In Vitro Selection and Affinity Maturation of Antibodies from A

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Proc. Natd. Acad. Sci. USA Vol. 89, pp. 3576-3580, April 1992 Biochemistry In vitro selection and affinity maturation of antibodies from a naive combinatorial immunoglobulin library (naive immunoglobulin repertoire/fflamentous phage/random mutagenesis) HERMANN GRAM*, LORI-ANNE MARCONI, CARLOS F. BARBAS III, THOMAS A. COLLET, RICHARD A. LERNER, AND ANGRAY S. KANG The Scripps Research Institute, Departments of Molecular Biology and Chemistry, 10666 North Torrey Pines Road, La Jolla, CA 92037 Contributed by Richard A. Lerner, January 7, 1992 ABSTRACT We have used a combinatorial immunoglob- H-chain IgG isotype for molecular cloning, and/or the high ulin library approach to obtain monoclonal antibodies from abundance of specific mRNA in the starting material (12) nonimmune adult mice, thereby establishing the principles of most likely biased the combinatorial libraries toward affinity- (i) accessing naive combinatorial antibody libraries for prede- matured antibodies. Recently, Marks et al. (19) demonstrated termined specificities and (ii) increasing the affinity of the that active single-chain (Sc) antibodies with affinity constants selected antibody binding sites by random mutagenesis. A between 106 and 107 M-1 against a hapten or a small number combinatorial Fab library expressing immunoglobulin Ip and it of epitopes on a protein can be obtained directly from light-chain fragments on the surface of filamentous phage was nonimmune combinatorial immunoglobulin libraries. prepared from bone marrow ofnonimmunized, adult BALB/c In its simplest form, the initial stage of the immune mice with the multivalent display vector pComb8. Phage response can be re-created in vitro by generating a combi- displaying low affinity Fabs (binding constants, 104-1O M-') natorial library of PCR-amplified immunoglobulin At and L binding to a progesterone-bovine serum albumin conjugate chains from the bone marrow of adult mice. This is a close were isolated from the library. Random mutagenesis of the approximation to the naive, unselected repertoire, since the heavy- and light-chain variable regions expressed in the mono- majority of B cells in bone marrow expressing immunoglob- valent phage display vector pComb3 was performed by error- ulin ,u chains have not been subjected to tolerance and prone PCR, and subsequently clones with improved affinity for antigen selection and should therefore represent all the the hapten conjugate were selected. We demonstrate that combinatorial junctional diversity of immunoglobulin V re- antibodies with desirable characteristics from a nonimmune gions (20). The phagemid pComb8 facilitates the display of source may be selected and affinity maturation may be achieved multiple copies ofthe Fab fragments along the phage surface by using the twin vectors pComb8 and pComb3, thus opening permitting access to low-affinity antibodies (15, 16). Hence, the route to obtaining specific antibodies from a generic library specific VH and VL pairs could possibly be enriched from a and bypassing immunization. diverse naive repertoire. The second stage of the immune response in vivo involves The B-cell immune response to an antigen can be viewed to affinity maturation of the selected specificities by mutation occur in two stages. The initial stage generates low-affinity and selection. An efficient way to generate random mutations antibodies mostly of the IgM isotype from an existing pool of in the laboratory is by an error-prone replication mechanism, the B-cell repertoire available at the time of immunization. either by targeting the mutations to the antibody binding sites The second stage, which is driven by antigen stimulation, by error-prone PCR (21), or by passaging the phagemid produces high-affinity antibodies predominantly of the IgG Fab isotype, starting with the light-chain and heavy-chain vari- carrying the genetic information for the fragment through able region (VL and VH) genes selected in the primary an Escherichia coli mutD strain, in which the spontaneous response. The predominant mechanism for affinity matura- mutation frequency is 103-105 times higher than in a wild-type tion is hypermutation ofV region genes followed by selection strain (22). Here we describe our results using error-prone of those cells that produce antibodies of the highest affinity PCR. In subsequent communications, we will describe a (reviewed in refs. 1 and 2). Both stages in the immune complementary method using randomized complementarity- response have been accessed and extensively studied by determining region (CDR) 3 sequences of a VH region to hybridoma technology (3). generate mutants (C.F.B., unpublished data). In the present Recently, there has been much interest in using gene study, we chose progesterone as a hapten since it elicits a cloning approaches to generate and express antibodies by restricted immune response in mice (23, 24). The method combinatorial library techniques to bypass hybridoma tech- described here has three essential features: (i) the ability to nology (4-19). The main driving force for this approach is to initially access low-affinity Fabs from a naive library by the more efficiently harness the vast antibody repertoire. We and use of multivalent phage expression systems, (ii) subsequent others have successfully generated diverse high-affinity an- affinity maturation by error-prone PCR, and (iii) use of a Sc tibodies to haptens, virus particles, and protein antigens, construct during the maturation process to avoid a high thereby recapitulating functional molecules appearing during background of artifactual binding due to loss of the L chain. the natural immune response in animals and humans. Most of When used in concert, these methods allow selection and the molecular genetic approaches for obtaining active anti- affinity maturation of antibodies from a naive library. bodies by screening combinatorial immunoglobulin libraries were directed toward the second stage of the antibody response, since the immunization protocol, the choice of the Abbreviations: BSA, bovine serum albumin; CDR, complementar- ity-determining region; gVIII and gIII, M13 gene VIII and gene III, respectively; Sc, single chain; VL, light-chain variable region; VH, The publication costs of this article were defrayed in part by page charge heavy-chain variable region. payment. This article must therefore be hereby marked "advertisement" *Present address: Sandoz Pharma, Preclinical Research, CH-4002 in accordance with 18 U.S.C. §1734 solely to indicate this fact. Basel, Switzerland. 3576 Downloaded by guest on September 25, 2021 Biochemistry: Gram et al. Proc. Natl. Acad. Sci. USA 89 (1992) 3577 METHODS TTAGATCGGAACCAGAACCAGAAGA TTT ACC TCTAGAGACTTTC-3'), was inserted into the Xho I/Spe I RNA Isolation and cDNA Synthesis. Three nonimmunized digested truncated pComb3 vector forming the phagemid adult male (6 months old) BALB/cByJ mice (Scripps breed- ScpComb3. The internal recognition sequences for restric- ing colony) were used to prepare 5 x 107 bone marrow cells tion endonucleases Xba I (TCTAGA) and Sac I (GAGCTC) in 4% fetal calf serum in phosphate-buffered saline (PBS). To are underlined. The VH and VL segments ofthe progesterone deplete for surface IgG-positive cells, the preparation was binders were amplified by PCR using the upstream primer incubated with rat anti-mouse IgG2b (0.1 ml), goat anti- described above and the oligonucleotides 5'-ATTTGG- mouse IgG (0.1 ml), and rabbit anti-mouse IgG2b (0.1 ml) for GAAGGACTGTCTAGATGMRGAGAC-3' (M is A or C and 30 min at ambient temperature. The cells were pelleted, R is A or G) and 5'-GAGGACTAGTTACAGTTGGTGCAG- washed with PBS, and resuspended in PBS (9 ml). Rabbit CATCAG-3', respectively. The internal recognition se- complement was added (1 ml) and incubated at 370C for 30 quences for Xba I (TCTAGA) and Spe I (ACTAGT) are min. The cells were pelleted and total RNA was isolated as underlined. The VH and VL Fv PCR fragments were digested described by Kang et al. (25). Total RNA was used as a with Xho I/Xba I and Sac I/Spe I, respectively, and subse- template for cDNA synthesis for p and K chains with the quently inserted into ScpComb3. following primers: A chain, 5'-ATTGGGACT AGI TTCTGC Expression and Detection of Soluble Fabs and Sc Fv Anti- GAC AGC TGG ATT-3'; K chain, 5'-GCG CCG IC[ AiA bodies. For Fab production, the gVIII moiety in the phage- ATT AAC ACT CAT TCC TGT TGAA-3', respectively, mids encoding the progesterone binders PgA11, PgB6, and using a SuperScript kit (BRL). Briefly, 7 Ag oftotal RNA was PgF1 was excised with restriction endonucleases Spe I and mixed with 60 pmol of primer, heated to 70'C for 10 min, and EcoRI and was subsequently replaced by a synthetic linker immediately cooled on ice. Two microliters of RNase inhib- encoding a TAA stop codon (underlined). The linker was itor, 10 pl of 5 x synthesis buffer, 8 A.l of dNTP mixture (to formed by the oligonucleotides 5'-CTAGTTAACTGAG- give a final concentration of 200 AM each NTP), 5 jul of 0.1 TAAG-3' and 5'-AATTCTTACTCAGHIAA-3'. The produc- M dithiothreitol, and 1 Al of BRL SuperScript reverse tion and detection of antibody Fab fragment was performed transcriptase (200 units/,l) were added, and the reaction essentially as described (18, 26) except that the E. coli cells mixture was made up to 50 pl with diethylpyrocarbonate- were disrupted by three freeze-thaw cycles. For producing treated water. The reaction was allowed to proceed at room soluble ScFv antibody fragments, the VH-linker-VL fusions temperature for 10 min and then
Recommended publications
  • B Cell Activation and Escape of Tolerance Checkpoints: Recent Insights from Studying Autoreactive B Cells

    B Cell Activation and Escape of Tolerance Checkpoints: Recent Insights from Studying Autoreactive B Cells

    cells Review B Cell Activation and Escape of Tolerance Checkpoints: Recent Insights from Studying Autoreactive B Cells Carlo G. Bonasia 1 , Wayel H. Abdulahad 1,2 , Abraham Rutgers 1, Peter Heeringa 2 and Nicolaas A. Bos 1,* 1 Department of Rheumatology and Clinical Immunology, University Medical Center Groningen, University of Groningen, 9713 Groningen, GZ, The Netherlands; [email protected] (C.G.B.); [email protected] (W.H.A.); [email protected] (A.R.) 2 Department of Pathology and Medical Biology, University Medical Center Groningen, University of Groningen, 9713 Groningen, GZ, The Netherlands; [email protected] * Correspondence: [email protected] Abstract: Autoreactive B cells are key drivers of pathogenic processes in autoimmune diseases by the production of autoantibodies, secretion of cytokines, and presentation of autoantigens to T cells. However, the mechanisms that underlie the development of autoreactive B cells are not well understood. Here, we review recent studies leveraging novel techniques to identify and characterize (auto)antigen-specific B cells. The insights gained from such studies pertaining to the mechanisms involved in the escape of tolerance checkpoints and the activation of autoreactive B cells are discussed. Citation: Bonasia, C.G.; Abdulahad, W.H.; Rutgers, A.; Heeringa, P.; Bos, In addition, we briefly highlight potential therapeutic strategies to target and eliminate autoreactive N.A. B Cell Activation and Escape of B cells in autoimmune diseases. Tolerance Checkpoints: Recent Insights from Studying Autoreactive Keywords: autoimmune diseases; B cells; autoreactive B cells; tolerance B Cells. Cells 2021, 10, 1190. https:// doi.org/10.3390/cells10051190 Academic Editor: Juan Pablo de 1.
  • Case of the Anti HIV-1 Antibody, B12

    Case of the Anti HIV-1 Antibody, B12

    Spectrum of Somatic Hypermutations and Implication on Antibody Function: Case of the anti HIV-1 antibody, b12 Mesfin Mulugeta Gewe A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy University of Washington 2015 Reading Committee: Roland Strong, Chair Nancy Maizels Jessica A. Hamerman Program Authorized to Offer Degree: Molecular and Cellular Biology i ii ©Copyright 2015 Mesfin Mulugeta Gewe iii University of Washington Abstract Spectrum of Somatic Hypermutations and Implication on Antibody Function: Case of the anti HIV-1 antibody, b12 Mesfin Mulugeta Gewe Chair of the Supervisory Committee: Roland Strong, Full Member Fred Hutchinson Cancer Research Center Sequence diversity, ability to evade immune detection and establishment of human immunodeficiency virus type 1 (HIV-1) latent reservoirs present a formidable challenge to the development of an HIV-1 vaccine. Structure based vaccine design stenciled on infection elicited broadly neutralizing antibodies (bNAbs) is a promising approach, in some measure to circumvent existing challenges. Understanding the antibody maturation process and importance of the high frequency mutations observed in anti-HIV-1 broadly neutralizing antibodies are imperative to the success of structure based vaccine immunogen design. Here we report a biochemical and structural characterization for the affinity maturation of infection elicited neutralizing antibodies IgG1 b12 (b12). We investigated the importance of affinity maturation and mutations accumulated therein in overall antibody function and their potential implications to vaccine development. Using a panel of point iv reversions, we examined relevance of individual amino acid mutations acquired during the affinity maturation process to deduce the role of somatic hypermutation in antibody function.
  • Affinity Maturation of a T-Cell Receptor-Like Antibody Specific for A

    Affinity Maturation of a T-Cell Receptor-Like Antibody Specific for A

    International Journal of Molecular Sciences Article Affinity Maturation of a T-Cell Receptor-Like Antibody Specific for a Cytomegalovirus pp65-Derived Peptide Presented by HLA-A*02:01 Se-Young Lee 1,†, Deok-Han Ko 1,†, Min-Jeong Son 1, Jeong-Ah Kim 1, Keunok Jung 2 and Yong-Sung Kim 1,2,* 1 Department of Molecular Science and Technology, Ajou University, Suwon 16499, Korea; [email protected] (S.-Y.L.); [email protected] (D.-H.K.); [email protected] (M.-J.S.); [email protected] (J.-A.K.) 2 Department of Allergy and Clinical Immunology, Ajou University School of Medicine, Suwon 16499, Korea; [email protected] * Correspondence: [email protected]; Tel.: +82-31-219-2662; Fax: +82-31-219-1610 † These authors have contributed equally to this work. Abstract: Human cytomegalovirus (CMV) infection is widespread among adults (60–90%) and is usually undetected in healthy individuals without symptoms but can cause severe diseases in im- munocompromised hosts. T-cell receptor (TCR)-like antibodies (Abs), which recognize complex antigens (peptide–MHC complex, pMHC) composed of MHC molecules with embedded short pep- tides derived from intracellular proteins, including pathogenic viral proteins, can serve as diagnostic and/or therapeutic agents. In this study, we aimed to engineer a TCR-like Ab specific for pMHC comprising a CMV pp65 protein-derived peptide (495NLVPMVATV503; hereafter, CMVpp65 ) 495-503 in complex with MHC-I molecule human leukocyte antigen (HLA)-A*02:01 (CMVpp65495-503/HLA- A*02:01) to increase affinity by sequential mutagenesis of complementarity-determining regions Citation: Lee, S.-Y.; Ko, D.-H.; Son, M.-J.; Kim, J.-A.; Jung, K.; Kim, Y.-S.
  • What Are the Primary Limitations in B-Cell Affinity Maturation, and How Much Affinity Maturation Can We Drive with Vaccination?: a Role for Antibody Feedback

    What Are the Primary Limitations in B-Cell Affinity Maturation, and How Much Affinity Maturation Can We Drive with Vaccination?: a Role for Antibody Feedback

    Downloaded from http://cshperspectives.cshlp.org/ on September 28, 2021 - Published by Cold Spring Harbor Laboratory Press What Are the Primary Limitations in B-Cell Affinity Maturation, and How Much Affinity Maturation Can We Drive with Vaccination? A Role for Antibody Feedback Kai-Michael Toellner,1 Daniel M.-Y. Sze,2 and Yang Zhang1 1Institute of Immunology and Immunotherapy, University of Birmingham, Birmingham B15 2TT, United Kingdom 2School of Health and Biomedical Sciences, RMIT University, Bundoora 3083, Australia Correspondence: [email protected] We discuss the impact of antibody feedback on affinity maturation of B cells. Competition from epitope-specific antibodies produced earlier during the immune response leads to immune complex formation, which is essential for transport and deposition of antigen onto follicular dendritic cells (FDCs). It also reduces the concentration of free epitopes into the mM to nM range, which is essential for B-cell receptors (BCRs) to sense affinity-dependent changes in binding capacity. Antibody feedback may also induce epitope spreading, leading to a broader selection of epitopes recognized by newly emerging B-cell clones. This may be exploitable, providing ways to manipulate epitope usage induced by vaccination. GREAT DEBATES What are the most interesting topics likely to come up over dinner or drinks with your colleagues? Or, more importantly, what are the topics that don’t come up because they are a little too controversial? In Immune Memory and Vaccines: Great Debates, Editors Rafi Ahmed and Shane Crotty have put together a collection of articles on such ques- tions, written by thought leaders in these fields, with the freedom to talk about the issues as they see fit.
  • Vaccine Immunology Claire-Anne Siegrist

    Vaccine Immunology Claire-Anne Siegrist

    2 Vaccine Immunology Claire-Anne Siegrist To generate vaccine-mediated protection is a complex chal- non–antigen-specifc responses possibly leading to allergy, lenge. Currently available vaccines have largely been devel- autoimmunity, or even premature death—are being raised. oped empirically, with little or no understanding of how they Certain “off-targets effects” of vaccines have also been recog- activate the immune system. Their early protective effcacy is nized and call for studies to quantify their impact and identify primarily conferred by the induction of antigen-specifc anti- the mechanisms at play. The objective of this chapter is to bodies (Box 2.1). However, there is more to antibody- extract from the complex and rapidly evolving feld of immu- mediated protection than the peak of vaccine-induced nology the main concepts that are useful to better address antibody titers. The quality of such antibodies (e.g., their these important questions. avidity, specifcity, or neutralizing capacity) has been identi- fed as a determining factor in effcacy. Long-term protection HOW DO VACCINES MEDIATE PROTECTION? requires the persistence of vaccine antibodies above protective thresholds and/or the maintenance of immune memory cells Vaccines protect by inducing effector mechanisms (cells or capable of rapid and effective reactivation with subsequent molecules) capable of rapidly controlling replicating patho- microbial exposure. The determinants of immune memory gens or inactivating their toxic components. Vaccine-induced induction, as well as the relative contribution of persisting immune effectors (Table 2.1) are essentially antibodies— antibodies and of immune memory to protection against spe- produced by B lymphocytes—capable of binding specifcally cifc diseases, are essential parameters of long-term vaccine to a toxin or a pathogen.2 Other potential effectors are cyto- effcacy.
  • B-Cell Development, Activation, and Differentiation

    B-Cell Development, Activation, and Differentiation

    B-Cell Development, Activation, and Differentiation Sarah Holstein, MD, PhD Nov 13, 2014 Lymphoid tissues • Primary – Bone marrow – Thymus • Secondary – Lymph nodes – Spleen – Tonsils – Lymphoid tissue within GI and respiratory tracts Overview of B cell development • B cells are generated in the bone marrow • Takes 1-2 weeks to develop from hematopoietic stem cells to mature B cells • Sequence of expression of cell surface receptor and adhesion molecules which allows for differentiation of B cells, proliferation at various stages, and movement within the bone marrow microenvironment • Immature B cell leaves the bone marrow and undergoes further differentiation • Immune system must create a repertoire of receptors capable of recognizing a large array of antigens while at the same time eliminating self-reactive B cells Overview of B cell development • Early B cell development constitutes the steps that lead to B cell commitment and expression of surface immunoglobulin, production of mature B cells • Mature B cells leave the bone marrow and migrate to secondary lymphoid tissues • B cells then interact with exogenous antigen and/or T helper cells = antigen- dependent phase Overview of B cells Hematopoiesis • Hematopoietic stem cells (HSCs) source of all blood cells • Blood-forming cells first found in the yolk sac (primarily primitive rbc production) • HSCs arise in distal aorta ~3-4 weeks • HSCs migrate to the liver (primary site of hematopoiesis after 6 wks gestation) • Bone marrow hematopoiesis starts ~5 months of gestation Role of bone
  • B Cell Responses Against Influenza Viruses

    B Cell Responses Against Influenza Viruses

    viruses Review B Cell Responses against Influenza Viruses: Short-Lived Humoral Immunity against a Life-Long Threat Jenna J. Guthmiller 1,* , Henry A. Utset 1 and Patrick C. Wilson 1,2 1 Section of Rheumatology, Department of Medicine, University of Chicago, Chicago, IL 60637, USA; [email protected] (H.A.U.); [email protected] (P.C.W.) 2 Committee on Immunology, University of Chicago, Chicago, IL 60637, USA * Correspondence: [email protected] Abstract: Antibodies are critical for providing protection against influenza virus infections. However, protective humoral immunity against influenza viruses is limited by the antigenic drift and shift of the major surface glycoproteins, hemagglutinin and neuraminidase. Importantly, people are exposed to influenza viruses throughout their life and tend to reuse memory B cells from prior exposure to generate antibodies against new variants. Despite this, people tend to recall memory B cells against constantly evolving variable epitopes or non-protective antigens, as opposed to recalling them against broadly neutralizing epitopes of hemagglutinin. In this review, we discuss the factors that impact the generation and recall of memory B cells against distinct viral antigens, as well as the immunological limitations preventing broadly neutralizing antibody responses. Lastly, we discuss how next-generation vaccine platforms can potentially overcome these obstacles to generate robust and long-lived protection against influenza A viruses. Keywords: influenza viruses; humoral immunity; broadly neutralizing antibodies; imprinting; Citation: Guthmiller, J.J.; Utset, H.A.; hemagglutinin; germinal center; plasma cells Wilson, P.C. B Cell Responses against Influenza Viruses: Short-Lived Humoral Immunity against a Life-Long Threat. Viruses 2021, 13, 1.
  • The Regulation of Peptide Mimotope/Epitope Recognition By

    The Regulation of Peptide Mimotope/Epitope Recognition By

    The Regulation of Peptide Mimotope/Epitope Recognition by Monoclonal Antibodies by Richard Gary Smith B.Sc. (Hons) Thesis submitted to the University of Nottingham for the degree of Doctor of Philosophy, March 2002. TABLE OF CONTENTS Abstract………………………………………………………………...……….…….8 Acknowledgements…………………………………………………………………...9 Glossary of terms……………………………………………………………………10 Chapter 1 Antibody Purification…………………………………………………..11 1.1 Introduction ......................................................................................................11 1.1.1 Antibodies ................................................................................................11 1.1.2 Monoclonal and engineered Antibodies...................................................12 1.2 Examples of a therapeutic and a commercially applied monoclonal antibody17 1.2.1 C595 monoclonal antibody (NCRC48)...................................................17 1.2.2 mAb 4155.................................................................................................18 1.3 Approaches to antibody purification................................................................20 1.3.1 Column chromatography..........................................................................20 1.3.2 Fluidized bed and expanded bed adsorption ............................................20 1.3.3 High performance Tangential Flow Filtration (HPTFF)..........................21 1.3.4 Magnetic beads.........................................................................................21 1.4 Physical
  • Generation of Memory B Cells Inside And

    Generation of Memory B Cells Inside And

    1258 Toshitada Takemori et al. DOI: 10.1002/eji.201343716 Eur. J. Immunol. 2014. 44: 1258–1264 Mini-Review Generation of memory B cells inside and outside germinal centers Toshitada Takemori1, Tomohiro Kaji2, Yoshimasa Takahashi3, Michiko Shimoda4 and Klaus Rajewsky5 1 Drug Discovery Antibody Platform Unit, RIKEN Center for Integrative Medical Sciences (IMS), Yokohama, Japan 2 Laboratory for Immunological Memory, RIKEN Research Center for Allergy and Immunology (RCAI), Yokohama, Japan 3 Department of Immunology, National Institute of Infectious Diseases, Tokyo, Japan 4 Cancer Immunology, Inflammation and Tolerance Program, Georgia Regents University Cancer Center, Augusta, GA, USA 5 Immune Regulation and Cancer, Max-Delbruck-Center¨ for Molecular Medicine, Berlin, Germany Germinal centers (GCs) are generally considered to be the sole site of memory B-cell generation. However, recent studies demonstrate that memory B cells can also develop in response to a T-cell dependent (TD) antigen before the onset, and independently of, the GC reaction. These two classes of memory cells persist equally over long periods of time and attain functional maturation through distinct but related transcriptional programs. Although the development of both memory B-cell types requires classical T-cell help, the generation of GC-dependent memory B cells requires TFH-cell help, while the generation of GC-independent memory cells does not. These findings led to the conclusion that B-cell memory is generated along two fundamentally distinct cellular differentiation pathways. In this review, we focus on the GC-independent pathway of memory B-cell development, and discuss how the unique features of memory B cells are maintained in the GC-independent pathway.
  • γδ T Cells Control Humoral Immune Response by Inducing T Follicular

    γδ T Cells Control Humoral Immune Response by Inducing T Follicular

    ARTICLE DOI: 10.1038/s41467-018-05487-9 OPEN γδ T cells control humoral immune response by inducing T follicular helper cell differentiation Rafael M. Rezende1, Amanda J. Lanser1, Stephen Rubino1, Chantal Kuhn1, Nathaniel Skillin1, Thais G. Moreira1, Shirong Liu1, Galina Gabriely1, Bruna A. David2, Gustavo B. Menezes2 & Howard L. Weiner1 γδ T cells have many known functions, including the regulation of antibody responses. However, how γδ T cells control humoral immunity remains elusive. Here we show that 1234567890():,; complete Freund’s adjuvant (CFA), but not alum, immunization induces a subpopulation of CXCR5-expressing γδ T cells in the draining lymph nodes. TCRγδ+CXCR5+ cells present antigens to, and induce CXCR5 on, CD4 T cells by releasing Wnt ligands to initiate the T follicular helper (Tfh) cell program. Accordingly, TCRδ−/− mice have impaired germinal center formation, inefficient Tfh cell differentiation, and reduced serum levels of chicken ovalbumin (OVA)-specific antibodies after CFA/OVA immunization. In a mouse model of lupus, TCRδ−/− mice develop milder glomerulonephritis, consistent with decreased serum levels of lupus-related autoantibodies, when compared with wild type mice. Thus, modulation of the γδ T cell-dependent humoral immune response may provide a novel therapy approach for the treatment of antibody-mediated autoimmunity. 1 Ann Romney Center for Neurologic Diseases, Brigham and Women’s Hospital, Harvard Medical School, Boston, MA 02115, USA. 2 Center for Gastrointestinal Biology, Federal University of Minas Gerais,
  • Somatic Hypermutation and Affinity Maturation Analysis Using the 4-Hydroxy-3-Nitrophenyl-Acetyl (NP) System

    Somatic Hypermutation and Affinity Maturation Analysis Using the 4-Hydroxy-3-Nitrophenyl-Acetyl (NP) System

    This is a repository copy of Somatic hypermutation and affinity maturation analysis using the 4-hydroxy-3-nitrophenyl-acetyl (NP) system. White Rose Research Online URL for this paper: http://eprints.whiterose.ac.uk/138157/ Version: Accepted Version Book Section: Heise, N and Klein, U orcid.org/0000-0002-4789-967X (2017) Somatic hypermutation and affinity maturation analysis using the 4-hydroxy-3-nitrophenyl-acetyl (NP) system. In: Calado, DP, (ed.) Germinal Centers. Methods in Molecular Biology, 1623 . Springer (Humana) , pp. 191-208. ISBN 978-1-4939-7094-0 https://doi.org/10.1007/978-1-4939-7095-7_16 (c) 2017, Springer Science+Business Media LLC. This is an author produced version of a chapter published in Methods in Molecular Biology volume 1623. Uploaded in accordance with the publisher's self-archiving policy. Reuse Items deposited in White Rose Research Online are protected by copyright, with all rights reserved unless indicated otherwise. They may be downloaded and/or printed for private study, or other acts as permitted by national copyright laws. The publisher or other rights holders may allow further reproduction and re-use of the full text version. This is indicated by the licence information on the White Rose Research Online record for the item. Takedown If you consider content in White Rose Research Online to be in breach of UK law, please notify us by emailing [email protected] including the URL of the record and the reason for the withdrawal request. [email protected] https://eprints.whiterose.ac.uk/ Somatic hypermutation and affinity maturation analysis using the 4-hydroxy- 3-nitrophenyl-acetyl (NP) system Nicole Heise and Ulf Klein Herbert Irving Comprehensive Cancer Center and Departments of Pathology & Cell Biology and Microbiology & Immunology, Columbia University, 1130 St.
  • Self-Antigen Driven Affinity Maturation Is Required for Pathogenic

    Self-Antigen Driven Affinity Maturation Is Required for Pathogenic

    bioRxiv preprint doi: https://doi.org/10.1101/2020.03.14.988758; this version posted March 15, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Self-antigen driven affinity maturation is required for pathogenic monovalent IgG4 autoantibody development Miriam L. Fichtner1,2,*, Casey Vieni3,4,*, Rachel L. Redler3, Ljuvica Kolich3, Ruoyi Jiang2, Kazushiro Takata1,2, Panos Stathopoulos1,2, Pablo Suarez1,2, Richard J. Nowak1, Steven J. Burden3, Damian C. Ekiert3,§ and Kevin C. O’Connor1,2,§. 1. Department of Neurology, Yale University School of Medicine, New Haven, CT 06511, USA 2. Department of Immunobiology, Yale University School of Medicine, New Haven, CT 06511, USA 3. Departments of Cell Biology and Microbiology, New York University School of Medicine, New York, NY 10016, USA 4. Medical Scientist Training Program, New York University School of Medicine, New York, NY, USA *, § Authorship note: First authors MLF and CV, and senior authors DCE and KCO contributed equally to this work. Corresponding author and contact information: Kevin C. O’Connor, PhD Yale School of Medicine Departments of Neurology and Immunobiology 300 George Street - Room 353J New Haven, CT 06511 Phone: (203)-737-3321 Fax: (203)-737-7903 [email protected] bioRxiv preprint doi: https://doi.org/10.1101/2020.03.14.988758; this version posted March 15, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Summary IgG4 autoantibodies in autoimmune myasthenia gravis are functionally monovalent, requiring a high affinity threshold featuring fast on/slow off rates, to reach pathogenic capacity.