DOCSLIB.ORG

Overexpression of UBE2C Correlates with Poor Prognosis in Gastric Cancer Patients

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Overexpression of UBE2C Correlates with Poor Prognosis in Gastric Cancer Patients European Review for Medical and Pharmacological Sciences 2018; 22: 1665-1671 Overexpression of UBE2C correlates with poor prognosis in gastric cancer patients H.-Q. ZHANG1,2, G. ZHAO1, B. KE1, G. MA1, G.-L. LIU1, H. LIANG1, L.-R. LIU1, X.-S. HAO1 1Department of Gastrointestinal Cancer Biology, National Clinical Research Center of Cancer, Tianjin Medical University Cancer Institute and Hospital, Tianjin, China 2Department of General Surgery, The First Central Hospital of Baoding, Baoding, China Abstract. – OBJECTIVE: The ubiquitin-con- ches the top, with more than 40 cases per 100,000. jugating enzyme E2C (UBE2C) has been known The occurrence of gastric cancer is more common as a crucial factor upregulated in various tumors. in males than in females, and mostly affects ol- The functions of UBE2C is mainly involved in the der population. The average age of people when pathway protein ubiquitination. This study inves- tigates the expression of UBE2C in gastric can- they are diagnosed is 68. Notably, East Asia area cers and its correlation with overall survival rate. accounts for more than 50% of gastric cancer-re- MATERIALS AND METHODS: Real-time PCR lated deaths worldwide2. The development and (RT-PCR) and Western blotting were performed progression of gastric cancer are mainly due to to determine the expression of UBE2C in gas- the complex mechanisms of oncogenes and tu- tric cancer samples and adjacent normal tis- mor suppressors. There has been considerable sues. Immunohistochemical staining was used progress in the treatment of gastric cancer over to assess the expression of UBE2C in 216 paraf- fin-embedded gastric cancer tissues. the years. However, the improvement in a 5-year RESULTS: The mRNA and relevant protein lev- survival rate of the treatment of gastric cancer is els of UBE2C in gastric cancer tissues are sig- merely significant3. UBE2C (Ubiquitin-conjuga- nificantly greater than those in the adjacent nor- ting enzyme E2 C) is a protein, which locates at mal tissues. Also, the expression of UBE2C is chromosome 20q13.12. UBE2C has eight isofor- found to correlate with lymphatic metastasis, ms and consists of 179 amino acids with mole- serosa invasion, TNM (Malignant Tumors) stag- 4 ing and Lauren’s classification (p<0.05). The cular weight of 19625 Da . As an essential pro- univariate analysis shows that the overexpres- tein involved in the regulation of cell cycle, the sion of UBE2C associates with poor progno- expression of UBE2C varies in different phases. sis (p=0.001). The multivariate analysis demon- Okamoto et al5 suggested that UBE2C protein strates that expression of UBE2C, lymphatic is highly expressed in various cancer cell lines, metastasis, and TNM staging are independent but lowly expressed in regular cell lines. Further prognostic indicators. studies6,7 indicated that UBE2C overexpression CONCLUSIONS: This study shows that over- expression of UBE2C contributes to the devel- promotes proliferation and invasion of tumors. 7-11 opment of gastric cancer, and UBE2C has the Moreover, other studies have also demonstra- potential to be exploited as a therapeutic target. ted that UBE2C overexpression correlates with poor prognosis in many tumors, such as pancrea- Key Words: tic cancer, breast cancer, lung cancer, skin cancer UBE2C, Gastric cancer, Prognosis, Clinicopatholog- and thyroid cancer. The expression of UBE2C in ical characteristics. gastric cancer is not yet thoroughly studied. The correlation with prognosis is not elucidated. We used RT-PCR, Western blotting, and im- Introduction munohistochemistry to assess the expression of UBE2C in gastric cancer tissues. Also, we in- Gastric cancer is one of the crucial prevalent vestigated the correlation between UBE2C le- and the most aggressive tumors worldwide, with vels and clinicopathological parameters, and the approximately more than 60,000 deaths annual- correlation between UBE2C expressions and the ly1. The prevalence rate of gastric cancer in East overall survival rate of patients who went through Asia, such as China, Japan, and South Korea rea- radical gastrectomy. Corresponding Author: Xishan Hao, MD; e-mail: [email protected] 1665 H.-Q. Zhang, G. Zhao, B. Ke, G. Ma, G.-L. Liu, H. Liang, L.-R. Liu, X.-S. Hao Patients and Methods by grinding and then added with TRIzol reagent (Thermo Fisher Scientific, Waltham, MA, USA) Patients for washing. Subsequently, they were homog- 30 gastric cancer tissues and their respective enized in liquid nitrogen; 1 mL of TRIzol was adjacent normal tissues (5 cm from the tumors) added (Thermo Fisher Scientific, Waltham, MA, were obtained from 2016 April to 2016 May in USA), and total RNA was extracted. RNA was Tianjin Medical University Cancer Institute and then converted to cDNA using PCR (Polymerase Hospital (Tianjin, China). Immediately after the Chain Reaction). The reaction system for RT-PCR collection, the tissues were cut into three to four was Real-time PCR. Master mix 12.5 μL (Ther- pieces each (around 80 μg) and kept into sterile mo Fisher Scientific, Waltham, MA, USA), for- Eppendorf tubes (EP) and then stored in liquid ni- ward primers 0.5 μL (Abcam, Cambridge, MA, trogen at -80°C. This study was approved by the USA), reverse primers 0.5 μL (Abcam, Cam- Ethical Committee of Tianjin Medical University bridge, MA, USA), cDNA 2 μL (Abcam, Cam- Cancer Institute and Hospital (Tianjin, China), bridge, MA, USA), and water were added till the and all patients have signed the informed consent. total volume was 20 μL. UBE2C (ubiquitin-con- jugating enzyme E2 C) forward primers (Abcam, Inclusion Criteria of Gastric Cambridge, MA, USA): 5’-CTGCCGAGCTCT- Cancer Patients GGAAAAAC-3’, UBE2C Reverse primers (Ab- 1- Patients with diagnosis of primary gastric cam, Cambridge, MA, USA), 5’-AGGAAAAAT- cancer before and after surgery; 2- patients with TAAAAAGACGACACAAG-3’. β-actin Forward no history of other cancers; 3- patients that have primers (Abcam, Cambridge, MA, USA): normal liver and kidney function; 4- patients with 5’GAGCTACGAGCTGCCTGACG3’, β-actin no Type II diabetes mellitus, hepatitis, cirrhosis or Reverse primers (Abcam, Cambridge, MA, USA) myocardial infarction; 5- patients with no history 5’CCTAGAAGCATTTGCGGTGG3’. RT-PCR of receiving radiotherapies, chemotherapies, endo- steps: 95°C 5 min, 95°C 30 s, 72°C 1 min, 40 crine therapies or immunotherapies prior to sur- cycles. Melting curve was obtained after ampli- gery. Paraffin samples were obtained from Tianjin fication. All the experiments were repeated three Medical University Cancer Institute and affiliated times and the relative expression of genes was Hospital (Tianjin, China). The total 216 samples calculated using 2-∆∆CT. were from patients who underwent radical gas- trectomy, and the complete clinical and follow-up Western Blotting information was still available. Meanwhile, nor- Tissues were homogenized, and protein lysis mal tissues from the same patient were collected buffer was added and incubated for 30 min. After as the control. The number of male gastric cancer protein quantification using BCA (bicinchoninic patients is 139, and female 77. The median age is acid) (Abcam, Cambridge, MA, USA), 30 μg of 53.6 years old (22-79). The histological grading protein were loaded and subjected to SDS-PAGE and TNM (Malignant Tumors) staging (The TNM (sodium dodecyl sulfate polyacrylamide gel elec- Classification of Malignant Tumors) of the gastric trophoresis) electrophoresis. Primary antibodies cancers were done according to AJCC (American against UBE2C and β-actin were diluted at ratio Joint Committee on Cancer) (2010 7th edition). of 1:1000, respectively, and incubated overnight at 4°C. Secondary antibodies were diluted at a ratio Follow-up Visits of 1:1500 and incubated for 1 h at room tempera- All the follow-up visits were stick to the NCCN ture. Blots were then developed and analyzed. (The National Comprehensive Cancer Network) guidelines of gastric cancer. The frequency of Immunohistochemistry Analysis follow-up visits was one visit every three months Briefly, the sections were deparaffinized, en- within the first two years after surgery; every 6 dogenous peroxidase activity was quenched with months from year 3 to year 5. Approval was ob- hydrogen peroxide, and antigen retrieval was tained from Institutional Review Boards (Tian- carried out using heating. Immunohistochemical jing, China). staining was carried out according to manufactur- ers protocol (SP immunohistochemical staining Total RNA Extraction and RT-PCR kit) (Sigma Aldrich, St. Louis, MO, USA). Prima- The frozen gastric cancer tissue samples and ry antibody was diluted at a ratio of 1:100. The adjacent normal tissues were first homogenized sections were visualized using diaminobenzidine 1666 Overexpression of UBE2C correlates with poor prognosis in gastric cancer patients Kaplan-Meier was exploited for survival analy- sis. For comparisons between groups, we setup a stratified log-rank test for analysis. Cox regres- sion model performed a univariate and multivar- iate analysis. p<0.05 is considered as statistically significant. Results mRNA Expression of UBE2C RT-PCR analysis shows that the average ∆CT value in the 30 gastric cancer tissue samples is 30.72±3.5, and the normal adjacent 32.64±1.2. Figure 1. Relative mRNA expression of UBE2C in gastric The relative mRNA expression of UBE2C is cancer tissues and adjacent normal tissues. shown in Figure 1. Protein Expression of UBE2C (DAB) (Sigma Aldrich, St. Louis, MO, USA) and The Western blotting result shows that the mo- counterstained using hematoxylin. Known posi- lecular weight of the UBE2C protein is around tive staining and PBS (phosphate-buffered saline) 19kDa. The protein expression of UBE2C in gas- was utilized as the negative control. The positive tric cancer is high, while it is low in normal tis- result was defined as positive staining of UBE2C sues. Among the 30 tumor samples, 21 samples in the cytoplasm. Firstly, staining percentage had UBW2C up-regulation in the mucosa (pos- score was defined as follows: 0 (≤ 5%), 1 (6-25%), itive rate: 70%), as shown in Figure 2.
Load more

Recommended publications
  • UBE2C Is Upregulated by Estrogen and Promotes Epithelial–Mesenchymal Transition Via P53 in Endometrial Cancer
    Published OnlineFirst October 29, 2019; DOI: 10.1158/1541-7786.MCR-19-0561 MOLECULAR CANCER RESEARCH | CANCER GENES AND NETWORKS UBE2C Is Upregulated by Estrogen and Promotes Epithelial–Mesenchymal Transition via p53 in Endometrial Cancer Yan Liu1, Rong Zhao1, Shuqi Chi1, Wei Zhang1, Chengyu Xiao1, Xing Zhou1, Yingchao Zhao2, and Hongbo Wang1 ABSTRACT ◥ Ubiquitin-conjugating enzyme E2C (UBE2C) plays important inhibited endometrial cancer cell proliferation, migration, invasion, roles in tumor progression; nevertheless, its function in endometrial and epithelial–mesenchymal transition (EMT), whereas UBE2C cancer remains unclear. This study elucidated the impact of UBE2C overexpression exerted the opposite effects. UBE2C downregulation on endometrial cancer and its underlying mechanism. Human increased p53 and its downstream p21 expression, with p53 over- endometrial cancer and normal endometrial tissues were acquired expression reversing the EMT-promoting effects of UBE2C. UBE2C from patients at Wuhan Union Hospital and UBE2C expression was enhanced p53 ubiquitination to facilitate its degradation in endo- detected by Western blotting and qRT-PCR. Endometrial cancer metrial cancer cells. Estradiol (E2) induced UBE2C expression via cells were transfected with a UBE2C overexpression plasmid or estrogen receptor a, which binds directly to the UBE2C promoter UBE2C-specific short hairpin RNA (shRNA) to up- or downregu- element. Silencing of UBE2C inhibited E2-promoted migration, late UBE2C expression, respectively. CCK8 and transwell assays
    [Show full text]
  • E2 Ubiquitin-Conjugating Enzymes in Cancer Implications for Immunotherapeutic Interventions
    Clinica Chimica Acta 498 (2019) 126–134 Contents lists available at ScienceDirect Clinica Chimica Acta journal homepage: www.elsevier.com/locate/cca Review E2 ubiquitin-conjugating enzymes in cancer: Implications for immunotherapeutic interventions T Seyed Mohammad Hosseinia,b, Isobel Okoyec, Mitra Ghasemi Chaleshtarid, Bita Hazhirkarzare, Javad Mohamadnejadb, Gholamreza Azizif, Mohammad Hojjat-Farsangig,h, Hamed Mohammadif, ⁎ Siamak Sandoghchian Shotorbania, Farhad Jadidi-Niaraghi,j, a Drug Applied Research Center, Tabriz University of Medical Sciences, Tabriz, Iran b Department of Life Science Engineering, Faculty of New Sciences and Technologies, University of Tehran, Tehran, Iran c Department of Dentistry, Faculty of Medicine and Dentistry, University of Alberta, Edmonton, T6G 2E1, Canada d Department of Clinical Biochemistry, Faculty of Medicine, Yasuj University of Medical Sciences, Yasuj, Iran e Russell H. Morgan Department of Radiology and Radiological Sciences, Johns Hopkins University School of Medicine, Baltimore, MD 21287, USA f Non-Communicable Diseases Research Center, Alborz University of Medical Sciences, Karaj, Iran g Bioclinicum, Department of Oncology-Pathology, Karolinska Institute, Stockholm, Sweden h The Persian Gulf Marine Biotechnology Medicine Research Center, Bushehr University of Medical Sciences, Bushehr, Iran i Immunology Research Center, Tabriz University of Medical Sciences, Tabriz, Iran j Department of Immunology, Faculty of Medicine, Tabriz University of Medical Sciences, Tabriz, Iran ARTICLE INFO ABSTRACT Keywords: Despite the medical advances of the 21st century, the incidence of cancer continues to increase and the search for E2 conjugating enzymes a universal cure remains a major health challenge. Our lack of understanding the complex pathophysiology of Ubiquitin the tumor microenvironment has hindered the development and efficiency of anti-cancer therapeutic strategies.
    [Show full text]
  • Targeting the Ubiquitin System in Glioblastoma', Frontiers in Oncology
    Citation for published version: Licchesi, J 2020, 'Targeting the Ubiquitin System in Glioblastoma', Frontiers in Oncology. https://doi.org/10.3389/fonc.2020.574011 DOI: 10.3389/fonc.2020.574011 Publication date: 2020 Document Version Publisher's PDF, also known as Version of record Link to publication University of Bath Alternative formats If you require this document in an alternative format, please contact: [email protected] General rights Copyright and moral rights for the publications made accessible in the public portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognise and abide by the legal requirements associated with these rights. Take down policy If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim. Download date: 24. Sep. 2021 REVIEW published: 25 November 2020 doi: 10.3389/fonc.2020.574011 Targeting the Ubiquitin System in Glioblastoma Nico Scholz 1, Kathreena M. Kurian 2, Florian A. Siebzehnrubl 3 and Julien D. F. Licchesi 1* 1 Department of Biology & Biochemistry, University of Bath, Bath, United Kingdom, 2 Brain Tumour Research Group, Institute of Clinical Neurosciences, University of Bristol, Bristol, United Kingdom, 3 Cardiff University School of Biosciences, European Cancer Stem Cell Research Institute, Cardiff, United Kingdom Glioblastoma is the most common primary brain tumor in adults with poor overall outcome and 5-year survival of less than 5%. Treatment has not changed much in the last decade or so, with surgical resection and radio/chemotherapy being the main options.
    [Show full text]
  • Protein Engineering of a Ubiquitin-Variant Inhibitor of APC/C Identifies a Cryptic K48 Ubiquitin Chain Binding Site
    Protein engineering of a ubiquitin-variant inhibitor of APC/C identifies a cryptic K48 ubiquitin chain binding site Edmond R. Watsona,b, Christy R. R. Gracea, Wei Zhangc,d,2, Darcie J. Millera, Iain F. Davidsone, J. Rajan Prabub, Shanshan Yua, Derek L. Bolhuisf, Elizaveta T. Kulkof, Ronnald Vollrathb, David Haselbache,g, Holger Starkg, Jan-Michael Peterse,h, Nicholas G. Browna,f, Sachdev S. Sidhuc,1, and Brenda A. Schulmana,b,1 aDepartment of Structural Biology, St. Jude Children’s Research Hospital, Memphis, TN 38105; bDepartment of Molecular Machines and Signaling, Max Planck Institute of Biochemistry, 82152 Martinsried, Germany; cDonnelly Centre for Cellular and Biomolecular Research, Banting and Best Department of Medical Research, University of Toronto, Toronto, ON, Canada M5S3E1; dDepartment of Molecular Genetics, University of Toronto, Toronto, ON, Canada M5S3E1; eResearch Institute of Molecular Pathology, Vienna BioCenter, 1030 Vienna, Austria; fDepartment of Pharmacology and Lineberger Comprehensive Cancer Center, University of North Carolina School of Medicine, Chapel Hill, NC 27599; gMax Planck Institute for Biophysical Chemistry, 37077 Göttingen, Germany; and hMedical University of Vienna, 1090 Vienna, Austria Contributed by Brenda A. Schulman, June 24, 2019 (sent for review February 19, 2019; reviewed by Kylie Walters and Hao Wu) Ubiquitin (Ub)-mediated proteolysis is a fundamental mechanism the type of catalytic domain. E3s harboring “HECT” and “RBR” used by eukaryotic cells to maintain homeostasis and protein catalytic domains promote ubiquitylation through 2-step reac- quality, and to control timing in biological processes. Two essential tions involving formation of a thioester-linked intermediate be- aspects of Ub regulation are conjugation through E1-E2-E3 enzy- tween the E3 and Ub’s C terminus: First, Ub is transferred from matic cascades and recognition by Ub-binding domains.
    [Show full text]
  • Ubiquitin Modifications
    npg Cell Research (2016) 26:399-422. REVIEW www.nature.com/cr Ubiquitin modifications Kirby N Swatek1, David Komander1 1Medical Research Council Laboratory of Molecular Biology, Francis Crick Avenue, Cambridge, CB2 0QH, UK Protein ubiquitination is a dynamic multifaceted post-translational modification involved in nearly all aspects of eukaryotic biology. Once attached to a substrate, the 76-amino acid protein ubiquitin is subjected to further modi- fications, creating a multitude of distinct signals with distinct cellular outcomes, referred to as the ‘ubiquitin code’. Ubiquitin can be ubiquitinated on seven lysine (Lys) residues or on the N-terminus, leading to polyubiquitin chains that can encompass complex topologies. Alternatively or in addition, ubiquitin Lys residues can be modified by ubiq- uitin-like molecules (such as SUMO or NEDD8). Finally, ubiquitin can also be acetylated on Lys, or phosphorylated on Ser, Thr or Tyr residues, and each modification has the potential to dramatically alter the signaling outcome. While the number of distinctly modified ubiquitin species in cells is mind-boggling, much progress has been made to characterize the roles of distinct ubiquitin modifications, and many enzymes and receptors have been identified that create, recognize or remove these ubiquitin modifications. We here provide an overview of the various ubiquitin modifications present in cells, and highlight recent progress on ubiquitin chain biology. We then discuss the recent findings in the field of ubiquitin acetylation and phosphorylation, with a focus on Ser65-phosphorylation and its role in mitophagy and Parkin activation. Keywords: ubiquitin; proteasomal degradation; phosphorylation; post-translational modification; Parkin Cell Research (2016) 26:399-422.
    [Show full text]
  • Ubiquitinating Enzyme Systems Eric Yao, Msc
    TECHNICAL BULLETIN Ubiquitinating Enzyme Systems Eric Yao, MSc. Scientist, Product Management - SignalChem Biotech Inc. Target Ub Recognizing Domain Target A E1 E2 Ub Target P Ub P Ub P E3 Ub Ub Poly-Ub A P P E1 E2 E2 - Interacting Ub P Domain Ub Ub Ub Monomeric 26 S Proteosome Ubiquitin Polymeric Ubiquitin Ub Ub Ub Ub Ub Ub Ub Ub Ub Ub Deconjugation/ Ub Ub Ub Recycling Target Degradation Protein modifications by ubiquitin (Ub) or ubiquitin-like proteins (UBLs) participate in many critical cellular processes such as cell-cycle regulation, DNA repair, oncogenesis, antiviral pathways and most notably, proteasomal degradation of target proteins. Ubiquitination and modification by UBLs share a similar catalytic cascade which requires the sequential action of three classes of enzymes: E1 activating enzymes, E2 conjugating enzymes and E3 ligases. Recent research has linked dysregulation of the Ub/UBLs modification system to numerous diseases including cancer, immunological disorders and neurodegeneration. Thus, the high substrate specificity provided by combinations of over 30 E2’s and over 600 E3’s makes these enzymes emerging drug targets. In response to a growing market demand, SignalChem has developed an extensive array of products encompassing enzymes, Ub/UBL modifiers and substrates in the ubiquitination, SUMOylation, ISGylation and NEDDylation processes. Using Promega’s AMP-GloTM technology and an optimized assay protocol, we have identified and validated a variety of functional combinations of the enzyme components. With the established protocol, each enzyme in the catalytic cascade has been assessed for their activity towards generation of free AMP. In addition, inhibition profiles of the ubiquitinating enzymes have been obtained using the assay system, further demonstrating their potential to be used in high-throughput screening to identify lead compounds for drug discovery and development programs.
    [Show full text]
  • Comparative Analysis of the Ubiquitin-Proteasome System in Homo Sapiens and Saccharomyces Cerevisiae
    Comparative Analysis of the Ubiquitin-proteasome system in Homo sapiens and Saccharomyces cerevisiae Inaugural-Dissertation zur Erlangung des Doktorgrades der Mathematisch-Naturwissenschaftlichen Fakultät der Universität zu Köln vorgelegt von Hartmut Scheel aus Rheinbach Köln, 2005 Berichterstatter: Prof. Dr. R. Jürgen Dohmen Prof. Dr. Thomas Langer Dr. Kay Hofmann Tag der mündlichen Prüfung: 18.07.2005 Zusammenfassung I Zusammenfassung Das Ubiquitin-Proteasom System (UPS) stellt den wichtigsten Abbauweg für intrazelluläre Proteine in eukaryotischen Zellen dar. Das abzubauende Protein wird zunächst über eine Enzym-Kaskade mit einer kovalent gebundenen Ubiquitinkette markiert. Anschließend wird das konjugierte Substrat vom Proteasom erkannt und proteolytisch gespalten. Ubiquitin besitzt eine Reihe von Homologen, die ebenfalls posttranslational an Proteine gekoppelt werden können, wie z.B. SUMO und NEDD8. Die hierbei verwendeten Aktivierungs- und Konjugations-Kaskaden sind vollständig analog zu der des Ubiquitin- Systems. Es ist charakteristisch für das UPS, daß sich die Vielzahl der daran beteiligten Proteine aus nur wenigen Proteinfamilien rekrutiert, die durch gemeinsame, funktionale Homologiedomänen gekennzeichnet sind. Einige dieser funktionalen Domänen sind auch in den Modifikations-Systemen der Ubiquitin-Homologen zu finden, jedoch verfügen diese Systeme zusätzlich über spezifische Domänentypen. Homologiedomänen lassen sich als mathematische Modelle in Form von Domänen- deskriptoren (Profile) beschreiben. Diese Deskriptoren können wiederum dazu verwendet werden, mit Hilfe geeigneter Verfahren eine gegebene Proteinsequenz auf das Vorliegen von entsprechenden Homologiedomänen zu untersuchen. Da die im UPS involvierten Homologie- domänen fast ausschließlich auf dieses System und seine Analoga beschränkt sind, können domänen-spezifische Profile zur Katalogisierung der UPS-relevanten Proteine einer Spezies verwendet werden. Auf dieser Basis können dann die entsprechenden UPS-Repertoires verschiedener Spezies miteinander verglichen werden.
    [Show full text]
  • Downregulation of Carnitine Acyl-Carnitine Translocase by Mirnas
    Page 1 of 288 Diabetes 1 Downregulation of Carnitine acyl-carnitine translocase by miRNAs 132 and 212 amplifies glucose-stimulated insulin secretion Mufaddal S. Soni1, Mary E. Rabaglia1, Sushant Bhatnagar1, Jin Shang2, Olga Ilkayeva3, Randall Mynatt4, Yun-Ping Zhou2, Eric E. Schadt6, Nancy A.Thornberry2, Deborah M. Muoio5, Mark P. Keller1 and Alan D. Attie1 From the 1Department of Biochemistry, University of Wisconsin, Madison, Wisconsin; 2Department of Metabolic Disorders-Diabetes, Merck Research Laboratories, Rahway, New Jersey; 3Sarah W. Stedman Nutrition and Metabolism Center, Duke Institute of Molecular Physiology, 5Departments of Medicine and Pharmacology and Cancer Biology, Durham, North Carolina. 4Pennington Biomedical Research Center, Louisiana State University system, Baton Rouge, Louisiana; 6Institute for Genomics and Multiscale Biology, Mount Sinai School of Medicine, New York, New York. Corresponding author Alan D. Attie, 543A Biochemistry Addition, 433 Babcock Drive, Department of Biochemistry, University of Wisconsin-Madison, Madison, Wisconsin, (608) 262-1372 (Ph), (608) 263-9608 (fax), [email protected]. Running Title: Fatty acyl-carnitines enhance insulin secretion Abstract word count: 163 Main text Word count: 3960 Number of tables: 0 Number of figures: 5 Diabetes Publish Ahead of Print, published online June 26, 2014 Diabetes Page 2 of 288 2 ABSTRACT We previously demonstrated that micro-RNAs 132 and 212 are differentially upregulated in response to obesity in two mouse strains that differ in their susceptibility to obesity-induced diabetes. Here we show the overexpression of micro-RNAs 132 and 212 enhances insulin secretion (IS) in response to glucose and other secretagogues including non-fuel stimuli. We determined that carnitine acyl-carnitine translocase (CACT, Slc25a20) is a direct target of these miRNAs.
    [Show full text]
  • The Human Gene Connectome As a Map of Short Cuts for Morbid Allele Discovery
    The human gene connectome as a map of short cuts for morbid allele discovery Yuval Itana,1, Shen-Ying Zhanga,b, Guillaume Vogta,b, Avinash Abhyankara, Melina Hermana, Patrick Nitschkec, Dror Friedd, Lluis Quintana-Murcie, Laurent Abela,b, and Jean-Laurent Casanovaa,b,f aSt. Giles Laboratory of Human Genetics of Infectious Diseases, Rockefeller Branch, The Rockefeller University, New York, NY 10065; bLaboratory of Human Genetics of Infectious Diseases, Necker Branch, Paris Descartes University, Institut National de la Santé et de la Recherche Médicale U980, Necker Medical School, 75015 Paris, France; cPlateforme Bioinformatique, Université Paris Descartes, 75116 Paris, France; dDepartment of Computer Science, Ben-Gurion University of the Negev, Beer-Sheva 84105, Israel; eUnit of Human Evolutionary Genetics, Centre National de la Recherche Scientifique, Unité de Recherche Associée 3012, Institut Pasteur, F-75015 Paris, France; and fPediatric Immunology-Hematology Unit, Necker Hospital for Sick Children, 75015 Paris, France Edited* by Bruce Beutler, University of Texas Southwestern Medical Center, Dallas, TX, and approved February 15, 2013 (received for review October 19, 2012) High-throughput genomic data reveal thousands of gene variants to detect a single mutated gene, with the other polymorphic genes per patient, and it is often difficult to determine which of these being of less interest. This goes some way to explaining why, variants underlies disease in a given individual. However, at the despite the abundance of NGS data, the discovery of disease- population level, there may be some degree of phenotypic homo- causing alleles from such data remains somewhat limited. geneity, with alterations of specific physiological pathways under- We developed the human gene connectome (HGC) to over- come this problem.
    [Show full text]
  • The N-Terminal Extension of UBE2E Ubiquitin-Conjugating Enzymes Limits Chain Assembly
    View metadata, citation and similar papers at core.ac.uk brought to youFeatured by CORE provided by Elsevier - PublisherArcle Connector The N-Terminal Extension of UBE2E Ubiquitin-Conjugating Enzymes Limits Chain Assembly Frances-Rose Schumacher, Georgina Wilson and Catherine L. Day Biochemistry Department, University of Otago, Dunedin 9054, New Zealand Correspondence to Catherine L. Day: [email protected] http://dx.doi.org/10.1016/j.jmb.2013.06.039 Edited by S. Khorasanizadeh Abstract Protein ubiquitylation depends upon the concerted action of ubiquitin-conjugating enzymes (E2s) and ubiquitin ligases (E3s). All E2s have a conserved ubiquitin-conjugating (UBC) domain but many have variable extensions N- and C-terminal to the UBC domain. For many E2s, the function of the extension is not well understood. Here, we show that the N-terminal extension of the UBE2E proteins regulates formation of polyubiquitin chains by the processive UBC domain. Target proteins are therefore mono- ubiquitylated by full-length UBE2E, whereas the UBC domain alone polyubiquitylates proteins. Although the N-terminal extension of UBE2E1 is largely disordered in solution, these residues have acriticalroleinlimitingchainbuilding,andwhen fused to the highly processive E2, UBE2D2, ubiquitylation is limited. For some E2s, interaction of ubiquitin with the ‘backside’ of the UBC domain Legend: Some ubiquitin-conjugating enzymes (E2s) com- promotes polyubiquitylation. However, interaction of prise just the conserved core domain, whereas others such ubiquitin with the backside of the UBC domain of as the UBE2E family have an N-terminal extension. Here, UBE2E1 does not appear to be important for we show that the core domain can build chains but the processivity.
    [Show full text]
  • 1 Supporting Information for Real-Time Tracking of Complex
    Supporting Information for Real-time tracking of complex ubiquitination cascades using a fluorescent confocal on-bead assay Joanna Koszela*, Nhan T Pham, David Evans, Stefan Mann, Irene Perez-Pi, Steven Shave, Derek F J Ceccarelli, Frank Sicheri, Mike Tyers, Manfred Auer* Supporting Methods Inhibitors BAY 11-7082, clomipramine and heclin were purchased from Sigma Aldrich (cat. no B5556, C7291 and SML1396, respectively). PYR-41 was purchased from Calbiochem (cat. no 662105) and CC0651 was provided by the Tyers group. The masses and purity of compounds were confirmed by analytical HPLC and LC/MS. Proteins The following proteins were purchased from BostonBiochem: wild type ubiquitin (cat. no U- 100H); untagged human recombinant ubiquitin activating enzyme (UBE1) (cat. no E-304); N- terminally His6-tagged human recombinant ubiquitin activating enzyme (UBE1) (cat. no E- 305); human recombinant E6AP (UBE3A) with a C-terminal His6-tag (cat. no E3-230). Protein expression and purification His6-tagged Ube2L3 was expressed from pET28a-LIC (provided by the Sicheri group) in BL21(DE3) E. coli. 1 L cultures were grown at 37°C in LB and induced with 0.5 mM isopropyl β-D-1-thiogalactopyranoside (IPTG) at 20°C overnight. Cells were harvested by centrifugation at 4,000 rpm, 4°C and lysed in lysis buffer (50 mM sodium phosphate buffer pH 8, 400 mM NaCl, 10 mM imidazole, 10 mM β-mercaptoethanol, protease inhibitor cocktail (Roche) with lysozyme (Sigma-Aldrich) and Benzonase Nuclease (Sigma-Aldrich, cat. no E8263)) and sonicated on ice for 1 min in 10 second pulses at 50% of maximum power 1 (Sonic VibraCell).
    [Show full text]
  • Circulating Mir-1246 Targeting UBE2C, TNNI3, TRAIP, UCHL1
    Journal of Personalized Medicine Article Circulating miR-1246 Targeting UBE2C, TNNI3, TRAIP, UCHL1 Genes and Key Pathways as a Potential Biomarker for Lung Adenocarcinoma: Integrated Biological Network Analysis Siyuan Huang 1, Yong-Kai Wei 2, Satyavani Kaliamurthi 3,4 , Yanghui Cao 5, Asma Sindhoo Nangraj 6, Xin Sui 1, Dan Chu 7, Huan Wang 7, Dong-Qing Wei 3,4,6 , Gilles H. Peslherbe 3, Gurudeeban Selvaraj 3,4 and Jiang Shi 7,* 1 Department of Oncology, The First Affiliated Hospital of Zhengzhou University, No.1 Jianshe East Road, Zhengzhou 450052, China; [email protected] (S.H.); [email protected] (X.S.) 2 College of Science, Henan University of Technology, Zhengzhou 450001, China; [email protected] 3 Centre for Research in Molecular Modeling and Department of Chemistry and Biochemistry, Concordia University, 7141 Sherbrooke Street West, Montréal, QC H4B 1R6, Canada; [email protected] (S.K.); [email protected] (D.-Q.W.); [email protected] (G.H.P.); [email protected] (G.S.) 4 Center of Interdisciplinary Science-Computational Life Sciences, College of Biological Engineering, Henan University of Technology, No.100, Lianhua Street, Hi-Tech Development Zone, Zhengzhou 450001, China 5 Department of General Surgery, Henan Tumor Hospital, No.127 Dongming Road, Zhengzhou 450008, China; [email protected] 6 The State Key Laboratory of Microbial Metabolism, College of Life Sciences and Biotechnology, Shanghai Jiao Tong University, Shanghai 200240, China; [email protected] 7 Department of Respiratory, The First Affiliated Hospital of Zhengzhou University, No.1 Jianshe East Road, Zhengzhou 450052, China; [email protected] (D.C.); [email protected] (H.W.) * Correspondence: [email protected]; Tel.: +86-15824836717 Received: 20 August 2020; Accepted: 28 September 2020; Published: 11 October 2020 Abstract: Analysis of circulating miRNAs (cmiRNAs) before surgical operation (BSO) and after the surgical operation (ASO) has been informative for lung adenocarcinoma (LUAD) diagnosis, progression, and outcomes of treatment.
    [Show full text]