mediators 0.85-0.8 0.8-0.75 Derl1 1.46 .0 .0 .0 .0 .0 .0 0 0 0 0 0 0.75-0.7 0 n n n n s s s s s s s s s s s s s s s n s s s n s s s s s s s s 1.36 n n n n n n n n n Edem1 n 6 5 6 5 S S T T T T le le is is is is P P N P P N P P N P N N P N N N m m m m m m m m m m m m m m m m ay ay ay ay I I m m ein ein LE LE c c io io io io io io io io io io io io io io io io U U U U U U U U A A A A es es t es es es es es es es es t es es es es es es es es es es es es es es es es D D D D ON D ON D LE) ON LE) ON ON ON 450 450

SM SM SM SM y y t t ulus ulus hain hain

I I I A I A I I lis lis lis lis lis lis lis lis lis lis lis lis lis lis lis lis ER ER 0.7-0.65 ER ER lis lis c c c c c c c c c c c c c c c c c c c c c c c c c c unds unds Edem3 1.28 hw hw hw hw ESI ESI at at at at c c F F hes hes P P iat iat iat iat Y Y Y Y O O A O O A T P T P T T T T C C

P P P P H H YC YC I I I I I I im im F F YC GC YC GC GC GC at at iv iv iv iv at at pro pro T T T T e e e e t t rt rt I I R R A OLI OLI I A OLI OLI I A A I I e e e e nt nt pirat pirat po po ST ST ST ST C C t t t t unc unc C C D D genes genes D D D D

abo abo abo abo abo abo abo abo abo abo abo abo abo abo abo abo pro pro pro pro pro pro pro pro pro pro pro pro pro pro pro pro pro pro pro pro pro pro pro pro pro 0.65-0.6 pro

y y 1.28 s s Sil1 C C abo P abo P P P

c c c c D D B B D B B B D B B B D D B B

m m F F m m

I I T T

s s

A A A A po po A A YLA YLA rat rat et et et et et et et et et et et et et et et et

LU LU LU LU e e e e s s ic ic ic ic ic ic ESI ESI OR OR et et A A A A res res erent erent erent erent A A A A A A A A egradat egradat egradat egradat lic lic lic lic lic lic lic lic lic lic lic lic lic lic lic lic lic lic lic lic o o F F EA EA S S S S

P P A A it it f f f f io io lded lded lded lded I OGEN C I OGEN C neo 0.6-0.55 neo ein ein ein ein A A C C Sec63 1.27 C C c c A A M M M M M M M M M M M M M M M M

C C D D D D hro hro t t

R R OXI OXI M M

XR XR OR OR C C o o

B o B o D P D P OR GZ OR GZ

res res het het het het het het H H ET ET ET ET c c dif dif dif dif OB OB e e e e e e e e e e e e e e e e P P P P ET ET XR XR XR XR rans rans

VS VS VS VS P P ESI ESI id id id id R R (T (T phat phat abo abo abo abo abo abo abo abo abo abo abo abo abo abo abo abo abo abo abo abo

T T D D

t t A LI A LI H H ne ne ne ne o o S-T S-T

I 0.55-0.5 I an an an an nt nt nt nt nt nt 1.26 SE SE SE SE U U U U EGR Sel1l EGR c c St St f f M M M M at at at R s R at R s R at at at at ine ine ine ine t t pro pro

SP H SP H

unf unf M M gen gen gen gen ell ell

ell ell

ell ell ell ell y y y y y y LP P LP P / / / / ine ine c ine ine c at at et et et n at at at et et et

et et n at et et et

et at at

y y ellular ellular ellular ellular I I A A C C o o D D A A T T c c c c s s s s s s VS VS VS VS E E E E E E LE LE LE LE N N

Gluc Gluc o c c o c c c c c c c c

o

o A

A

R R hio hio EB EB ho ho ro ro / / C C t m t m m m m m m m m m m m rganic rganic D OU LER D OU H LER H A A y y n n n n ro l t ro l t 0.50-0.45 ruv ruv

1.25

SA SA SA SA T T T T E E Svip E t gly t gly A A t t t e e t e e e e e e F F T T ano ano Sugars Sugars part part P P OSP OSP y y leuc leuc at at at at o o ON ON

at P at P is is e e e e A D I A D I e e e e

T T T T Y Y Y Y I I leuc leuc io io f f s s A f A f bio bio bio bio bio bio M M YC YC N N -alanine -alanine -alanine -alanine pano LXR pano LXR s s ulum ulum R R by by f f N N I I

at at o s o s ho ho KR KR LP LP H H P ut P ut

e e e e Es Es r r r r

A D

A D T T SYN SYN T T â â o o o o lipid lipid o her lipid lipid her her o her her her ino 0.45-0.4 ino n n n n e e e e X X X X X X OA OA OA OA C T C

T 1.23 A s A s ic Uba5 ic ns ns o o T T F F ly ly s s ns o ns o lipid lipid lipid lipid lipid lipid id id lipid lipid id id

C C ro ro s s I ide ide I ide ide A A P P

B

B s s

drat o drat o T T elec elec N A N A A A

I I t t w eride eride w eride eride et et f et et f t t M M D D D D N N N N D D Glut Glut o o m m n n n n OS OS OS OS E E E E o o et et ic ic

I I F I I F I I

P

P c l-C c l l l-C l l A A

t t po po y ac y ac D D c c am am hex po hex po o o hy hy ERADcomponents alc alc ral ral ral ral

A A T A A T and and and and nhibit 0.4-0.35 nhibit y y R 1.21 R R Sec24c R io io M N M N ON ON C C I I ac ac VE VE VE VE F F and and and and s s y y leo leo I I and and and and bro bro n n f n n f T T t t A A ent ent T T and and and and et et R R A A o o cellularrespiration L L L L ic ic bio bio res ero ellular res ero ellular T T Gly Gly res res o o enz enz U U rigly rigly OXI OXI

io io OP OP R R P P c uc c uc ed ed ed ed at at T T

0.35-0.3 c t c c t c

c c idat idat A A Y Y Y Y gen gen gen gen neut f neut f o o arbo arbo A A SOLEU SOLEU m m ac ac B B I I ine ine ine ine rganic rganic T T I I x x R R N N I I

A A ine ine ine ine c c c c T T

D D o o R R gly gly o o Gly Gly P P

C C T T D D

lanine lanine 0.3-0.25 Ero1l lanine 1.05 Xeno Xeno D D ET ET ediat ediat

plas plas A A N N A A ndro ndro f f by by

ELEC ELEC Leuc Leuc OXI OXI

B B

regulat regulat F F Leuc Leuc A A

A A M o M o

0.25-0.2 n n n n 1.05

Nars ON ON ellular ellular ellular ellular M M D D E E E E I I io io M M m m c c H H L-1 L-1 Endo Endo N N I I M M C 0.2-0.15 C

I Grb10 0.94 I at at M M lis lis A A C C S/ S/ OC OC Valine, Valine, browncell differentiation fat

Valine, Valine,

PERK T T Y Y 0.15-0.1 Ptx3 0.96 Y I I responseunfolded to protein abo abo LP LP T T deriv deriv pathway

LEU LEU triglyceridemetabolic process acetyl-CoA metabolic process acetyl-CoA M M

T

T et et

neutrallipid metabolic process 0.1-0 Atf4 0.91 cellularcatabolicCHO process A A E, E, M M

organicethermetabolic process F F N

N

glycerolethermetabolic process LI LI energy energy M M M M VA VA regulationlipid of metabolic process 0 1 5 Diabetes Page 32 of 39

A B C WT TG WT TG 2.5 WT kD 1.5 * GRP78 * WT-lean 2.0 ** TG 75 * * * WT-ob ** p = 0.13 PDIA6 1.0 1.5 ** * PDI # TG-ob 50 ** # 1.0 50 ERp44ERp44 0.5 0.5 **

mRNA levels (a.u.) mRNA 25 DsbA-L 0.0 * levels (a.u.) mRNA 0.0 100 HSP90 0 1 2 Grp78 Pdia6 ERp44 DsbA-L Grp78 Pdia6 Ero1l ERp44DsbA-L Protein levels (a.u.)

D Grp78 Pdia6 ERp44 DsbA-L Ero1l 2.0 2.0 1.5 1.5 1.5 WT-ob ** ** * 1.5 1.5 ** TG-ob 1.0 1.0 1.0 1.0 1.0 0.5 0.5 0.5 0.5 0.5 N.D. mRNA levels (a.u.) mRNA 0.0 0.0 0.0 0.0 0.0 Adipo SVC M! Adipo SVC M! Adipo SVC M! Adipo SVC M! Adipo SVC M!

E 4 p < 0.0001 8 p < 0.0001 2.0 p < 0.0001 2.0 p < 0.0001 3 6 H 1.5 1.5 Adipocyte XBP1s 2 4 mRNA (a.u.) mRNA mRNA (a.u.) mRNA mRNA (a.u.) mRNA WT (a.u.) mRNA 1.0 1.0 1001 2 TG Pdia6 Grp78

75 ERp44 0 0 0.5 DsbA-L 0.5 ER chaperones 0 4 8 12 16 0 4 8 12 16 0 4 8 12 16 0 4 8 12 16 (Protein folding) 50Xbp1s mRNA (a.u.) Xbp1s mRNA (a.u.) Xbp1s mRNA (a.u.) Xbp1s mRNA (a.u.) 25 ** (% baseline) * Pdia6 (p) ERp44 (p) DsbA-L (p) ER homeostasis

F Blood glucose levels 0 G 0 15 30 10 5 *** 3 Grp78 Pdia6 ERp44 3’ UTR *** Time post i.p. (min) 8 4 * Input Input Input Input 2 6 3 HMW adiponectin IgG IgG IgG IgG XBP1 XBP1 XBP1 XBP1 4 2 1 2 1 0 0 0 Glucose homeostasis Luciferase activity (a.u.) CON XBP1s CON XBP1s CON XBP1s Page 33 of 39 Diabetes

SUPPLEMENTARY DATA

Adipocyte XBP1s Promotes Adiponectin Multimerization and Systemic

Glucose Homeostasis

Haibo Sha, Liu Yang, Meilian Liu, Sheng Xia, Yong Liu, Feng Liu, Sander Kersten, and

Ling Qi

1 Diabetes Page 34 of 39

A B )

. 1.5 40

WT ) u . g ( a

( TGm t

30 h s

l 1.0 g i e e v 20 e w l

y

A 0.5 d

N 10 o R B

m 0.0 0 Erdj4 P58ipk Edem Chop WT TGm C ) l N.S.

d 500 WT / 5 min) g TGm ⋅ m 400 4 (

e

s 300 3 mg/dl o 4 c u

l 200 2 g

d 100 1 o o l 0 0 B 0 30 60 90 120 (×10 AUC WT TGm Time post i.p. (min)

Supplementary Fig. 1. Gene expression and glucose tolerance test in moderate adipocyte XBP1s transgenic mice. A: qPCR analysis of XBP1s target gene Erdj4, P58ipk and Edem, and nontarget gene Chop in WAT of WT (n = 6) and TGm mice (n = 3). B: Body weights of 37weekold WT (n = 7) and TGm (n = 5) male mice. C: Glucose tolerance test. Blood glucose concentrations of mice in (B) were measured at indicated time points post i.p. 2 g glucose/kg body weight. Right, area under the curve (AUC) analysis. Data are mean ± s.e.m. N.S., not significant by Student’s t test.

2 Page 35 of 39 Diabetes

) A . D u

. 2.0

Adiponectin in media a (

* N Fraction 1 2 3 4 5 6 7 8 9 10 1112 13 N 1.5 CO XBP1s P D A CON 1.0 75 GRP78 W

M 1.0 1.4

L 0.5 XBP1s / W PDI

M 0.0 50 H s 1.0 1.2 LMW HMW 1 CON BP 50 X ERp44 B C 1.0 1.5

) DsbA-L 1.5 . 2.0 ) CON 25 . u . u . a 1.0 1.2 ( XBP1s a 1.5 * (

s 1.0 l 100 A e * HSP90 v N 1.0 * e l R *

m A

0.5 N

2 0.5 R P a 0.0 m 0.0 8 44 rp7 p bA-L CON G Pdia6 s Ero1l XBP1s ER D

Supplementary Fig. 2. Overexpression of XBP1s promotes adiponectin multimerization in 3T3L1 adipocytes. Fully differentiated 3T3L1 adipocytes were transfected with GFP (CON) or XBP1s plasmids by electroporation. 24 h later, cells and medium were collected for further analyses. A: Representative Western blot analysis of adiponectin complexes secreted by 3T3L1 adipocytes following sucrose gradient fractionation. Right: quantitation of the ratio of HMW to LMW adiponectin from three independent experiments. B: QPCR analysis of aP2 expression, normalized to ribosomal gene L32. C: QPCR analysis in 3T3L1 adipocytes transfected with GFP (CON) or XBP1s. Gene expression was normalized to ribosomal gene L32. Data are mean ± s.e.m. *p < 0.05 by Student’s t test. a.u., arbitrary unit. D: Western blot analysis in 3T3L1 adipocytes transfected with GFP (CON) or XBP1s.

3 Diabetes Page 36 of 39

Supplementary Fig. 3. Knockdown of DsbA-L attenuates the effect of XBP1s on adiponectin multimerization in 3T3L1 adipocytes. 3T3L1 adipocytes at day 7 were transfected with XBP1s or XBP1s together with DsbAL RNAi (DsbALi) plasmids by electroporation. 48 h later, cells and medium were collected for further analyses. A: DsbA-L mRNA levels determined by qPCR. Bars represent mean ± s.e.m. *p < 0.05 by Student’s t test. B: Western blot analysis of adiponectin complexes secreted by 3T3L1 adipocytes following sucrose gradient fractionation. Quantitation of HMW/LMW adiponectin shown on the right of the blots.

4 Page 37 of 39 Diabetes

Supplementary Fig. 4. Transient knockdown of Xbp1 has no effect on adiponectin multimerization in 3T3L1 adipocytes. 3T3L1 adipocytes at day 7 were transfected with control RNAi (CONi) or XBP1 RNAi (XBP1i) plasmids for 24 h by electroporation; cells and medium were collected for further analyses. A: Western blots of nuclear extracts (of cells treated with Tg for 6 h) or total cell lysates (cells were untreated). Bottom: quantitation of protein levels normalized to HSP90. *, a nonspecific band. B: Representative Western blot analysis of adiponectin complexes secreted by 3T3L1 adipocytes following sucrose gradient fractionation (three repeats). Quantitation of triplicates from one experiment shown below. Bars represent mean ± s.e.m. *p < 0.05 by Student’s t test.

5 Diabetes Page 38 of 39

Supplementary Table 1. Antibodies Used for Western blots

Name Source (catalog number) Dilution XBP1 Santa Cruz (sc7160) 1:1,000 IRE1α Cell Signaling (3294) 1:1,000 CREB Dr. Marc Montminy (Salk) 1:10,000 Adiponectin Sigma (A6354) 1:10,000 GRP78 Santa Cruz (sc1051) 1:1,000 PDI Assay Design (SPA890) 1:5,000 DsbAL PhosphoSolutions (465DsbAL) 1:10,000 ERp44 Cell signaling (2886) 1:1,000 HSP90 Santa Cruz (sc7947) 1:10,000 pSer473 AKT Cell Signaling (9271) 1:2,000 AKT Cell Signaling (9272) 1:5,000 Goat antimouse IgG HRP BioRad (1706516) 1:10,000

6 Page 39 of 39 Diabetes

Supplementary Table 2. Primer Sequences Used for RT-PCR, qPCR and ChIP

Gene Forward Reverse RT- HA-Xbp1s ATTACGCCATGGAATTCTGC GGACCGGGTACCATGAGC PCR L32 GAGCAACAAGAAAACCAAGCA TGCACACAAGCCATCTACTCA

qPCR Xbp1 ACATCTTCCCATGGACTCTG TAGGTCCTTCTGGGTAGACC Xbp1s GAGTCCGCAGCAGGTG TCCAGAATGCCCAAAAGG Xbp1u GAAGAGAACCACAAACTCCAGC GCAGAGGTGCACATAGTCTGAG Tnfa TCAGCCGATTTGCTATCTCATA AGTACTTGGGCAGATTGACCTC Grp78 TGTGGTACCCACCAAGAAGTC TTCAGCTGTCACTCGGAGAAT Pdia6 TGGTTCCTTTCCTACCATCACT ACTTTCACTGCTGGAAAACTGC DsbA-L GCCCATGTGGATGGTAAAAC GAAGTAAAGGCAGGCACAGC Erp44 AGAATTCCATCACGGACCTG ACGTAAGCCTCTGCTGGTGT Ero1l CGGACCAAGTTATGAGTTCCA TCAGAGAGATTCTGCCCTTCA Chop ATATCTCATCCCCAGGAAACG TCTTCCTTGCTCTTCCTCCTC Adipoq GGAACTTGTGCAGGTTGGAT GCTTCTCCAGGCTCTCCTTT aP2 AGCATCATAACCCTAGATGG TCACGCCTTTCATAACACAT

ChIP Grp78 ATTGGTGGCCGTTAAGAATG TGAAGTCGCTACTCGTTGGA Pdia6 GGTCCACGTTTGCCTTACTC TCCTCCTCCTCACATGAACC Erp44 CACAGGGCTTACTGGGAAAG CCTCTCACGCCCTCACTTC 3’UTR GAGCTGGAGCAAGAGTCCAC TGGGAATGCAGAATTTAAGG

7