DOCSLIB.ORG

Biological Characterization of Fungal Endophytes Isolated from Agarwood Tree Aquilaria Crassna Pierre Ex Lecomte

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Biological Characterization of Fungal Endophytes Isolated from Agarwood Tree Aquilaria Crassna Pierre Ex Lecomte Tạp chí Công nghệ Sinh học 14(1): 149-156, 2016 BIOLOGICAL CHARACTERIZATION OF FUNGAL ENDOPHYTES ISOLATED FROM AGARWOOD TREE AQUILARIA CRASSNA PIERRE EX LECOMTE Hoang Kim Chi, Le Huu Cuong, Tran Thi Nhu Hang, Nguyen Dinh Luyen, Tran Thi Hong Ha, Le Mai Huong Institute of Natural Products Chemistry, Vietnam Academy of Science and Technology Received: 15.5.2015 Accepted: 30.12.2015 SUMMARY In recent years, a considerable number of studies on the role of microbes in agarwood production have been carried out in plants of the species Aquilaria. Based on the fact that there is a relationship between the microorganisms residing inside the plant and the agarwood formation, we isolated and characterized endophytic fungi associated with A. crassna samples collected from Southern Vietnam. Morphological identification and DNA barcoding analysis of the fungal endophytic isolates indicated that they were classified at least into three groups of diverse genera: Geotrichum, Fusarium and Colletotrichum belonging to families Dipodascaceae, Nectriaceae and Glomerellaceae, respectively. Noteworthy, Geotrichum candium strain SHTr1 isolated from a dark colored woody sample of agarwood was able to produce a fruity odor and exhibited a slight antimicrobial activity against the test bacterium Staphylococcus aureus. Another fungal isolate, Fusarium verticillioides SHTr3’s, showed a moderate antimicrobial activity against a test Gram positive bacteria Bacillus subtillis and S. aureus with MIC values at 50 µg.mL-1. At 200 µg.mL-1, the ethyl acetate extracts of fungal isolates F. verticillioides SHTr3 and Colletotrichum truncatum SHTrHc7 were found to have comparable scavenging abilities on DPPH-free radicals with 53.87 and 71.82%, respectively. The present results contribute to a depiction of a diverse fungal endophytic community in Vietnamese agarwood plant A. crassna and provide important information for further understanding of the role of endophytic fungi in agarwood formation and therapeutic applications of host plants in general. Keywords: Aquilaria crassna, endophytic fungi, Geotrichum candium, Fusarium verticillioides, Colletotrichum truncatum INTRODUCTION number and critically endangered (The IUCN Red List of Threatened Species <http://www.iucnredlist.org>). To date, a total Agarwood is the resinous and fragrant number of 19 species of Aquilaria have been listed heartwood that is derived from the wounded trees of in South East Asia region. Among them, A. crassna the genera Aquilaria and Gyrinops of the family is the most native to Vietnam where its distribution Thymelaeaceae (Myrtales) (Blanchette, 2006). is sparse but widespread (Naef, 2011). Rogers (2009) highlighted the most important plant species that biosynthesize agarwood, Aquilaria Various studies have been carried out in order to agollocha, A. malaccensis and A. crassna. These find out effective ways for enhancing agarwood plants were described as large evergreens that are formation in Aquilaria and Gyrinops plants that may found in the areas ranging from India and throughout help to minimize the exploitation of the plants Southeast Asia. Because of its historical use in worldwide. For example, artificial wound in the medicine, in fragrances as an aromatic oil, and also trunk of grown plants and biological treatments were in religious ceremonies, agarwood has become one tested to induce the agarwood formation. Tamuli et of the most valuable non-timber forest products with al. (2005) stated that essential oils of the eaglewood ranging prices in consumer countries by as much as tree A. agallocha Roxb. are products of pathogenesis 30,000 USD per kilogram for top quality wood with involvement of Aspergillus niger as a dominant (Hansen, 2000; Jayachandran et al., 2014). Because fungi in stem. Other pathogenic fungi found in the of the over-exploitation of agarwood in recent agarwood are Fusarium sp., Penicillium sp., and decades, the wild plants have been reduced in Trichoderma sp. (Tamuli et al., 2005). Jayachandran 149 Hoang Kim Chi et al. et al. (2014) compared the essential oil contents from All isolates were initially grouped based on different categories of infected plants of A. morphological characteristics like colony shape, malaccensis and found an apparent higher level of color of the aerial hyphae, growth rate in PDA aromadendrene 2 in the highly infected wood medium, and microscopic features of reproductive (24.76%) in comparison to the moderately infected structures. Representative strains of each (1.73%) and the less infected woods (1.58%). morphological group were then selected for Interestingly, the compound was totally absent in the molecular identification. wood oil of healthy plants (Jayachandran et al., 2014). DNA extraction, amplification of fungal ribosomal DNA, sequencing and sequence analysis Fungal endophytes, the group of special fungi were carried out for the molecular identification of which reside internally in plant tissues without fungal strains. The extraction of fungal DNA was causing any apparent effects, have become an carried out according to the manufacturer's protocols interest of study due to their ability in producing (DNeasy Plant Mini kit, Qiagen). For PCR novel active compounds (Strobel, Daisy, 2003; amplification, MasterCycler EP Gradient S cycler Porras-Alfaro, Bayman, 2011). The variation of (Eppendorf, Germany) was applied, using the fungal communities under different living conditions primers ITS1 (TCCGTAGGTGAACCTGCGG) and and host plant species, as well as host tissue types ITS4 (TCCTCCGCTTATTGATATGC) (White et have also been observed in previous studies (Mishra al., 1990). The PCR was started with an initial et al., 2012, Lamit et al., 2014). To date, denaturation at 95°C for 3 min, followed by 30 investigations in host plants belonging to Aquilaria cycles of denaturation at 95°C for 45 s, annealing at spp. in Vietnam have been limited. The present study 50°C for 35 s, and elongation at 72°C for 1.5 min, was undertaken to characterize endophytic fungi and final elongation took 10 min at 72°C. The isolated from samples of A. crassna Pierre ex sequencing of PCR products was performed on ABI Lecomte in Northern Vietnam, and additionally to 3100 Avant Genetic Analyzer (Applied Biosystems, investigate antimicrobial and antioxidant activities, USA). The sequences were then compared with of these fungal isolates. those available in GenBank via BLASTN searches (http://blast.ncbi.nlm.nih.gov/Blast.cgi) (Altschul et al., 1997). Software BioEdit v7.0.5.2 was used for MATERIALS AND METHODS sequence analyses (Hall, 1999). Isolation and culture of endophytic fungi Extraction of bioactive compounds from endophytic fungi for biological evaluation Endophytic fungi were isolated from fresh materials of agarwood plant samples – Aquilaria Endophytic strains were cultivated at 25°C for crassna Pierre ex Lecomte, collected from Nha 14 days in 150 mL of potato dextrose broth (PDB) Trang (Khanh Hoa province) situated in Southern with constant shaking (200 rpm) in an incubator Vietnam. Different parts of the samples, including shaker (IKA, Germany). The fermentation broth was fruits, leaves, and woody samples, especially inner extracted with an organic solvent (ethyl acetate, XL, parts of the woods which appeared in dark color, China) in a 500-ml Erlenmeyer flask by vigorous were exposed by knife disinfected with 70% ethanol, soaking at ambient temperature. Extractions were and followed by a surface sterilization according to repeated three times and combined. The crude Schluz et al. (1993). Segments (0.5 cm in size) from extracts obtained were then concentrated at reduced sterilized samples were placed in Petri dishes pressure in a rotary vacuum evaporator (EYELA, containing Potato dextrose agar (PDA, broth of Japan) (50°C at 40 rpm) and subsequently dissolved sliced potatoes 200 g.L-1, dextrose 20 g.L-1, agar 15 in dimethyl sulphoxide (DMSO) (Sigma Aldrich, g.L-1, pH 6) and chloramphenicol (50 µg.mL-1) (St- Germany) for biological assessments. Germain, Summerbell, 1996), incubated at 30°C and monitored every day to check the growth of fungal Antimicrobial activity assay hyphae from the segments. Fungal mycelia growing The prepared crude ethyl acetate extracts of from segments were then re-cultivated, purified and fungal endophytes were tested against 8 microbial transferred to fresh PDA slants and stored at 4°C. strains, namely Escherichia coli ATCC 25922 Identification of fungal endophytic isolates (Gram negative), Pseudomonas aeruginosa ATCC 25923 (Gram negative), Bacillus subtillis ATCC 150 Tạp chí Công nghệ Sinh học 14(1): 149-156, 2016 11774 (Gram positive), Staphylococcus aureus Antioxidant assays subsp. aureus ATCC 11632 (Gram positive), The antioxidant potential of the fungal isolates Aspergillus niger 439 (filamentous fungi), was tested using 1,1-diphenyl-2-picrylhydrazyl Fusarium oxysporum M42 (filamentous fungi), (DPPH) free radical assays (Brand-Williams, 1995; Candida albicans ATCC 7754 (yeast) and Shela et al., 2003) in 96-well microtiter plates. Saccharomyces cerevisiae SH 20 (yeast). A Briefly, 10 µL extract solution at serial diluted modification of the broth dilution test method concentrations were added into a well containing 190 (Vlietinck, 1998; Langfied et al., 2004) in sterile µL of DPPH in ethanol (Sigma Aldrich, Germany). 96-well microplates was used to detect Reactions of the extract with DPPH took place at antimicrobial activity of selected fungal strains. 37oC for 30 min in the dark. The absorbance of Briefly, test samples with
Load more

Recommended publications
  • Expanding the Knowledge on the Skillful Yeast Cyberlindnera Jadinii
    Journal of Fungi Review Expanding the Knowledge on the Skillful Yeast Cyberlindnera jadinii Maria Sousa-Silva 1,2 , Daniel Vieira 1,2, Pedro Soares 1,2, Margarida Casal 1,2 and Isabel Soares-Silva 1,2,* 1 Centre of Molecular and Environmental Biology (CBMA), Department of Biology, University of Minho, Campus de Gualtar, 4710-057 Braga, Portugal; [email protected] (M.S.-S.); [email protected] (D.V.); [email protected] (P.S.); [email protected] (M.C.) 2 Institute of Science and Innovation for Bio-Sustainability (IB-S), University of Minho, 4710-057 Braga, Portugal * Correspondence: [email protected]; Tel.: +351-253601519 Abstract: Cyberlindnera jadinii is widely used as a source of single-cell protein and is known for its ability to synthesize a great variety of valuable compounds for the food and pharmaceutical industries. Its capacity to produce compounds such as food additives, supplements, and organic acids, among other fine chemicals, has turned it into an attractive microorganism in the biotechnology field. In this review, we performed a robust phylogenetic analysis using the core proteome of C. jadinii and other fungal species, from Asco- to Basidiomycota, to elucidate the evolutionary roots of this species. In addition, we report the evolution of this species nomenclature over-time and the existence of a teleomorph (C. jadinii) and anamorph state (Candida utilis) and summarize the current nomenclature of most common strains. Finally, we highlight relevant traits of its physiology, the solute membrane transporters so far characterized, as well as the molecular tools currently available for its genomic manipulation.
    [Show full text]
  • M.Sc. Dissertation
    2 ACKNOWLEDGEMENTS I wish to thank the following: God , for giving me the strength and guidance to start each day with new hope. Prof. J. L. F. Kock , for his guidance, understanding and passion for research. Prof. P. W. J. van Wyk and Miss B. Janecke for their patience and assistance with the SEM, TEM and CLSM. Dr. C. H. Pohl , for her encouragement and assistance. Mrs. A. van Wyk , for providing the yeast cultures used during this study and also for her encouragement and support. Mr. S. F. Collett , for assisting with the graphical design of this dissertation. My colleagues in Lab 28 , for always being supportive and helpful. My mother, Mrs. M. M. Swart and grandmother, Mrs. M. M. Coetzer , for their patience, love and encouragement. My family for their encouragement and for believing in me. Mr. P. S. Delport , for his love, understanding and patience. 3 CONTENTS Page Title Page 1 Acknowledgements 3 Contents 4 CHAPTER 1 Literature Review 1.1 Motivation 9 1.2 Automictic yeasts 10 1.2.1 Definition of a yeast 10 1.2.2 Automixis 11 1.3 Oxylipins 19 1.3.1 Background 19 1.3.2 3-OH oxylipins 19 1.3.2.1 Chemical structure and production 19 1.3.2.2 Distribution 20 1.3.2.3 Function 23 1.3.2.4 ASA inhibition 23 1.4 Purpose of research 24 1.5 References 26 4 CHAPTER 2 Oxylipin accumulation and acetylsalicylic acid sensitivity in fermentative and non-fermentative yeasts 2.1 Abstract 38 2.2 Introduction 40 2.3 Materials and Methods 41 2.3.1 Strains used and cultivation 41 2.3.2 Ultrastructure 42 2.3.2.1 Scanning electron microscopy (SEM)
    [Show full text]
  • Oxylipin Distribution in Eremothecium
    1 Oxylipin distribution in Eremothecium by Ntsoaki Joyce Leeuw Submitted in accordance with the requirements for the degree Magister Scientiae in the Department of Microbial, Biochemical and Food Biotechnology Faculty of Natural and Agricultural Sciences University of the Free State Bloemfontein South Africa Supervisor: Prof J.L.F. Kock Co- supervisors: Dr C.H. Pohl Prof P.W.J. Van Wyk November 2006 2 This dissertation is dedicated to the following people: My mother (Nkotseng Leeuw) My brother (Kabelo Leeuw) My cousins (Bafokeng, Lebohang, Mami, Thabang and Rorisang) Mr. Eugean Malebo 3 ACKNOWLEDGEMENTS I wish to thank and acknowledge the following: ) God, to You be the glory for the things You have done in my life. ) My family (especially my mom) – for always being there for me when I’m in need. ) Prof. J.L.F Kock for his patience, constructive criticisms and guidance during the course of this study. ) Dr. C.H. Pohl for her encouragement and assistance in the writing up of this dissertation. ) Mr. P.J. Botes for assistance with the GC-MS. ) Prof. P.W.J. Van Wyk and Miss B. Janecke for assistance with the CLSM and SEM. ) My fellow colleagues (especially Chantel and Desmond) for their assistance, support and encouragement. ) Mr. Eugean Malebo for always being there when I needed you. 4 CONTENTS Page Title page I Acknowledgements II Contents III CHAPTER 1 Introduction 1.1 Motivation 2 1.2 Definition and classification of yeasts 3 1.3 Classification of Eremothecium and related genera 5 1.4 Pathogenicity 12 1.5 Oxylipins 13 1.5.1 Definition
    [Show full text]
  • APUNTE GEOTRICOSIS 2020.Pdf
    Geotricosis GEOTRICOSIS DEFINICIÓN: es una infección oportunista causada por el hongos del género Geotrichum que produce lesiones broncopulmonares, bronquiales, bucales, vaginales, cutáneas y diseminadas. ETIOLOGÍA: actualmente se reconoce una única especie dentro del género que se asocia con infecciones en el ser humano, Geotrichum candidum. Son especies muy relacionadas: -Magnusiomyces capitatus (ex Geotrichum capitatum) y -Saprochaete clavata (ex Geotrichum clavatus) CLASIFICACIÓN TAXONÓMICA: Reino: Fungi División: Ascomycota Subdivisión: Saccharomycotina Familia: Dipodascaceae Género: Telemorfo: Galactomyces candidus Anamorfo: Geotrichum candidum ECOLOGÍA Y DISTRIBUCIÓN: Es una levadura ascosporógena (que produce ascosporos) ampliamente distribuída en la naturaleza en el suelo, agua, aire, así como en plantas, cereales, y productos lácteos. También se encuentra en la microbiota habitual en la boca , intestinos y la piel sana. CAUSAS PREDISPONENTES Y CUADROS CLÍNICOS: Dado que Geotrichum es un habitante habitual del tracto intestinal, puede causar infecciones oportunistas de origen endógeno o de origen exógeno adquiridas vía ingestión o inhalación en pacientes diabéticos, tratados con antibióticos, corticoides, citostáticos, inmunosupresores, pacientes neutropénicos, con cáncer, Sida y en general en el hospedero inmunocomprometido, produciendo infecciones bronquiales y pulmonares, bucales, vaginales y cutáneas así como fungemia e infecciones diseminadas. Geotricosis pulmonar: es una infección de evolución crónica muy similar a la tuberculosis y muchas veces secundaria a ella. Puede presentarse debilitamiento general y fiebre. El esputo es mucoide, viscoso de color gris claro y en algunos casos purulento. 1 Geotricosis Geotricosis bronquial: consiste en una infección endobronquial cuyos síntomas incluyen tos crónica intensa, esputo gelatinoso sin fiebre y estertores ligeros o roncos. En las placas de rayos X se observan engroasamientos peribronquiales difusos.
    [Show full text]
  • Fungal and Bacterial Community Composition and Structure In
    Fungal and bacterial community composition and structure in fermented `hairy' tofu (Mao tofu) Gian Maria Niccol`oBenucci1, Xinxin Wang2, Li Zhang3, Gregory Bonito2, and Fuqiang Yu3 1Michigan State university 2Michigan State University 3Kunming Institute of Botany Chinese Academy of Sciences October 22, 2020 Abstract The process of fermenting tofu extends thousands of years. Despite a resurgent interest in microbial communities and fermented foods, little knowledge exists concerning microbial diversity of communities of fermented `hairy' tofu known in China as Mao tofu. We used high-throughput metagenomic sequencing of the ITS, LSU and 16S rDNA marker genes to disentangle the Mao tofu fungal and bacterial community composition and diversity across the four most important markets in the Yunnan region of China. We show that hairy tofu in this region consists of around 170 fungal and 365 bacterial taxa. Significant differences in community structure were found between markets and niches. Machine learning random forest models were able to accurately classify both market and niche of sample origin. An over-abundance of yeast taxa were detected, and Geotrichum were the most abundant fungal taxa, followed by Torulaspora, Trichosporon, and Pichia. Mucor (Mucormycota) was also abundant in the LSU data and especially in the outside niche (rind), which consists of the visible `hairy' mycelium. The majority of the bacterial OTUs belonged to Proteobacteria, Firmicutes, and Bacteroidota, with Acinetobacter, Lactobacillus, Sphingobacterium and Flavobacterium the most abundant members. Of interest, putative fungal pathogens of plants (e.g. Cercospora, Diaporthe, Fusarium) and animal (e.g. Metarhizium, Entomomortierella, Pyxidiophora, Candida, Clavispora), as well as bacterial (e.g. Legionella) pathogens, were detected.
    [Show full text]
  • Perchlorate Bioremediation: Controlling Media Loss in Ex-Situ
    UNLV Theses, Dissertations, Professional Papers, and Capstones 5-1-2016 Perchlorate Bioremediation: Controlling Media Loss in Ex-Situ Fluidized Bed Reactors and In-Situ Biological Reduction by Slow-Release Electron Donor Sichu Shrestha University of Nevada, Las Vegas, [email protected] Follow this and additional works at: https://digitalscholarship.unlv.edu/thesesdissertations Part of the Civil Engineering Commons, and the Environmental Engineering Commons Repository Citation Shrestha, Sichu, "Perchlorate Bioremediation: Controlling Media Loss in Ex-Situ Fluidized Bed Reactors and In-Situ Biological Reduction by Slow-Release Electron Donor" (2016). UNLV Theses, Dissertations, Professional Papers, and Capstones. 2744. https://digitalscholarship.unlv.edu/thesesdissertations/2744 This Dissertation is brought to you for free and open access by Digital Scholarship@UNLV. It has been accepted for inclusion in UNLV Theses, Dissertations, Professional Papers, and Capstones by an authorized administrator of Digital Scholarship@UNLV. For more information, please contact [email protected]. PERCHLORATE BIOREMEDIATION: CONTROLLING MEDIA LOSS IN EX-SITU FLUIDIZED BED REACTORS AND IN-SITU BIOLOGICAL REDUCTION BY SLOW- RELEASE ELECTRON DONOR By Sichu Shrestha Bachelor of Engineering in Civil Engineering, Institute of Engineering, Tribhuvan University, Nepal 2004 Master of Science in Civil and Environmental Engineering Carnegie Mellon University 2011 A dissertation submitted in partial fulfillment of the requirements for the Doctor of Philosophy-
    [Show full text]
  • Unconventional Yeasts Are Tolerant to Common Antifungals, and Aureobasidium Pullulans Has Low Baseline Sensitivity to Captan, Cyprodinil, and Difenoconazole
    antibiotics Article Unconventional Yeasts Are Tolerant to Common Antifungals, and Aureobasidium pullulans Has Low Baseline Sensitivity to Captan, Cyprodinil, and Difenoconazole Electine Magoye 1 , Maja Hilber-Bodmer 1, Melanie Pfister 2 and Florian M. Freimoser 1,* 1 Agroscope, Research Division Plant Protection, Müller-Thurgau-Strasse 29, 8820 Wädenswil, Switzerland; [email protected] (E.M.); [email protected] (M.H.-B.) 2 Swiss Federal Institute of Technology (ETH) Zurich, 8092 Zurich, Switzerland; melanie.pfi[email protected] * Correspondence: fl[email protected] Received: 14 August 2020; Accepted: 11 September 2020; Published: 15 September 2020 Abstract: Many yeasts have demonstrated intrinsic insensitivity to certain antifungal agents. Unlike the fungicide resistance of medically relevant yeasts, which is highly undesirable, intrinsic insensitivity to fungicides in antagonistic yeasts intended for use as biocontrol agents may be of great value. Understanding how frequently tolerance exists in naturally occurring yeasts and their underlying molecular mechanisms is important for exploring the potential of biocontrol yeasts and fungicide combinations for plant protection. Here, yeasts were isolated from various environmental samples in the presence of different fungicides (or without fungicide as a control) and identified by sequencing the internal transcribed spacer (ITS) region or through matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry. Among 376 isolates, 47 taxa were identified, and Aureobasidium pullulans was the most frequently isolated yeast. The baseline sensitivity of this yeast was established for 30 isolates from different environmental samples in vitro to captan, cyprodinil, and difenoconazole. For these isolates, the baseline minimum inhibitory concentration (MIC50) values for all the fungicides were higher than the concentrations used for the control of plant pathogenic fungi.
    [Show full text]
  • APUTS) Reporting Terminology and Codes Microbiology (V1.0
    AUSTRALIAN PATHOLOGY UNITS AND TERMINOLOGY (APUTS) Reporting Terminology and Codes Microbiology (v1.0) 1 12/02/2013 APUTS Report Information Model - Urine Microbiology Page 1 of 1 Specimen Type Specimen Macro Time Glucose Bilirubin Ketones Specific Gravity pH Chemistry Protein Urobilinogen Nitrites Haemoglobin Leucocyte Esterases White blood cell count Red blood cells Cells Epithelial cells Bacteria Microscopy Parasites Microorganisms Yeasts Casts Crystals Other elements Antibacterial Activity No growth Mixed growth Urine MCS No significant growth Klebsiella sp. Bacteria ESBL Klebsiella pneumoniae Identification Virus Fungi Growth of >10^8 org/L 10^7 to 10^8 organism/L of mixed Range or number Colony Count growth of 3 organisms 19090-0 Culture Organism 1 630-4 LOINC >10^8 organisms/L LOINC Significant growth e.g. Ampicillin 18864-9 LOINC Antibiotics Susceptibility Method Released/suppressed None Organism 2 Organism 3 Organism 4 None Consistent with UTI Probable contamination Growth unlikely to be significant Comment Please submit a repeat specimen for testing if clinically indicated Catheter comments Sterile pyuria Notification to infection control and public health departments PUTS Urine Microbiology Information Model v1.mmap - 12/02/2013 - Mindjet 12/02/2013 APUTS Report Terminology and Codes - Microbiology - Urine Page 1 of 3 RCPA Pathology Units and Terminology Standardisation Project - Terminology for Reporting Pathology: Microbiology : Urine Microbiology Report v1 LOINC LOINC LOINC LOINC LOINC LOINC LOINC Urine Microbiology Report
    [Show full text]
  • The Occurrence of Listeria Monocytogenes Is Associated With
    Tan et al. Microbiome (2019) 7:115 https://doi.org/10.1186/s40168-019-0726-2 RESEARCH Open Access The occurrence of Listeria monocytogenes is associated with built environment microbiota in three tree fruit processing facilities Xiaoqing Tan1,2, Taejung Chung1,2, Yi Chen3, Dumitru Macarisin3, Luke LaBorde1 and Jasna Kovac1,2* Abstract Background: Multistate foodborne disease outbreaks and recalls of apples and apple products contaminated with Listeria monocytogenes demonstrate the need for improved pathogen control in the apple supply chain. Apple processing facilities have been identified in the past as potential sources of persisting L. monocytogenes contamination. In this study, we sought to understand the composition of microbiota in built apple and other tree fruit processing environments and its association with the occurrence of the foodborne pathogen L. monocytogenes. Results: Analysis of 117 samples collected from three apple and other tree fruit packing facilities (F1, F2, and F3) showed that facility F2 had a significantly higher L. monocytogenes occurrence compared to F1 and F3 (p <0.01).The microbiota in facility F2 was distinct compared to facilities F1 and F3 as supported by the mean Shannon index for bacterial and fungal alpha diversities that was significantly lower in F2, compared to F1 and F3 (p <0.01).Microbiotain F2 was uniquely predominated by bacterial family Pseudomonadaceae and fungal family Dipodascaceae. Conclusions: The composition and diversity of microbiota and mycobiota present in the investigated built food processing environments may be indicative of persistent contamination with L. monocytogenes. These findings support the need for further investigation of the role of the microbial communities in the persistence of L.
    [Show full text]
  • Supplementary Materials For
    Electronic Supplementary Material (ESI) for RSC Advances. This journal is © The Royal Society of Chemistry 2019 Supplementary materials for: Fungal community analysis in the seawater of the Mariana Trench as estimated by Illumina HiSeq Zhi-Peng Wang b, †, Zeng-Zhi Liu c, †, Yi-Lin Wang d, Wang-Hua Bi c, Lu Liu c, Hai-Ying Wang b, Yuan Zheng b, Lin-Lin Zhang e, Shu-Gang Hu e, Shan-Shan Xu c, *, Peng Zhang a, * 1 Tobacco Research Institute, Chinese Academy of Agricultural Sciences, Qingdao, 266101, China 2 Key Laboratory of Sustainable Development of Polar Fishery, Ministry of Agriculture and Rural Affairs, Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Qingdao, 266071, China 3 School of Medicine and Pharmacy, Ocean University of China, Qingdao, 266003, China. 4 College of Science, China University of Petroleum, Qingdao, Shandong 266580, China. 5 College of Chemistry & Environmental Engineering, Shandong University of Science & Technology, Qingdao, 266510, China. a These authors contributed equally to this work *Authors to whom correspondence should be addressed Supplementary Table S1. Read counts of OTUs in different sampled sites. OTUs M1.1 M1.2 M1.3 M1.4 M3.1 M3.2 M3.4 M4.2 M4.3 M4.4 M7.1 M7.2 M7.3 Total number OTU1 13714 398 5405 671 11604 3286 3452 349 3560 2537 383 2629 3203 51204 OTU2 6477 2203 2188 1048 2225 1722 235 1270 2564 5258 7149 7131 3606 43089 OTU3 165 39 13084 37 81 7 11 11 2 176 289 4 2102 16021 OTU4 642 4347 439 514 638 191 170 179 0 1969 570 678 0 10348 OTU5 28 13 4806 7 44 151 10 620 3
    [Show full text]
  • The Abundance and Diversity of Fungi in a Hypersaline Microbial Mat from Guerrero Negro, Baja California, México
    Journal of Fungi Article The Abundance and Diversity of Fungi in a Hypersaline Microbial Mat from Guerrero Negro, Baja California, México Paula Maza-Márquez 1,*, Michael D. Lee 1,2 and Brad M. Bebout 1 1 Exobiology Branch, NASA Ames Research Center, Moffett Field, CA 94035, USA; [email protected] (M.D.L.); [email protected] (B.M.B.) 2 Blue Marble Space Institute of Science, Seattle, WA 98104, USA * Correspondence: [email protected] Abstract: The abundance and diversity of fungi were evaluated in a hypersaline microbial mat from Guerrero Negro, México, using a combination of quantitative polymerase chain reaction (qPCR) amplification of domain-specific primers, and metagenomic sequencing. Seven different layers were analyzed in the mat (Layers 1–7) at single millimeter resolution (from the surface to 7 mm in depth). The number of copies of the 18S rRNA gene of fungi ranged between 106 and 107 copies per g mat, being two logarithmic units lower than of the 16S rRNA gene of bacteria. The abundance of 18S rRNA genes of fungi varied significantly among the layers with layers 2–5 mm from surface contained the highest numbers of copies. Fifty-six fungal taxa were identified by metagenomic sequencing, classified into three different phyla: Ascomycota, Basidiomycota and Microsporidia. The prevalent genera of fungi were Thermothelomyces, Pyricularia, Fusarium, Colletotrichum, Aspergillus, Botrytis, Candida and Neurospora. Genera of fungi identified in the mat were closely related to genera known to have saprotrophic and parasitic lifestyles, as well as genera related to human and plant pathogens and fungi able to perform denitrification.
    [Show full text]
  • 1. Padil Species Factsheet Scientific Name: Common Name Image
    1. PaDIL Species Factsheet Scientific Name: Geotrichum candidum Link emended J.W. Carmich. Dipodascaceae, Saccharomycetales, Saccharomycetidae, Saccharomycetes, Saccharomycotina, Ascomycota, Fungi Common Name Peach sour rot Live link: http://www.padil.gov.au/pests-and-diseases/Pest/Main/142760 Image Library Australian Biosecurity Live link: http://www.padil.gov.au/pests-and-diseases/ Partners for Australian Biosecurity image library Department of Agriculture, Water and the Environment https://www.awe.gov.au/ Department of Primary Industries and Regional Development, Western Australia https://dpird.wa.gov.au/ Plant Health Australia https://www.planthealthaustralia.com.au/ Museums Victoria https://museumsvictoria.com.au/ 2. Species Information 2.1. Details Specimen Contact: Jose Liberato - [email protected] Author: Liberato JR, McTaggart AR, Shivas RG Citation: Liberato JR, McTaggart AR, Shivas RG (2012) Peach sour rot(Geotrichum candidum )Updated on 9/15/2012 Available online: PaDIL - http://www.padil.gov.au Image Use: Free for use under the Creative Commons Attribution-NonCommercial 4.0 International (CC BY- NC 4.0) 2.2. URL Live link: http://www.padil.gov.au/pests-and-diseases/Pest/Main/142760 2.3. Facets Commodity Overview: Horticulture Commodity Type: Fresh Fruit, Fresh Vegetables, Citrus Distribution: Cosmopolitan Group: Fungi Status: Uncertain Status - In Australia 2.4. Other Names Oidium lactis Fresen. Oospora lactis (Fresen.) Sacc. 2.5. Diagnostic Notes Symptoms Geotrichum candidum is a ubiquitous wound pathogen causing post-harvest fruit and vegetable spoilage. Description Carmichael (1957) studied and emended the genus Geotrichum. A summary of his description of Geotrichum candidum follows. Mycelium hyaline, septate, radiating into branched vegetative and sporulating hyphae.
    [Show full text]