The cloning, expression and partial characterization of a human delta opioid receptor

Item Type text; Dissertation-Reproduction (electronic)

Authors Fang, Lei.

Publisher The University of Arizona.

Rights Copyright © is held by the author. Digital access to this material is made possible by the University Libraries, University of Arizona. Further transmission, reproduction or presentation (such as public display or performance) of protected items is prohibited except with permission of the author.

Download date 29/09/2021 11:52:35

Link to Item http://hdl.handle.net/10150/186784 INFORMATION TO USERS

This manuscript has been reproduced from the microfilm master. UMI films the text directly from the original or copy submitted. Thus, some thesis and dissertation copies are in typewriter face, while others may be from any type of computer printer.

The quality of this reproduction is dependent upon the quality of the copy submitted. Broken or indistinct print, colored or poor quality illustrations and photographs, print bleedtbrough, substandard margins, and improper alignment can adversely affect reproduction.

In the unlikely. event that the author did not send UMI a complete manuscript and there are missing pages, these will be noted. Also, if unauthorized copyright material had to be removed, a note will indicate the deletion.

Oversize materials (e.g., maps, drawings, charts) are reproduced by sectioning the original, beginning at the upper left-hand comer and continuing from left to right in equal sections with small overlaps. Each original is also photographed in one exposure and is included in reduced form at the back of the book.

Photographs included in the original manuscript have been reproduced xerographically in this copy. Higher quality 6" x 9" black and white photographic prints are available for any photographs or illustrations appearing in this copy for an additional charge. Contact UMI directly to order.

U·M·I University Microfilms International A Bell & Howell Information Company 300 North Zeeb Road. Ann Arbor. M148106-1346 USA 313/761-4700 800/521-0600

Order Number 9432851

The cloning, expression and partial characterization of a human delta opioid receptor

Fang, Lei, Ph.D. The University of Arizona, 1994

V·M·I 300 N. Zeeb Rd. Ann Arbor, MI48106

THE CLONING, EXPRESSION AND PARTIAL CHARACTERIZATION OF A HUMAN DELTA OPIOID RECEPTOR

by

Lei Fang

A Dissertation Submitted to the Faculty of the

COMMITTEE ON PHARMACOLOGY AND TOXICOLOGY (GRADUATE)

In Partial Fulfillment of the Requirements for the Degree of

DOCTOR OF PHILOSOPHY

In the Graduate College

THE UNIVERSITY OF ARIZONA

1994 2 THE UNIVERSITY OF ARIZONA GRADUATE COLLEGE

As members of the Final Examination Committee, we certify that we have read the dissertation prepared by Lei Fang ------~------entitled The Cloning, Expression and Partial Characterization

of a Human Delta Opioid Receptor

and recommend that it be accepted as fulfilling the dissertation

Doctor of Philosophy

Final approval and acceptance of this dissertation is contingent upon the candidate's submission of the final copy of the dissertation to the Graduate College.

I hereby certify that I have read this dissertation prepared under my direction and recommend that it be accepted as fulfilling the dissertation 3

STATEMENT BY AUTHOR

This dissertation has been submitted in partial fulfillment of requirements for an advanced degree at The University of Arizona and is deposited in the University Library to be made available to borrowers under rules of the Library.

Brief quotations from this dissertation are allowable without special permission, provided that accurate acknowledgment of source is made. Requests for permission for extended quotation from or reproduction of this manuscript in whole or in part may be granted by the head of the major department or the Dean of the Graduate College when in his or her judgment the proposed use of the material is in the interests of scholarship. In all other instances, however, permission must be obtained from the author.

SIGNED: ---=.fl----.l.Et--*----f"-l---- 4 ACKNOWLEDGMENTS

I would like to thank my advisor Dr. Henry I. Yamamura for all his supervision, patience and encouragement throughout my entire graduate training. I am particularly indebted to Dr. Richard J. Knapp for his advice, criticism and enthusiasm. I would also like to thank my committee members: Dr. William R. Roeske, Dr. Frank Porreca, Dr. Thomas P. Davis and Dr. Hugh E. Laird for their valuable insight and direction in my graduate training. I would also like to thank everybody who works in Dr. Yamamura's laboratory. Particularly Ewa Malatynska, Xiaoping Li, Eva Varga, Robert Horvath, Giovanna Santoro and other graduate students for their moral and technical support and Hayes Karla for her secretarial assistance. Thanks are also given to Dr. Josephine Lai for her friendship and suggestions, and Ms. Sue Waite for the help. My special thanks are given to my parents, my aunt and my boyfriend for their deep love and tireless support and understanding. 5 TABLE OF CONTENTS Page LIST OF FIGURES ...... 9

LIST OF TABLES ...... 11

ABSTRACT ...... 12

INTRODUCTION ...... 14

Background ...... 14

Opiates and Their Pharmacological Effects ...... 14 Multiple Opioid Receptors & Endogenous Opioid Peptides ...... 15 Mechanisms of Opioid Receptor Function ...... 20 Delta Opioid Receptors & Selective Ligands .. 1...... 25 Subtypes of the Delta Opioid Receptors ...... 31 Molecular Cloning of the Opioid Receptors ...... 37

Research Hypotheses ...... 39

Explanation of Dissertation Format ...... 41

MATERIALS & METHODS ...... 42

Cell Lines ...... 42

Chemicals & Opioid Compounds ...... 42

Molecular Cloning Techniques ...... 43

Messenger RN'A Isolation ...... 39 Double Stranded cDNA Synthesis ...... 44 6 TABLE OF CONTENTS (Continued) Page Preparation of Delta Opioid Receptor cDNA Probes Using the Polymerase Chain Reaction (PCR) ...... 46 Preparation of Radio labeled ([32p]) cDNA Probes ...... 47 Filter Replica Hybridization Screening of Human cDNA Libraries ...... 49 Dot Blot Hybridization Analysis of cDNA Clones ...... 53 Sequence Analysis ...... 53 Reconstruction of a Human Delta Opioid Receptor (hDOR) Open Reading Frame ...... 55 Expression & Partial Characterization of the Reassembled Human cDNA Clone ...... 56 PCR Amplification of the Full Length Human Delta Opioid Receptor Open Reading Frame ...... 58

COS-7 Cell Membrane Preparations ...... 59

RadioIigand Binding Assays ...... 59

Tissue Dependence of Specific Binding ...... 59 Saturation Studies ...... 60 Inhibition Studies ...... 61 Data Analysis ...... 62

RESULTS ...... 63

Synthesis of Hybridization Probes ...... 63 Hybridization Screening of Human cDNA Libraries ...... 66 Reconstruction of a Human Delta Opioid Receptor (hDOR) ORF ...... 76 Transient Expression and Partial Characterization of the Reassembled hDOR ...... 78 DNA and Amino Acid Sequences of the Reassembled hDOR (78x44) ...... 79 PCR Amplification of a Full Length hDOR ORF ...... 80 7 TABLE OF CONTENTS (Continued) Page DISCUSSION ...... 94

Cloning of a Reassembled hDOR ...... 94 Evidence that the Reassembled hDOR ORF Represents a Naturally Occurring hDOR ...... 96 Sequence Comparison ofhDOR to the mDOR and rDOR ...... 97 Pharmacological Comparison ofhDOR to the mDOR and rDOR ...... 99 Delta Opioid Receptor Subtypes ...... 102

CONCLUSION ...... 106

LIST OF REFERENCES ...... 107 8 LIST OF FIGURES

Figure Page

1. Primers and Conditions for PCR Amplification ...... 48

2. Filter Replica Hybridization Screening Method ...... 51

3. Excision ofpBluescript SK- (PBS) Phagemids ...... 52

4. Reconstruction of the ORF for the Human Delta Opioid Receptor ...... 57

5. A 0.46 kb PCR Product Electrophoresed on a 1% TAE Agarose Gel ...... 64

6. A 0.25 kb PCR Product Electrophoresed on a 1% TAE Agarose Gel...... 65

7A. The First Hybridization Screening of a Human Striatal cDNA Library Using the 0.46 kb Mouse Probe ...... 68

7B. The Second Hybridization Screening of a Positive Plaque Obtained from the First Screening Using the 0.46 kb Mouse Probe ...... 69

7C. The Third Hybridization Screening of One of the Positive Plaques Obtained from the Second Screening Using the 0.46 kb Mouse Probe ...... 70

8. Schematic Comparison of a Human Striatal cDNA Clone (44-11) to the Mouse Delta Opioid Receptor (mDOR) ORF ...... 71

9. Restriction Enzyme Digestion of the 44-11 Human Striatal Clone ...... 72 9 LIST OF FIGURES (Continued)

Figure Page

10. Putative Molecular Structure of the mDOR and the Comparison of Relative Positions of the Hybridization Screening Probes...... 73

11. Sequence Alignment of the Human Clones to the mDOR ORF ...... 74 12. Dot Blot Analysis of the Human cDNA Clones Using the 0.25 kb Mouse Probe ...... 75

13. Digestion ofa Reassembled Human cDNA (78x44) in pBS with EcoR I, Apa I and Hinc II Restriction Enzymes ...... 77

14. Tissue Dependence of Specific Binding to COS-7 Cell Membranes Transfected with 78x44-pcDNA3 ...... 81

15. Saturation Isotherm for [3H]NTI Binding to COS-7 Cell Membranes Transfected with 78x44-pcDNA3 ...... 82

16. Inhibition of [3H]NTI Binding to COS-7 Cell Membranes Transfected with 78x44-pcDNA3 by Selective Opioid Ligands ...... 83

17. [4'-CI-Phe4]DPDPE Inhibition of [3H]NTI Binding to COS-7 Cell Membranes Transfected with 78x44-pcDNA3 in the Absence or Presence of 100 11M Gpp(NH)p and lOOmMNaCI ...... 85

18. Nucleotide and Amino Acid Sequence of 78x44 hDOR ...... 86

19. Hydrophobicity Plot of the Reassembled 78x44 hDOR Amino Acid Sequence ...... 87 10 LIST OF FIGURES (Continued)

Figure Page

20. Nucleotide Sequence Comparison ofhDOR, mDOR and rDOR ...... 88

21. Amino Acid Sequence Comparison ofhDOR, mDOR and rDOR ...... 90

22. Summary of the Cloning ofa Reassembled hDOR ORF ...... 91

23. A 1.1 kb PCR Product Electrophoreses on a 1% TAE Agarose Gel...... 92

24. Putative Molecular Structure of the hDOR ...... 93 11

LIST OF TABLE Table Page

1. Inhibition Constants of [3H]NTI Binding to COS-7 Cell Membranes Transfected with 78x44-pcDNA3 by Selective Opioid Ligands ...... 84

2. Comparison of the Binding Affinities of the B Selective Ligands for the Cloned mDOR, rDOR and hDOR ...... 101 12 ABSTRACT A human delta (0) opioid receptor (hDOR) was cloned from human brain cDNA libraries by filter replica hybridization screening methods. A single clone (44-11) from a human striatal cDNA library was obtained with a 467 bp cDNA probe produced by peR amplification using NG 108-15 cells cDNA as the template. The 44-11 clone contained a 0.7 kb fragment corresponding to the 3' end of the mouse 0 opioid receptor (mDOR) open reading frame (ORF) including the TGA stop codon. The 0.7 kb segment derived from the 44-11 clone by EcoR I and Not I restriction enzyme digestion, was used to screen a human temporal cortical cDNA library. Three positive 1.0 kb clones were obtained from this library. None of the clones contained the full length 0 opioid receptor ORF. Sequence analysis showed that two of these clones were identical to each other and also identical to a portion of the 44-11 clone. However, one of these clones 78-4, was shown to contain a 0.64 kb fragment corresponding to the 5' end of the mDOR ORF including the ATG start codon. Since the 44-11 and 78-4 clones shared identical overlapping regions and a unique Hinc II restriction site, a human cDNA containing a full length of the 0 opioid receptor ORF was reconstructed by ligation of these two clones at the Hinc II site. The reassembled human cDNA (78x44) has the full length human 0 opioid receptor (hDOR) ORF. It contains 1116 nucleotides encoding a protein of 372 amino acids with 93% amino acid identity to the mDOR and the rat 0 opioid receptor (rDOR). The 78x44 cDNA was subcloned into the 13 pcDNA3 expression vector and transiently transfected into COS-7 cells. These cells expressed 1.0 pmole of [3H]naltrindole binding/mg protein. Delta opioid receptor selective ligands exhibited high affinity at the receptors while Jl and K selective ligands showed low affinity at the receptors. These results show that the expressed protein in COS-7 cells transfected with 78x44-pcDNA3 is the human 0 opioid receptor. 14

INTRODUCTION Background Opiates and Their Pharmacological Effects Opiates have been widely used for the treatment of pain for thousands of years. Early applications for opiate drugs by people in Egypt, Europe and Middle East included their use for the treatment of headache, arthritic and chest pain (Castglioni, 1947; Benedetti and Premuda, 1990). The first systematic study of the therapeutic effects of opiates was undertaken in the seventeenth century because of the establishment of experimental medicine. In 1806, the German chemist Sertilrner, isolated the major active alkaloid from Papaver somniferum, and named this compound morphine after the latin name for the Greek God of dreams. It is known that opium, a crude extract of the poppy plant Papaver somniferum, contains over 25 alkaloids (Jaffe and Martin, 1990). The most important of these alkaloids are morphine and codeine (methylmorphine). Since the activity of opium was difficult to predict, it was soon replaced with morphine for minor surgical procedures, for postoperative and chronic pain, and as adjunct to general anesthetics (Brownstein, 1993 ). Unfortunately, it was found that morphine had just as much potential for abuse as opium, and was not completely safe for use. Thus began a continuing effort to develop synthetic compounds that were safer, more efficacious and had fewer side effects than morphine. For example heroin (diacetylmorphine) was synthesized in 1898 and thought to be more potent than morphine while lacking abuse liability (Brownstein, 15

1993). To date, it has proven that heroin also has abuse liability. Additionally, some compounds such as N-allylnormorphine (Unna, 1943), which has the ability to block the actions of morphine, were also synthesized. These compounds have provided an important role in therapeutics and in the opiate research fields. Opiates including natural and synthetic opium-like drugs were then given the generic name "opioids". Opioids, like most drugs, produce a variety of pharmacological effects. Opioids exert their most striking effects in the central nervous system (eNS), and produce not only analgesia but also euphoria, respiratory depression and induce prolactin release (Knapp et aI., 1993). Opioids can also inhibit the gastrointestinal tract to cause constipation (Knapp et aI., 1993). In the cardiovascular system, opioids can decrease vascular blood pressure to cause hypotension (Knapp et aI., 1993). The prolonged use of opioids can lead to the development of tolerance of their actions. Patients treated with opioids over extended periods can also show evidence of physical dependence after discontinuing opioid drug administration. Drug addiction will occur if the patient attempts to treat the withdrawal syndrome with increasing doses of opioids. Thus the medical use of opioid drugs is limited by major concerns of (1) their active side effects and (2) tolerance and physical dependence, which can lead to drug addiction. Multiple Opioid Receptors & Endogenous Opioid Peptides Opioids produce their pharmacological effects through membrane bound receptors. This hypothesis is supported by many observations. First, opioids 16

show a pattern of structure similarity. Differences in opioid agonist structure can be related to differences in activity or potency. These structure-activity relationships are well developed in the opioid system (Goldstein et aI., 1971). Second, different isomers of the same opioid agonist, for example (-)levorphanol and (+ )dextrometaorphan, have different pharmacological potency. The variation of potency observed for different opioid drug stereoisomers implies a precise molecular recognition for the mediation of opioid drug activity. This is the best explained by the existence of a receptor protein having selectivity for this class of drugs. Finally, the identification of opioid selective antagonists such as naloxone, that specifically block and reverse opioid drug effects, strongly suggests that opioids must interact with a specific site(s) (receptor) to produce their pharmacological effects. One approach for the demonstration of opioid receptors in the brain was the in vitro receptor binding assay using radiolabeled ligands that were initially proposed by Goldstein et al. (1971). A critical element of this approach was to distinguish receptor-bound radioligand (specific binding) from the nonreceptor-bound radio ligand (nonspecific binding). Since the stereoisomer of the levorphanol, dextrorphan, showed no activity, Goldstein et al. (1971) proposed that radioligand bound to opioid receptors would show similar stereoselectivity. However, their experiments were unsuccessful due to the low specific activity (< 10 Cilmmole) of [3H]levorphanol (Goldstein et aI., 1971). Two years later, three laboratories (Pert and Snyder, 1973; Simon et aI., 1973; Terenius, 1973) simultaneously 17

reported the characterization of opioid receptors in neural tissue showing stereoselectivity and saturability by modifications of the original Goldstein et aI. (1971) receptor binding approach. The existence of mUltiple opioid receptors was first proposed by Martin and coworkers (Martin et aI., 1976; Gilbert and Martin, 1976) based on the distinct pharmacological profiles of three opioid agonists, morphine, keto cyclazocine and SKF-I0,047. Distinct syndromes were obtained by morphine, ketocyclazocine and SKF-I0,047 in dogs with long-term spinal transsections (chronic spinal dog preparation) (Martin et aI., 1976). Morphine caused miosis, bradycardia, hypothermia and nociceptive depression, while ketocyclazocine induced pupil constriction, flexor reflex depression and sedation. SKF-I0,047, on the other hand, produced mydriasis, tachypnea, tachycardia and mania. These observations suggested that morphine, keto cyclazocine, and SKF-I0,047 produced their effects through three types of opioid receptors, mu (!..l), kappa (K) and sigma (0'), which were named after the first letter of each receptor's prototype agonists, morphine, ketocyclazocine, and SKF-I0,047, respectively. The discovery of opioid receptors implied the existence of endogenous opioid compounds acting on these receptors. Electrical stimulation of certain brain regions such as the periaqueductal brain regions produced naloxone reversible analgesia in animal and human subjects (Reynolds, 1969; Mayer et aI., 1971; Akil et aI., 1977; Hosobuchi et aI., 1977), strongly supporting the existence of endogenous opiate-like substances that can be 18

released from neurons. These hypothesized substances were initially called "endorphins" for endogenous morphine-like compounds. In 1975, Hughes and Kosterlitz successfully isolated and purified two small pentapeptides from extracts of porcine brain with the amino acid sequence of Tyr-Gly-Gly -Phe-Met ([Met]enkephalin), and Tyr-Gly-Gly-Phe-Leu ([Leu]enkephalin), respectively. Terenius and Wahlstrom (1975) also isolated these two pentapeptides from brain tissue and cerebrospinal fluid by using a competitive binding assay. It was found that [Met]enkephalin was present in the structure of ~-lipotropin (~-LPH), a peptide containing 91 amino acids isolated from the pituitary (Li, 1964). Subsequently, a 31 amino acid residue of the carboxyl terminal of ~-LPH (61-91), was isolated from camel pituitary and confirmed to have opioid activity (Li and Chung, 1976). This peptide was named ~-endorphin, and contained the [Met]enkephalin sequence at its amino terminus. In 1979, a third important endogenous opioid peptide, called dynorphin, was isolated and purified from' porcine brain and pituitary (Goldstein et aI., 1979 and 1981). Thus, many endogenous opioid peptides had been found in the brain and pituitary. They represent three distinct peptide families derived from different peptide precursors, proenkephalin A (Kimura et aI., 1980), proenkephalin B (prodynorphin, Kakidani et aI., 1982) and pro-opiomelanocortin (POMC, Mains et aI., 1977), respectively. The discovery of the enkephalins resulted in the identification of another opioid receptor type, the delta (B) opioid receptor (Lord et aI., 1977). This 19 finding was based on the differences in the rank order of opioid agonist potency in reducing the electrically-induced contractions in the mouse vas deferens (MVD) and guinea pig ileum (GPI) bioassays. The rank order of potency in the MVD was [Leu]enkephalin > ~-endorphin > morphine, which was significantly different from that in the GPI, which was morphine

> ~-endorphin > [Leu]enkephalin (Lord et aI., 1977). These observations indicated that the agonists were acting on different opioid receptor populations in the two tissues. In addition, a 1C agonist, ketocyc1azocine showed weak activity in the MVD relative to its greater potency in the GPI bioassays. These data suggested that the MVD contained an opioid receptor that was not present in the GPI. The symbol for the delta opioid receptor came from the mouse vas deferens. Furthermore, the marked differences in the rank order of potencies for opioid agonists were observed between the rat vas deferens (RVD), MVD and GPI (Wuster et aI., 1979). These differences suggested the presence of a distinct opioid receptor in the RVD, differing from previously Il, K, 0 and (j receptors, and was referred to as the epsilon (e) receptor. Although the total number of opioid receptor types is still unknown, it is generally accepted that the opioid receptors can be subdivided into at least three major types, Il, 0, and 1C (Pasternak et aI., 1983; Paterson et aI., 1984).

The (j receptor originally described by Martin and colleagues (1976) does not represent an opioid receptor type because the effects described for (+)SKF-IO,047 were produced by the isomer (+)SKF-IO,047, and were not 20 blocked by naloxone. On the other hand, the £ receptor described by Wuster et al. (1979) mediates no activity in the eNS (Shook et aI., 1988), and the characterization of this receptor is still incomplete due to the lack of selective ligands (Knapp et aI., 1993). Thus, three opioid receptors fl, 0 and

1( are well defined, and distinguished by four criteria: (1) rank order of potency, (2) unique anatomical distribution, (3) physiological and behavioral profiles, and (4) differences in the activation of cellular responses (Dole et aI., 1975; Paterson et aI., 1984; Holaday, 1985). The extent to which the endogenous opioid peptides are targeted to specific opioid receptor types is limited (Knapp et aI., 1993). The enkephalins show some selectivity for the 0 opioid receptors, ~-endorphins have some selectivity for the fl opioid receptors, while dynorphins have significant selectivity for the 1( opioid receptors. However, there is sufficient cross reactivity between the endogenous opioid peptides and the three major opioid receptor types to suggest that there is no segregation between receptors and peptides. Mechanisms ofOpioid Receptor Function Opioid receptors produce their biochemical responses through a G­ protein second messenger system and can be described as G-protein coupled receptor (GPR). Blume et al. (1979) first demonstrated that guanine triphosphate (GTP) was required for opioid inhibition of stimulated adenylate cyclase activity. Kurose et al. (1983) showed that a pertussis toxin, known to adenine diphosphate (ADP)-ribosylate a cysteine residue in 21 the a-subunit of inhibitory G-proteins, could reduce the ability of opioids to inhibit stimulated adenylate cyclase activity in hybrid mouse neuroblastoma x rat glioma cells (NG 108-15 cells). Many early studies including Childers (1991) illustrated that the binding of opioid agonists, but not antagonists, was regulated by guanine nucleotides using in vitro radioligand binding assays. They reported that opioid receptors were linked to their second messenger systems through a G-protein and that the differences in agonist binding affinity was dependent on G-protein binding to an allosteric receptor site (Childers, 1991). In general, opioid agonists show multiple binding affinity states to opioid receptors. One is the receptor-G protein­ coupled high affinity state that can be produced by guanine diphosphate (GDP) and magnesium (Mg2+) pretreatment (Chang et aI., 1983). The other state is the receptor-G-protein-uncoupled low affinity state that can be produced by a nonhydrolyzable guanine triphosphate (GTP) analog guanylyl-imidodiphosphate (GMP-PNP, Gpp(NH)p), and Na+ to dissociate G-protein bound to the receptor (Werling et aI., 1988). Veda et aI. (1991) also reported that opioid agonists stimulated the hydrolysis of guanine nuc1eotides. All these findings show that the opioid receptors must be first coupled to a G-protein before their pharmacological effects are elicited. Opioid receptors induce inhibition of adenyl ate cyclase activity after coupling to a G-protein. Collier and Roy (1974) reported that morphine and other opioid agonists produced a naloxone-reversible inhibition of the formation of cyclic adenine monophosphate (cAMP) induced by 22 prostaglandin E 1 (PGE 1) or E2 (PGE2) without altering the basal cAMP level in rat brain homogenate. A year later, two research groups also showed that both prostaglandin (El/E2) stimulated cAMP accumulation and basal cAMP level were inhibited by opioid agonists in NG 108-15 cells (Sharma et aI., 1975; Traber et aI., 1975). These cells were reported to contain only the 0 type of opioid receptor (Chang and Cuatrecasas, 1979). Klee et aI. (1984) also demonstrated an inverse coupling of 0 opioid receptors to adenylate cyclase activity in NG 108-15 cells. Opioid inhibition of cAMP formation was also found in other cell lines containing Jl and l( opioid receptors (Frey and Kebabian, 1984; Yu et aI., 1986; Maneckjee and Minna, 1990). Using the method of optimizing the opioid signal in brain membranes preincubated at pH 4.0 developed by Childers (1988), researchers were able to measure the inhibition of cAMP formation in brain membranes (Childers, 1991). The inhibition of cAMP accumulation is also observed in the cells transfected with cloned opioid receptors (Evans et aI., 1992; Kieffer et aI., 1992; Yasuda et aI., 1993; Chen et aI., 1993; Fukuda et aI., 1993; Nishi, et aI., 1993; Minami et aI., 1993; Wang et aI., 1994). The membership of opioid receptors to the GPR superfamily is further supported by their molecular structure characteristics. The deduced amino acid sequences of these receptors contain conserved seven transmembrane domains, which are found in all G-protein coupled receptors, such as the adrenergic receptors and the muscarinic receptors (Lefkowitz and Caron, 1992; Mei et aI., 1989). These transmembrane regions show high homology 23 between all of the G-protein coupled receptors (Evans et aI., 1992; Lefkowitz and Caron, 1992; Mei et aI., 1989). In addition, like the adrenergic and muscarinic receptors, the third intracellular loop of the opioid receptor may be involved with the G-protein coupling process (Evans et aI., 1992). The binding affinity of opioid agonists was reduced by Gpp(NH)p and Na+ in cells transfected with the cloned opioid receptors (Yasuda et aI., 1993). The inhibition of cAMP accumulation by opioid agonists was also observed for cells transfected with cloned B and K opioid receptors (Evans et aI., 1992; Yasuda et aI., 1993). Opioid receptors mediate ion channel conductance that can modulate neurotransmitter release. Membrane potassium conductance is increased by the activation of Il and B opioid receptors, whereas membrane calcium conductance is decreased by the activation of K opioid receptors (North, 1986; Werz and MacDonald, 1984 and 1985). Single unit recording in the rat locus coeruleus (William and North, 1984), guinea pig submucous plexus and cultured mouse dorsal root ganglion cells (Werz and MacDonald, 1983) showed that the application of opioids produced hyperpolarization of the neurons by decreasing neuronal discharge and transmitter release. The inhibition of neurotransmitter release by the opioids was characterized by Illes (1989), and the mechanism of this effect was reviewed by Crain and Shen (1990). Agonists bind to opioid receptors to activate the associated inhibitory G-protein (Gi). The receptor-Gi-protein 24

complex then acts on membrane channels, such as potassium (K+) (for Jl

and () opioid receptor) and calcium (Ca2+) channels (for K opioid receptor), and results in an increase of K+ conductance and decrease of Ca2+ conductance. The change in ion conductance produces a reduction in the duration of action potential of the neurons and neurotransmitter released from the neurons (Crain and Shen, 1990). Izquierdo (1990) reported that all three opioid receptor selective agonists such as morphine (Jl selective agonist) ethyl keto cyclazocine (K selective agonist) and [D-Pen2, D­ pen5]enkephalin (DPDPE, () selective agonist) could reduce electrically stimulated acetylcholine (Ach) release by cholinergic neurons. In contrast, low concentrations (nM) of the opioid agonists could cause an increase in action potential duration and increase in neurotransmitter release, resulting in an excitatory effect (Crian and Shen, 1990). A possible explanation for these data is that the opioid receptor is coupled to a stimulatory G-protein (Gs) when activated by a low concentration of an opioid agonist. The receptor-Gs complex could stimulate adenylate cyclase activity to increase the cAMP levels thus activate a protein kinase A. This could decrease K+ conductance after Jl and () opioid receptor activations and increase Ca2+ conductance after K opioid receptor activations. The action potential duration is then increased and the neuron is depolarized, causing an excitatory effect (Crian and Shen, 1990). Both the inhibitory and excitatory effects of opioid receptor activation may be related to analgesia (Crian and Shen, 1990). A possible mechanism 25 for opioid agonist-induced spinal antinociception is to either enhance the inhibitory neuromodulator adenosine release or to reduce the excitatory neuromodulator acetylcholine release, so as to reduce the neuron sensitivity (Crian and Shen, 1990). Delta Opioid Receptors & Selective Ligands As described above, opioid receptors mediate many pharmacological effects. The importance of 0 opioid receptor studies is due to the potential therapeutic value of 0 opioid receptor selective drugs. The importance of developing the 0 opioid receptor selective drugs for clinical use is that they could mediate analgesia without the side effects associated with currently available opioid drugs such as morphine (Knapp et aI., 1989; Rapaka and Porreca, 1991). The 0 opioid receptor mediates several important pharmacological effects in the central nervous system (Knapp et aI., 1989), gastrointestinal system (Burks et aI., 1988, Kromer, 1989; Sheldon et aI., 1990) and respiratory systems (Shook et aI., 1990). The mediation of analgesia by spinal 0 opioid receptors was reviewed by Knapp et aI. (1989 and 1993). Analgesic activity is observed after spinal and supraspinal administration of o selective agonists (Heyman et aI., 1987 and 1988). It was reported that a 0 selective agonist DPDPE produced a potent analgesic effect, which could be blocked by a 0 selective antagonist ICI 174,864 (N, N,-diallyl-Try-Aib-Aib­ Phe-Leu-OH, where Aib is a a-amino-isobutyric acid) but not a J..l selective antagonist ~-funaltrexamine (~-FNA) (Heyman et aI., 1987). Russell et aI. 26

(1987) demonstrated that analgesic tolerance to a Il selective agonist [N­ methyl-Phe3, D-Pro4]morphinceptin (PLOI7) did not result in cross­ tolerance to a B selective agonist [D-Ala2, D-LeuS]enkephalin (DADLE). Mathiasen and Vaught (1987) provided evidence for the mediation of analgesia by supraspinal B opioid receptors. They found that both B6CBA­ AW-J/A Gimpy) and CS7BL/6Jbgj (beige) mice did not show an analgesic response after intracerebroventricular (i.c.v.) injection of Il selective agonists morphine sulfate and [D-Ala2, MePhe4, Gly-oIS]enkephalin (DAGO), while an analgesic effects can be seen after i.c.v. injection of a B selective agonist [D-Pen2, L-PenS]enkephalin (DPLPE) (Mathiasen and Vaught, 1987). The inhibition of gastrointestinal transit produced by B selective agonists was produced by intrathecal (i.t.) injection to mice but not found after i.c.v. administration (Porreca et aI., 1983 and 1984; Galligan et aI., 1984). Shook et al. (1987) also demonstrated that the modulation of gastrointestinal transit by B opioid receptors was found only in the spinal cord, but not at supraspinal nor peripheral sites. The constipating activity of opioids may limit their clinical use as analgesics. However, it is also clear that B selective agonists produce few adverse effects in the gut, and could be used significantly for clinical management of disorders such as diarrhea and the pain of cholescystitis (Sheldon et aI., 1990). Opioids, especially morphine, induce the depression of respiration, which is the most life-threatening side effect of using opioids (Haddad et 27 aI., 1984; Haddad and Lasala, 1987). May et ai. (1989) showed that after i.c.v. or i.t. injection of a 0 selective agonist DPDPE there were no signs of respiratory depression determined by respiratory rate or blood gas (PaC02) measurements. Therefore, 0 opioid receptor selective agonists may stimulate, rather than depress, ventilatory function (Cheng and Szeto, 1991; Cheng et aI., 1993), and would have a significant advantage over fl selective agonists.

Many side effects caused by fl and 1( opioid receptor activation in the endocrine systems, are not found by the 0 opioid receptor activation (Leadem and Yagenova, 1987; Van de Heiining et aI., 1991). In addition, 0 selective agonists are not aversive compared to the K selective agonists. (Cowan et aI., 1988; Dewitte et aI., 1989; Bals-Kubik et aI., 1990). Finally, some 0 selective agonists can modulate the effects induced by other opiates such as morphine (Vaught and Takemori, 1979; Jiang et aI., 1990 a and b). On the other hand, the 0 selective antagonists may delay or prevent tolerance and physical dependence induced by morphine and other fl selective agonists (Abdelhamid et aI., 1991; Miyamoto et aI., 1993), and may also block the reinforcing properties of abused drugs, such as cocaine (Menken et aI., 1992; Reid et aI., 1993). These data suggest that 0 opioid receptors play a critical role in clinical applications including analgesia, gastrointestinal disorder and treatment of drug abuse. The investigation of 0 opioid receptor physiology and pharmacology was facilitated by the development of biologically stable and selective 0 opioid 28 receptor ligands. Endogenous opioid peptides including enkephalins, p­ endorphins and dynorphins, have relatively high affinities for the 3 opioid receptors (Knapp and Yamamura, 1992), but the selectivity of these endogenous opioid peptides for the 3 opioid receptor is quite poor. Because of the low selectivity and rapid degradation of the endogenous opioid peptides by tissues, many synthetic opioid peptides were developed. Two groups of these peptides were synthesized and used for the characterization of 3 opioid receptors (Knapp and Yamamura, 1992). The first group were linear peptides, which were synthesized either by modifications of the side chain substituents extending from the peptide backbone or by modifications of the peptide bond. These peptides were Tyr­ D-Ser-Gly-Phe-Leu-Thr (DSLET) (Gacel et aI., 1980), [D-Ser2, (O-tert­ butyl), LeuS, Thr6]enkephalin (DSTBULET) (Delay-Goyet et aI., 1988; Gacel et aI., 1988) and [D-Ser2, (O-tert-butyl, LeuS, Thr6 (O-tert­ butyl)]enkephalin (BUBU) (Delay-Goyet et aI., 1988; Gacel et aI., 1988). The second group were cyclic peptides, which were synthesized by different methods to bridge together parts of the peptide to reduce conformational flexibility and increase stability. Studies of the conformational properties of the enkephalins and related analogues indicated that a compact, folded conformation of these analogues could increase the selectivity for the 3 opioid receptors (Mosberg et aI., 1983a). Thus, Mosberg and colleagues synthesized a conformational constrained cyclic enkephalin analogue Tyr­ D-Pen-Gly-Phe-D-Pen (DPDPE) (Mosberg et aI., 1983b). The affinity and 29

selectivity of DPDPE for 0 opioid receptors were then demonstrated by using radioligand binding assays and bioassays (Mosberg et aI., 1983a, Corbett et aI., 1984; Cotton et aI., 1985; Delay-Goyet et aI., 1985). More recently, Toth et aI. (1990) found that halogenation (F, CI, Br, and I) of the DPDPE phenylalanine (Phe) residue in the 4 position further increased both selectivity and affinity for the 0 opioid receptors. Other structural modifications of DPDPE compounds were also studied (Cavagnero et aI., 1991; Toth et aI., 1992) Three different D-amino acid containing peptides, selective for the 0 opioid receptors, have been isolated from amphibian skin. One of these peptides is Tyr-D-Met-Phe-His-Leu-Met-Asp-NH2. This peptide was named deltorphin by Kreil et aI. (1989), dermorphin gene-associated peptide ([D-Met2]DGAP) by Lazarus et al. (1989), and dermenkephalin (DREK) by Amiche et al. (1989). The other two peptides were named as deltorphin I and II with the amino acid sequences of Tyr-D-Ala-Phe-Asp-Val-Val-Gly­ NH2 ([D-Ala2, Asp4]deltorphin) and Tyr-D-Ala-Phe-Glu-Val-Val-Gly­ NH2 ([D-Ala2, Glu4]deltorphin), respectively (Erspamer et aI., 1989). They were isolated from extracts of phyllomedusa hieolor skin. Until recently, the only non-peptidic 0 opioid receptor selective agonist was the BW 373U86 (Chang et aI., 1993). The binding of BW 373U86 was found not to be regulated by guanine nucleotides and sodium in mouse brain, MVD tissue homogenates (Wild et aI., 1993) and NG 108-15 cell membranes (Childers et aI., 1993). 30 All of the compounds described above are 0 opioid receptor selective agonists. The first 0 opioid receptor selective antagonists available were the enkephalin analogues ICI 154129 (Shaw et aI., 1982) and ICI 174864 (Cotton et aI., 1984). The low antagonist activity and affinity of these two peptide antagonists limited the in vivo use for 0 opioid receptor characterization. More recently, several additional 0 opioid receptor selective antagonists derived from naltrexone, a classical non-selective opioid receptor antagonist, were characterized (Takemori et aI., 1992). Naltrindole (NTI), a selective non-peptidic 0 opioid receptor ligand, shows antagonist activity and the ability to cross the blood-brain barrier (Portoghese et aI., 1988 a and b). NTI also showed about lOO-fold selectivity for the 0 opioid receptors relative to the Il opioid receptors, and

10,OOO-fold selectivity relative to the K opioid receptors in radioligand binding studies (Portoghese et aI., 1988 a and b). Studies with two other compounds naltriben (NTB) and 7-benzylidenenaltrexone (BNTX) (Portoghese et aI., 1988 a and b; Portoghese et aI., 1992), were also found to be 0 opioid receptor selective antagonists. The peptide Tyr-Tic-Phe-Phe (TIPP) was first synthesized and characterized as an antagonist with both high affinity and selectivity for the 0 opioid receptors by Schiller et aI. (1992 a and b). In addition, [D-Ala2, Leu5, Cys6]enkephalin (DALCE) was synthesized and reported as a 0 opioid receptor selective agonist (Bowen et aI., 1987). It inactivates 0 opioid receptors presumably by thiol-disulfide exchange between a sulfhydryl group in the binding site of the receptor and 31

the cysteine residue in the position 6 to alkylate the receptors (Bowen et aI., 1987). An irreversible 0 selective antagonist naltrindole-5' isothiocyanate (5' NTII) was also synthesized and characterized by Portoghese et al. (1990). In summary, there are many 0 opioid receptor selective ligands including peptides, nonpeptides, agonists and antagonists, which could be used as tools to study 0 opioid receptor pharmacology. A few of the ligands were radiolabeled with either [3H] or [1251] for the characterization of the 0 opioid receptors. Selective radioligands for 0 opioid receptors commonly used by investigators are [3H]DPDPE (Akiyama et aI., 1985; Cotton et aI., 1985), [3H][4'-CI-Phe4]DPDPE ([3H]pCI-DPDPE, Vaughn et aI., 1989), [3H][D-Ala2, Glu4]deltorphin ([3H]deltorphin II, Buzas et aI., 1992), and [3H]naltrindole ([3H]NTI, Yamamura et aI., 1992; Fang et aI., 1993). Iodinated DPDPE and [D-Ala2, Glu4]deltorphin ([125]DPDPE and [125][D-Ala2, Glu4]deltorphin) were characterized by Knapp et al. (1989) and Fang et aI. (1992), respectively. Subtypes ofthe Delta Opioid Receptors The early evidence supporting the existence of multiple 0 opioid receptor subtypes was based on the interaction between the 0 and Il opioid receptors. It was demonstrated that [Leu5]enkephalin, one of the first 0 selective endogenous peptides, increased the morphine-induced antinociception at non-antinociceptive doses (Vaught and Takemori, 1979), whereas [Met5]enkephalin, another 0 selective endogenous peptide, decreased morphine-induced antinociception (Lee et aI., 1980; Vaught et aI., 1982). 32

Additionally, morphine-induced antinociception was also increased by DPDPE, a 0 selective synthetic peptide, and decreased by [D-Ala2, Met5]enkephalinamide (DAMA), another 0 selective ligand. Both potentiation and attenuation were blocked by leI 174864, a 0 selective antagonist (Porreca et aI., 1987; Heyman et aI., 1987; Heyman et aI., 1988). However, DPDPE failed to modulate antinociception induced by other f..l opioid receptor selective agonists, such as [D-Ala2, NMPhe4, Gly­ ol]enkephalin (DAMGO), [N-Me-Phe3, D-Pro4]morphiceptin (PLO 17), ~­ endorphin, phenazocine, etorphine and sufentanil (Heyman et aI., 1989 a and b; Heyman and Porreca, 1989). These data suggested that some f..l and 0 opioid receptors were functionally coupled. Moreover, studies with two f..l opioid receptor selective antagonists, ~-FNA and naloxonazine, also supported the concept of the 1l-0 receptor interaction (Heyman et aI., 1989 a and b). The Il selective antagonist ~-FNA, but not naloxonazine abolished the change in potency produced by a 0 selective agonist DPDPE. It was also suggested that functional coupling between the f..l and 0 opioid receptors was not only limited to the mediation of antinociception but also involved in other functions mediated by the Il opioid receptors. This includes 0 modulation of endotoxic shock and urinary bladder motility mediated by the Il opioid receptors. (Holaday and D'Amato, 1983; D'Amato and Holaday, 1984; Sheldon et aI., 1989). The modulation of f..l opioid receptor-induced pharmacological function by 0 opioid receptor selective agonists suggests a f..l-O receptor complex 33 having distinct but interacting sites for Jl and 0 agonists. Rothman and Westfall (1982 a and b) demonstrated an apparent noncompetitive interaction between radiolabeled and unlabeled ligands presumed to bind at either Jl or 0 sites by radioligand binding assays. They hypothesized that the o opioid receptor site was allosterically linked to a Jl opioid receptor site. This hypothesis was further supported by the analysis of radio ligand binding data obtained from the rat and mouse brain membrane preparations (Barrett and Vaught, 1982; Rothman and Westfall, 1983; Demoliou-Mason and Barnard, 1986; Rothman et aI., 1987 a and b; Rothman et aI., 1988). Based on a noncompetitive interaction between the Jl and 0 selective ligands in the absence or presence of site-directed alkylating agents (Rothman et aI., 1988), it was suggested that 0 opioid receptors may exist in at least two subtypes. One of them is named Onon-complexed (oncx), which is independent of Jl opioid receptors. The other subtype of the 0 opioid receptors is called Ocomplex (ocx), which is physically associated with the Jl opioid receptors (Rothman et aI., 1988; Rothman et aI., 1993). Mattia et ai. (1991a) demonstrated that [D-Ala2, Leu5, Ser6]enkephalin (DALES) produced its antinociceptive actions at the 0 non-complexed opioid receptor. Other evidence for 0 opioid receptor heterogeneity does not consider interactions with other opioid receptor types. Porreca and associates first identified the oland 02 opioid receptor subtypes based on the differential antagonism produced by two irreversible 0 selective ligands using in vivo antinociception studies (Jiang et aI., 1991). They reported that the 34

antinociception produced by DPDPE was blocked by an irreversible 8 selective ligand DALCE but not by 5' NTH, whereas the antinociception produced by [D-Ala2, Glu4]deltorphin was blocked by 5' NTH but not by DALCE (Jiang et aI., 1991). Therefore, DPDPE and [D-Ala2, Glu4 ]deltorphin appear to act at different 8 opioid receptor subtypes to produce analgesia. The 81 opioid receptor subtype was defined as the receptor where DPDPE and DALCE act, while the 82 opioid receptor was defined as the site where [D-Ala2, Glu4]deltorphin and 5' NTH act (Jiang et aI., 1991; Mattia et aI., 1992). Takemori and colleagues have investigated two 8 selective antagonists NTB and BNTX (Portoghese et aI., 1988 a and b). They observed that NTB blocked the DSLET produced antinociception better than that induced by DPDPE (Sofuoglu et aI., 1991 a; Portoghese et aI., 1992). The antagonist BNTX was found to antagonize the antinociception of DPDPE more effectively than that of DSLET (Portoghese et aI., 1992). These data further support the concept of the 8 opioid receptor SUbtypes. It was postulated that the 81 opioid receptor subtype could be activated by DPDPE and inhibited by DALCE and BNTX, while the 82 opioid receptor subtype could be activated by [D-Ala2, Glu4]deltorphin and inhibited by 5' NTH and NTB. DPDPE, DALCE and BNTX are considered to be 81 selective ligands, and [D-Ala2, Glu4]deltorphin, 5' NTH and NTB are considered to be 82 selective ligands in the example of 8 receptor mediated analgesia. 35

The existence of the 0 opioid receptor subtypes was also shown by antinociceptive cross-tolerance studies. Repeated administration (i.c.v.) of DPDPE over three days produced a five-fold right shift of the dose-response (antinociception) curve of DPDPE, but no change in the antinociception induced by [D-Ala2, Glu4]deltorphin or DAMGO, a J.L selective ligand (Mattia et aI., 1991 b) was seen. On the other hand, repeated administration of [D-Ala2, Glu4]deltorphin reduced the potency of itself to produce analgesia but had no effect on the potency of DPDPE (Mattia et aI., 1991 b). These data indicated that there was no cross-tolerance between these two 8 selective agonists, and thus suggested that DPDPE and [D-Ala2, Glu4]deltorphin produced their analgesic effects through different 8 opioid receptor subtypes. This conclusion was further supported by the observation that cold water swim stress (CWSS) induced antinociception might be mediated by 82 opioid receptor subtype because it was prevented by the induction of [D-Ala2, Glu4]deltorphin tolerance but not DPDPE tolerance (Vanderah et aI., 1992). Additionally, the absence of cross-tolerance between the antinociceptive effects of DPDPE and DSLET in mice, was also observed by Sofuoglu et aI. (1991 b). It was shown that acute tolerance to DPDPE shifted the dose-response curve of DADLE in the ~-FNA treated mice but not those of either DSLET nor DAMGO, while acute tolerance to DSLET shifted the dose-response curve of DSLET but not those of DPDPE nor DADLE (Sofuoglu et al. 1991 b). Thus, the concept of 0 opioid receptor 36 subtypes is well supported by the differences in their pharmacological characteristics in vivo. Evidence for multiple 0 opioid receptors was also found by the identification of differences in the binding properties of these receptors. A cyclopropyl-phenylalanine substituted enkephalin analogue, [D-Ala2, (2R, 3S)-VEPhe4, Leu5]enkephalin methyl ester (CP-OMe), synthesized by Stammer and colleagues, was demonstrated to have high affinity to brain tissue 0 opioid receptors but only weak activity in the MVD bioassay (Shimohigashi et aI., 1987; 1988 a and b). Later, Vaughn et aI. (1990) showed that this compound had a 33-fold lower affinity to sites labeled by [3H]pCI-DPDPE in the MVD than those labeled in rat brain, while [4'-CI­ Phe4]DPDPE did not show differences in the binding affinities of either the brain or MVD membrane preparations.

Recently, mUltiple 0 opioid receptor binding sites were observed In radioligand binding assays by several research groups using 0 opioid receptor selective radioligands. Negri et aI. (1991) showed that DPDPE inhibited the [3H][D-Ala2, Asp4]deltorphin binding at two sites, while [D­ Ala2, Asp4]deltorphin inhibited the [3H]DPDPE binding at one site. Two binding affinity sites for DPDPE and [D-Ala2, Asp4]deltorphin that were labeled by [3H][D-Ala2, D-Leu5]enkephalin ([3 H] DADLE) , were also observed in the rat brain membranes by using binding surface analysis methods (Xu et aI., 1991). It was reported that 90% showed high affinity and 10% showed low affinity for the sites labeled by [3H]DADLE (Xu et 37 aI., 1991). The multiple binding sites observed for DPDPE and [D-Ala2, Asp4]deltorphin remained after Gpp(NH)p treatment to dissociate bound G­ protein from the receptor. This treatment was intended to force the entire B opioid receptor population into a single low affinity state. These results indicated that the two binding sites did not represent different agonist affinity states, but suggested that they were two different B opioid receptor sUbtypes. In addition, Sofuoglu et aI. (1992) showed that DPDPE and DADLE had higher affinities for the sites labeled by either [3H]DPDPE or [3H]DADLE than those labeled by [3H]DSLET, whereas DSLET showed equal affinity for the sites labeled by [3H]DPDPE, [3H]DADLE and [3H]DSLET. Thus, these binding data imply a multiplicity of B opioid receptors in brain membrane preparations. Molecular Cloning ofthe Opioid Receptors

Although B opioid receptor heterogeneity IS supported by pharmacological studies, mUltiple B opioid receptors have not been cloned. A B opioid receptor was first cloned by two independent groups using the same functional expression cloning and random primed cDNA library construction methods (Evans et aI., 1992; Kieffer et aI., 1992). The clone was obtained from NG 108-15 cells cDNA, and was identified as a mouse B opioid receptor by Evans et ai. (1992) and Kieffer et ai. (1992). Althought the initial deduced amino acid sequence published by Evans et ai. (1992) and Kieffer et aI. (1992) were different due to a frame shift of the nucleotide sequence, the correct sequence of the clone (Kieffer et aI., 1992) is identical 38 to the sequence published by Evans et al. (1992). Based on the Evans et aI. (1992) report, the cDNA encoding the mouse () opioid receptor is 1.116 kb and encodes a 372 amino acid protein with significant homology to the somatostatin family of G-protein coupled receptors. Seven transmembrane domains and the two consensus glycosylation sites in the N-terminus, were identified for this clone. MUltiple consensus sequences for phosphorylation appeared on several cytoplasmic domains including the third intracellular loop thought to mediate the interactions of the receptor with G-proteins. Radioligand binding studies further proved that this clone has () opioid receptor binding properties, and its ability to inhibit cAMP accumulation was also measured (Evans et aI., 1992). Subsequently, a mouse () opioid receptor was also cloned by Yasuda et aI. (1993) from a mouse brain cDNA library and showed complete sequence identity to that published by Evans et al. (1992) and Kieffer et al. (1992). Additional opioid receptors were cloned and their deduced amino acid sequence were published. A mouse K opioid receptor was cloned from adult mouse brain as part of a somatostatin receptor project (Yasuda et aI., 1993). A rat f.1 opioid receptor was cloned (Chen et aI., 1993) from a rat brain cDNA library by using the polymerase chain reaction (PCR) with primers designed based on the published mouse () opioid receptor sequence (Evans et aI., 1992). This rat f.1 opioid receptor shared about 60% amino acid homology to the mouse () and K opioid receptors. At the same time, Fukuda et aI. (1993) also cloned an identical rat f.1 opioid receptor, as well as a rat () 39 opioid receptor. The rat and mouse 0 opioid receptors shared 97% amino acid identity with little interspecies difference. Moreover, a rat 1C opioid receptor was also cloned by using peR and cDNA library screening methods (Minami et aI., 1993; Nishi et aI., 1993). Finally, a human Jl opioid receptor was recently cloned and showed 95% amino acid identity with the rat Jl opioid receptor (Wang et aI., 1994). Interestingly, no structure difference is observed to support the existence of 8, Jl and 1C opioid receptor subtypes. There are several possible reasons for this: (1) Opioid receptor subtypes differ greatly in their molecular gene structure and cannot be easily obtained by homology screening methods. (2) The subtypes may be expressed at very different levels. (3) The subtypes of the opioid receptors may result from the differential mRNA processing by alternative splicing. (4) Apparent subtypes of the opioid receptors may result from their being coupled to different effector systems in different tissues. Research Hypotheses The motivation for the characterization of 8 opioid receptors is to ultimately produce drugs for pain relief having limited or no adverse side effects. The existence of subtypes of the 8 opioid receptor offers further possibilities to design even safer and more effective analgesics through selectivity for only one of the 8 opioid receptor subtypes. However, the rational modification of 8 selective drugs requires a better understanding of the physiology, pharmacology and molecular biology of these receptors and 40 their subtypes. It is of particular importance that compounds under development for therapeutic use be tested with the human forms of the target receptor. Therefore, the central research hypotheses in this dissertation are (1) A human B opioid receptor can be cloned from human cDNA libraries by homology screening using a mouse delta opioid receptor cDNA probe. (2) The human delta opioid receptor has a different amino acid sequence from the murine delta opioid receptors. It will be very important to clone, express and characterize a human B opioid receptor in order to test these hypotheses. In addition, the rapid development of new B selective opioids in clinical practice would be facilitated by the availability of isolated human B opioid receptors. The recent cloning of the mouse and rat B opioid receptors (Evans et aI., 1992; Kieffer et aI., 1992; Yasuda et aI., 1993; Fukuda et aI., 1993) provide a possible way for the cloning and characterization of human B opioid receptors. Since the seven transmembrane domains of the opioid receptors share significant homology to each other, the fragments derived from these transmembrane regions can be used as specific probes for homology screening of human cDNA libraries. Once the nucleotide and deduced amino acid sequence of a human B opioid receptor are obtained, a recombinant cell line expressing only this human B opioid receptor can be developed. This cell line will allow investigators to study the human B opioid receptor in isolation from Jl or K opioid receptors. This will enable the determination of the characteristics of 41 human 0 opioid receptors including its ligand requirements, agonist and antagonist binding domains and second messenger functional coupling. The binding profiles of several 0 selective ligands can be compared for the cloned human 0 opioid receptors to the mouse and rat 0 opioid receptors. Furthermore, the possible mechanisms of the human 0 opioid receptor desensitization including receptor phosphorylation and down-regulation can be studied on the cloned human 0 opioid receptor(s). The drugs selective for the 0 opioid receptors under development can be tested in the cells stable expressing this human 0 opioid receptor. Finally, antibodies selective for human 0 opioid receptors can be produced and they will be useful for the studies of the distributions of human 0 opioid receptors. Explanation of Dissertation Format The principle format of this dissertation is based on the "Manual for Theses and Dissertations" required by the Graduate College in the University of Arizona. Basically, the dissertation contains a general journal format including abstract, introduction, materials and methods, results, discussion and conclusion in six subsections. It describes the cloning, expression and partial characterization of a novel human 0 opioid receptor. The references cited for this dissertation are listed based on the format of the Journal ofPharmacology and Experimental Therapeutics. 42

MATERIALS & METHODS Cell Lines NG 108-15 cells were obtained from the fusion of mouse neuroblastoma and rat glioma hybrid cell line (Hamprecht, 1977). These cells were found to contain high densities of B opioid receptors without containing Jl and K opioid receptors (Chang and Cuatrecasas, 1979). The B opioid receptors in the NG 108-15 cells have been also characterized using [3H]DPDPE (Knapp and Yamamura 1990). COS-7 cells are African Green Monkey kidney cells, derived from CV-l cells transformed with early origin-defective mutants of the SV -40 virus (Gluzman, 1981). The term COS refers to CV-l Origin SV-40. These cells allow the rapid and high replication of any plasmid containing the SV -40 early origin, and express foreign genes on plasmids having a suitable promoter with high efficiency. This cell line is suitable for transient transfection and have been used for the expression of many receptor proteins including the B opioid receptors (Evans et aI., 1992). Chemicals & Opioid Compounds Chemicals were purchased from commercial sources at the highest grade of purity available. Peptides including [4'-CI-Phe4]DPDPE (Toth et aI., 1990) and [D-Ala2, Glu4]deltorphin (Erspamer et aI., 1989; Misicka et aI., 1991) were synthesized by established methods. Naltrindole (NTI) was obtained from Research Biochemical Inc. (Natick, MA). The opioid compounds such as Jl selective ligands PLO 17, DAGO, morphine, K 43 selective ligands U-69593 and U-50488 and 0 selective ligands BNTX, NTB and naltrexone were purchased from Peninsula Laboratories Inc. (Belmont, CA) or Sigma Chemical Co .. [3H]NTI was obtained from New England Nuclear (Boston, MA) having a specific activity of 30.5 Ciimmol. Molecular Cloning Techniques Messenger RNA Isolation NG 108-15 cells messenger RNA (mRNA) was isolated usmg the FastTrack mRNA Isolation Kit Version 3.0 as described by the manufacture (Invitrogen San Diego, CA). The cells were rinsed with 5.0 ml of phosphate buffered solution (PBS buffer) without calcium and magnesium (PD buffer), and incubated with 5.0 ml ofPDIEDTA solution (Versene, IX) at 370 C for 10 min. After being dislodged from the flask, and transferred to a 50 ml tube, the cells were centrifuged at 6500 rpm for 5 min. Lysis buffer (15 ml) containing 300 JlI of RNase protein degrader (provided by Kit) was added to the cell pellet, and shaken gently. The cells were resuspended by passing the suspension through a sterile 30 cc syringe with a 20 gauge needle seven times, and then incubated at 470 C for 1.5 hrs in a shaking water bath. The cell lysate was then mixed thoroughly with 950 JlI ofNaCI (5.0 M) and one Oligo(dT) 20 - 30 Cellulose tablet. The tube was shaken gently for 2 min to allow the tablet to swell, and was then rocked at room temperature for 45 min. After centrifugation at 6500 rpm for 5 min, the Oligo( dT) cellulose was resuspended with 20 ml of high salt binding buffer (provided by Kit) two times and then resuspended with 10 ml of low salt wash buffer 44

(provided by Kit) two times. The final pellet was resuspended with 600 fll of low salt wash buffer and loaded onto the column drop by drop. The column was washed with 450 fll of low salt wash buffer two times, and the mRNA was eluted from the column to the RNA Eppendorf tubes using a no salt elution buffer (provided by Kit). The mRNA was then precipitated using 0.1 volumes of 2.0 M sodium acetate (NaOAc) and 2.0 volumes of 100% ethanol at -200C overnight, and then centrifuged at 14,000 rpm for 30 min. After rinsing with 70% ethanol, the RNA was dried in the SpeedVac (SAVANT Instrument Inc., Farmingdale, NY) for 10 min, and dissolved in 50 fll diethylpyrocarbonate (DEPC) treated (nuclease-free) water. The quality of isolated mRNA was checked by mRNA gel electrophoresis. The OD260 of mRNA sample was determined by spectrophotometric measurement on a Lamda 3B, UV NIS Spectrophotometer (Perkin-Elmer Corporation, Norwalk, Connecticut). The mRNA concentration was then calculated using the equation OD260 x 40 x dilution factor = flg/fll of mRNA. Double Stranded eDNA Synthesis The mRNA was reverse transcribed to single stranded cDNA using avian myeloblastosis virus (AMY) reverse transcriptase. This reaction was started by the annealing of the poly(T) primer (2.5 flg) to the poly(A) tail of the mRNA (5.0 Jlg). The solution was heated at 750C for 10 min and briefly centrifuged for 5 seconds. The mixture was then incubated overnight by placing the tube into a beaker (250 ml) filled with 750C water. The 45 transcription of mRNA to eDNA was performed by adding 5X first strand buffer (0.2 volume), RNasin (1:4 dilution, 0.1 volumes), sodium pyrophosphate (40 mM, 0.1 volume), avian myeloblastosis virus (AMY) reverse transcriptase (15 units/Ilg mRNA) and nuclease-free water to the previous annealed mixture. The final reaction volume was 55 III (for 5 Ilg mRNA). The reaction mixture was incubated at 420 C for 60 min, and then placed on ice. The second strand cDNA was synthesized by adding lOX second strand buffer (27.5 Ill), E. Coli DNA polymerase (23 units/1 st reaction volume =

6.5 Ill), E. Coli. RNAase H (0.8 units/l st reaction volume = 2.0 Ill) and DEPC nuclease-free water combined with the first reaction mixture. The final volume was 275 Ill. After a 3 hrs incubation at 140 C, the sample mixture was heated to 700 C for 10 min, and centrifuged at 14,000 rpm for 5 seconds. Ten III ofT4 polymerase (2 units/Ilg input ofmRNA) was added to the tube containing synthesized cDNA, and incubated at 370 C for 10 min to ligate the small cDNA fragments. The double stranded cDNA (dscDNA) product was precipitated after adding 0.1 volumes of sodium acetate (NaOAc, 3.0 M) and 2.0 volume of 100% ethanol as described above. The quality of synthesized dscDNA was determined by agarose gel electrophoresis using Tris-Borate-EDTA (TBE) buffer. The DNA concentration was determined by the measurement at OD260 on a Lamda 3B, UVNIS Spectrophotometer (Perkin-Elmer Corporation, Norwalk, 46

Connecticut) and calculated using equation OD260 x 50 x dilution factor = flg/fll DNA. Preparation of Delta Opioid Receptor cDNA Probes Using the Polymerase Chain Reaction (PCR) Two sets of polymerase chain reaction (PCR) primers were designed from the mouse B opioid receptor (mDOR) open reading frame (ORF) sequence (Evans et aI., 1992) using the Oligo DNA primer analysis computer program (Oligo. 4.1) to predict their potential efficiency in a PCR reaction. The sequences of the first set of primers were 5'-GGGTCTTGGC TTCAGGTGTCG-3' (sense) and 5'-GCAGCGCTTGAAGTTCTCGTC-3' (antisense). NG 108-15 cells cDNA was used as the template. This set of primers amplified a 467 bp fragment, corresponding to nucleotides 518-984 (from transmembrane region IV to transmembrane region VII) of the mDOR ORF (Evans et aI., 1992), and was referred to as a 0.46 kb mouse probe. The sequences of the second set of primers were 5'-GCCCCTCGTCAACCTCT C-3' (sense) and 5'-GCCACGTTTCCATCAAGTA-3' (antisense). This set of primers amplified a 256 bp segment corresponding to nucleotides 42-325 of the mDOR ORF (Evans et aI., 1992), and was referred to as a 0.25 kb mouse probe. Both sets of primers were synthesized with a Cyclone Plus DNA Synthesizer (Milligen Biosearch, Burlington, MA). The PCR was carried out in a final volume of 50 fll consisting of 10 fll of PCR reaction buffer (lOX concentration) with 1.5 mM MgCl2 provided by Boehringer Mannheim (Indianapolis, IN), 10 fll of deoxynucleotides triphosphates 47

(dNTPs, Boehringer Mannheim, Indianapolis, IN, 200 /1M), 1.0 ng!/11 of each primer, 5.0 ng cDNA template and 0.5 /11 (2.5 U) Thermus aquaticus (Taq) DNA polymerase (Boehringer Mannheim, Indianapolis, IN). The reactions were performed for 30 cycles consisting of a 1.0 min denaturation step at 940 C, a 2.0 min annealing step at 600 C and a 3 min extension step at 720 C. At the end of the 30 cycles, a 10 min extension at 720 C was included. These two sets of primers and PCR conditions were shown in Figure 1. The PCR products were separated on a 1% agarose gel using Tris-Acetate­ EDTA (TAB) buffer. The DNA fragments were extracted from the gel using the QIAEX method (QIAGEN Inc. CA). The purified cDNA was ligated into pCRII cloning vector (Invitrogen, San Diego, CA) and transformed into JSS competent cells (Bio-Rad Laboratories, Richmond, CA) by electroporation. Transformed JSS cells were selected for the presence of ampicillin resistance by their growth on LB agar plates containing 100 /1g!/11 ampicillin. Plasmids containing DOR cDNA insert were produced by mass culture of a single recombinant JSS clone for plasmid purification (Wizard™, Mini- or Maxi-preps, Promega, Madison, WI) and sequenced using dideoxy-chain termination method (see Sequence Analysis). Preparation ofRadio labeled ([32pJ) cDNA Probes Plasm ids containing the 8 opioid receptor (DOR) cDNA fragment were digested at the cloning sites using restriction digestion enzyme EcoR I. After separation on a 1% TAE agarose gel, the cDNA insert was purified from the gel. 48

~GTCTTGGCTTCAGGTGTCG~ 5'-GCCCCTCGTCAACCT~' ~ r= ' pi • 5' Primer 5 ~er 5' I --7 I 3' NG 108-15 256 bp f= 467 bp 7p. eDNA 3' Primer ~ ~m~ _------.....1" ~ 5'-GCCACGTTTCCATCAAGTA-3' 5'-GCAGCGCTTGAAGTTCTCGTC-3'

Elongation Denaturation (94 0 C, 1 min) (72 0 C, 3 min)

Annealing (60 0 C, 2 min) I J t 0.25 kb Mouse Probe 2 0.46 kb Mouse Probe 1 (5' end mouse probe) (3' end mouse probe) t t Dot Blot Analysis Hybridization Screening of a Human Striatal eDNA Library

Figure 1. Primers and Conditions for PCR Amplification.

The PCR primers were designed based on the mDOR ORF sequence (Evans et aI., 1992), and synthesized using a Cyclone Plus DNA Synthesizer. The sequences of these primers are shown here. PCR was performed by using these primers combined with NG 108-15 cells cDNA as a template. The PCR conditions are also shown here. Two PCR products were obtained, referred to as a 0.46 kb mouse probe and a 0.25 kb mouse probe. 49

The purified cDNA was random prime labeled with [a-32P]dCTP (New England Nuclear, Boston, MA) using reagents provided by Boehringer Mannheim (Indianapolis, IN) for use as a screening probe. The labeling reaction was performed by mixing 300 ng cDNA and dNTPs with Klenow enzyme and incubated overnight at 37oC. The reaction was terminated by adding 2.0 JlI of EDTA (0.2 mM) with 78 JlI of sterile water. The mixture was then purified using a Quick Spin TM column (Boehringer Mannheim, Indianapolis, IN) to separate incorporated from the free [32p]. The radioactivity was counted with Ecolite( +) liquid scintillation cocktail (lCN, Covina, CA) by a Beckman scintillation counter (LS6000SE). Filter Replica Hybridization Screening ofHuman cDNA Libraries Human striatal and temporal cortical cDNA libraries were screened using conserved filter replica hybridization screening method (Sambrook et aI., 1989) as shown in Figure 2. Briefly, the cDNA library phage was incubated with XL-Blue or BB4 bacterial cells and plated with top-agar at a precalculated titer of about 50,000 to 80,000 plaque forming unit (Pfu) onto 100 mm LB-plates. The plates were incubated for approximately 8 hrs at 370 C and then stored overnight at 4oC. Duplicate Hybond-N filters (Amersham) were used to lift phages from the plaques to produce replicates of the plates and then dried for 2 hr. Filters with phage DNA were denatured with sodium hydroxide (NaOH, 0.5 M), neutralized with Tris-HCI (1.0 M)/EDTA (1.0 mM) buffer. After cross-linking the DNA to the filters using UV light for 2 min, the filters were then prehybridized at 420 C in buffer 50 containing 5X SSC, 50% formamide, 5X Denhardt's solution, 25 mM sodium phosphate (PH 7.0), 1% (w/v) sodium lauryl sulfate (SDS), and 50 /-Lg!ml salmon sperm DNA. After 3 hrs prehybridization, the radiolabeled probe was added for overnight incubation (at least 18 hr) at 420 C (high stringency hybridization condition). The hybridization reaction was terminated by washing the filters in buffer containing 6X SSC and 0.1 % SDS (low stringency wash condition), and incubated for approximately 1 hr at 420 C in the same washing solution to remove any nonspecifically bound probe. The filters were then rinsed again using a 6X SSC solution, dried and placed in cassettes against a sheet of Hyperfilm-MP (Amersham). The films were exposed at -700 C for 48 hr' and then developed with Kodak D-19 developer and fixer. Positive signals on the autoradiography film that were present on both duplicate filters were used to find the corresponding location of the phage lysate plate. Phage samples were removed from the top-agar and transferred to 1.0 ml of suspension medium (SM buffer) containing NaCI (100 mM), MgS04 (8.0 mM), Tris-HCI (50 mM) and gelatin (0.01 %). The isolated phage were used to infect bacterial cells for further second and third screenings until a phage clone was isolated. Since both cDNA libraries were constructed in the A. ZAP II vector (Stratagene, La Jolla, CA), phages showing hybridization to the probe after the third screening were used to infect SOLR bacterial cells in the presence of helper phage and amplified in culture medium (EXASSISTTM/SOLRTM 51

System, Stratagene, La Jolla, CA). The helper phage will excise the cDNA insert in a circular pBluescript SK(-) (PBS) plasmid vector. Figure 3 shows the diagram of the excision of pBS phagemid from A ZAP vector. The cDNA insert in pBluescript (PBS) was then transformed into JSS competent cells (Bio-Rad Laboratories, Richmond, CA) and prepared by plasmid purification (Wizard TM, Mini- or Maxi-preps, Promega, Madison, WI). HostCeUs 50,000 pfu library DN~ ~ in vector ~ Top Agarose

Pour and incubate at 4ZOC for 8 hI'? ~!:::::::=~~;;:::i Plate wI clear lysate plaques I Transfer plaque DNA 1. Denatu~e us~g Na,?H from plate to Hybond filter 2. Neutra~ usmg Tns-HCUEDTA 3. Wash with 2X ssc ~~----7~ H b .d" ti 1. Buffer containing 50% formamide I y n JZa on: 2. Incubate at 420 C , 3 hrs \jj (High Stringency) 3. Add radio-labeled probe Cross-link using UV 4. (.,.ba" (8 brs at 42 OC/ ~ Washing Condition (Low Stringency): 1 1. Wash in 6X sse with 0.1 % SDS for 1 hrs 2. Rinse in 6X SSC 3. Dry 00 Expose to X-Ray film 00 for 72 hrs. at -70 '\:: 00

Figure 2. Filter Replica Hybridization Screening Method. 52

Excision of pBluescript SK- phagemid froin A. Zap IT

T3 insert T7

pBluescript SK­ A--J cl8S7 Phaoemid terminator initiator +helper phage c:o-infection tenninator initiator I" f1(-) origin T7

insert

AmpR T3

Figure 3. Excision ofpBluescript SK- (PBS) Phagemid from A ZAP II.

The human striatal eDNA library was constructed into A ZAP II vector and the interested eDNA insert was contained in the pBS phagemid. The pBS phagemid can be excised by a helper phage co-infection. The interested eDNA insert was then released by the EcoR I restriction enzyme digestion. 53

Dot Blot Hybridization Analysis ofcDNA Clones DNA plasmids (1.0-10 ng) were spotted directly on Hybond-N filters (Amersham). After being dried for 2 hrs at room temperature, the DNA was denatured with sodium hydroxide (NaOH, 0.5 M), neutralized with Tris­ HCI (1.0 M)/EDTA (1.0 mM) buffer, and then cross-linked to the filters using UV light for 2 min. The filters were then incubated at the high stringency hybridization condition as described above, stopped by rinsing the filters in IX SSC and 0.1% SDS washing solution (high stringency wash condition), and incubated at 420 C for I hr to remove any nonspecifically bound probe. The filters were then rinsed again using a IX SSC solution, dried and placed in cassettes against a sheet of Hyperfilm-MP (Amersham) for 48 hr exposure at -700 C, and then developed with Kodak D-19 developer and fixer. Sequence Analysis Sequence analysis was performed by the dideoxy chain-termination method using the Sequenase Version 2.0 DNA Sequencing Kit as described by the manufacture (U.S. Biochemical Corp., Cleveland, OH). Briefly, the purified plasmid DNA was denatured by adding 0.1 volumes of 2.0 M NaOH 12.0 mM EDTA buffer and incubated for 30 min at 370 C. After neutralizing the DNA solution with 0.1 volumes of 3.0 M sodium acetate (NaOAc, pH 4.5 - 5.5), the DNA was precipitated with 2.0 volumes of 100% ethanol for 15 min at -700 C and centrifuged at 14,000 rpm for 30 min. The pellet DNA was washed with 70% ethanol and redissolved in 7.0 54

III of distilled water. The annealing reaction was then perfonned by adding

2.0 III of Sequenase reaction buffer and 1.0 III of primer, heated at 6S O for 2 min. The mixture was cooled slowly in a small beaker of 6SoC water and placed at room temperature to cool. Once the temperature was below 3SoC (about IS-30 min), the annealing mixture was centrifuged briefly and chilled on ice. The labeling reaction was perfonned by adding 1.0 III of dithiothreitol (DTT, 0.1 M), 2.0 III of diluted Labeling Mix (I:S dilution using sterile water), 2.0 III of diluted Sequenase enzyme (l:8 dilution using Enzyme Dilution Buffer) and 0.5 III of [a._35S]dATP (New England Nuclear, Boston, MA, 10 IlCi/lll) to the ice-cold annealed DNA mixture (10 Ill), mixed thoroughly and incubated for 2-S min at room temperature. The tennination reaction was carried out by transferring 3.S III of labeling reaction to each tennination tube containing G, A, T and C, mixing and continuing to incubate for S min at 370 C. The final reaction was stopped by adding 4.0 III of Stop Solution (provided by Kit). The sequencing gel was prepared 2-20 hrs prior to use by completely dissolving 31.S g of urea (lCN Biomedicals, Inc., Aurora, Ohio) in 10 ml of Tris-Borate-EDTA (TBE) buffer (Boehringer Mannheim, Indianapolis, IN, lOX), 7.5 ml of Long-Ranger™ gel solution (J. T. Baker, Inc., Phillipsburg, NJ, 50% concentrate) and sterile water up to 75 ml volume. Three hundred seventy-five III of 10% ammonium persulfate (APS, Sigma) and 37.5 III of N, N, N', N'-tetramethyl-ethylenediamine (TEMED, Sigma) were added just before pouring the gel. The gel was prewanned to 500 C by 55 applying voltage to give a constant power of 60 watts before use. When the gel was ready for loading, the samples were heated at 75 0 C for 2 min, centrifuged briefly and chilled on ice. Four fl} of each sample was then loaded on the gel under a constant power of 60 watts. After approximately 1.5 hrs, another 4.0 fll of each sample reaction was denatured at 75 0 C for 2 min and loaded on to the gel at the same condition as described above. The gel was then removed at the end of the experiment, attached to a sheet of blotting paper (Bio-Rad Laboratories, Richmond, CA), dried for 30 min using a Gel Dryer (Bio-Rad Laboratories, Richmond, CA, MODEL 583), placed in cassettes against a sheet of Hyperfilm-MP (Amersham) for 36 hr exposure at -700 C, and then developed with Kodak D-19 developer and fixer. The sequence was read manually from the developed film. Sequence alignments and homology searches were determined using DNASIS Version 2.0 (Hitachi Software Engineering Co., San Bruno, CA). Reconstruction of a Human Delta Opioid Receptor (hDOR) Open Reading Frame Two human cDNA clones 78-4 and 44-11, corresponding to the 5' end of the mDOR ORF and the 3' end of the mDOR ORF, respectively, were ligated together at a common Hinc II site to obtain a full cDNA clone encoding the human delta opioid receptor (hDOR). The diagram of the reconstruction of these two clones is shown in Figure 4. Basically, these two clones were first digested with Hinc II restriction enzyme alone (for the 78- 4 clone) and Hinc IIIApa I (for the 44-11 clone) restriction enzymes for 12 56 hr at 37oC, and loaded on to a 1% TAE agarose gel for electrophoresis. The 3.5 kb fragment (78-4 + pBS vector) and the 1.1 kb fragment (from 44-11) were isolated by electroelution. The two fragments were then ligated using T4 ligase (Promega, Madison, WI) at 150 C for 12 hrs, and transformed into JS5 competent cells (Bio-Rad Laboratories, Richmond, CA) by electroporation. The full cDNA insert (78x44) was confirmed by digestion with EcoR I, Apa I and Hinc II (Promega, Madison, WI) restriction enzymes. Expression & Partial Characterization of the Assembled Human cDNA Clone The full cDNA construct (78x44) was transferred from the pBS vector (Stratagene, La Jolla, CA) into a pcDNA3 expression vector (Invitrogen, San Diego, CA) by restriction enzyme digestion at the EcoR I and Apa I sites and T4 ligation as described above. The recombinant vector (78x44- pcDNA3) was tranfected into COS-7 cells (30 J..lg/162 cm2 culture flask of 50 - 80% confluency) using the DEAE-Dextran method (DEAE Profection, Promega, Madison, WI) for transient expression. Briefly, 30 J..lg of DNA was diluted to a final volume of 540 J..lI in IX PBS buffer, and mixed with 28 J..lI of 10 mg/ml DEAE-Dextran. After washing the cells twice with 15 ml of prewarmed PD buffer, the DNAlDEAE-Dextran mixture (568 J..lI) was added to the flask and dispensed evenly over the cells. The concentration of DEAE-Dextran added to the cells was 0.5 mg/ml. 57

644 bp --I 1124 bp TGA ATG HincH EcoRI Smal \;;:I:::I:=C::::I=Z::::Z::±=:::;I EcoHinc RI II ~"'----"'-=:::::;J EcoRSma I I Pst I Apa I Pst I Bst XI ~I h~

T3 T3 T7

Restriction Enzyme Digestions T4 Ligation

1.7kh ------+ 0.6 kb I 1.1 kb Hinc H TGA

EcoR I Apa I Pst I Q:::c:i::;lg;;::c::c:------.J!!. Sma I T7 Sst XI T3

Figure 4. Reconstruction of a Human cDNA Containing a Full Length hDORORF.

Clone 44-11 in pBS vector was digested by Hinc II and Apa I, and a 1.1 kb insert was released. In the mean time, clone 78-4 in pBS vector was also digested only with Hinc II, and a 3.5 kb band (0.6 kb insert + 2.9 kb pBS vector ) was obtained. The two fragments were then isolated from the gel, ligated using T4ligase. The reconstructed human cDNA insert (78x44) was about 1.7 kb. These studies were majorly performed by Dr. Knapp and Dr. Malatynska in Dr. Yamamura's laboratory. 58

After incubation at 370 C for 30 min, 6.0 ml of prewarmed Dulbecco's Modified Eagle Medium (DMEM) with 10% Fetal Bovine Serum (FBS) and 100 JlI of chloroquine were gently added to the culture flask, and further incubated for up to 2.5 hrs at 370 C. The DEAE-DMEM medium was then removed, and another 25 ml fresh prewarmed DMEM-I0% FBS medium was added to the cells. The cells were continuing incubated at 370 C in a humidified atmosphere incubator (5% C02 and 95% air) for 48 hr. peR Amplification ofthe Full Length hDOR ORF A set of primers was designed based on the sequences of the 78x44 reassembled human cDNA clone. The sense primer was 5'-ATGGAACCG GCCCCCTCCGCCGGCGCC-3', which was derived from the 78-4 human temporal cortical cDNA containing a receptor start codon ATG. The antisense primer was 5'-(T)CAGGCGGCACGGCCACCGCCGGGACC-3', which was derived from the 44-11 human striatal cDNA containing a receptor stop codon TGA. The human occipital cortical cDNA library, the human striatal cDNA library and the human temporal cortical cDNA library were used as templates for the PCR amplification. The contents of the PCR mixture were obtained from Boehringer Mannheim PCR Core Kit as previously described except the magnesium concentrations (0.25 mM - 5.0 mM) were adjusted in the reactions. The reactions were performed for 35 cycles consisting of a 4.0 min denaturing step at 940 C, a 2.0 min annealing step at 670 C and a 3 min extension step at 720 C. At the end of the 35 cycles, a 7 min extension at 720 C was included. The PCR products were 59 then subcloned into pCR II vector (Invitrogen, San Diego, CA), transformed into JS5 competent cells (Bio-Rad Laboratories, Richmond, CA) by electroporation, amplified in liquid culture for plasmid purification (Wizard™, Mini- or Maxi-preps, Promega, Madison, WI) and sequenced as previously described. COS-7 Cell Membrane Preparations The transfected COS-7 cells were detached with 5.0 mM EDTA in PD buffer. After centrifugation, the harvested cell membrane pellets were stored at -20oC for further use. All frozen membranes were used within one weeks. On the day of the experiment, the membrane pellets were resuspended in 40 volumes of fresh Tris-Mg buffer containing 50 mM Tris-HCI/5.0 mM

MgCl2 (PH = 7.4) and homogenized using a motor-driven Teflon-glass tissue grinder. The membrane homogenates were then centrifuged at 48,000 x g for 15 min at 4oC. The crude membrane pellets were resuspended in another 40 volumes of Tris-Mg buffer and incubated at 25 0 C for 30 min. The final cell membranes were collected by centrifugation and resuspended in fresh Tris-Mg buffer before use in radioligand binding assays. Membrane protein was measured by the Lowry protein assay (Lowry et aI., 1951). Radioligand Binding Assays Tissue Dependence ofSpecific Binding Tissue dependence studies measured the specific radio ligand bound at several tissue concentrations. The membrane concentration that is used in further binding studies must bind less than 5% of the lowest concentration 60 of total radioligand added. The tissue dependence of specific binding was determined using three different delta opioid receptor selective radioligands, [3H]NTI (100 pM), [3H][4'-CI-Phe4]DPDPE (0.75 nM), and [3H][D-Ala2, Glu4]Deltorphin (0.5 nM) at three COS-7 cell membrane concentrations. Saturation Studies The equilibrium dissociation rate constant (Kd) and the receptor density (Bmax) in the COS-7 cell membranes transfected with a reassembled 78x44 human cDNA in pcDNA3 expression vector and the nonrecombinant pcDNA3 vector itself were determined by saturation studies using [3H]NTI. The binding was performed at 12 (10 - 500 pM) different [3H]NTI concentrations in assay buffer containing 50 mM Tris-HC1, 5.0 mM MgCI2, 1 mg/ml BSA, 50 Jlg/ml bacitracin, 30 JlM bestatin, 10 JlM captopril and 0.1 mM phenylmethylsulfonyl fluoride (PMSF) adjusted to pH 7.4. The total binding and the nonspecific binding were defined in the absence or presence of 10 JlM naltrexone, respectively. The final volume of the assay samples was 1.0 ml. Incubations were performed at 250 C for 5 hrs to insure equilibrium at the lowest concentration of radio ligand used in the assay. The tubes were then filtered through GFIB glass fiber strips (Brandel, Gaithersburg, MD) previously treated with 0.5% polyethylenimine to reduce nonspecific binding. The filtration was done using a 48 channel Brandel Cell Harvester to separate the bound radio ligand from the free radioligand. The filtrates were washed three times with 4.0 ml of ice-cold saline and bound radioactivity measured using Ecolite(+) liquid scintillation cocktail 61

(lCN, Covina, CA) by a Beckman scintillation counter (LS6000SE) at 56% efficiency. Inhibition Studies The ligand requirements of sites labeled by [3H]NTI in the COS-7 cell membranes transfected with 78x44 human cDNA were determined by competitive inhibition studies using several unlabeled opioid receptor selective ligands. These ligands were dissolved completely in either DMSO with assay buffer or in assay buffer alone, and 10 different concentrations were prepared before performing the experiments. After adding the ligands to the tubes at different concentrations, the assay was carried out by incubating membranes with 100 pM [3H]NTI for 3 hrs at 25 0 C to obtain complete inhibition curves. The radio ligand concentrations used here were the lowest practical concentrations so that binding was restricted to preferred sites. Total binding was defined as the amount of radioligand bound to membrane proteins in the absence of inhibitor whereas nonspecific binding was defined as the amount of radio ligand bound in the presence of 10 JlM naltrexone. The G-protein-delta opioid receptor interactions were investigated in the absence (control) and presence of 100 mM sodium and 100 JlM Gpp(NH)p. The final assay volume was 1.0 ml, and the assay samples were filtered at the end of each experiment in order to insure separation of the bound from the free radioligand. The radioactivities were measured as described above. 62

Data Analysis The dissociation rate constant (Kd) and the receptor density (Bmax) for saturation studies, and the IC50 values for inhibition studies were determined by weighted nonlinear least squares regression methods (Munson and Rodbard, 1980) as previously described by Knapp and Yamamura (1990). All the binding data were analyzed using the Inplot 4.0 (Graphpad Software, Inc.) computer program. Ki values were calculated from the equation Ki=IC50/1 +[L]/Kd (Cheng and Prusoff, 1973). The F­ ratio test was used to determine the significance of differences in fit between one and two site models. Apparent differences between mean values of measured parameters were tested for significance using the Student's t test (unpaired, two-tailed) for the log values of the binding parameters. Hill slope values were given as the arithmetic mean + SEM. The untransformed Hill slope values were tested for significant differences against a population mean of 1 using the Student's t test. A p value equal to 0.05 was used as the cut-off for significance in all cases. 63

RESULTS Synthesis of Hybridization Probes Two specific cDNA fragments were obtained from NG 108-15 cells cDNA by peR amplification using two sets of primers as shown in Figure 1. Two single clear bands of about 0.46 kb and 0.25 kb, respectively, were obtained after isolation of the peR products from a 1% TAE agarose gel. These results are shown in Figures 5 and 6. The peR products were extracted from the gel, subcloned into the peR II cloning vector and sequenced. Sequence analysis showed that the sequences of these two fragments had 100% homology to the mouse B opioid receptor (mDOR) open reading frame target sequence (ORF) (Evans et aI., 1992; Kieffer et aI., 1992). The 467 bp cDNA fragment, corresponding to nucleotides 518-984 of the mOOR ORF from the transmembrane domain IV to the transmembrane domain VII (Evans et aI., 1992) will be identified here as the "0.46 kb mouse probe" ("3' end mouse probe"). The 256 bp fragment, corresponding to nucleotides 42-325, will be identified here as the "0.25 kb mouse probe" ("5' end mouse probe"). 64

A B

0.46 kb

.,.. ~0.46kb

Figure 5. A 0.46 kb PCR Product Electrophoresed on a 1% TAE Agaraose Gel.

A. PCR amplification of NG 108-15 cells cDNA using 5'-GGGTCTTGGC TTCAGGTGTCG-3' (sense) and 5'-GCAGCGCTTGAAGTTCTCGTC- 3' (antisense) primers. A 0.46 kb single band was obtained. B. The PCR product (0.46 kb) was subcloned into pCR II vector, and digested with EcoR I. A 0.46 kb insert was released and shown here. This insert is referred to as a 0.46 kb mouse probe (3' end mouse probe) and used for hybridization screening. 65

A B

~ O.25kb

0.25 kb

Figure 6. A 0.25 kb PCR Product Electrophoresed on a 1% TAE Agarose Gel.

A. PCR amplification of NG 108-15 cells cDNA using 5'-GCCCCTCG TCAACCTCTC-3' (sense) and 5'-GCCACGTTTCCATCAAGTA-3' (antisense) primers. A 0.25 kb single band was obtained. B. The PCR product (0.25 kb) was subcloned into PCR II vector, and digested with EcoR I. A 0.25 kb insert was released and shown here. This insert is referred to as a 0.25 kb mouse probe (5' end mouse probe) and used for the dot blot analysis. 66

Hybridization Screening of Human cDNA Libraries A human striatal cDNA library packaged in the "- ZAP II vector was first screened using the 0.46 kb mouse probe (3' end mouse probe) under high stringency hybridization conditions and low stringency washing conditions. A single positive plaque containing an individual clone (44-11) was produced after three rounds of cloning by limiting dilution. The three screening results are illustrated in Figure 7 (A, B & C). The isolated phage clone was then used to infect SOLR bacterial cells in the presence of the Exassist helper phage to excise the pBluescript phagemid (PBS) from the "­ ZAP II vector (Figure 4). The plasmid (PBS) containing the cDNA insert was then isolated and purified as described before (see method: Filter Replica Hybridization Screening of Human cDNA Libraries). Restriction enzyme digestion with EcoR I (cloning site) cut out a 1.6 kb cDNA insert, which was named 44-11. Sequence analysis of this 44-11 cDNA insert indicated that the beginning 768 bp of this clone corresponded to the 3' end of the mDOR ORF (Evans et ai., 1992) including the receptor stop codon TGA with a nucleotide sequence homology of 89%. The remaining portion of 44-11 (0.9 kb) was the untranslated region (UTR) downstream of the receptor ORF. The 44-11 clone lacked about 350 bp of the 5' end of the mDOR ORF including the receptor start codon ATG. A comparison of the 44-11 sequence to the mDOR ORF sequence is shown in Figure 8. A human cDNA probe was derived by digestion of the 44-11 clone with EcoR I and Not I restriction enzymes to release a 0.7 kb fragment. Figure 9 shows the 67 results of digestion with EcoR I restriction enzyme alone which cut out a 1.6 kb 44-11 clone (A), and with EcoR I and Not I restriction enzymes to release a 0.7 kb fragment (B) which was isolated on a 1% TAE agarose gel. This 0.7 kb cDNA fragment was then isolated, random primed labeled as described before, and used as a human probe to screen a human temporal cortical cDNA library, which was constructed in the A ZAP vector. The molecular structure of the mDOR ORF (Evans et aI., 1992), and the comparison of all the probes (two mouse probes and one human probe) to mDOR ORF are shown in Figure 10. After filter replica hybridization screenmg of the human temporal cortical cDNA library six times at 106 plaques/screening using the 0.7 kb human probe, three isolated clones were obtained (78-4, 78-18, and 86-15). Digestion with the EcoR I restriction enzyme revealed that all three clones were approximately 1.0 kb, which is smaller than the mDOR ORF (1.116 kb, Evans et aI., 1992). Sequence analysis further suggested that two of these clones, 78-18 and 86-15, were identical to each other and also identical to the portion of the 44-11 clone, which corresponded to the 3' end of the mDOR ORF. One of these clones (78-4) was found to contain 644 bp corresponding to the 5' end of the mDOR ORF including the start codon (ATG) with a nucleotide homology of 89%. The remaining part of the 78-4 clone was the untranslated region (UTR) containing 233 bp upstream of the receptor ORF. The sequence alignment of the clones 44-11, 78-4, 78-18 and 86-15 to the mDOR ORF is shown in Figure 11. 68

Dot blot hybridization analysis was also used to confirm whether the 78- 4 clone contained the 5' end of the B opioid receptor ORF by using the 0.25 kb mouse probe, which represents the 5' end of the mDOR ORF sequence. The results are shown in Figure 12, and are consistent with the sequence results.

A .... <:)

• • ••

Figure 7A. The First Hybridization Screening of a Human Striatal cDNA Library Using the 0.46 kb Mouse Probe.

A human striatal cDNA library was screened six times (106 plaques/screening) using the 0.46 kb mouse probe (3' end mouse probe) under high stringency hybridization and low stringency washing conditions. One positive plaque was obtained and shown here. 69

B

• •

• • o • , • • . • • • . , . • • ,

Figure 7B. The Second Hybridization Screening of a Positive Plaque Obtained from the First Screening Using the 0.46 kb Mouse Probe.

The positive plaque obtained from the first screening was isolated and screened again under high stringency hybridization and low stringency washing conditions. Many positive plaques containing the cDNA insert (44- 11) were obtained and shown here. 70

c • • • • • •(..11, . t . •• • • ~;. • • • • ,...• . • • • • • • • . • • • • •

Figure 7C. The Third Hybridization Screening of One of the Positive Plaques Obtained from the Second Screening Using the 0.46 kb Mouse Probe.

One of the positive plaques obtained from the second screening showing hybridization to the 0.46 kb mouse probe was isolated and screened again under high stringency hybridization and low stringency washing conditions. Nearly all of the A. phage plaques showed positive hybridization to the labeled probe. One of these plaques was then used to infect SOLR bacterial cells with the ExAssist helper phage. 71

Start Codon Stop Codon 5' • ___... ORF______(1.116 Kb) ... __ 3' mDOR

I 5' p::CI:::C::r::I:::C::r::I:::c;::I======~ 3' r 350 bp ORF = 0.7 kb UTR = 0.9 kb ATG I I I I EcoRI EcoRI I I 44-11 Clone I (1.6 kb)

Figure 8. Schematic Comparison of a Human Striatal cDNA Clone (44-11) to the Mouse Delta Opioid Receptor (mDOR) ORF.

A 1.6 kb cDNA insert (44-11) was obtained from a human striatal cDNA library by using a 0.46 kb mouse probe (3' end mouse probe). The 44-11 clone contained 768 bp corresponding to the 3' end of the mDOR ORF sequence including the stop codon TGA, but lacked about 350 bp of the 5' end of the mDOR ORF sequence including the start codon ATG. The 44-11 clone also contained 0.9 kb UTR downstream from the receptor ORF. 72

A B

1.6kb~

--v.7kb

Figure 9. Restriction Enzyme Digestion of the 44-11 Human Striatal Clone.

A. A human striatal cDNA clone (44-11) in pBS vector was digested with EcoR I restriction enzyme alone for 2.5 hr and electrophoresed on a 1% TAE agarose gel. A 1.6 kb single band was obtained. B. This human striatal clone was also digested with EcoR I and Not I restriction enzymes. A 0.7 kb cDNA fragment was released. The 0.7 kb cDNA fragment was then isolated and used as a human probe for further hybridization screening of a human temporal cortical cDNA library. 73

Mouse Delta-Opioid Receptor

Extracellular

• Acidic • Basic o Polar • Hydrophobic • Lipid Bilayer ~ Glycosylation Site

----I Intracellular

Figure 10. Putative Molecular Structure of the mDOR and the Comparison of Relative Positions of the Hybridization Screening Probes.

Mouse delta opioid receptor (mDOR) (Evans et aI., 1992) is a G-protein coupled receptor having a seven transmembrane domain structure. The N­ terminus of the receptor is in the extracellular region, and the C-terminus of the receptor is in the intracellular region. The relative positions of the hybridization screening cDNA probes corresponding to the mDOR sequences are shown here. Note that 0.25 kb and 0.46 kb probes are directly derived from the mDOR, whereas the 0.7 kb probe is derived from a human striatal cDNA clone (44-11). 74

l. e arne 1 434 869 1303 1738 2173 1 44-11/3a 2 mOOR ORF 3 86-1S/4a/T7 ,- 4 86-1S/4a/T3 ) 5 78-4a 6 78-18/T7 ~ 7 78-18/T3 ~ I Consensus •

Figure 11. Sequence Alignment of the Human Clones to the mDOR ORF.

Sequence analyses showed that none of the clones had the full length human o opioid receptor (hDOR) ORF. However, the entire hDOR ORF sequence is represented by the 78-4 human temporal cortical cDNA clone and the 44- 11 human striatal cDNA clone. The other two human temporal cortical cDNA clones (78-18 & 86-15) were identical to each other and corresponded to a portion of the 44-11 clone. 75

78·4 44·11

pBJuescript

Figure 12. Dot Blot Hybridization Analysis of the Human cDNA Clones Using the 0.25 kb Mouse Probe.

A 0.1 ng sample of the plasmid DNA for the 78·4 clone, 44-11 clone and pBS vector (control) were dotted on a filter and then denatured with NaOH and neutralized in Tris-HClIEDTA buffer. After cross-linking the DNA to the filter, the filter was hybridized with the 0.25 kb mouse probe under a high stringency hybridization conditions (50% formamide, 420 C), and washed under high stringency washing conditions (IX SSC + 0.1 % SDS). The 78·4 clone shows a positive hybridization after a 72 hr exposure at - 700 C, whereas the 44-11 clone and pBS vector do not show hybridization to the probe. These data show that clone 78-4 contains the 5' end of the mDOR ORF sequence, whereas clone 44-11 does not contain the 5' end of the mDOR ORF sequence. 76

Reconstruction of a Human Delta Opioid Receptor (hDOR) ORF Alignment of the 78-4 and the 44-11 clone sequences to the mouse 8 opioid receptor (mDOR) open reading frame (ORF) sequence showed that the 78-4 human temporal cortical cDNA clone and the 44-11 human striatal cDNA clone had a 296 bp overlapping regions, and shared a common Hinc II restriction site. Therefore, a human cDNA (78x44) containing the full length of human 8 opioid receptor (hDOR) ORF was constructed by ligation of the 78-4 human temporal cortical cDNA clone and the 44-11 human striatal cDNA clone at the Hinc II restriction site using T4 ligase performed by Dr. knapp and Dr. Malatynska in Dr. Yamamura's laboratory (Figure 4). The reassembled human cDNA contained a 0.6 kb fragment derived from the 78-4 human temporal cortical cDNA clone and a 1.1 kb fragment derived from the 44-11 human striatal cDNA clone, respectively. The 0.6 kb fragment could be released by digestion with EcoR I and Hinc II restriction enzymes, while the 1.1 kb fragment could be released by digestion with Hinc II and Apa I restriction enzymes. The 1.7 kb reassembled human cDNA (78x44) was initially constructed in the pBluescript (PBS) vector, and was cut by digestion with EcoR I and Apa I restriction enzymes. Digestions by EcoR I, Apa I and Hinc II restriction enzymes were used to confirm the fragments. These fragments were isolated on the agarose gels and the results are shown in Figure 13. 77

A B

-1.1 kb l.lkb_

Figure 13. Digestion of a Reassembled Human cDNA (78x44) in pBS with EcoR I, Apa I and Hinc II Restriction Enzymes.

The reassembled human cDNA (78x44) in pBS was digested with Hinc II/Apa I (A) and EcoR I1Apa I (B) restriction digestion enzymes and electrophoresed on the agarose gels. A 1.1 kb band derived from 44-11 clone and a 1.7 kb band are shown on the gels. These data suggest that the reassembled human cDNA (78x44) is 1.7 kb and that the Hinc II site is still present in the clone. 78

Transient Expression and Partial Characterization of the Reassembled hDOR The reassembled 78x44 human cDNA was then transferred from the pBS vector into the pcDNA3 expression vector for transient expression. The restriction enzyme digestion was performed with EcoR I and Apa I, and a 1.7 kb insert was released and ligated to the pcDNA3 vector by T4 ligase. The 78x44-pcDNA3 was then transiently transfected into COS-7 cells. Radioligand binding assays were performed 48 hrs. after transfection to verify that the 78x44 human clone had 0 opioid receptor binding properties. Specific binding of [3H][4'-CI-Phe4]DPDPE (0.75 nM), [3H][D-Ala2, Glu4]deltorphin (0.5 nM) and [3H]NTI (100 pM) radioligands to the transfected COS-7 cell membrane homogenates increased with increasing membrane concentrations (Figure 14). Only low levels of specific 0 receptor binding was obtained for control (untransfected) cells. Saturation studies demonstrated that COS-7 cells transfected with 78x44-pcDNA3 expressed over 1.0 pmol of receptor/mg protein as detected by [3H]NTI binding, a 0 selective antagonist (Yamamura et aI., 1992; Fang et aI., 1993). [3H]NTI had an extremely high affinity to these receptors expressed in COS-7 cells transfected with 78x44-pcDNA3 with a Kd value of 28 pM after correction for variations of expressed receptor density. The inhibition of [3H]NTI (100 pM) binding to these receptors by selective opioid ligands suggested that these receptors had the ligand requirements expected for 0 opioid receptors. A saturation isotherm for [3H]NTI binding 79 to the COS-7 cell membranes transfected with 78x44-pcDNA3 is shown in Figure 15. The representative inhibition curves by selective opioid ligands are shown in Figure 16. The inhibition constants (Kj) and Hill slopes (nH) are shown in Table 1, respectively. The a opioid receptor selective antagonists NTB and BNTX showed high affinities (Table 1) at binding sites labeled by 100 pM [3H]NTI in the transfected COS-7 cell membranes. The data for these two a selective antagonists were best fit by the one-site model. In addition, NTB, a proposed a2 selective ligand, showed 8-fold higher affinity at the sites labeled by [3H]NTI in the transfected COS-7 cell membranes than that ofBTNX, a proposed al selective ligand. The a opioid receptor selective agonists [D-Ala2, Glu4]deltorphin and [4'-Cl­ Phe4]DPDPE also showed nanomolar affinities at the sites labeled by 100 pM [3H]NTI with Hill slope values less than 1 and the data were best fit by the two-site model (Figure 16). The /..l opioid receptor selective antagonist

CTAP and a K opioid receptor agonist U-69,593 showed micromolar affinities (Table 1) for the [3H]NTI binding sites in the transfected COS-7 cell membranes. The presence of Gpp(NH)p and NaCl substantially reduced the binding affinity of the a selective agonist [4'-CI-Phe4]DPDPE in the COS-7 cell membranes transfected with 78x44-pcDNA3 (Figure 17). DNA and Amino Acid Sequence of the Reassembled hDOR (78x44) Further sequence analyses of the whole reassembled human 78x44 cDNA clone using extension sequencing primers showed that the ORF of the 78x44 cDNA contained 1116 nucleotides and had 89% sequence 80

homology to the mDOR ORF (Evans et aI., 1992), and 90% sequence homology to the rat delta opioid receptor (rDOR) ORF (Fukuda et aI., 1993). The 78x44 cDNA also contained a 233 bp untranslated region (UTR) upstream from the ORF and a 437 bp untranslated region (UTR) downstream from the ORF. This clone encodes a protein of 372 amino acids, having 93% identity to both mouse and rat delta opioid receptors. Hydrophobicity analysis of 78x44 hDOR sequence suggested that it contained seven lipophilic regions consistent with the seven transmembrane domains. The nucleotide sequence of 78x44 hDOR and its deduced amino acid sequence are shown in Figure 18. The hydrophobicity plot of 78x44 hDOR is shown in Figure 19. The alignment of the nucleotide and amino acid sequences of the 78x44 hDOR, mDOR and rDOR are shown in Figures 20 and Figure 21. The methods for the preparation of the reassembled hDOR are summarized in Figure 22. PCR Amplification of a Full Length hDOR ORF A single 1.1 kb PCR product was obtained from a human occipital cortical cDNA library using the sense primer 5'-ATGGAACCGGCCCCCT CCGCCGGCGCC-3' derived from the 78-4 human temporal cortical cDNA sequence including the start codon ATG and the antisense primer 5'­ (T)CAGGCGGCACGGCCACCGCCGGGACC-3' derived from the 44-11 human striatal cDNA sequence including the stop codon TGA. The PCR product was isolated from an agarose gel (Figure 23). A single 1.1 kb band was then extracted from the gel, subcloned into pCR II vector and 81 sequenced. Sequence analysis of this PCR product shows that this clone has 100% sequence identity to the reassembled 78x44 hDOR ORF. Using the same PCR primers and conditions as described before, no product was obtained from either the human striatal or temporal cortical cDNA libraries (data not shown). The putative molecular structure of the human 0 opioid receptor is shown in Figure 24.

o Total Binding 1m Nonspecific Binding i§ Specific Binding 3500

3000

2500

2000 DPM 1500

0-=-===+=-- NTI Deltorphin pCl.DPDPE Human 0 Opioid Receptor Nonrecombinant Vector Control

Figure 14. Tissue Dependence of Specific Binding to COS-7 Cell Membranes Transfected with 78x44-pcDNA3.

The specific binding of [3H]NTI (100 pM), [3H]deltorphin (0.5 nM) and [3H]pCI-DPDPE to the COS-7 cell membranes transfected with 78x44- pcDNA3 and nonrecombinant pcDNA vector (control) were determined. Three different membrane concentrations were used in the experiments. The figures represent the specific binding of each radioligand at the lowest tissue concentration. 82

140

120

Bound 100 • [3H]NTI 80 • Total Binding (pM) • Specific Binding 60 .& Nonspecific Binding 40

20 a a 500 1000 1500 2000 [3H]Naltrindole Concentration (pM)

Figure 15. Saturation Isotherm for [3H]NTI Binding to the COS-7 Cell Membranes Transfected with 78x44-pcDNA3.

The representative figure shows [3H]NTI binding to the COS-7 cell membranes transfected with 78x44-pcDNA3. The total binding (. TB) and nonspecific binding (.A. NSB) were defined in the absence and presence of 10 IlM naltrexone, respectively. The specific binding (. SB) is represented by the filled circles. 83

100

90

00 c 80 ~ i5 70 e: -~ 60 ....-e 50 is 0 40 c:.J c- o 30 ~ 20 10

0 I -2 -1 0 1 2 3 4 5

Inlubitor Concentration (Log nM)

Figure 16. Inhibition of [3H]NTI Binding to the COS-7 Cell Membranes Transfected with 78x44-pcDNA3 by Selective Opioid Ligands.

Specific binding of 100 pM [3H]NTI in the COS-7 cell membranes transfected with 78x44-pCDNA3 was inhibited by increasing concentrations of selective opioid ligands. The ordinate and abscissa represent percentage of control specific binding and the log of inhibitor concentrations, respectively. Nonspecific binding was defined with 10 JlM naltrexone. Incubations were perfonned at 25 0 C for 3 hr. The curves shown are obtained by averaging data from 3 or 4 independent detenninations, and fitting these data to a four parameter logistic function. The ligands used are listed as follow, NTB (0), BNTX (CJ), [D-Ala2, Glu4]Deltorphin (+), [4'CI­ Phe4]DPDPE (T), CTAP (_), and U-69593 (e). 84 Table 1

Inhibition Constants of [3H]NTI Binding to the COS-7 Cell Membranes Transfected with 78x44-pcDNA3 by Selective Opioid Ligands.

[3H]NTI (100 pM)

Ki (nM)± SEM nH ±SEM

Delta Selective Ligands

NTB 0.28 ± 0.11 1.23 ± 0.00

BNTX 2.3 ± 0.58 0.82 ± 0.13

[D-Ala2, Glu4]Deltorphin 8.7± 6.6 1.00 ± 0.36

[4'-CI-Phe 4]DPDPE 2.8± 0.11 0.72± 0.05

Mu Selective Ligand

CTAP 4,100 ± 2,100 0.79 ± 0.03

Kappa Selective Ligand

U-69593 92,000 ± 19,000 0.76 ± 0.10 85

[4'-CI-Phe 4 ]OPOPE Inhibition of [3H]NTI Binding in COS-7 Cell Membranes Transfected with hOOR w/o Gpp(NH)p and NaCI

-. 100 "0 [ 4'-CI-Phe4 ]DPDPE ..,'- • c 0 + Gpp(NH)p (100 uM) u • 75 + NaCI (100 mM) ~o.

~ '-' 50 cCl ~c iii u 25 i4: '13 a.IIJ en 91~0----~9~--~----~----~----~--~ - -8 -7 -6 -5 -4 Log [4'-CI-Phe4 ]DPDPE, M

Figure 17. [4'-CI-Phe4]DPDPE Inhibition of [3H]NTI Binding to the COS-7 Cell Membranes Transfected with 78x44-pcDNA3 in the Absence and Presence of 100 JlM Gpp(NH)p and 100 mM NaCl.

The COS-7 cell membranes transfected with 78x44-pcDNA3 were incubated at 25 0 C for 3 hr. with 100 pM [3H[NTI and 10 concentrations of [4'-CI-Phe4]DPDPE in the presence C.) or absence C+) of 100 JlM Gpp(NH)p and 100 mM NaCl. Nonspecific binding was defined with 10 JlM naltrexone. The curves shown are representative of two experiments. 86

CCGAGGAGCC'I'GCGC'I'GCTCC'I'GGCTCACAGCGCTCCGGGCGAGGAGAGCGGG CGGACCGGGGGGC'I'CGGCCGG'lUCGGGCGGCGAGGCAGGCGGACGAGGCGCAGAGACAGC ~CGGGGCGCGGCACGCGGCGGGTCGGGGCGGC=C'I"roCCGCTCCCCT CGCGTCGGATCCCCGCGCCCAGGCAGCCGGTGGAGAGGGACGCGGCGGACGCCGGCAGCC 234 ATGGAACCGGCCCCCTCCGCCGGCGCCGAGC'I'GCAGCCCCCGC'l'CTTCGCCMCGCCTCG 293 1 M EPA P SAG A E L Q P P L FAN A S 20 294 GACGCCTACCCTAGCGCCTTCCCCAGCGCTGGCGCCAA"roCGTCGGGGCCGCCAGGACCG 353 21 0 A Y P S A F P SAG A N A S G P P G P 40 354 GGGAGCGCCTCGTCCc;:rg;CCCTGGC;MTCGCCATCACCGCGC'!'C'!'A(;'!'t;;(iGCCGTGTGC 413 41 GSA S S L A L A I A T T & L Y S & v C 60 'n4I 414 cC;CGTW.GGbTGC;Z;CCC;AAc;qrGc;:rn;xc"'B'IT!'l::GGC;ATCGTCCGGTACACTAAOA'ro 473 61 " v C t, t, 9 N V ! V M '" 9 T V R Y T K K 80 474 AAOACGGCCACCAJ,C;"TtT"C;J.TbTTb""C;CTGGcc;TT"9C;C;9"TGbQc;TGQC;C;AC;C;,,qC; 533 81 K TAT N T Y TEN L " L " P " L " T S 100 'n4 II 534 AbQbTGCC'l"I"l'CCAGAG'roCCAAGTACC'I'GATGGAGACGTGGCCCTTCGGCGAGC'roCTC 593 101 ~ P F Q S A K Y L K E T W P F GEL L 120 594 TGCAAGGCTGTQc;TCTCCJ,TQQ"c;T&c;T"C;"AT&TGTTC"ccAr~"TbTTb"crrt;TC"CC; 653 121 C K A V L S T P Y Y N M E ~ $ T E T L T 140 'n4 III 654 ATG"m"CTGl'T(lACCGCTACATCGC'ro'ro'roCCACCC'I'GTCMGGCCCTGGACTTCCGC 713 141 M M $ V 0 R Y I A V C H P V K A L 0 F R 160 714 ACGCC'I'GCCAAGGCCAAOC1'1"TCI\Ac;aTtTQTJ.'I'k'lX'.r{jTCCTGGC;c;Tc;"GGC;9'rnlQC; 7 7 3 161 T P A K A K L T N I ~ I W V LAS 9 V C 180 'n4 VI 774 QTGC;C;C;mllTGQ'l";,,'lI'{jc:'!'!j'rnIlC;C;CGTCCCCGGGACGGTGCAGTGG'ro'roCA'roCTC 8 3 3 181 V P T K Y K " V T R PRO G A V V C H L 200 834 CAGTTCCCCAGCCCCAGC'I'GGTACTGGGACACGG'roACCAAO"TtTQbQmTTCc;=rc;xrc; 8 9 3 201 Q F P S P S W Y W 0 T V T K I C; Y E ~ '" 220 894 gC;c;TTbQ'lI'.qroc;c;c;mC;Z;mM'C"C;bQTGTGc;ThTGQcc;Tc;~CGCC'I'G 953 221 " E V V P T LIT T V C; Y 9 L M L ~ R L 240 'n4V 954 CGCAG'ro'roCGCCTGC'roTCGGGCTCCMGGAGAAGGACCGCAGCCTGCGGCGCATCACG 1013 241 R S V R L L S G S K E K 0 R S L R R I T 260 1014 CGCA'roG'!'Ch'lMQ1h{j'rni'll:jQGbQcc;ngrn;gmTGTIr.ooc;gC;C;C;"TCC;AC;"TC'!"!'C 1 0 7 3 261 R K V L V V V 9 A E V V C; W A P I H T E 280 'n4 VI 1074 GTCATCGTC'I'OGACGCTGGTGGACATCGACCGGCGCGACCCGc;TGQ'lWWGbTGbQbTG 1133 281 Y-.L...ll W T L V 0 lOR R 0 P L V V " Q t. 300 1134 CAC;bTGTGC;ATCQC;gCTCGQc;:"C;CC;C"ATAgcAgCc;:c""cC;C;bQTGc;TCTAC;gc;:x:c 1193 301 H L C; I " L 9 v A N S S L N P V • Y ,,'" 320 'n4 VII 1194 C:S:GACGAGAACTTCAAGCGC'I'GCTTCCGCCAGCTC'roCCGCMGCCC'I'GCGGCCGCCCA 1253 321 ~ 0 E N F K R C F R Q L C R K P C G R P 340 1254 GACCCCAGCAGCTTCAGCCGGCCCCGCGAAGCCACGGCCCGCGAGCG'roTCACCGCC'I'GC 1313 341 0 P S S F S R PRE A TAR E R V T A C 360 1314 ACCCCGTCCGATGGTCCCGGCGGTGGCCG'roCCGCC'I'GAACCCCGTCCGATGGTCCCGGC 1352 361 T P S 0 G P G G G R A A • 372 GG'roGCCG'roCCGCC'I'GACCAGGCCATCCGGCCCCCAGACGCCCCTCCCTAGT'roTACCC GGAGGCCACA'roAGTCCCAG'roGGAGGCGCGAGCCA'roA'roTGGAGTGGGGCCAGTAGAT AGGTCGGAGGGCTT'roGGACCGCCAGATGGGGCCTC'roTTTCGGAGACGGGACCGGGCCG CTAGATGGGCATGGGG'roGGCCTCTGGTT'roGGGCGAGGCAGAGGACAGATCAATGGCGC AG'roCCTCTGGTCTGGG'roCCCCCGTCCACGGCTCTAGGTGGGGCGGGAAAGCCAGTGAC TCCAGGAGAGGAGCGGGACC'I'GTGGCTCTACMC'I'GAGTCCTTAAACAGGGCATCTCCAG GAAGGCGGGGCTTCAACC'I"roAGACAGCTTCGGTTTCTAACTTGGAGCCGGACTTTCGGA GT'roGGGGGTCCGGGGCCC

Figure 18. Nucleotide and Amino Acid Sequence of 78x44 hDOR.

The open reading frame of hDOR starts at the start codon (A TG) and ends at the stop codon (TGA *) containing 1116 nucleotides. It encodes a protein of 372 amino acids. The seven transmembrane (TM I - TM VII) domains are underlined. The upstream and downstream regions contain 233 and 437 nucleotides, respectively. 87

5.00 ------, 4.00 I II III 3.00 2.00 1.00 Hydrophobicity 0.00 ~~~4Pf..l!IdHH+--"+-tt-tt-:-iiII -1.00 -2.00 -3.00 -4.00 -5.00 lL-----I10-1---2~0-:-1-----:3::0:-:1---:;::372

Residue Number

Figure 19. Hydrophobicity Plot of the Reassembled 78x44 hOOR Amino Acid Sequence.

Hybrophobic domains of the protein appear above the zero hydrophobicity line. Positions of putative transmembrane domains are indicated I-VII. 88 * * ** * * * * * **** * * * hDOR ATGGAACCGGCCCCCTCCGCCGGCGCCGAGCTGCAGCCCCCGCTCTTCGCCAAC rDOR ATGGAGCCGGTGCCTTCTGCCCGTGCGGAGCTGCAGTTTTCGCTCCTCGCCAl.C mOOR ATGGAGCTGGTGCCCTCTGCCCGTGCGGAGCTGCAGTCCTCGCCCCTCGTCAAC ** * ** * * ** hDOR GCCTCGGACGCCTACCCTAGCGCCTTCCCCAGCGCTGGCGCCAATGCGTCGGGG rDOR GTCTCGGACACCTTCCCTAGCGCCTTCCCCAGTGCGAGCGCCAATGCGTCGGGG mOOR CTCTCGGACGCCTTTCCCAGCGCCTTCCCCAGCGCGGGCGCCAATGCGTCGGGG * ** ** ** * * * * * * hDOR CCGCCAGGACCGGGGAGCGCCTCGTCCCTCGCCCTGQCAATCGCCATCACCGCG rDOR TCGCCGGGCGCCCGCAGTGCCTCGTCCCTGGCTCTGGCCATCGCCATCACCGCG mOOR TCGCCGGGAGCCCGTAGTGCCTCGTCCCTCGCCCTAGCCATCGCCATCACCGCG * * * * * hDOR CTCXACTCGGCCGTGTGCGCCGTGGQGCTGCTGQGCAACGTGCTTGTCATGTTC rDOR CTCXACTCGGCTGTGTGCGCCGTGGGGCTGCTGGGCAACGTGCTCGTCATGTTT mOOR CTCTACTCGGCTGTGTGCGCAGTGGGGCTTCTGGGCAACGTGCTCGTCATGTTT * * ** * * hDOR GGCATCGTCCGGTACACTAAGATGAAGACGGCCACCAACATCTACATCTTCAAC rDOR GGAATCGTCCGGTACACTAAGCTGAAGACGGCCACCAACATCTACATCTTCAAT mDOR GGCATCGTCCGGTACACCAAATTGAAGACCGCCACCAACATCTACATCTTCAAT * * * * * * hDOR CTGGCCTTAGCCGATGCGCTGGCCACCAGCACGCTGCCTTTCCAGAGTGCCAAG rDOR CTGGCCTTGGCGGATGCGCTGGCCACCAGCACACTGCCCTTCCAGAGCGCCAAG mOOR CTGGCTTTGGCTGATGCGCTGGCCACCAGCACGCTGCCCTTCCAGAGCGCCAAG * * * * * * hDOR TACCTGATGGAGACGTGGCCCTTCGGCGAGCTGCTCTGCAAGGCTGTGCTCTCC rDOR TACCTGATGGAAACGTGGCCGTTCGGAGAGCTGCTGTGCAAGGCTGTGCTCTCC mOOR TACTTGATGGAAACGTGGCCGTTTGGCGAGCTGCTGTGCAAGGCTGTGCTCTCC * * * * * * hDOR ATCGACTACTAC8ATATGTTCACCAGCATCTTCACGCTCACCATGATGAGTGTT rDOR ATTGACTACTACAACATGTTCACCAGCATCTTCACGCTCACCATGATGAGCGTG mOOR ATTGACTACTACAACATGTTCACTAGCATCTTCACCCTCACCATGATGAGCGTG

** * * * *** hDOR GACCGCTACATCGCTGTCTGCCACCCTGTCAAGGCCCTGGACTTCCGCACGCCT rDOR GACCGCTACATTGCGGTCTGCCACCCTGTCAAGGCCTTGGACTTCCGGACACCG mOOR GACCGCTACATTGCTGTCTGCCATCCTGTCAAAGCCCTGGACTTCCGGACACCA *** * * *** hDOR GCCAAGGCCAAGCTGATCAACATCTGTATCTGGGTCCTGGCCTCAGGCGTTGGC rDOR GCCAAGGCCAAGCTGATCAACATATGCATCTGGGTCTTGGCTTCAGGTGTTGGG mOOR GCCAAGGCCAAGCTGATCAATATATGCATCTGGGTCTTGGCTTCAGGTGTCGGG

Figure 20. Nucleotide Sequence Comparison ofhDOR, mDOR and rDOR.

The ORF of the reassembled 78x44 hDOR contains 1116 nucleotides showing 89% homology to the mDOR (Evans et aI., 1992) and 90% homology to the rDOR (Fukuda et aI., 1993). The nucleotide differences are indicated (*). The expected seven transmembrane regions are underlined. 89

hOaR GTQCCCATCATGGTCATGGCTGTQACCCGTCCCCGGGACGGTGCAGTGGTGTGC* * ** * * * rOaR GTCCCCATCATGGTCATGGCAGTGACCCAACCCCGGGATGGAGCAGTGGTATGC mOoR GTCCCCATCATGGTCATGGCAGTGACCCAACCCCGGGATGGTGCAGTGGTATGC * * * hOaR ATGCTCCAGTTCCCCAGCCCCAGCTGGTACTGGGACACGGTGACCAAGATCTGC rOaR ACGCTCCAGTTCCCCAGCCCCAGCTGGTACTGGGACACTGTGACCAAGATCTGC mOOR ATGCTCCAGTTCCCCAGTCCCAGCTGGTACTGGGACACTGTGACCAAGATCTGC * * * * hOaR GTGTTCCTCTTCGCCTTCGTGGTGCCCATCCTCATCbTCACCGTGTGCTATGGC rOaR GTGTTCCTCTTCGCCTTCGTGGTGCCCAT1CTCATCATCACCGTGTGCTATGGC mOOR GTQTTCCTCTTTGCCTTCGTGGTGCCGATCCTCATCbTCACGGTGTGCTATGGC * * * * * hOaR CTCATGCTQCTGCGCCTGCGCAGTGTGCGCCTGCTGTCGGGCTCCAAGGAGAAG rOaR CTCATGCTGCTGCGCCTGCGCAGCGTGCGCCTGCTGTCCGGCTCCAAGGAGAAG mOOR CTCATGCTACTGCGCCTGCGCAGCGTGCGTCTGCTGTCCGGTTCCAAGGAGAAG

hOaR GACCGCAGCCTGCGGCGCATCACGCGCATGQTGCTGGTGGTTGTGGGCGCCTTC* * rOaR GACCGCAGCCTGCGGCGCATCACGCGCATGGTGCTGGTGGTGGTGGGAGCCTTC mOOR GACCGCAGCCTGCGGCGCATCACGCGCATGGTGCTGGTGGTGGTGGGCGCCTTC

hOaR GTGGTGTGTTGGGCGCCCATCCACATCTTCGTCATCGTCTGGACGCTGGTGGAC* rOaR GTGGTGTGCTGGGCGCCCATCCACATCTTCGTCATCGTCTGGACGCTGGTGGAC mOoR GTGGTGTGCTGGGCGCCCATCCACATCTTCGTCATCGTCTGGACGCTGGTGGAC * * * * * * hOaR ATCGACCGGCGCGACCCGCTGGTGGTGGCTGCGCTGCACCTGTGCATCGCGCTG rOaR ATCAATCGGCGCGACCCACTTGTGGTGGCCGCGCTGCACTTGTGCATTGCGCTG mOoR ATCAATCGGCGCGACCCACTTGTGGTGGCCGCACTGCACCTGTGCATTGCGCTG

hOaR GGCTACGCCAbTAGCAGCCTC8ACCCCGTGCTCTbCGCTTTCCTCGACGAGAAC* * * * * rOaR GGCTACGCC8ACAGCAGCCTCAbCCCGGTTCTCTACGCCTTCCTGGACGAGAAC mOOR GGCXACGCC8ACAGCAGCCTC8ACCCGGTTCTCTACGCCTTCCTGGACGAGAAC

* ** * * * hOaR TTCAAGCGCTGCTTCCGCCAGCTCTGCCGCAAGCCCTGCGGCCGCCCAGACCCC rOaR TTCAAGCGCTGCTTCCGCCAGCTCTGTCGCGCGCCCTGCGGCGGCCAAGAACCC mOoR TTCAAGCGCTGCTTCCGCCAGCTCTGTCGCACGCCCTGCGGCCGCCAAGAACCC

* ** * * * * * * * * * hOaR AGCAGCTTCAGCCGGCCCCGCGAAGCCACGGCCCGCGAGCGTGTCACCGCCTGC rOaR GGCAGCCTCCGCCGTCCCCGCCAGGCCACCGCGCGTGAGCGTGTCACCGCCTGC mOOR GGCAGTCTCCGTCGTCCCCGCCAGGCCACCACGCGTGAGCGTGTCACTGCCTGC

hOaR ACCCCGTCCGATGGTCCCGGCGGTGGCCGTGCCGCC* * * * ** rOaR ACCCCCTCCGACGGCCCGGGCGGTGGCGCTGCCGCC mOoR ACCCCCTCCGACGGCCCGGGCGGTGGCCGTGCCGCC

Figure 20. Nucleotide Sequence Comparison of hDOR, mDOR and rDOR (continued). 90

10 *20 30 * 40 50 hOOR 1 MEF@[email protected] La OA/XIPSAFPSA GANASGPpc;fEl Q}:;ASSLAI..Al 50 moOR 1 M~PSARAE L S OAFPSAFPSA GANASGSPGA RSASSLALAI 50 rOOR 1 MEPVPSARAE L L ~PSAFPSA ~ASGSPGA RSASSLALAI 50 60 70 80 •• 90 100 hOOR 51 AITbLYSbVC bVGLLGNYLV MFGIYRYT~ KTATNIYIFN LALbPALbTS 100 moOR 51 blTALYSbVC bVGLLGNYLV MFGIVRYTKL KTATNIYIFN LALbPALbTS 100 rOOR 51 bITbLYSbvC bVGLLGNYLV MFGIYRYTKL KTATNIYIFN LALbPALbTS 100 110 120 130 140 150 hOOR 101 ~PFQSAKYL METWPFGELL CKAYLSIOYX NNFTSIFTLT MMSYDRYIAV 150 moOR 101 ~PFQSAKYL METWPFGELL CKAVLSlpyy NMFTSIFTLT MMSVDRYIAV 150 rOOR 101 ~QSAKYL METWPFGELL CKAYLSIPYX NMFTSIFTLT MMSVDRYIAV 150 160 170 180 190 200 hOOR 151 CHPVKALOFR TPAKAKLINI CIWVLASGYG YPIMVMb~ PRDGAVVCML 200 moOR 151 CHPVKALOFR TPAKAKLINI CIWVLASGVG VPIMYMAVTO PRDGAVVCML 200 rOOR 151 CHPVKALOFR TPAKAKLINI CIWVLbSGYG VPIMYMAVTO PRDGAVV~ 200 210 220 230 240· 250 hOOR 201 QFPSPSWYWD TVTKICVFLF bFYVPILIIT VCYGLMLLRL RSVRLLSGSK 250 moOR 201 QFPSPSWYWD TVTKICYFLF AFYVPILIIT VCYGLMLLRL RSVRLLSGSK 250 rOOR 201 QFPSPSWYWD TVTKICYFLF AFYVPILIIT VCXGLMLLRL RSVRLLSGSK 250 •• 270 280 290 300 hOOR 251 EKORSLRRIT RMVLyyyGbF YYCWbPIHIF YIVWTLVD~ RROPLVVhAL 300 moOR 251 EKDRSLRRIT RMYLVVVGbF VVCWbPIHIF YIVWTLVDIN RRDPLYVhAL 300 rOOR 251 EKORSLRRIT RMYLVVVGAF VVCWbPIHIF VIVWTLVDIN RROPLVVAAL 300 310 320 330 340. 350 hOOR 301 HLCIALGYAN SSLNPVLYbF LOENFKRCFR QLCg:CGR!EJ m~p~ 350 moOR 301 HLCIALGYAN SSLNPVLYAF LOENFKRCFR QLC CGRQ EPGSLRRPRQ 350 rOOR 301 HLClbLGYAN SSLNpYLYhF LOENFKRCFR QLC C~ EPGSLRRPRQ 350 • 360 370 380 390 400 hOOR 351 ATARERVTAC TPSDGPGGGR AA .....••. 400 moOR 351 A~ERVTAC TPSDGPGGGR AA ...... 400 rOOR 351 ATARERVTAC TPSDGPGG~ AA ...... !. 400

Figure 21. Amino Acid Sequence Comparison of hDOR, mDOR and rDOR.

The reassembled hDOR (78x44) shows 93% amino acid homology to both mDOR (Evans et aI., 1992) and rDOR (Fukuda et aI., 1993). The expected seven transmembrane domains are underlined. The potential N-terminal glycosylation sites(*) and the cytoplasmic phosphorylation sites (.) are also indicated above the sequence. The amino acid differences are boxed. 91

5' ======3' NO 108-15 cDNA

PCR 0.46 kb Mouset Probe (3' end mouse probe) Screen (Human Striatal cDNA Library) 0.25 kb Mouse Probe ~ Sequence .Missing the 5' end (5' end mouse probe) Clone 4~4_11 (1.6 kb) Analysis::> of the mDOR ORF R~striqtion Enzyme .showing 89% homology to Digestions the 3' end of the mDOR ORF EcoR I & Not I)

0.7 kb Human Probe Dot Blot Screen (Human Temporal Cortical ~ cDNA Library) 3 Clones • 78-4 (1.0 kb) l · 78-18 (1.0kb) \If .86-15 (1.0 kb) PositiveJ Clone Negative Clone I Sequence (78-4) (44-11) ~ Analysis

• None of the clones contains the full length ofDOR • Only the 78-4 clone contains 5' end of the mDOR • The 78-18 and 86-15 clones are identical to Restriction each other and to the 44-11 clone Enzyme Digestion (Hinc II & Apa I) T4 Ligation

DEAE-Dextran Reassembled Clone T f1 f ) Delta Opioid Receptor Binding Properties (78x44) rans ec Ion

Figure 22. Summary of the Cloning ofa Reassembled hDOR ORF. 92

A B

--I.) kb l.lkb_

Figure 23. A 1.1 kb PCR Product Electrophoresed on a 1% TAE Agarose Gel.

A. PCR amplification of a human occipital cDNA library using 5'­ ATGGAACCGGCCCCCTCCGCCGGCGCC-3' (sense) and 5'-(T)CAG GCGGCACGGCCACCGCCGGGACC-3' (antisense) primers. A 1.1 kb single band was obtained. B. The PCR product (1.1 kb) was subcloned into PCR II vector, and digested with EcoR I. A 1.1 kb insert was released and shown here. This insert was isolated, purified and sequenced. 93

Human Delta Opioid Receptor • Acidic • Basic o Polar @ Hydrophobic • Lipid Bilayer

In tracellular

Figure 24. Putative Molecular Structure of the hDOR. 94

DISCUSSION Cloning of a Reassembled Human Delta Opioid Receptor Since the opioid receptors 01, 0 and K) share substantial sequence homology, high stringency hybridization (50% formamide, 420 C) and low stringency washing conditions (6X SSC + 0.1% SDS, 420 C) were used to . screen human cDNA libraries for the isolation of human 0 opioid receptors. Double stranded cDNA (dscDNA) was synthesized from the NG 108-15 cells mRNA and used as a template for PCR amplification. The reasons for using NG 108-15 cells cDNA were that these cells express high levels of 0 opioid receptors (Chang and Cuatrecasas, 1979) and are expected to have high levels of 0 opioid receptor mRNA, and that the recently cloned mouse oopioid receptor was also initially obtained from this cell line (Evans et aI., 1992; Kieffer et aI., 1992). Although a full length of human 0 opioid receptor ORF has not been obtained from cDNA library hybridization screening, the entire human 0 opioid receptor ORF sequence is represented by portions of the 78-4 human temporal cortical and 44-11 human striatal cDNA clones (Figure 11). Since both clones overlapped each other by 296 bp and shared a common restriction enzyme (Hinc II) site, a human cDNA encoding a full ORF of the 0 opioid receptor was constructed by ligation (Figures 4 and 13). The reassembled 78x44 cDNA was shown to encode a human 0 opioid receptor by its pharmacological binding profiles. First, it was demonstrated that three 0 opioid receptor selective radioligands ([3H]NTI, [3H][4'-CI- 95

Phe4]DPDPE and [3H] [D-Ala2, Glu4]deltorphin) showed high levels of specific binding to the 78x44-pcDNA3 transfected cells. Second, it was shown that [3H]NTI has high affinity for the expressed receptors. Third, the binding affinities of selective opioid receptor ligands (BNTX, NTB, [4'-Cl­ Phe4]DPDPE, [D-Ala2, Glu4]Deltorphin, CTAP and U-69593) were all consistent with their affinities at () opioid receptors. The rank order of affinity of these ligands was NTB > BNTX > [4'-CI-Phe4]DPDPE > [D­ Ala2, Glu4]Deltorphin» CTAP » U-69593 (Table 1). Thus, the receptors expressed by COS-7 cells transfected with 78x44-pcDNA3 has ligand requirements expected for () opioid receptors. COS-7 cells have been used for the expression of opioid receptors by many investigators (Evans et aI., 1992; Kieffer et aI., 1992; Chen et aI., 1993; Wang et aI., 1994). The presence of a low density of () opioid receptors in this cell line was reported by Malatynska et al. (in preparation). However, it was observed that COS-7 cells transfected with 78x44-pCDNA3 could express over 1.0 pmole of receptor/mg protein when labeled by [3H]NTI (Figure 15). In contrast, no specific [3H]NTI binding was observed for the COS-7 cell membranes transiently transfected with the 78-4 human temporal cortical cDNA clone alone and the 44-11 human striatal cDNA clone alone (data not shown), which suggested that neither the 78-4 nor the 44-11 clones encoded the full open reading frame (ORF) of the receptor. 96

Evidence that the Reassembled hDOR Represents a Naturally Occurring hDOR The reconstruction of the human B opioid receptor (hDOR) ORF from two fragments obtained from clones derived from two different tissues poses the question of whether this construct exists in nature. The question can be asked: does the reconstructed hDOR represent a normal B opioid receptor sequence or a chimeric form of the B opioid receptor? To answer this question, it is very important to confirm that the two individual human clones used for the reconstruction of the hDOR ORF, represent the same human B opioid receptor. After carefully sequencing the 78-4 and the 44-11 clones at least three times, it was observed that the major parts of the sequences for the overlapping regions of the 78-4 and the 44-11 clones were completely identical. The small portion (84 bp) of the 78-4 sequence initially having extremely low homology to the 44-11, was due to the rearrangement of this clone during the library construction. Because the 84 bp sequence was complementary to a segment (position 382 to 465) of the receptor ORF removed from its expected position and orientation relative to the original 78-4 clone. The production of the full length human B opioid receptor ORF (::::: 1.1 kb) from a human occipital cortical cDNA library by PCR amplification using primers based on the sequences of the 78-4 and the 44-11 clones (Figure 23) is the strongest evidence demonstrating that this reconstructed sequence does exist in nature. The identical sequence of this PCR product to 97 The production of the full length human () opioid receptor ORF (::::: 1.1 kb) from a human occipital cortical eDNA library by PCR amplification using primers based on the sequences of the 78-4 and the 44-11 clones (Figure 23) is the strongest evidence demonstrating that this reconstructed sequence does exist in nature. The identical sequence of this PCR product to the reassembled 78x44 hDOR ORF indicated that the reassembled 78x44 hDOR ORF represents a normal human () opioid receptor rather than a chimeric form of the () opioid receptor. Dr. Eva Varga in Dr. Yamamura's laboratory performed a southern blot analysis of the genomic library using two different probes based on the N­ terminal and C-terminal sequences of the 78x44 hDOR. A single 4.6 kb band was obtained from genomic library by using these two different probes. Thus, these data further support the conclusion that the 78-4 and the 44-11 clones are indeed derived from the same receptor, and the reassembled 78x44 cDNA encodes a naturally occurring human () opioid receptor. Sequence Comparison of hDOR to the mDOR and rDOR The ORF of the reassembled 78x44 hDOR cDNA contains 1116 nucleotides, showing 89% nucleotide homology to the mDOR ORF and 90% nucleotide identity to the rDOR ORF. Most nucleotide differences are found near the N-terminus and C-terminus of the receptor ORF (Figure 20). The reassembled 78x44 hDOR cDNA also contains 233 nucleotides upstream and 437 nucleotides downstream from the receptor ORF. These 98 nuc1eotides in the untranslated region may be involved in gene regulation, and will be studied in the future. A receptor protein of 372 amino acids was predicted from the reassembled 78x44 hDOR cDNA with 93% homology to either mouse or rat 8 opioid receptors (Evans et aI., 1992; Fukuda et aI., 1993). The hydrophobic putative seven transmembrane domains of this human 8 opioid receptor (hDOR) are shown in Figures 19 and 24. Amino acid sequence comparison of hDOR to the mOOR and rDOR indicates that there are no amino acid differences in the transmembrane domains (Figure 21). The amino acids that differ from either the mOOR or the rDOR are mostly found in the N-terminus and C-terminus of the human 8 opioid receptor (hDOR) ORF (Figure 21). Two consensus glycosylation sites are found in the N­ terminus of the hDOR, and a pair of cysteine residues proposed to form a disulfide bond is also found in the first two extracellular loops (Figures 21 and 24). The mUltiple consensus sequences for phosphorylation (Ser and Thr) appear in the third intracellular loop and C-terminus. These residues may regulate G-protein coupling and receptor function (Figure 24). In addition, Reisine and associates (Livingston et aI., 1994) demonstrated that the aspartate (Asp) residues in the second and third transmembrane domains (Asp95 and Asp128) were important for agonist binding but not antagonist binding. The Asp95 reduced binding of selective agonists, while Asp128 reduced binding of all agonists (Livingston et aI., 1994). These two Asp residues are also present in this human 8 opioid receptor (hDOR), and can 99 be mutated to an asparagme (Asn) residue to further study the ligand requirements of the human B opioid receptor. Pharmacological Comparison of hDOR to the mDOR and rDOR The discovery of the B opioid receptor molecular sequences has allowed the analysis of the amino acid residues and domains of the receptors that are involved in ligand binding and second messenger functional coupling. Reisine and co-workers (personal communication) have studied specific domains in the cloned mouse K and B opioid receptors for their selective ligand binding using chimeras. They found that the N-terminus of the cloned mouse K opioid receptor was critical for K selective agonist binding but not antagonist binding. The K opioid receptor may have different sites for their selective agonist and antagonist binding. In contrast, the N­ terminus of the cloned mouse B opioid receptor is not critical for both agonist and antagonist binding (Reisine, personal communication). Since there are no amino acid differences in the transmembrane domains of our cloned hDOR compared to the mDOR and rDOR (Figure 21), most amino acid differences are near the N-terminus of the hDOR, the ligand requirements for the cloned hDOR should be similar to the cloned mDOR and rDOR. This hypothesis was proven by comparison of the binding affinities of the B selective ligands for the cloned mDOR and rDOR to the cloned hDOR. The preliminary data were shown in Table 2. The differences in the binding affinities of the B selective ligands for the cloned mDOR (Raynor et aI., 1993) and rDOR (Fukuda, et aI., 1993) to the hDOR may due 100 to the differences in the receptor densities and radioligand concentrations which were used in the assays. For example, Raynor et al. (1993) performed their binding assays using 1.0 nM [3H]NTI, which was about 5-fold higher than the Kd value of [3H]NTI (0.18 nM) from their saturation studies, and 10 fold higher than what we used (100 pM). The cloned rDOR binding affinities were detected by [3H]DADLE, a () selective agonist, rather than [3H]NTI. The better way to compare the binding affinities of the () selective ligands for the cloned mDOR, rDOR and hDOR is to perform the binding assays using the same radioligand and concentration, the same receptor density and perform the assays in the same day. These studies are in the progress. In addition, the comparison of the binding affinities of the () selective ligands for () opioid receptors in the tissue preparations to the cloned hDOR is also in the progress. The correlation analysis will be performed to determine whether the pharmacological profiles of the cloned hDOR are similar to the () opioid receptors in biological tissues. In addition, Livingston et al. (1994) demonstrated that mutation of aspartate 95 (Asp95) and aspartate 128 (Asp128) in the second and third transmembrane domain of the mouse () opioid receptor to an asparagine, reduced the affinity of the receptor for () selective or non-selective agonists but not antagonists. The histidine 278 (His278) in the sixth transmembrane domain of the mouse () opioid receptor was not essential for the () opioid receptor ligand binding. These data indicated that () selective agonists bind differently to the () opioid receptor than do either non-selective agonists or 101 antagonists. The Asp95, Asp128 and His278 are also found in the cloned hDOR. These residues may playa similar role in the ligand requirements for the human 0 opioid receptors.

Table 2. Comparison of the Binding Affinities (ki) of the 0 Selective Ligands for the Cloned mDOR, rDOR and hDOR.

hDOR mDORa rDORb Radioligands [3H]NT! [3H]NTI [3H]DADLE (100 pM) (1.0 nM) (5.0 nM) Ligands NT! 0.05 nM 0.02 nM ND NTB 0.28 nM 0.013 nM ND BNTX 2.3 nM 0.66nM ND DPDPE ND 14nM 28nM [D-Ala2,Glu4] deltorphin 8.7nM 3.3 nM ND DSLET ND 4.8nM 12nM DADLE ND ND 5.0nM a: Data from Raynor et aI., 1993, b: Data from Fukuda et aI., 1993, ND = No Determination The hypothesis that the cloned hDOR is coupled to the G-protein was clearly demonstrated by in vitro radioligand binding assays using a radiolabeled 0 selective antagonist such as [3H]NTI. The inhibition curve for [4'-CI-Phe4]DPDPE was substantially shifted to the right in the presence of Gpp(NH)p (100 JlM) and NaCI (100 mM) (Figure 17), indicating that cloned hDOR is indeed coupled to a G-protein before eliciting any pharmacological response. This conclusion is further supported by the observation of multiple site binding for agonists but not antagonists seen in the [3H]NTI binding inhibition studies (Table 1). 102

An attempt was made to determine the biochemical function of the cloned hDOR in transiently transfected COS-7 cells. Unfortunately, neither inhibition nor stimulation of cAMP formation was detectable in the transiently transfection system. The most likely reason for the unsuccessful experiments is that only a small fraction of the transfected cells express 0 opioid receptors, and could be expected to show opioid-induced adenylyl cyclase inhibition. All of the cells will show forskolin-induced adenylyl cyclase stimulation. This would produce a low signal to noise ratio and prevent detection of the inhibition response. This problem will be overcome by the preparation of a cell line giving stable expression of the hDOR which is now in progress. Delta Opioid Receptor Subtypes Since BNTX, a proposed 01 selective antagonist (Sofuoglu et aI., 1991a), showed 8-fold lower affinity to this cloned hDOR labeled by [3H]NTI than NTB, a proposed 02 selective antagonist (Sofuoglu et aI., 1991a), this cloned hDOR can be hypothesized to be a 02 opioid receptor. This conclusion is in agreement with that given by Raynor et aI. (1993). Reisine and co-workers (Raynor et aI., 1993) demonstrated the pharmacological characteristics of the cloned mouse K, 0 and Il opioid receptors, and suggested that the cloned Il and K opioid receptors corresponded to the endogenously expressed III and Kl receptor subtypes, whereas the cloned mouse 0 opioid receptor was different from the murine brain 0 opioid receptors (Raynor et aI., 1993). It was also suggested that the cloned mouse 103

8 opioid receptor matched the 82 opioid receptor subtype because the 82 selective agonists DSLET and [D-Ala2, Glu4]deltorphin, and the antagonist NTB were more potent than the 81 agonist DPDPE and 81 antagonist BNTX at the cloned 8 opioid receptor. The lack of correlation between the 8 ligands in the cloned mouse 8 opioid receptor and that of mouse brain membranes might further support the existence of the 8 opioid receptor subtypes. Interestingly, all the opioid receptors including 8 opioid receptor cloned by several independent research groups (Evans et aI., 1992; Kieffer et aI., 1992; Fukuda et aI., 1993), show similar genes in several species, such as the mDOR and the rDOR compared to our cloned hDOR, shared 93% homology and referred to as the 82 opioid receptor based on their ligand binding profiles. A 8 opioid receptor showing 81 receptor pharmacology has not been cloned in any species. The possible reasons might be (1) mRNA concentrations for the 81 opioid receptor are extremely low, whereas mRNA concentrations for 82 opioid receptor are abundant, (2) the brain tissues used for cloning and characterization of 8 opioid receptors, may contain the 82 opioid receptors rather than 81 opioid receptors, (3) differences between the 01 and 82 opioid receptor subtypes represent different post-translational modifications or events, and (4) the 81 and 82 opioid receptor subtypes are very different so that homology screening with 82 cDNA probes fails to detect 81 subtypes. Thus, the 81 and 82 opioid receptor subtypes may result from the alternative mRNA splicing, or 104

coupling to the differential G-protein effector systems present in different tissues. Although a single band was obtained from the southern blot analysis (Varga and Yamamura, in preparation), it can not rule out the existence of the 0 opioid receptor subtypes in the genomic library due to the alternative mRNA splicing. Therefore, in order to obtain the 01 opioid receptor molecular structure, one of the strategies is to find tissues containing higher 01 opioid receptor levels. Raffa et al. (1992) reported that [D-Ala2, GLu4 ]deltorphin, a 02 selective ligand, produced antinociception after intrathecal (i.t.) but not after intracerebroventricular (i.c.v.) administration in the CXBK mouse, whereas DPDPE, a 01 selective ligand, produced antinociception following both i.t. and i.c.v. administration in the CXBK mouse. These data suggest that the CXBK mouse may have a predominant population of supraspinal 01, rather than 02 opioid receptors responsible for the mediation of analgesia (Raffa et aI., 1992). The guinea pig brain membranes may be another good tissue to study the 01 opioid receptors since the 01 selective antagonist BNTX showed 1DO-fold greater affinity (Ki

= 0.1 nM) for [3H]DPDPE binding sites (0I) relative to those of [3H]DSLET binding sites (02) (Portoghese et aI., 1992). The inibition of [3H]NTI binding to both the CXBK mouse and the guinea pig brain membranes by BNTX and NTB may resolve this question. Additionally, BNTX and NTB inhibition of [3H]NTI binding can also be performed in the rat olfactory bulb membranes, a tissue in which stimulation rather than 105 inhibition of adenyl ate cyclase activity was observed (Olianas and OnaIi, 1992). A complex BNTX inhibition curve in the rat olfactory bulb membranes may further support the existence of the <>1 opioid receptors in this tissue (data not shown). These studies are in progress. Finally, the cloned human <> opioid receptor, as well as other opioid receptors, will provide important screening systems for the testing of new compounds. The characterization of human <> opioid receptor ligand requirements and second messenger coupling will be performed once a stable-transfected cell line is available. Chimeric, deleted or mutated hDOR can be studied to further understand the relationships between opioid receptor structure and function. It can be anticipated that opioid drug design and discovery will be facilitated by this work. 106

CONCLUSION A reassembled human 0 opioid receptor (hDOR) was prepared from human striatal and temporal cortical cDNA clones. This reassembled hDOR represents a normal human 0 opioid receptor that can be shown to exist in a human occipital cortical cDNA library. The cloned human 0 opioid receptor contains 1116 nucleotides encoding a protein of 372 amino acids, showing 93% amino acid identity to the mouse 0 opioid receptor (mDOR) and rat 0 opioid receptor (rDOR). This receptor also contains conserved seven transmembrane domains, which are consistent with the proposed structure for G-protein coupled receptors. The 0 opioid receptor binding properties of the cloned hDOR were demonstrated by in vitro radioligand binding assays using a 0 selective radioligand [3H]NTI. The G-protein interaction was also determined for the cloned hDOR by binding experiments in the absence and presence of Gpp(NH)p and NaCI that showed that treatment regulated 0 selective agonist binding affinity. The functional properties of this hDOR will be examined in stable cell line expressing the hDOR in the future. 107

LIST OF REFERENCES

1. ABDELHAMID, E. E., SULTANA, M., PORTOGHESE, P. S. AND TAKEMORl, A. E.: Selective blockage of delta opioid receptors prevents the development of morphine tolerance and dependence in mice. 1. Pharmacol. Exp. Ther. 258: 299-303, 1991.

2. AKIL, H., MAYER, D. 1. AND LIEBESKIND, 1. C.: Antagonism of stimulation-produced analgesia by naloxone, a narcotic antagonist. Science 191: 961-962, 1977.

3. AKIYAMA, K., GEE, K. W., MOSBERG, H. I., HRUBY, V. J. AND YAMAMURA, H. I.: Characterization of [3H] [2-D-penicillamine, 5-D­ penicillamine ]enkephalin binding to 0 opiate receptors in the rat brain and neuroblastoma-glioma hybride cell line (NG 108-15). Proc. Natl. Acad. Sci. USA 82: 2543-2547, 1985.

4. AMICHE, M., SAGAN, S., MOR, A., DELFOUR, A. AND NICOLAS, P.: Dermenkephalin (Tyr-D-Met-Pen-His-Leu-Met-Asp-NH2): A potent and fully specific agonist for the 0 opioid receptor. Mol. Pharmacol. 35: 774-779, 1989.

5. BALS-KUBIK, R., SHIPPENBERG, T. S. AND HERZ, A.: Involvement of central Jl and 0 opioid receptors in mediating the reinforcing effects of ~-endorphin in the rat. Eur. J. Pharmacol. 175: 63-69, 1990.

6. BARRETT, R. W. AND VAUGHT, J. L.: The effects of receptor selective opioid peptides on morphine-induced analgesia. Eur. 1. Pharmacol. 88: 427-430, 1982.

7. BENEDETTI, C. AND PREMUDA, L.: The history of opium and its derivatives. In Advances in pain research and therapy. 14, Edited by Benedetti, C., Chapman, C.R. and Giron, G., New York, Raven, 1990. 108 8. BLUME, A. J., LICHTSHTEIN, D. AND BOONE, G.: Coupling of opiate receptors to adenylate cyclase: requirement for Na+ and GTP. Proc. Nat!. Acad. Sci. USA 76: 5626-5630, 1979.

9. BOWEN, W. K., HELLEWELL, S. B., KELEMAN, M., HUEY, R. AND STEWART, D.: Affinity labeling of B-opioid receptors using [D­ Ala2, Leu5, Cys6]enkephalin: covalent attachment via thiol-disulfide exchange. Bio. Chern. 262: 13434-13439, 1987.

10. BROWNSTEIN, MJ.: A brief history of opiates, opioid peptides, and opioid receptors. Proc. NatI. Acad. Sci. USA 90: 5391-5393, 1993.

11. BURKS, T. F., FOX, D. A., HIRNING, L. D., SHOOK, J. E., AND PORRECA, F.: Regulation of gastrointestinal function by mUltiple opioid receptors. Life Sci. 43: 2177-2181, 1988.

12. ROzAs, B., TOTH, G., CAVAGNERO, S., HRUBY, V. J. AND BORSODI, A.: Synthesis and binding characteristics of the highly delta-specific new tritiated opioid peptide, [3H]deltorphin II. Life Sci. 50: PL75-PL78, 1992.

13. CASTGLIONI, A.: A history of medicine. Alfred A. Knopf, New York, 1947.

14. CAVAGNERO, S., MISICKA, A., KNAPP, R. 1., DAVIS, P., FANG, L., BURKS, T. F., Y AMAMURA, H. I. AND HRUBY, V. 1.: Delta opioid receptor-selective ligands: [D-Pen2, D-pen5]enkephalin­ dermenkephalin chimeric peptides. Life Sci. 49: 495-503, 1991.

15. CHANG, K.-J. AND CUATRECASAS, P.: Multiple opiate receptors: enkephalins and morphine bind to receptors of different specificity. J. BioI. Chern. 254: 2610-2618, 1979. 109 16. CHANG, K.-J., BLANCHARD, S. C. AND CUATRECASAS, P.: Unmasking of magnesium-dependent high-affinity binding sites for [D­ Ala2, D-Leu5]enkephalin after pretreatment of brain membranes with guanine nucleotides. Proc. Natl. Acad. Sci. USA 80: 940-944, 1983.

17. CHANG, K.-J., RIGDON, G. C., HOWARD, J. L. AND MCNUTT, R. W.: A novel potent and selective nonpeptidic 3-opioid receptor agonist BW 373U86. 1. Pharmacol. Exp. Ther. 267: 852-857, 1993.

18. CHEN, Y., MESTEK, A., LID, 1., HURLEY, 1. A. AND YU, L.: Molecular cloning and functional expression of a Il-opioid receptor from rat brain. Mol. Pharmacol. 44: 8-12, 1993.

19. CHENG, P. Y. AND SZETO, H. H.: The effects of delta selective agonists and antagonists on breathing patterns in the fetal lamb. Proeedings of the INRC, Copper Mountain, CO, 1991.

20. CHENG, P. Y., WU, D., DECENA, 1., SOONG, Y., MCCABE, S. AND SZETO, H. H.: Opioid-induced stimulation of fetal respiratory activity by [D-Ala2]deltorphin I. Eur. J. Pharmacol. 230: 85-88, 1993.

21. CHENG, Y.-C. AND PRUSOFF, W. H.: Relationship between the inhibition constant (Kj) and the concentration of inhibitor which causes 50% inhibition (IC-50) of an enzymatic reaction. Biochem. Pharmacol. 22: 3099-3102, 1973.

22. CHILDERS, S. R.: Opiate-inhibited adenylate cyclase in rat brain membranes depleted of Gs-stimulated adenyl ate cyclase. 1. Neurochem. 50: 543-553, 1988.

23. CHILDERS, S. R.: Opioid receptor-coupled second messenger systems. Life Sci. 48: 1991-2003, 1991. 110 24. CHILDERS, S. R., FLEMING, L. M., SELLEY, D. E., MCNUTT, R. W. AND CHANG, K.-1.: BW 373U86: a nonpeptidic delta-opioid agonist with novel receptor-G protein-mediated actions in rat brain membranes and neuroblastoma cells. Mol. Pharmacol. 44 (4): 827-834, 1993.

25. COLLIER, H. O. J. AND ROY, A. C.: Morphine-like drugs inhibit the stimulation by E-prostaglandins of cyclic AMP formation by rat brain homogenate. Nature 248: 24-27, 1974.

26. CORBETT, A. D., GILLGAN, M. G., KOSTERLITZ, H. W., MCKNIGHT, A. T., PATERSON, S. 1. AND ROBSON, L. E.: Selectivities of opioid peptide analogues as agonists and antagonists at the o-receptor. Br. 1. Pharmacol. 83: 271-279, 1984.

27. COTTON, R., GILES, M. G., MILLER, L., SHAW, J. S. AND TIMMS, D.: ICI 174,864: A highly selective antagonist for the opioid delta receptor. Eur. 1. Pharmacol. 97: 331-332, 1984.

28. COTTON, R., KOSTERLITZ, H. W., PATERSON, S. J., RANCE, M. 1. AND TRAYNOR, 1. R.: The use of [3H] [D-Pen2, D­ Pen5]enkephalin as a highly selective ligand for the o-binding site. Br. J. Pharmacol. 84: 927-932, 1985.

29. COWAN, A., ZHU, Z. Z., MOSBERG, H. I., OMNAAS, 1. R. AND PORRECA, F.: Direct dependence studies in rats with agents selective for different types of opioid receptor. 1. Pharmacol. Exp. Ther. 246: 950-955, 1988.

30. CRAIN, S. M. AND SHEN, K.-F.: Opioids can evoke direct receptor­ mediated excitatory effects on sensory neurons. Trends in Pharmacol. Sci. 11: 77-81, 1990.

31. D'AMATO, R. 1. AND HOLADAY, J. W.: MUltiple opioid receptors in endotoxic shock: evidence for 0 involvement and fl-O interactions in vivo. Proc. Natl. Acad. Sci. USA 81: 2892-2901, 1984. 111 32. DELAY-GOYET, P., ZAJAC, J.-M., RIGAUDY, P., FOUCAUD, B. AND ROQUES, B. P.: Comparative binding properties of linear and cyclic ~-selective enkephalin analogues: [3H][D-Thr2, Leu5]enkephalyl-Thr6 and [3 H][D-Pen2 , D-Pen5]enkephalin. FEBS Lett. 183:439-443, 1985.

33. DELAY-GOYET, P., SEGUIN, C.,GACEL, G. AND ROQUES, B. P.: [3H][D-Ser2 (O-tert-butyl), Leu5]enkephalyl-Thr6 and [D-Ser2 (0- tert-butyl), Leu5]enkephalyl-Thr6 (O-tert-butyl). Two newenkephalin analogs with both a good selectivity and a high affinity toward o-opioid binding sites. J. BioI. Chern. 263: 4124-4130, 1988.

34. DEMOLIOU-MASON, C. D. AND BARNAR, D. E. A.: Distinct subtypes of the opioid receptor with allosteric interactions in brain membranes. J. Neurosci. 46: 1118-1128, 1986.

35. DEWITTE, P., HEIDBREDER, C., AND ROQUES, B. P.: Kelatorphan, a potent enkephalinase inhibitor, and opioid receptor agonists DAGO and DTLET, differentially modulate self-stimulation behavious depending on the site of administration. Neuropharmacoi. 28: 667-676, 1989.

36. DOLE, V. P., CUATRECASAS, P. AND GOLDSTEIN, A.: Criteria for receptors. In Synder, S. H. and Matthysee, E. eds. Opiate Receptor Mechanisms. 24-26, Cambridge, Massachusetts, MIT Press, 1975.

37. ERSPAMER, V., MELCHIORRI, P., FALCONIERI-ERSPAMER, G., NEGRI, L., CORSI, R., SEVERINI, C., BARRA, D., SIMMACO, M. AND KRElL, G.: Deltorphins: A family of naturally occurring peptides with high affinity and selectivity for 0 opioid binding sites. Proc. Nati. Acad. Sci. USA 86: 5188-5192, 1989.

38. EVANS, C. J., KEITH, D. E., MORRISON, H., MAGANDZO, K., AND EDWARDS, R. H.: Cloning of a delta opioid receptor by functional expression. Science 258: 1952-1955, 1992. 112 39. FANG, L., KNAPP, R. J., MATSUNAGA, T. 0., WEBER, S., DAVIS, T., HRUBY, V. 1. AND YAMAMURA, H. I.: Synthesis of [4'_1251- Phe3, Glu4 ]deltorphin and characterization of its () opioid receptor binding properties. Life Sci. 51: PL189-PLI93, 1992.

40. FANG, L., KNAPP, R. J., HORVATH, R., MATSUNAGA, T. 0., HAASETH, R. C., HRUBY, V. J., PORRECA, F. AND Y AMAMURA, H. I.: Characterization of [3H]naltrindole binding to delta opioid receptors in mouse brain and mouse vas deferens: evidence for delta opioid receptor heterogeneity. J. Pharmacol. Exp. Ther. 268: 836-846, 1993.

41. FREY, E. A. AND KEBAB IAN, J. W.: Jl.-opiate receptors in 7315c tumor tissue mediates inhibition of immunoreactive prolactin release and adenylate cyclase activity. Endocrinol115: 1797-1804, 1984.

42. FUKUDA, K., KATO, S., MORl, K., NISHI, M. AND TAKASHIMA, H.: Primary structures and expression from cDNAs of rat opioid receptor ()- and J..l- subtypes. FEBS Lett. 327: 311-314, 1993.

43. GACEL, G., FOURNIE-ZALUSKI, M.-C. AND ROQUES, B. P.: D­ Tyr-Ser-Gly-Phe-Leu-Thr, a high preferential ligand for ()-opioid receptors. FEBS Lett. 118: 245-247, 1980.

44. GACEL, G., DAUGE, V., BREUZE, P., DELAY-GOYET, P. AND ROQUES, B. P.: Development of conformationally constrained linear peptides exhibiting a high affinity and pronounced selectivity for () opioid receptors. 1. Med. Chern. 31: 1891-1897, 1988.

45. GALLIGAN,1. J., MOSBERG, H. I., HURST, R., HRUBY, V. 1. AND BURKS, T. F.: Cerebral delta opioid receptors mediate analgesia but not the intestinal motility effects of intracerebroventricular administered opioids. J. Pharmacol. Exp. Ther. 229: 641-648, 1984. 113 46. GILBERT, P. E. AND MARTIN, W. R.: The effects of morphine- and nalorphine-like drugs in the non-dependent, morphine-dependent and cyclazocine-dependent chronic spinal dog. J. Pharmacol. Exp. Ther. 198: 66-82, 1976.

47. GLUZMAN, Y.: SV 40 transformed SImIan cells support the replication of early SV40 mutants. Cell. 23: 175-182, 1981.

48. GOLDSTEIN, A., LOWNEY, L. I. AND PAL, B. K.: Stereospecific and nonspecific interactions of the morphine congener levorphanol in subcellular fractions of mouse brain. Proc. Natl., Acad. Sci. USA 68: 1742-1747, 1971.

49. GOLDSTEIN, A., TACHIBANA, S., LOWNEY, L. I., HUNKAPILLER, M. AND HOOD, L.: Dynorphin-(1-13), an extraordinarily potent opioid peptide. Proc. Natl. Acad. Sci. USA 76: 6666-6670, 1979.

50. GOLDSTEIN, A., FISCHLI, W., LOWNEY, L.I., HUNKAPILLER, M. AND HOOD, L.: Porcine pituitary dynorphin: Complete amino acid sequence of the biological active heptadecapeptide. Proc. Natl. Acad. Sci. USA 78: 7219-7223, 1981.

51. HADDAD, G. G., SCHAEFFER, 1. I. AND CHANG, K.-J.: Opposite effects of the 0- and Il-opioid receptor agonists on ventilation in conscious adult dog. Brain Res. 323: 73-82, 1984.

52. HADDAD, G. G. AND LASALA, P. A.: Effect of parasympathetic blockade on ventilatory and cardiac depression induced by opioids. Resp. Physiol. 67: 101-114, 1987.

53. HAMPRECHT, B.: Structural, electrophysiological, biochemical and pharmacological properties of neuroblastoma-glioma cell hybrids in cell culture. Int. Rev. Cytol. 49: 99-163, 1977. 114 54. HEYMAN, J. S., MULVANEY, S. A., MOSBERG, H. I. AND PORRECA, F.: Opioid delta-receptor involvement in supraspinal and spinal antinociception in mice. Brain Res. 420: 100-108, 1987.

55. HEYMAN, J. S., VAUGHT, J. L., RAFFA, R. B. AND PORRECA, F.: Can supraspinal o-opioid receptors mediate antinociception? Trends Phannacol. Sci. 9: 134-138, 1988.

56. HEYMAN, J. S. AND PORRECA, F.: Modulation of J..L mediated antinociception by a agonists in the mouse. Adv. Biosci. 75: 467-470, 1989.

57. HEYMAN, J. S., VAUGHT, J. L., MOSBERG, H. I., HAASETH, R. C. AND PORRECA, F.: Modulation of f.1 mediated antinociception by a agonists in the mouse: selective potentiation of morphine and normorphine by [D-Pen2, D-Pen5]enkephalin. Eur. J. Pharmacol. 165: 1-10, 1989a.

58. HEYMAN, J. S., JIANG, Q., ROTHMAN, R. B., MOSBERG, H. 1. AND PORRECA, F.: Modulation of f.1 mediated antinociception by a agonists in the mouse: Pharmacological characterization with antagonists. Eur. J. Pharmacol. 169: 43-52, 1989b.

59. HOLADAY, J. W. AND D'AMATO, R. J.: MUltiple opioid receptors: evidence for J..L-O binding site interactions in endotoxic shock. Life Sci. 33: 703-706, 1983.

60. HOLADAY, J. W.: Endogeneous opioids and their receptors. In Current Concepts. 1-64, Kalamazoo, Michigan: The Upjohn Co., 1985.

61. HOSOBUCHI, Y., ADAMS, T. F., AND LINCHITZ, R.: Pain relief by electrical stimulation of the central gray matter in human and its reveal by naloxone. Science 197: 183-199, 1977. 115 62. HUGHES, J., SMITH, T. W., KOSTERLITZ, H. W., FOTHERGILL, L. A., MORGAN, B. A., AND MORRIS, H. R.: Identification of two related pentapeptides from the brain with potent opiate agonist activity. Nature 258: 577-579, 1975.

63. ILLES, P.: Modulation of transmitter and hormone release by mUltiple neuronal opioid receptors. Rev. Physiol. Biochem. Pharmacol. 112: 139-233, 1989.

64. IZQUIERDO, I.: Acetylcholine release is modulated by different opioid receptor types in different brain regions and species. Trends in Pharmacol. Sci. 11: 179-180, 1990.

65. JIANG, Q., MOSBERG, H. I. AND PORRECA, F.: Modulation of the potency and efficacy of mu-mediated antinociception by delta agonists in the mouse. 1. Pharmacol. Exp. Ther. 254: 683-689, 1990a.

66. JIANG, Q., MOSBERG, H. I. AND PORRECA, F.: Selective modulation of morphine antinociception, but not development of tolerance, by 0 receptor agonists. Eur. J. Pharmacol. 186: 137-141, 1990b.

67. JIANG, Q., TAKEMORI, A. E., SULTANA, M., PORTOGHESE, P. S., BOWEN, W. D., MOSBERG, H. I. AND PORRECA, F.: Differential antagonism of opioid delta antinociception by [D-Ala2, Leu5, Cys6]enkephalin and naltrindole 5'-isothiocyanate: Evidence for delta receptor subtypes. J. Pharmacol. Exp. Ther. 257: 1069-1075, 1991.

68. JAFFE, I. F. AND MARTIN, W. R.: Opioid analgesics and antagonists. In The pharmacological basis of therapeutics (8th. ed.). Gilman, A. G., RaIl, T. W., Nies, A. s., and Taylor, P. eds. Pergamon Press (New York), 1990. 116 69. KAKIDANI, H., FURTANI, Y., TAKAHASHI, H., NODA, M., MORIMOTO, Y., HIROSE, T., ASAI, M., INAY AMA, S., NAKANISHI, S. AND NUMA, S.: Cloning and sequence analysis of cDNA for porcine ~-neo-endorphin/dynorphin precursor. Nature 298: 245-249, 1982.

70. KIEFFER, B. L., BEFORT, K., GAVERIAUX-RUFF, C. AND HIRTH, C. G.: The B-opioid receptor: isolation of a cDNA by expression cloning and phannacological characterization. Proc. Nat!. Acad. Sci. USA 89: 12048-12052, 1992.

71. KIMURA, S., LEWIS, R. V., STERN, A. S., ROSSlER, J., STEIN, S. AND UNDFRIEND, S.: Probable precursors of (Leu) and (Met)enkephalin in adrenal medulla: peptides of 3-5 kilodaltons. Proc. Nat!. Acad. Sci. USA 77: 1681-1685, 1980.

72. KLEE, W. A., KOSKI, G., TOCQUE, B. AND SIMONS, W. F.: On the mechanism of receptor-mediated inhibition of adenylate cyclase. Adv. Cyclic Nucleotide Res. 17: 153-159, 1984.

73. KNAPP, R. 1., PORRECA, F., BURKS, T. F. AND YAMAMURA, H. I.: Mediation of analgesia by mUltiple opioid receptors. In Drug Treatment of Cancer Pain in a Drug-Oriented Society. ed. by Hill, C. S. and Fields, W. S., 11: 247-289, Raven Press, New York, 1989.

74. KNAPP, R. 1. AND Y AMAMURA, H. I.: [3H][D-Pen2, D­ Pen5]enkephalin binding to delta opioid receptors on intact neuroblastoma-glioma (NG 108-15) hybrid cells. Life Sci. 46: 1457- 1463, 1990.

75. KNAPP, R. 1., SHARMA, S. D., TOTH, G., DUONG, M. T., FANG, L., BOGERT, C. L., WEBER, S. J., HUNT, M., DAVIS, T. P., WAMSLEY, J. K., HRUBY, V. 1. AND YAMAMURA, H. I.: [D­ Pen2, 4,_125I-Phe4, D-Pen5]Enkephalin: A selective high affinity radioligand for delta opioid receptors with exceptional specific activity. J. Phannaco!' Exp. Ther. 258: 1077-1083, 1991. 117 76. KNAPP, R. J. AND Y AMAMURA, H. I.: Delta opioid receptor radioligands. Biochem. Pharmacol. 44: 1687-1695, 1992.

77. KNAPP, R. J., HUNT, M., WAMSLEY, J. K. AND YAMAMURA, H. I.: CNS receptors for opioids. In Imaging Drug Action in the Brain. ed. by E. D. London, 119-176, CRC Press, Inc., Boca Raton, 1993.

78. KRElL, G., BARRA, D., S IMMAC 0, M., ERSPA:MER, V., ERSPA:MER, G. F., NEGI, L., SEVERINI, C., CORSI, R. AND MELCHIORRI, P.: Deltorphin, a novel amphibian skin peptide with high selectivity and affinity for 0 opioid receptors. Eur. J. Pharmacol. 162: 123-128, 1989.

79. KROMER, W.: The current status of opioid research on gastrointestinal motility. Life Sci. 44: 579-589, 1989.

80. KUROSE, H., KATANDA, T., AMANO, T. AND UI, M.: Specific uncoupling by islet-activating protein, pertussis toxin, of negative signal transduction via a-adrenergic, cholinergic, and opiate receptors in neuroblastoma x glioma hybrid cells. J. BioI. Chern. 258: 4870- 4875, 1983.

81. LAZARUS, L. H., WILSON, W. E., CASTIGLIONE, R. D. AND GUGLIETTA, A.: Dermorphin gene sequence peptide with high affinity and selectivity for 0- receptors. J. BioI. Chern. 264: 3047-3050, 1989.

82. LEADEM, C. A. AND YAGENOVA, S. V.: Effects of specific activation of mu-, delta- and kappa-opioid receptors on the secretion of luteinizing hormone and prolactin in the ovariectomized rat. Neuroendocrinol. 45: 109-117, 1987.

83. LEE, N. M., LEYBIN, L., CHANG, K.-J. AND LOH, H. H.: Opiate and peptide interaction: effect of enkephalins on morphine analgesia. Eur. J. Pharmacol. 68: 181-185, 1980. 118 84. LEFKOWITZ, R. J. AND CARON, M. G.: Adrenergic receptors. The Harvey Lectures, Series 86: 33-45, 1992.

85. LI, C. H.: Lipotropin, a new active peptide from pituitary glands. Nature 201: 924-928, 1964.

86. LI, C. H. AND CHUNG, D.: Isolation and structure of an untriakontapeptide with opiate activity from camel pituitary glands. Proc. Nat!. Acad. Sci. USA 73: 1145-1148, 1976.

87. LIVINGSTON, F. S., KONG, H., RAYNOR, K., BELL, G. I. AND REISINE, T.: Aspartate 128 in the third transmembrane spanning region of the cloned mouse delta opioid receptor is necessary for agonist binding. Summited, 1994.

88. LORD, J. A. H., WATERFIELD, A. A., HUGHES, J. AND KOSTERLITZ, H. W.: Endogenous opioid peptides: mUltiple agonists and receptors. Nature 267: 495-499, 1977.

89. LOWRY, O. H., ROSEBROUGH, N. J., FARR, A. L. AND RANDALL, R. J.: Protein measurement with the folin phenol reagents. J. Bio. Chern. 193: 265-275, 1951.

90. MAINS, R. E., EIPPER, B. A. AND LING, N.: Common precursor to corticotropins and endorphins. Proc. Nat!. Acad. Sci. USA 74: 3014- 3018, 1977.

91. MALATYNSKA, E., ZALEWSKA, T., KNAPP, R. J. AND Y AMAMURA, H. I.: The presence of delta-opioid receptors on COS-7 cells. In preparation.

92. MANECKJEE, R. AND MINNA, J. D.: Opioid and nicotine receptors affect growth regulation of human lung cancer cell lines. Proc. Nat!. Acad. Sci. USA 87: 3294-3298, 1990. 119 93. MARTIN, W. R., EADES, C. C., THOMPSON, J. A., GILBERT, P. E. AND HUPPLER, R. E.: The effects of morphine and nalorphine-like dnlgs in the nondependent and morphine dependent chronic spinal dog. J. Pharmacol. Exp. Ther. 179: 517-532, 1976.

94. MATHIASEN, J. R. AND VAUGHT, J. L.: [D-Pen2, L­ pen5]enkephalin induced analgesia in the jimpy mouse: in vivo evidence for delta-receptor mediated analgesia. Eur. J. Pharmacol. 136: 405-407, 1987.

95. MATTIA, A., VANDERAH, T., MOSBERG, H. I., OMNAAS, J. R., BOWEN, W. D. AND PORRECA, F.: Pharmacological characterization of [D-Ala2, Leu5, Ser6]enkephalin (DALSE): antinociceptive actions at the opioid Bnon-complexed receptor. Eur. J. Pharmacol. 192: 371-375, 1991a.

96. MATTIA, A., VANDERAH, T., MOSBERG, H. I. AND PORRECA, F.: Lack of antinociceptive cross-tolerance between [D-Pen2, D­ pen5]enkephalin and [Ala2]deltorphin II in mice: evidence for delta receptor subtypes. Eur. J. Pharmacol. 258: 583-587, 1991b.

97 . MATTIA, A., FARMER, S. C., TAKEMORI, A. E., SULTANA, M., PORTOGHESE, P. S., MOSBERG, H. I., BOWEN, W. D. AND PORRECA, F.: Spinal opioid delta antinociception in the mouse: mediation by a 5'-NTII-sensitive delta receptor subtypes. J. Pharmacol. Exp. Ther. 260: 518-525, 1992.

98. MAY, C. N., DASHWOOD, M. R., WHITEHEAD, C. J. AND MATHIAS, C. J.: Differential cardiovascular and respiratory responses to central administration of selective opioid agonists in conscious rabbits: correlation with receptor distribution. Br. J. Pharmacol. 98: 903, 1989.

99. MAYER, D. J., WOLFLE, T. L., AKIL, H., CARDER, B. AND LIEBESKIND, J. C.: Analgesia from electrical stimulation in the brain stem of the rat. Science. 174: 1351-1354, 1971. 120 100. MEl, L., ROESKE, W. R. AND YAMAMURA, H. I.: Molecular pharmacology of muscarinic receptor heterogeneity. Life Sci. 45: 1831- 1851, 1989.

101.MENKENS, K., BILSKY, E. 1., WILD, K. D., PORTOGHESE, P. S., REID, L. D. AND PORRECA, F.: Cocaine place preference is blocked by the 3-opioid receptor antagonist, naltrindole. Eur. J. Pharmacol. 219: 345-346, 1992.

102. MINAMI, M., TOYA, T., KATAO, Y., MAEKAWA, K., NAKAMURA., S., ONOGI, T., KANEKO, S. AND SATOH, M.: Cloning and expression of a cDNA for the rat K-opioid receptor. FEBS Lett. 329: 291-295, 1993.

103. MISICKA, A., LIPKOWSKI, A. W., FANG, L., KNAPP, R. J., DAVIS, P., KRAMER, T., BURKS, T. F., YAMAMURA, H. I., CARR, D. B. AND HRUBY, V. 1.: Topographical requirements for delta opioid ligands: presence of a carboxyl group in position 4 is not critical for deltorphin high delta receptor affinity and analgesia activity. Biochem. Biophys. Res. Commun. 180: 1290-1297, 1991.

104.MIYAMOTO, Y., PORTOGHESE, P. S. AND TAKEMORI, A. E.: Involvement of delta-2 opioid receptors in the development of morphine dependence in mice. 1. Pharmacol. Exp. Ther. 264: 1141- 1145,1993.

105. MOSBERG, H. I., HURST, R., HRUBY, V. 1., GEE, K., Y AMAMURA, H. I., GALLIGAN, J. J. AND BURKS, T. F.: Bis­ phenicillamine enkephalins possess highly improved specificity toward 3 opioid receptors. Proc. Nat!. Acad. Sci. USA 80: 5871-5874, 1983a.

106. MOSBERG, H. I., HURST, R., HRUBY, V. J., GEE, K., AKIYAMA, K., YAMAMURA, H. I., GALLIGAN, 1. 1. AND BURKS, T. F.: Cyclic penicillamine containing enkephalin analogs display profound delta receptor selectivities. Life Sci. 33 (Suppl. 1): 447-450, 1983b 121 107. MUNSON, P. B. AND RODBARD, D.: LIGANDS: A versatile computerized approach for characterization of ligand-binding systems. Ana. Biochem. 107: 220-239, 1980.

108. NEGRI, L., POTENZA, R. L., CORSI, R. AND MELCHIORRI, P.: Evidence for two subtypes of 8 opioid receptors in rat brain. Eur. J . . Pharmacol. 196: 335-336, 1991.

109. NISHI, M., T AKESHIMA, H., FUKUDA, K., KATO, S. AND MORl, K.: cDNA cloning and pharmacological characterization of an opioid receptor with high affinities for K-subtype-selective ligands. FEBS Lett. 330: 77-80, 1993.

110. NORTH, R. A.: Opioid receptor types and membrane ion channels. Trends Neurosci. 9: 114-117, 1986.

111.0LIANAS, M. C. AND ONALI., P.: Characterization of opioid receptors mediating stimulation of adenylate cyclase activity in rat olfactory bulb. Mol. Pharmacol. 42: 109-115, 1992.

112. PASTERNAK, G. W., GINTZLER, A. R., HOUGHTEN, R. A., LING, G. S. F., GOODMAN, R. R., SPIEGEL, K., NISHIMURA, S., JOHNSON, N. AND RECHT, L. D.: Biochemical and pharmacological evidence for opioid receptor mUltiplicity in the central nervous system. Life Sci. 33 (suppl. 1): 167-173, 1983.

113.PATERSON, S. 1., ROBSON, L. E. AND KOSTERLITZ, H. W.: Opioid receptors. In The Peptides VI, Udenfriend, S. and Meienhofer, 1., eds: 147-187, London: Academic Press, 1984.

114. PERT, C. B. AND SNYDER, S. H.: Opiate receptor: demonstration in nervous tissue. Science 179: 1011-1012, 1973. 122 115. PORRECA, F., MOSBERG, H. I., HURST, R., HRUBY, V. J. AND BURKS, T. F.: A comparison of the analgesic and gastrointestinal transit effects of [D-Pen2, L-Cys5]enkephalin after intracerebroventricular and intrathecal administration to mice. Life Sci. 33 (Suppl. I): 457-460, 1983.

116. PORRECA, F., MOSBERG, H. I., HRUBY, V. J. AND BURKS, T. F.: Roles of mu, delta, and kappa opioid receptors in spinal and supraspinal mediation of gastrointestinal transit effects and hot-plate analgesia in the mouse. J. Pharmacol. Exp. Ther. 230: 341-348, 1984.

117. PORRECA, F., HEYMAN, J. S., MOSBERG, H. I., OMNAAS, J. R. AND VAUGHT, J. L.: Roles of mu and delta receptors in the supraspinal and spinal analgesic effects of [D-Pen2, D­ pen5]enkephalin in the mouse. J. Pharmacol. Exp. Ther. 241: 393-400, 1987.

118.PORTOGHESE, P. S., SULTANA, M., NAGASE, H. AND TAKEMORI, A. E.: Application of the message-address concept in the design of highly potent and selective non-peptide delta opioid receptor antagonists. J. Med. Chern. 31: 281-282, 1988a.

119. PORTOGHESE, P. S., SULTANA, M. AND TAKEMORI, A. E.: Naltrindole, a highly selective and potent non-peptide delta opioid receptor antagonist. Eur. J. Pharmacol. 146: 185-186, 1988b.

120.PORTOGHESE, P. S., SULTANA, M. AND TAKEMORI, A. E.: Naltrindole 5'-isothiocyanate: a non-equilibrium, highly selective () opioid receptor antagonist. J. Med. Chern. 33: 1547-1548, 1990.

121. PORTOGHESE, P. S., SULTANA, M., NAGASE, H. AND TAKEMORI, A. E.: A selective ()1-opioid receptor antagonist: 7- benzylidenenaltrexone. Eur. J. Pharmacol. 218: 195-196, 1992. 123 122.RAFFA, R. B., MARTINEZ, R. P. AND PORRECA, F.: Lack of antinociceptive efficacy of intracerebroventricular [D-Ala2, Glu4]deltorphin, but not [D-Pen2, D-Pen5]enkephalin, in the Jl-opioid receptor deficient CXBK mouse. Eur. 1. Pharmacol. 216: 453-456, 1992.

123.RAPAKA, R. S. AND PORRECA, F.: Development of delta opioid peptides as nonaddicting analgesics. Pharmacol. Res. 8: 1-8, 1991.

124. RAYNOR, K., KONG, H., CHEN, Y., YASUDA, K., YU, L., BELL, G. I. AND REISINE, T.: Pharmacological characterization of the cloned K-, 0-, and Jl-opioid receptors. 1. Pharmacol. Exp. Ther. 45: 17- 20, 1993.

125. REID, L. D., HUBBELL, C. L., GLACCUM, M. B., BILSKY, E. 1., PORTOGHESE, P. S. AND PORRECA, F.: Naltrindole, an opioid delta receptor antagonist, blocks cocaine-induced facilitation of responding for rewarding brain stimulation. Life Sci. 52: PL67-PL71, 1993.

126. REYNOLDS, D. V.: Surgery in the rat during electrical analgesia induced by focal brain stimulation. Science 164: 444-446, 1969.

127. ROTHMAN, R. B. AND WESTFALL, T. C.: Morphine allosterically modulates the binding of [3H]leucine to a particulate fraction of rat brain. Mol. Pharmacol. 21: 538-547, 1982a.

128. ROTHMAN, R. B. AND WESTFALL, T. C.: Allosteric coupling between morphine and enkephalin receptors in vitro. Mol. Pharmacol. 21: 548-557, 1982b.

129. ROTHMAN, R. B. AND WESTFALL, T. C.: Further evidence for an opioid receptor complex. J. Neurobiol. 14: 341-351, 1983. 124 130. ROTHMAN, R. B., JACOBSON, A. E., RICE, K. C. AND HERKENHAM, M.: Autoradiographic evidence for two classes of Jl opioid binding sites in rat brain using [125I]FK33824. Peptide 8: 1015- 1021, 1987a.

131. ROTHMAN, R. B., MCLEAN, S., BYKOV, V., LESSOR, R. A., JACOBSON, A. E., RICE, K. C. AND HOLADAY, 1. W.: Chronic morphine up-regulates a mu-opiate binding site labeled by 3H-cyclo­ FOXY: a novel opiate antagonist suitable for positron emission tomography. Eur. 1. Pharmacol. 142: 73-81, 1987b.

132. ROTHMAN, R. B., LONG, J. B., BYKOV, V., JACOBSON, A. E., RICE, K. C. AND HOLADAY, 1. W.: Beta-FNA binds irreversibly to the opiate receptor complex: in vivo and in vitro evidence. J. Pharmacol. Exp. Ther. 247: 405-416, 1988.

133. ROTHMAN, R. B., HOLADAY, J. W. AND PORRECA, F.: Allosteric coupling among opioid receptors: evidence for an opioid receptor complex. In Opioids, ed. by Hertz, A., Akil, H., Simmon, E., Springer Verlag, New York, 10411: 217-237,1993.

134. RUSSELL, R. D., LESLIE, 1. B., SU, Y.-F., WATKINS, W. D. AND CHANG, K.-1.: Continuous intrathecal opioid analgesia: tolerance and cross-tolerance of mu and delta spinal opioid receptors. J. Pharmacol. Exp. Ther. 240: 150-158, 1987.

135. SAMBROOK, 1., FRITSCH, E. F. AND MANIATIS, T.: Molecular cloning: A laboratory mannual. 1989, Cold Spring Harbor Laboratory Press. Cold Spring Harbor.

136. SCHILLER, P. W., NGUYEN, T. M.-D., WELTROWSKA, G., WILKES, B. C., MARSDEN, B. J., LEMIEUX, C. AND CHUNG, N. N.: Differential stereochemical requirements of J.l vs B opioid receptors for ligand binding and signal transduction: Development of a new class of potent and highly B-selective peptide antagonists. Proc. Natl., Acad. Sci. USA 89: 11871-11875, 1992a. 125 137. SCHILLER, P. W., NGUYEN, T. M.-D., WILKES, B. C., LEMIEUX, C. AND CHUNG, N. N.: A new class of potent and highly selective 8 opioid receptor peptide antagonists without Jl antagonist properties. FASEB J 6: A1575, 1992b.

138. SHARMA, S. K., NIRENBERG, M. AND KLEE, W. A.: Morphine receptors as regulators of adenylate cyclase activity. Proc. Natl. Acad. Sci. USA 72: 590-594, 1975.

139. SHAW, J. S., MILLER, L., TURNBULL, M. J., GORMLEY, 1. J. AND MORLEY,1. S.: Selective antagonists at the opiate delta-receptor. Life Sci. 31: 1259-1262, 1982.

140. SHELDON, R. J., NUNAN, L. AND PORRECA, F.: Differential modulation by [D-Pen2, D-pen5]enkephalin and dynorphin A 1-17 of the inhibitory bladder motility effects of selected mu agonists in vivo. 1. Pharmacol. Exp. Ther. 249: 462-469, 1989.

141. SHELDON, R. J., MALARCHIK, M. E., BURKS, T. F. AND PORRECA, F.: Effects of opioids on ion transport in intact and stripped mouse intestine. J. Pharmacol. Exp. Ther. 253: 144-151, 1990.

142. SHIMOHIGASHI, Y., COSTA, T., PFEIFFER, A., HERZ, A., KIMURA, H. AND STAMMER, C. H.: VEPhe4-enkephalin analogs, delta receptors in rat brain are different from those in mouse vas deferens. FEBS Lett. 222: 71-74, 1987.

143. SHIMOHIGASHI, Y., COSTA, T., HERZ, A., KIMURA, H. AND STAMMER, C. H.: Synthesis of high potent VEPhe4-enkephalin analogs active only for brain delta receptors. In Peptide Chemistry 1987, ed. by Shiba, T. and Sakakibara, S., 569-572, Protein Research Foundation, Osaka, 1988a. 126 144. SHIMOHIGASHI, Y., TAKANO, Y., KAMIYA, H.-O., COSTA, T., HERZ, A., KIMURA, H. AND STAMMER, C. H.: A highly selective ligand for brain 0 opiate receptors, a VEPhe4-enkephalin analogs, suppresses Jl receptor-mediated thermal analgesia by morphine. FEBS Lett. 233: 289-293, 1988b.

145. SHOOK, J. E., PELTON, J. T., HRUBY, V. J. AND BURKS, T. F.: Peptide opioid antagonist separates peripheral and central opioid antitransit effects. J. Pharmacol. Exp. Ther. 243: 492-500, 1987.

146. SHOOK, J. E., KAZMIERSKI, W., WIRE, W. S., LEMCKE, P. K., HRUBY, V. J. AND BURKS, T. F.: Opioid receptor selectivity of P­ endorphin in vitro and in vivo: mu, delta, and epsilon receptors. J. Pharmacol. Exp. Ther. 246: 1018-1025, 1988.

147. SHOOK, J. E., WATKINS, W. D. AND CAMPORESI, E. M.: Differential roles of opioid receptors in respiration, respiratory disease and opiate-induced respiratory depression. Am. Rev. Respire. Dis. 142: 895-909, 1990.

148. SIMON, E. 1., HILLER, 1. M. AND EDELMANN, I.: Stereospecific binding of the potent narcotic analgesic 3H-etorphine to rat brain homogenate. Proc. Natl. Acad. Sci. USA 70: 1947-1951, 1973.

149. SOFUOGLU, M., PORTOGHESE, P. S. AND TAKEMORI, A. E.: Differential antagonism of delta opioid agonists by naltrindole and its benzofuran analog (NTB) in mice: evidence for delta opioid receptor subtypes. 1. Pharmacol. Exp. Ther. 257: 676-680, 1991a.

150. SOFUOGLU, M., PORTOGHESE, P. S. AND TAKEMORI, A. E.: Cross-tolerance studies in the spinal cord of p-FNA-treated mice provides further evidence for delta opioid receptor subtypes. Life Sci. 49: PLI53-PLI56, 1991b. 127 151. SOFUOGLU, M., PORTOGHESE, P. S. AND TAKEMORI, A. E.: 0- opioid receptor binding in mouse brain: evidence for heterogeneous binding sites. Eur. J. Pharmacol. 216: 273-277, 1992.

152. TAKEMORI, A. E., SULTANA, M., NAGASE, H. AND PORTOGHESE, P. S.: Agonist and antagonist activities of ligands derived from naltrexone and oxymorphine. Life Sci. 50: 1491-1495, 1992.

153. TERENIUS, L.: Stereospecific interaction between narcotic analgesics and a synaptic plasma membrane. Acta. Pharmacol. Toxicol. 32: 317- 320, 1973.

154. TERENIUS, L. AND WAHLSTROM, A.: Inhibition of narcotic receptor binding in brain extracts and cerebrospinal fluid. Acta. Pharmacol. et. Toxicol. 35 (supply 1): 55, 1975.

155. TRABER, 1., FISCHER, K., LATZIN, S. AND HAMPRECHT, B.: Morphine antagonists action of prostaglandin in neuroblastoma and glioma hybrid cells. Nature 253: 120-122, 1975.

156. TOTH, G., KRAMER, T. H., KNAPP, R. 1., LUI, G., DAVIS, P., BURKS, T. F., YAMAMURA, H.I. AND HRUBY, V. 1.: [D-Pen2, D­ pen5]enkephalin analogous with increased affinity and selectivity for 0 opioid receptors. J. Med. Chern. 33: 249-253, 1990.

157. TOTH, G., RUSSELL, K. C., LANDIS, G., KRAMER, T. H., FANG, L., KNAPP, R. J., DAVIS, P., BURKS, T. F., Y AMAMURA, H. I. AND HRUBY, V. 1.: Ring substituted and other conformationally constrained tyrosine analogues of [D-Pen2, D-pen5]enkephalin with delta opioid receptor selectivity. 1. Med. Chern. 35: 2384-2391, 1992.

158. UEDA, H., NOZAKI, M. AND SATOH, M.: Multiple opioid receptors and GTP-binding proteins. Compo Biochem. Physiol. 980: 157-169, 1991. 128 159. UNNA, K.: Antagonistic effect ofN-allylnormorphine upon morphine. J. Pharmacol. Exp. Ther. 79: 27-31, 1943.

160. VAN DE HEIINING, B. J., KOEKKOEK-VAN DEN HERIK, I. AND VAN WIMERSMA GREIDANUS, T. B.: The opioid receptor subtypes mu and kappa, but not delta, are involved in the control of the vasopressin and oxytocin release in the rat. Eur. J. Pharmacol. 209: 199-206, 1991.

161. VANDERAH, T. W., WILD, K. D., TAKEMORI, A. E., SULTANA, M., PORTAGHESE, P. S., BOWEN, W. D., MOSBERG, H. I. AND PORRECA, F.: Mediation of swim-stress antinociception by the opioid delta2 receptor in the mouse. 1. Pharmacol. Exp. Ther. 262: 190-197, 1992.

162. VAUGHN, 1. K., KNAPP, R. 1., rOTH, G., WAN, Y.-P., HRUBY, V. J. AND YAMAMURA, H. I.: A high affinity, highly selective ligand for the delta opioid receptor: [3H][D-Pen2, pCI-Phe4, D­ Pen5]enkephalin. Life Sci. 45: 1001-1008, 1989.

163.VAUGHN,1. K., WIRE, W. S., DAVIS, P., SHIMOHIGASHI, Y., TOTH, G., KNAPP, R. 1., HRUBY, V. J., BURKS, T. F. AND YAMAMURA, H. I.: Differentiation between rat brain and mouse vas deferens () opioid receptors. Eur. J. Pharmacol. 177: 99-101, 1990.

164. VAUGHT, 1. L. AND TAKEMORI, A. E.: Differential effects of leucine enkephalin and methionine enkephalin on morphin-induced analgesia, acute tolerance and dependence. J. Pharmacol. Exp. Ther. 208: 86-90, 1979.

165. VAUGHT, 1. L., ROTHMAN, R. B. AND WESTFALL, T. C.: Mu and delta receptors: their role in analgesia and in the differential effects of opioid peptides on analgesia. Life Sci. 30: 1443-1455, 1982. 129 166. WANG, J. B., JOHNSON, P. S., PERSICO, A. M., HAWKINS, A. L., GRIFFIN, C. A. AND URI, G. R.: cDNA and genomic clones, pharmacologic characterization and chromosomal assignment. FEBS Lett. 338: 217-222, 1994.

167. WERLING, L. L., PUTTFARCKEN, P. S. AND COX, B. M.: Multiple agonist-affinity states of opioid receptors: regulation of binding by guanyl nucleotides in guinea pig cortical, NG 108-15 and 7315c cell membranes. Mol. Pharmacol33: 423-431, 1988.

168. WERZ, M. A. AND MACDONALD, R. L.: Opioid peptides with differential affinity for mu and delta receptors decrease sensory neuron calcium-dependent action potentials. J. Pharmacol. Exp. Ther. 227: 394-402, 1983.

169. WERZ, M. A. AND MACDONALD, R. L.: Dynorphin reduced calcium-dependent action potential duration by decreasing voltage­ dependent calcium conductance. Neurosci. Lett. 46: 185-190, 1984.

170. WERZ, M. A. AND MACDONALD, R. L.: Dynorphin and neoendorphin peptides decrease dorsal root ganglion neuron calcium­ dependent action potential duration. J. Pharmacol. Exp. Ther. 234 : 49- 56, 1985.

171. WILD, K. D., FANG, L., MCNUTT, R. W., CHANG, K.-J., TOTH, G., BORSODI, A., YAMAMURA, H. I. AND PORRECA, F.: Opioid delta receptor binding of BW 373U86, a non-peptidic delta agonist, is not regulated by guanine nucleotides and sodium. Eur. J. Pharmacol. 246: 289-292, 1993a.

172. WILLIAMS, J. T. AND NORTH, R. A.: Opiate-receptor interactions on single locus coeruleus neurons. Mol. Pharmacol. 26: 489-497, 1984.

173. WUSTER, M., SCHULZ, R. AND HERZ, A.: Specificity of opioids towards the mu, delta and epsilon opiate receptors. Neurosci. Lett. 15: 193-198,1979. 130 174. XU, H., NI, Q., JACOBSON, A. E., RICE, K. C. AND ROTHMAN, R. B.: Preliminary ligand binding data for subtypes of the delta opioid receptor in rat brain membranes. Life Sci. 49: PLI41-PLI46, 1991.

175. YAMAMURA, M. S., HORVATH, R., TOTH, G., OTVOS, F., MALATYNSKA, E., KNAPP, R. J., PORRECA, F., HRUBY, V. J. AND YAMAMURA, H. I.: Characterization of [3H]naltrindole binding to delta opioid receptors in rat brain. Life. Sci. 50: PLI19-PLI24, 1992.

176. YASUDA, K., RAYNOR, K., KONG, H., BREDER, C. D., TAKEDA, J., REISINE, T. AND BELL, G. I.: Cloning and functional comparison of K and 0 opioid receptors from mouse brain. Proc. Nati. Acad. Sci. USA 90: 6736-6740, 1993.

177. YU, V. C., RICHARDS, M. L. AND SADEE, W.: A human neuroblastoma cell line expresses mu and delta opioid receptor sites. J. BioI. Chern. 261: 1065-1070, 1986.