Overexpression of UBE2C Correlates with Poor Prognosis in Gastric Cancer Patients

European Review for Medical and Pharmacological Sciences 2018; 22: 1665-1671 Overexpression of UBE2C correlates with poor prognosis in gastric cancer patients

H.-Q. ZHANG1,2, G. ZHAO1, B. KE1, G. MA1, G.-L. LIU1, H. LIANG1, L.-R. LIU1, X.-S. HAO1

1Department of Gastrointestinal Cancer Biology, National Clinical Research Center of Cancer, Tianjin Medical University Cancer Institute and Hospital, Tianjin, China 2Department of General Surgery, The First Central Hospital of Baoding, Baoding, China

Abstract. – OBJECTIVE: The ubiquitin-con- ches the top, with more than 40 cases per 100,000. jugating enzyme E2C (UBE2C) has been known The occurrence of gastric cancer is more common as a crucial factor upregulated in various tumors. in males than in females, and mostly affects ol- The functions of UBE2C is mainly involved in the der population. The average age of people when pathway protein ubiquitination. This study inves- tigates the expression of UBE2C in gastric can- they are diagnosed is 68. Notably, East Asia area cers and its correlation with overall survival rate. accounts for more than 50% of gastric cancer-re- MATERIALS AND METHODS: Real-time PCR lated deaths worldwide2. The development and (RT-PCR) and Western blotting were performed progression of gastric cancer are mainly due to to determine the expression of UBE2C in gas- the complex mechanisms of oncogenes and tu- tric cancer samples and adjacent normal tis- mor suppressors. There has been considerable sues. Immunohistochemical staining was used progress in the treatment of gastric cancer over to assess the expression of UBE2C in 216 paraffin-embedded gastric cancer tissues. the years. However, the improvement in a 5-year RESULTS: The mRNA and relevant protein lev- survival rate of the treatment of gastric cancer is els of UBE2C in gastric cancer tissues are sig- merely significant3. UBE2C (Ubiquitin-conjuga- nificantly greater than those in the adjacent nor- ting enzyme E2 C) is a protein, which locates at mal tissues. Also, the expression of UBE2C is chromosome 20q13.12. UBE2C has eight isofor- found to correlate with lymphatic metastasis, ms and consists of 179 amino acids with mole- serosa invasion, TNM (Malignant Tumors) stag- 4 ing and Lauren’s classification (p<0.05). The cular weight of 19625 Da . As an essential pro- univariate analysis shows that the overexpres- tein involved in the regulation of cell cycle, the sion of UBE2C associates with poor progno- expression of UBE2C varies in different phases. sis (p=0.001). The multivariate analysis demon- Okamoto et al5 suggested that UBE2C protein strates that expression of UBE2C, lymphatic is highly expressed in various cancer cell lines, metastasis, and TNM staging are independent but lowly expressed in regular cell lines. Further prognostic indicators. studies6,7 indicated that UBE2C overexpression CONCLUSIONS: This study shows that overexpression of UBE2C contributes to the devel- promotes proliferation and invasion of tumors. 7-11 opment of gastric cancer, and UBE2C has the Moreover, other studies have also demonstra- potential to be exploited as a therapeutic target. ted that UBE2C overexpression correlates with poor prognosis in many tumors, such as pancrea- Key Words: tic cancer, breast cancer, lung cancer, skin cancer UBE2C, Gastric cancer, Prognosis, Clinicopatholog- and thyroid cancer. The expression of UBE2C in ical characteristics. gastric cancer is not yet thoroughly studied. The correlation with prognosis is not elucidated. We used RT-PCR, Western blotting, and im- Introduction munohistochemistry to assess the expression of UBE2C in gastric cancer tissues. Also, we in- Gastric cancer is one of the crucial prevalent vestigated the correlation between UBE2C le- and the most aggressive tumors worldwide, with vels and clinicopathological parameters, and the approximately more than 60,000 deaths annual- correlation between UBE2C expressions and the ly1. The prevalence rate of gastric cancer in East overall survival rate of patients who went through Asia, such as China, Japan, and South Korea rea- radical gastrectomy.

Corresponding Author: Xishan Hao, MD; e-mail: [email protected] 1665 H.-Q. Zhang, G. Zhao, B. Ke, G. Ma, G.-L. Liu, H. Liang, L.-R. Liu, X.-S. Hao

Patients and Methods by grinding and then added with TRIzol reagent (Thermo Fisher Scientific, Waltham, MA, USA) Patients for washing. Subsequently, they were homog- 30 gastric cancer tissues and their respective enized in liquid nitrogen; 1 mL of TRIzol was adjacent normal tissues (5 cm from the tumors) added (Thermo Fisher Scientific, Waltham, MA, were obtained from 2016 April to 2016 May in USA), and total RNA was extracted. RNA was Tianjin Medical University Cancer Institute and then converted to cDNA using PCR (Polymerase Hospital (Tianjin, China). Immediately after the Chain Reaction). The reaction system for RT-PCR collection, the tissues were cut into three to four was Real-time PCR. Master mix 12.5 μL (Ther- pieces each (around 80 μg) and kept into sterile mo Fisher Scientific, Waltham, MA, USA), for- Eppendorf tubes (EP) and then stored in liquid ni- ward primers 0.5 μL (Abcam, Cambridge, MA, trogen at -80°C. This study was approved by the USA), reverse primers 0.5 μL (Abcam, Cam- Ethical Committee of Tianjin Medical University bridge, MA, USA), cDNA 2 μL (Abcam, Cam- Cancer Institute and Hospital (Tianjin, China), bridge, MA, USA), and water were added till the and all patients have signed the informed consent. total volume was 20 μL. UBE2C (ubiquitin-conjugating enzyme E2 C) forward primers (Abcam, Inclusion Criteria of Gastric Cambridge, MA, USA): 5’-CTGCCGAGCTCT- Cancer Patients GGAAAAAC-3’, UBE2C Reverse primers (Ab- 1- Patients with diagnosis of primary gastric cam, Cambridge, MA, USA), 5’-AGGAAAAAT- cancer before and after surgery; 2- patients with TAAAAAGACGACACAAG-3’. β-actin Forward no history of other cancers; 3- patients that have primers (Abcam, Cambridge, MA, USA): normal liver and kidney function; 4- patients with 5’GAGCTACGAGCTGCCTGACG3’, β-actin no Type II diabetes mellitus, hepatitis, cirrhosis or Reverse primers (Abcam, Cambridge, MA, USA) myocardial infarction; 5- patients with no history 5’CCTAGAAGCATTTGCGGTGG3’. RT-PCR of receiving radiotherapies, chemotherapies, endo- steps: 95°C 5 min, 95°C 30 s, 72°C 1 min, 40 crine therapies or immunotherapies prior to sur- cycles. Melting curve was obtained after ampli- gery. Paraffin samples were obtained from Tianjin fication. All the experiments were repeated three Medical University Cancer Institute and affiliated times and the relative expression of genes was Hospital (Tianjin, China). The total 216 samples calculated using 2-∆∆CT. were from patients who underwent radical gastrectomy, and the complete clinical and follow-up Western Blotting information was still available. Meanwhile, nor- Tissues were homogenized, and protein lysis mal tissues from the same patient were collected buffer was added and incubated for 30 min. After as the control. The number of male gastric cancer protein quantification using BCA (bicinchoninic patients is 139, and female 77. The median age is acid) (Abcam, Cambridge, MA, USA), 30 μg of 53.6 years old (22-79). The histological grading protein were loaded and subjected to SDS-PAGE and TNM (Malignant Tumors) staging (The TNM (sodium dodecyl sulfate polyacrylamide gel elec- Classification of Malignant Tumors) of the gastric trophoresis) electrophoresis. Primary antibodies cancers were done according to AJCC (American against UBE2C and β-actin were diluted at ratio Joint Committee on Cancer) (2010 7th edition). of 1:1000, respectively, and incubated overnight at 4°C. Secondary antibodies were diluted at a ratio Follow-up Visits of 1:1500 and incubated for 1 h at room tempera- All the follow-up visits were stick to the NCCN ture. Blots were then developed and analyzed. (The National Comprehensive Cancer Network) guidelines of gastric cancer. The frequency of Immunohistochemistry Analysis follow-up visits was one visit every three months Briefly, the sections were deparaffinized, en- within the first two years after surgery; every 6 dogenous peroxidase activity was quenched with months from year 3 to year 5. Approval was ob- hydrogen peroxide, and antigen retrieval was tained from Institutional Review Boards (Tian- carried out using heating. Immunohistochemical jing, China). staining was carried out according to manufactur- ers protocol (SP immunohistochemical staining Total RNA Extraction and RT-PCR kit) (Sigma Aldrich, St. Louis, MO, USA). Prima- The frozen gastric cancer tissue samples and ry antibody was diluted at a ratio of 1:100. The adjacent normal tissues were first homogenized sections were visualized using diaminobenzidine

1666 Overexpression of UBE2C correlates with poor prognosis in gastric cancer patients

Kaplan-Meier was exploited for survival analysis. For comparisons between groups, we setup a stratified log-rank test for analysis. Cox regres- sion model performed a univariate and multivariate analysis. p<0.05 is considered as statistically significant.

Results

mRNA Expression of UBE2C RT-PCR analysis shows that the average ∆CT value in the 30 gastric cancer tissue samples is 30.72±3.5, and the normal adjacent 32.64±1.2. Figure 1. Relative mRNA expression of UBE2C in gastric The relative mRNA expression of UBE2C is cancer tissues and adjacent normal tissues. shown in Figure 1.

Protein Expression of UBE2C (DAB) (Sigma Aldrich, St. Louis, MO, USA) and The Western blotting result shows that the mo- counterstained using hematoxylin. Known posi- lecular weight of the UBE2C protein is around tive staining and PBS (phosphate-buffered saline) 19kDa. The protein expression of UBE2C in gas- was utilized as the negative control. The positive tric cancer is high, while it is low in normal tis- result was defined as positive staining of UBE2C sues. Among the 30 tumor samples, 21 samples in the cytoplasm. Firstly, staining percentage had UBW2C up-regulation in the mucosa (pos- score was defined as follows: 0 (≤ 5%), 1 (6-25%), itive rate: 70%), as shown in Figure 2. Among 2 (26-50%), 3 (51-75%), 4 (≥ 76%). Secondly, stain- the 10 TNMI/II samples, 5 samples are UBE2C ing intensity score was determined by the color of positive (there are 8 TNMI samples, 3 of them the staining, such as light yellow, brown yellow show weak positivity of UBE2C and 5 of them or brown. The scoring is evaluated as follows: are negative; 2 TNMII samples are UBE2C pos- (1) 0 (no yellow color), 1 (light yellow), 2 (brown itive). 17 samples (85%) out of the 20 TNMIII/ yellow), 3 (brown). (2) The staining percentage is IV are UBE2C positive. Compared to the adjacent also classified into four classes based on 5 fields: normal tissues, gastric cancer samples have a sig- 0 (no positive cells), 1 (< 25% positive cells), 2 nificantly higher expression of UBE2C (p<0.01) (25-50%), 3 (≥ 51%). The final score is generated (Figures 3 and 4). by multiplying the staining intensity score by the relevant staining percentage. 0 is negative, 1-2 is weak, 3-6 is moderate, 7-9 is strong. Overall, the final score ≤ 2 is defined as negative, and > 2 is defined as positive.

Statistical Analysis We used SPSS13.0 (SPSS Inc., Chicago, IL, USA) for statistical analysis. The t-test was ap- plied to compare between groups, and x2-test was performed to test the correlation between UBE2C expression and clinicopathological parameters.

Figure 3. Expression of UBE2C protein in gastric cancer tissues and adjacent normal tissues was determined by West- Figure 2. Protein expression of UBE2C in gastric cancer ern blotting. Relative expression of UBE2C protein in gastric samples and adjacent normal tissues (T is gastric cancer tis- cancer tissues and adjacent normal tissues was plotted and sue, and N is adjacent normal tissue). differences were analyzed with a paired samples test (p<0.01).

1667 H.-Q. Zhang, G. Zhao, B. Ke, G. Ma, G.-L. Liu, H. Liang, L.-R. Liu, X.-S. Hao

A B

C D

Figure 4. (A) Positive expression of UBE2C protein in gastric cancer tissues (diffuse type). (B) Negative expression of UBE2C protein in gastric cancer tissues (diffuse type). (C) Negative expression of UBE2C protein in gastric cancer tissues (intestinal type). (D) Positive expression of UBE2C protein in gastric cancer tissues (intestinal type) (200X).

UBE2C Expression in Gastric Cancer difference between these two groups (χ2 = 6.370, Tissues Assessed by Immunohistochemistry p<0.05) (Table I). UBE2C proteins are expressed in the cytoplasm of tumor cells. Very few of the UBE2C Correlation Between UBE2C Expression proteins are localized at the nuclear membrane and Pathological Parameters with brown or dark brown color. The positivity The correlation between UBE2C expression rate of UBE2C protein in gastric cancers is 67.6% and pathological parameters in the 216 gastric (146/216). In the corresponding adjacent normal cancer patients is demonstrated in Table II. There tissues, there is no expression of UBE2C protein is no significant correlation between UBE2C level or very low expression, and the positivity rate is and age, gender, differentiation or the localization 19.4% (42/216) (Figure 4). There is a significant of the tumors. However, there is significant cor-

Table I. Expression of UBE2C in gastric cancer and adjacent normal tissues. UBE2C

N Positive Negative χ2 p-value

Gastric cancer 216 146 70 6.370 p<0.05 Adjacent normal 216 42 174

*Correlation is significant at the 0.05 level.

1668 Overexpression of UBE2C correlates with poor prognosis in gastric cancer patients

Table II. Correlation between UBE2C expression and pathological parameters. UBE2C Expression N Clinical parameters Positive (%) Negative (%) χ2 p-value

Age 216 146 (67.6) 70 (32.4) < 60 107 67 (62.6) 40 (37.4) 2.397 0.578 ≥ 60 109 79 (72.5) 30 (27.5) Gender Male 139 82 (59.0) 57 (41.0) 0.069 0.165 Female 77 44 (57.1) 33 (42.9) Tumor size (cm) ≤ 5 122 78 (63.9) 44 (36.1) 1.713 0.165 ≥5 94 68 (72.3) 26 (27.7) Differentiation High, medium, low or none 118 84 (71.2) 34 (29.8) 1.534 0.089 98 62 (63.3) 36 (36.7) Lymphatic metastasis Negative 81 45 (55.6) 36 (44.4) 8.572 0.015 Positive 135 101 (74.8) 34 (24.6) Tumor localization Cardiac 39 25 (64.1) 14 (35.9) 0.290 0.307 Body 48 32 (66.7) 16 (33.3) Antrum 129 89 (69.0) 40 (31.0) Lauren’s classification Intestinal 115 83 (72.1) 32 (27.9 2.357 0.043 Diffuse 101 63 (62.4) 38 (37.6) Invasion of serosa No 94 55 (58.5) 39 (41.6) 6.27 0.011 Yes 122 91 (74.6) 31 (25.4) TNM staging I-II 74 43 (58.1) 31 (41.9) 4.623 0.032 III-IV 142 103 (72.5) 39 (27.5)

Table III. Univariate and Multivariate analysis of factors that affect the survival rate in gastric cancer patients. Univariate analysis Multivariate analysis

Clinical parameters Hazard ratio (95% CI) p-value Hazard ratio (95% CI) p-value

Age 0.636 (0.359-1.128) 0.968 0.781 (0.401-1.219) 0.887 Gender 1.079 (0.611-1.903) 0.597 1.102 (0.707-2.113) 0.468 Differentiation 1.434 (0.810-2.537) 0.571 1.483 (0.719-2.640) 0.682 Lauren’s classification 1.564 (0.884-2.768) 0.114 1.591 (0.787-2.864) 0.229 Tumor diameter 0.678 (0.379-1.213) 0.149 0.632 (0.347-1.290) 0.154 Lymphatic metastasis 0.421(0.235-0.751) 0.013 0.419 (0.219-0.767) 0.026 TNM staging 0.525 (0.292-0.945) 0.003 0.536 (0.241-0.909) 0.011 Tumor location 1.826 (0.204-16.341) 0.092 1.839 (0.227-17.000) 0.134 UBE2C expression 8.641 (5.684-13.136) 0.001 8.345 (5.351-12.944) 0.007

relation with lymphatic metastasis, invasion of five-year survival rate is 37.1% (26/70) in the UBE2C serosa, TNM staging and Lauren’s classification negative group, and 19.8% in UBE2C positive group (p<0.05), (Table III). (Figure 5). There is a significant difference between these two groups (χ2=6.37, p<0.05). The medium Correlation Between UBE2C Expression survival time is 46.8 months (1-89 months), and and Prognosis in UBE2C positive and negative groups are 30.25 The 216 gastric cancer patients were divided into months and 50.0 months, respectively. Kaplan-Mei- UBE2C positive group and UBE2C negative group, er analysis shows UBE2C protein expression is cor- and the five-year survival rate is 25.5% (55/216). The related with poor prognosis.

1669 H.-Q. Zhang, G. Zhao, B. Ke, G. Ma, G.-L. Liu, H. Liang, L.-R. Liu, X.-S. Hao

gastric cancer tissues. The UBE2C expression is correlated with the invasion of serosa, lymphatic metastasis, TNM staging and Lauren’s classification, which implies that UBE2C affects the invasion, metastasis and tumor development. Lou- souarn et al19 suggested that UBE2C promotes lymphatic metastasis in breast cancer patients with positive lymph node. In thyroid cancer[20], UBE2C is also a critical factor that drives the ma- lignancy of tumors. Kaplan-Meier analysis shows that the overexpression of UBE2C is correlated with poor prognosis in gastric cancer patients. The finding indicates Figure 5. Correlation between UBE2C expression and sur- that gastric cancer patients with high expression of vival rate. UBE2C are likely to have a poor prognosis; therefore, they need more systematic post-surgery treatment. Univariate and Multivariate COX analysis show that UBE2C expression is an independent Discussion prognostic marker, suggesting that UBE2C could be a potential therapeutic target. Over the years, though there has been a considerable advancement in the diagnosis and treatment of gastric cancers, the prognosis is still a Conclusions challenging issue. The early symptoms of gastric cancer are not visible, and therefore, it is likely to We demonstrate the correlation between UBE2C be undiagnosed and untreated. It is of vital im- expression and Lauren’s classification, invasion of portance to find new biomarkers to facilitate the serosa, lymphatic metastasis, and TNM staging. diagnosis, relapse evaluation, and personalized UBE2C high expression indicates shorter survival chemotherapy. UBE2C is also called dJ447F3.2, time and poor prognosis. The study in colon cancer and it has been shown to be overexpressed in showed that inhibition of UBE2C could increase various cancers. Also, up-regulation of UBE2C the sensitivity to chemotherapies, including using can induce tumor cell proliferation, invasion, and small molecules that inhibit UBE2C. However, the metastasis12-14. Yang et al15 showed that UBE2C molecular mechanisms behind the regulation of is up-regulated in many cancer cell lines, and gastric cancer by UBE2C are still unclear, and this knockdown of UBE2C could decrease the prolif- is what we aim to investigate in the future. Addi- eration of gastric cancer cells. In this work, we tionally, we will explore the potential of utilizing investigated the correlation between UBE2C ex- UBE2C as a therapeutic target. pression and clinicopathological characteristics, including a 5-year survival rate. Firstly, we used methodologies such as RT-PCR Conflict of Interest and Western blotting to assess the mRNA and The Authors declare that they have no conflict of interests. protein expression of UBE2C in 30 tumor samples and adjacent normal tissues. Compared to the adjacent normal tissues, gastric cancer tissues References have higher mRNA and protein levels compare to UBE2C. Western blotting results showed that the 1) Ferlay J, Shin HR, Bray F, Forman D, Mathers C, Par- positive rate of UBE2C in the 30 samples is as kin DM. Estimates of worldwide burden of cancer much as 70% (21/30). Furthermore, the pattern of in 2008: GLOBOCAN 2008. Int J Cancer 2010; mRNA and protein expression is similar to their 127: 2893 -2917. matching samples. The data indicate that UBE2C 2) Chen W, Zheng R, Zeng H, Zhang S, He J. Annual report on status of cancer in China 2011. Chin J can function as an oncogene in gastric cancers, Cancer Res 2015; 27: 2-12. and play essential roles during tumor growth16-18. 3) Ono H. Early gastric cancer: diagnosis, pathology, Also, immunohistochemistry also showed treatment techniques and treatment outcomes. identical results of high expression of UBE2C in Eur J Gastroenterol Hepatol 2006; 18: 863-866.

1670 Overexpression of UBE2C correlates with poor prognosis in gastric cancer patients

4) Jiang F, Basavappa R. Crystal structure of the cy- 13) Rawat A, Gopal G, Selvaluxmy G, Rajkumar T. Inhi- clin-specific ubiquitin-conjugating enzyme from bition of ubiquitin conjugating enzyme UBE2C clam, E2-C, at 2.0 A resolution. Biochemistry reduces prolife ration and sensitizes breast can- 1999; 38: 6471-6478. cer cells to radiation, doxorubicin, tamoxifen and 5) Okamoto Y, Ozaki T, Miyazaki K, Aoyama M, Miyazaki letrozole. Cell Oncol (Dordr) 2013; 36: 459-467. M, Nakagawara A. UbcH10 is the cancer-related 14) Li C, Xue HG, Feng LJ, Wang ML, Wang P, Gai XD. E2 ubiquitin-conjugating enzyme. Cancer Res The effect of saikosaponin D on doxorubicin phar- 2003; 63: 4167-4173. macokinetics and its MDR reversal in MCF-7/adr 6) Fujita T, Ikeda H, Taira N, Hatoh S, Naito M, Doihara cell xenografts. Eur Rev Med Pharmacol Sci 2017; H. Overexpression of UbcH10 alternates the cell 21: 4437-4445. cycle profile and accelerate the tumor prolifera- 15) Yang M, Qu Y, Shi R, Wu X, Su C, Hu Z, Chang Q, Liu tion in colon cancer. BMC Cancer 2009; 9: 87. S, Pan G, Lei M, Xie F, Tu S, Tao W, Zhou H, Hu G, Zhang Z 7) Chen S, Chen Y, Hu C, Jing H, Cao Y, Liu X. Associ- . Ubiquitin-conjugating enzyme UbcH10 ation of clinicopathological features with UbcH10 promotes gastric cancer growth and is a potential expression in colorectal cancer. Cancer Res Clin biomarker for gastric cancer. Oncol Rep 2016; 36: Oncol 2010; 136: 419-426. 779-786. Fujita T, Ikeda H, Taira N, Hatoh S, Naito M, Doihara van Ree JH, Jeganathan KB, Malureanu L, van Deurs- 16) 8) H. en JM. Overexpression of the E2 ubiquitin-con- Overexpression of UbcH10 alternates the cell jugating enzyme UbcH10 causes chromosome cycle profile and accelerate the tumor prolifera- missegregation and tumor formation. J Cell Biol tion in colon cancer. BMC Cancer 2009; 9: 87. 2010; 188: 83-100. 17) Chen S, Chen Y, Hu C, Jing H, Cao Y, Liu X. Associ- 9) Pallante P, Berlingieri MT, Troncone G, Kruhoffer ation of clinicopathological features with UbcH10 M, Orntoft TF, Viglietto G, Caleo A, Migliaccio I, expression in colorectal cancer. Cancer Res Clin Decaussin-Petrucci M, Santoro M, Palombini L, Fusco Oncol 2010; 136: 419-426. A. UbcH10 overexpression may represent a mark- 18) Cacciola NA, Calabrese C, Malapelle U, Pellino G, er of anaplastic thyroid carcinomas. Br J Cancer De Stefano A, Sepe R, Sgariglia R, Quintavalle C, 2005; 93: 464-471 Federico A, Bianco A, Uchimura Bastos A, Milone M, Bellevicine C, Milone F, Carlomagno C, Selvaggi F, 10) Psyrri A, Kalogeras KT, Kronenwett R, Wirtz RM, Troncone G, Fusco A, Pallante P. Batistatou A, Bournakis E, Timotheadou E, Gogas UbcH10 expres- H, Aravantinos G, Christodoulou C, Makatsoris T, sion can predict prognosis and sensitivity to the Linardou H, Pectasides D, Pavlidis N, Economopou- antineoplastic treatment for colorectal cancer pa- los T, Fountzilas G. Prognostic significance of tients. Mol Carcinog 2016; 55: 793-807. UBE2C mRNA expression in high-risk early 19) Loussouarn D, Campion L, Leclair F, Campone M, breast cancer. A Hellenic Cooperative Oncolo- Charbonnel C, Ricolleau G, Gouraud W, Bataille R, gy Group (HeCOG) Study. Ann Oncol 2012; 23: Jézéquel P. Validation of UBE2C protein as a prog- 1422-1427. nostic marker in node-positive breast cancer. Br J 11) Zhao ZK, Wu WG, Chen L, Dong P, Gu J, Mu JS, Cancer 2009; 101: 166-173. Yang JH, Liu YB. Expression of UbcH10 in pan- 20) Lee JJ, Au AY, Foukakis T, Barbaro M, Kiss N, Clif- creatic ductal adenocareinoma and its correla- ton-Bligh R, Staaf J, Borg A, Delbridge L, Robinson tion with prognosis. Tumour Biol 2013; 34: 1473- BG, Wallin G, Höög A, Larsson C. Array-CGH 1477. identifies cyclin D1 and UBCH10 amplicons in an- 12) Sudbo J, Lippman SM, Lee JJ, Mao L, Kildal W, Sudbo aplastic thyroid carcinoma. Endocr Relat Cancer A, Sagen S, Bryne M, El-Naggar A, Risberg B, Evensen 2008; 15: 801-815. JF, Reith A. The influence of resection and aneu- 21) Sabitha, K. Rajkumar, T. Identification of small mol- ploidy on mortality in oral leukoplakia. N Engl J ecule inhibitors against UBE2C by using docking Med 2004; 350: 1405-1413. studies. Bioinformation 2012; 8: 1047-1058.

1671