In Vitro Selection and Affinity Maturation of Antibodies from A

Proc. Natd. Acad. Sci. USA Vol. 89, pp. 3576-3580, April 1992 Biochemistry In vitro selection and affinity maturation of antibodies from a naive combinatorial immunoglobulin library (naive immunoglobulin repertoire/fflamentous phage/random mutagenesis) HERMANN GRAM*, LORI-ANNE MARCONI, CARLOS F. BARBAS III, THOMAS A. COLLET, RICHARD A. LERNER, AND ANGRAY S. KANG The Scripps Research Institute, Departments of Molecular Biology and Chemistry, 10666 North Torrey Pines Road, La Jolla, CA 92037 Contributed by Richard A. Lerner, January 7, 1992 ABSTRACT We have used a combinatorial immunoglob- H-chain IgG isotype for molecular cloning, and/or the high ulin library approach to obtain monoclonal antibodies from abundance of specific mRNA in the starting material (12) nonimmune adult mice, thereby establishing the principles of most likely biased the combinatorial libraries toward affinity- (i) accessing naive combinatorial antibody libraries for prede- matured antibodies. Recently, Marks et al. (19) demonstrated termined specificities and (ii) increasing the affinity of the that active single-chain (Sc) antibodies with affinity constants selected antibody binding sites by random mutagenesis. A between 106 and 107 M-1 against a hapten or a small number combinatorial Fab library expressing immunoglobulin Ip and it of epitopes on a protein can be obtained directly from light-chain fragments on the surface of filamentous phage was nonimmune combinatorial immunoglobulin libraries. prepared from bone marrow ofnonimmunized, adult BALB/c In its simplest form, the initial stage of the immune mice with the multivalent display vector pComb8. Phage response can be re-created in vitro by generating a combi- displaying low affinity Fabs (binding constants, 104-1O M-') natorial library of PCR-amplified immunoglobulin At and L binding to a progesterone-bovine serum albumin conjugate chains from the bone marrow of adult mice. This is a close were isolated from the library. Random mutagenesis of the approximation to the naive, unselected repertoire, since the heavy- and light-chain variable regions expressed in the mono- majority of B cells in bone marrow expressing immunoglob- valent phage display vector pComb3 was performed by error- ulin ,u chains have not been subjected to tolerance and prone PCR, and subsequently clones with improved affinity for antigen selection and should therefore represent all the the hapten conjugate were selected. We demonstrate that combinatorial junctional diversity of immunoglobulin V re- antibodies with desirable characteristics from a nonimmune gions (20). The phagemid pComb8 facilitates the display of source may be selected and affinity maturation may be achieved multiple copies ofthe Fab fragments along the phage surface by using the twin vectors pComb8 and pComb3, thus opening permitting access to low-affinity antibodies (15, 16). Hence, the route to obtaining specific antibodies from a generic library specific VH and VL pairs could possibly be enriched from a and bypassing immunization. diverse naive repertoire. The second stage of the immune response in vivo involves The B-cell immune response to an antigen can be viewed to affinity maturation of the selected specificities by mutation occur in two stages. The initial stage generates low-affinity and selection. An efficient way to generate random mutations antibodies mostly of the IgM isotype from an existing pool of in the laboratory is by an error-prone replication mechanism, the B-cell repertoire available at the time of immunization. either by targeting the mutations to the antibody binding sites The second stage, which is driven by antigen stimulation, by error-prone PCR (21), or by passaging the phagemid produces high-affinity antibodies predominantly of the IgG Fab isotype, starting with the light-chain and heavy-chain vari- carrying the genetic information for the fragment through able region (VL and VH) genes selected in the primary an Escherichia coli mutD strain, in which the spontaneous response. The predominant mechanism for affinity matura- mutation frequency is 103-105 times higher than in a wild-type tion is hypermutation ofV region genes followed by selection strain (22). Here we describe our results using error-prone of those cells that produce antibodies of the highest affinity PCR. In subsequent communications, we will describe a (reviewed in refs. 1 and 2). Both stages in the immune complementary method using randomized complementarity- response have been accessed and extensively studied by determining region (CDR) 3 sequences of a VH region to hybridoma technology (3). generate mutants (C.F.B., unpublished data). In the present Recently, there has been much interest in using gene study, we chose progesterone as a hapten since it elicits a cloning approaches to generate and express antibodies by restricted immune response in mice (23, 24). The method combinatorial library techniques to bypass hybridoma tech- described here has three essential features: (i) the ability to nology (4-19). The main driving force for this approach is to initially access low-affinity Fabs from a naive library by the more efficiently harness the vast antibody repertoire. We and use of multivalent phage expression systems, (ii) subsequent others have successfully generated diverse high-affinity an- affinity maturation by error-prone PCR, and (iii) use of a Sc tibodies to haptens, virus particles, and protein antigens, construct during the maturation process to avoid a high thereby recapitulating functional molecules appearing during background of artifactual binding due to loss of the L chain. the natural immune response in animals and humans. Most of When used in concert, these methods allow selection and the molecular genetic approaches for obtaining active anti- affinity maturation of antibodies from a naive library. bodies by screening combinatorial immunoglobulin libraries were directed toward the second stage of the antibody response, since the immunization protocol, the choice of the Abbreviations: BSA, bovine serum albumin; CDR, complementarity-determining region; gVIII and gIII, M13 gene VIII and gene III, respectively; Sc, single chain; VL, light-chain variable region; VH, The publication costs of this article were defrayed in part by page charge heavy-chain variable region. payment. This article must therefore be hereby marked "advertisement" *Present address: Sandoz Pharma, Preclinical Research, CH-4002 in accordance with 18 U.S.C. §1734 solely to indicate this fact. Basel, Switzerland. 3576 Downloaded by guest on September 25, 2021 Biochemistry: Gram et al. Proc. Natl. Acad. Sci. USA 89 (1992) 3577 METHODS TTAGATCGGAACCAGAACCAGAAGA TTT ACC TCTAGAGACTTTC-3'), was inserted into the Xho I/Spe I RNA Isolation and cDNA Synthesis. Three nonimmunized digested truncated pComb3 vector forming the phagemid adult male (6 months old) BALB/cByJ mice (Scripps breed- ScpComb3. The internal recognition sequences for restric- ing colony) were used to prepare 5 x 107 bone marrow cells tion endonucleases Xba I (TCTAGA) and Sac I (GAGCTC) in 4% fetal calf serum in phosphate-buffered saline (PBS). To are underlined. The VH and VL segments ofthe progesterone deplete for surface IgG-positive cells, the preparation was binders were amplified by PCR using the upstream primer incubated with rat anti-mouse IgG2b (0.1 ml), goat anti- described above and the oligonucleotides 5'-ATTTGG- mouse IgG (0.1 ml), and rabbit anti-mouse IgG2b (0.1 ml) for GAAGGACTGTCTAGATGMRGAGAC-3' (M is A or C and 30 min at ambient temperature. The cells were pelleted, R is A or G) and 5'-GAGGACTAGTTACAGTTGGTGCAG- washed with PBS, and resuspended in PBS (9 ml). Rabbit CATCAG-3', respectively. The internal recognition se- complement was added (1 ml) and incubated at 370C for 30 quences for Xba I (TCTAGA) and Spe I (ACTAGT) are min. The cells were pelleted and total RNA was isolated as underlined. The VH and VL Fv PCR fragments were digested described by Kang et al. (25). Total RNA was used as a with Xho I/Xba I and Sac I/Spe I, respectively, and subse- template for cDNA synthesis for p and K chains with the quently inserted into ScpComb3. following primers: A chain, 5'-ATTGGGACT AGI TTCTGC Expression and Detection of Soluble Fabs and Sc Fv Anti- GAC AGC TGG ATT-3'; K chain, 5'-GCG CCG IC[ AiA bodies. For Fab production, the gVIII moiety in the phage- ATT AAC ACT CAT TCC TGT TGAA-3', respectively, mids encoding the progesterone binders PgA11, PgB6, and using a SuperScript kit (BRL). Briefly, 7 Ag oftotal RNA was PgF1 was excised with restriction endonucleases Spe I and mixed with 60 pmol of primer, heated to 70'C for 10 min, and EcoRI and was subsequently replaced by a synthetic linker immediately cooled on ice. Two microliters of RNase inhib- encoding a TAA stop codon (underlined). The linker was itor, 10 pl of 5 x synthesis buffer, 8 A.l of dNTP mixture (to formed by the oligonucleotides 5'-CTAGTTAACTGAG- give a final concentration of 200 AM each NTP), 5 jul of 0.1 TAAG-3' and 5'-AATTCTTACTCAGHIAA-3'. The produc- M dithiothreitol, and 1 Al of BRL SuperScript reverse tion and detection of antibody Fab fragment was performed transcriptase (200 units/,l) were added, and the reaction essentially as described (18, 26) except that the E. coli cells mixture was made up to 50 pl with diethylpyrocarbonate- were disrupted by three freeze-thaw cycles. For producing treated water. The reaction was allowed to proceed at room soluble ScFv antibody fragments, the VH-linker-VL fusions temperature for 10 min and then

Load more