European Review for Medical and Pharmacological Sciences 2018; 22: 1665-1671 Overexpression of UBE2C correlates with poor prognosis in gastric cancer patients H.-Q. ZHANG1,2, G. ZHAO1, B. KE1, G. MA1, G.-L. LIU1, H. LIANG1, L.-R. LIU1, X.-S. HAO1 1Department of Gastrointestinal Cancer Biology, National Clinical Research Center of Cancer, Tianjin Medical University Cancer Institute and Hospital, Tianjin, China 2Department of General Surgery, The First Central Hospital of Baoding, Baoding, China Abstract. – OBJECTIVE: The ubiquitin-con- ches the top, with more than 40 cases per 100,000. jugating enzyme E2C (UBE2C) has been known The occurrence of gastric cancer is more common as a crucial factor upregulated in various tumors. in males than in females, and mostly affects ol- The functions of UBE2C is mainly involved in the der population. The average age of people when pathway protein ubiquitination. This study inves- tigates the expression of UBE2C in gastric can- they are diagnosed is 68. Notably, East Asia area cers and its correlation with overall survival rate. accounts for more than 50% of gastric cancer-re- MATERIALS AND METHODS: Real-time PCR lated deaths worldwide2. The development and (RT-PCR) and Western blotting were performed progression of gastric cancer are mainly due to to determine the expression of UBE2C in gas- the complex mechanisms of oncogenes and tu- tric cancer samples and adjacent normal tis- mor suppressors. There has been considerable sues. Immunohistochemical staining was used progress in the treatment of gastric cancer over to assess the expression of UBE2C in 216 paraf- fin-embedded gastric cancer tissues. the years. However, the improvement in a 5-year RESULTS: The mRNA and relevant protein lev- survival rate of the treatment of gastric cancer is els of UBE2C in gastric cancer tissues are sig- merely significant3. UBE2C (Ubiquitin-conjuga- nificantly greater than those in the adjacent nor- ting enzyme E2 C) is a protein, which locates at mal tissues. Also, the expression of UBE2C is chromosome 20q13.12. UBE2C has eight isofor- found to correlate with lymphatic metastasis, ms and consists of 179 amino acids with mole- serosa invasion, TNM (Malignant Tumors) stag- 4 ing and Lauren’s classification (p<0.05). The cular weight of 19625 Da . As an essential pro- univariate analysis shows that the overexpres- tein involved in the regulation of cell cycle, the sion of UBE2C associates with poor progno- expression of UBE2C varies in different phases. sis (p=0.001). The multivariate analysis demon- Okamoto et al5 suggested that UBE2C protein strates that expression of UBE2C, lymphatic is highly expressed in various cancer cell lines, metastasis, and TNM staging are independent but lowly expressed in regular cell lines. Further prognostic indicators. studies6,7 indicated that UBE2C overexpression CONCLUSIONS: This study shows that over- expression of UBE2C contributes to the devel- promotes proliferation and invasion of tumors. 7-11 opment of gastric cancer, and UBE2C has the Moreover, other studies have also demonstra- potential to be exploited as a therapeutic target. ted that UBE2C overexpression correlates with poor prognosis in many tumors, such as pancrea- Key Words: tic cancer, breast cancer, lung cancer, skin cancer UBE2C, Gastric cancer, Prognosis, Clinicopatholog- and thyroid cancer. The expression of UBE2C in ical characteristics. gastric cancer is not yet thoroughly studied. The correlation with prognosis is not elucidated. We used RT-PCR, Western blotting, and im- Introduction munohistochemistry to assess the expression of UBE2C in gastric cancer tissues. Also, we in- Gastric cancer is one of the crucial prevalent vestigated the correlation between UBE2C le- and the most aggressive tumors worldwide, with vels and clinicopathological parameters, and the approximately more than 60,000 deaths annual- correlation between UBE2C expressions and the ly1. The prevalence rate of gastric cancer in East overall survival rate of patients who went through Asia, such as China, Japan, and South Korea rea- radical gastrectomy. Corresponding Author: Xishan Hao, MD; e-mail: [email protected] 1665 H.-Q. Zhang, G. Zhao, B. Ke, G. Ma, G.-L. Liu, H. Liang, L.-R. Liu, X.-S. Hao Patients and Methods by grinding and then added with TRIzol reagent (Thermo Fisher Scientific, Waltham, MA, USA) Patients for washing. Subsequently, they were homog- 30 gastric cancer tissues and their respective enized in liquid nitrogen; 1 mL of TRIzol was adjacent normal tissues (5 cm from the tumors) added (Thermo Fisher Scientific, Waltham, MA, were obtained from 2016 April to 2016 May in USA), and total RNA was extracted. RNA was Tianjin Medical University Cancer Institute and then converted to cDNA using PCR (Polymerase Hospital (Tianjin, China). Immediately after the Chain Reaction). The reaction system for RT-PCR collection, the tissues were cut into three to four was Real-time PCR. Master mix 12.5 μL (Ther- pieces each (around 80 μg) and kept into sterile mo Fisher Scientific, Waltham, MA, USA), for- Eppendorf tubes (EP) and then stored in liquid ni- ward primers 0.5 μL (Abcam, Cambridge, MA, trogen at -80°C. This study was approved by the USA), reverse primers 0.5 μL (Abcam, Cam- Ethical Committee of Tianjin Medical University bridge, MA, USA), cDNA 2 μL (Abcam, Cam- Cancer Institute and Hospital (Tianjin, China), bridge, MA, USA), and water were added till the and all patients have signed the informed consent. total volume was 20 μL. UBE2C (ubiquitin-con- jugating enzyme E2 C) forward primers (Abcam, Inclusion Criteria of Gastric Cambridge, MA, USA): 5’-CTGCCGAGCTCT- Cancer Patients GGAAAAAC-3’, UBE2C Reverse primers (Ab- 1- Patients with diagnosis of primary gastric cam, Cambridge, MA, USA), 5’-AGGAAAAAT- cancer before and after surgery; 2- patients with TAAAAAGACGACACAAG-3’. β-actin Forward no history of other cancers; 3- patients that have primers (Abcam, Cambridge, MA, USA): normal liver and kidney function; 4- patients with 5’GAGCTACGAGCTGCCTGACG3’, β-actin no Type II diabetes mellitus, hepatitis, cirrhosis or Reverse primers (Abcam, Cambridge, MA, USA) myocardial infarction; 5- patients with no history 5’CCTAGAAGCATTTGCGGTGG3’. RT-PCR of receiving radiotherapies, chemotherapies, endo- steps: 95°C 5 min, 95°C 30 s, 72°C 1 min, 40 crine therapies or immunotherapies prior to sur- cycles. Melting curve was obtained after ampli- gery. Paraffin samples were obtained from Tianjin fication. All the experiments were repeated three Medical University Cancer Institute and affiliated times and the relative expression of genes was Hospital (Tianjin, China). The total 216 samples calculated using 2-∆∆CT. were from patients who underwent radical gas- trectomy, and the complete clinical and follow-up Western Blotting information was still available. Meanwhile, nor- Tissues were homogenized, and protein lysis mal tissues from the same patient were collected buffer was added and incubated for 30 min. After as the control. The number of male gastric cancer protein quantification using BCA (bicinchoninic patients is 139, and female 77. The median age is acid) (Abcam, Cambridge, MA, USA), 30 μg of 53.6 years old (22-79). The histological grading protein were loaded and subjected to SDS-PAGE and TNM (Malignant Tumors) staging (The TNM (sodium dodecyl sulfate polyacrylamide gel elec- Classification of Malignant Tumors) of the gastric trophoresis) electrophoresis. Primary antibodies cancers were done according to AJCC (American against UBE2C and β-actin were diluted at ratio Joint Committee on Cancer) (2010 7th edition). of 1:1000, respectively, and incubated overnight at 4°C. Secondary antibodies were diluted at a ratio Follow-up Visits of 1:1500 and incubated for 1 h at room tempera- All the follow-up visits were stick to the NCCN ture. Blots were then developed and analyzed. (The National Comprehensive Cancer Network) guidelines of gastric cancer. The frequency of Immunohistochemistry Analysis follow-up visits was one visit every three months Briefly, the sections were deparaffinized, en- within the first two years after surgery; every 6 dogenous peroxidase activity was quenched with months from year 3 to year 5. Approval was ob- hydrogen peroxide, and antigen retrieval was tained from Institutional Review Boards (Tian- carried out using heating. Immunohistochemical jing, China). staining was carried out according to manufactur- ers protocol (SP immunohistochemical staining Total RNA Extraction and RT-PCR kit) (Sigma Aldrich, St. Louis, MO, USA). Prima- The frozen gastric cancer tissue samples and ry antibody was diluted at a ratio of 1:100. The adjacent normal tissues were first homogenized sections were visualized using diaminobenzidine 1666 Overexpression of UBE2C correlates with poor prognosis in gastric cancer patients Kaplan-Meier was exploited for survival analy- sis. For comparisons between groups, we setup a stratified log-rank test for analysis. Cox regres- sion model performed a univariate and multivar- iate analysis. p<0.05 is considered as statistically significant. Results mRNA Expression of UBE2C RT-PCR analysis shows that the average ∆CT value in the 30 gastric cancer tissue samples is 30.72±3.5, and the normal adjacent 32.64±1.2. Figure 1. Relative mRNA expression of UBE2C in gastric The relative mRNA expression of UBE2C is cancer tissues and adjacent normal tissues. shown in Figure 1. Protein Expression of UBE2C (DAB) (Sigma Aldrich, St. Louis, MO, USA) and The Western blotting result shows that the mo- counterstained using hematoxylin. Known posi- lecular weight of the UBE2C protein is around tive staining and PBS (phosphate-buffered saline) 19kDa. The protein expression of UBE2C in gas- was utilized as the negative control. The positive tric cancer is high, while it is low in normal tis- result was defined as positive staining of UBE2C sues. Among the 30 tumor samples, 21 samples in the cytoplasm. Firstly, staining percentage had UBW2C up-regulation in the mucosa (pos- score was defined as follows: 0 (≤ 5%), 1 (6-25%), itive rate: 70%), as shown in Figure 2.