Hip2 Interacts with Cyclin B1 and Promotes Its Degradation Through

FEBS Letters 584 (2010) 4505–4510

journal homepage: www.FEBSLetters.org

Hip2 interacts with cyclin B1 and promotes its degradation through the ubiquitin proteasome pathway ⇑ Yoonhee Bae a, Dongwon Choi a, Hyangshuk Rhim b, Seongman Kang a, a Graduate School of Life Sciences and Biotechnology, Korea University, Seoul 136-701, Republic of Korea b Research Institute of Molecular Genetics, College of Medicine, Catholic University of Korea, Seoul 137-701, Republic of Korea article info abstract

Article history: Hip2, a ubiquitin conjugating enzyme, is involved in the suppression of cell death. The present study Received 16 July 2010 revealed that Hip2 regulates the stability of the apoptotic and cell cycle regulator cyclin B1. Hip2 was Revised 4 October 2010 found to interact with cyclin B1 to promote its degradation through the ubiquitin proteasome path- Accepted 8 October 2010 way. As a result, Hip2 signiﬁcantly blocked cell death induced by the cyclin B1 protein, suggesting Available online 19 October 2010 that Hip2 is involved in the regulation of cyclin B1-mediated cell death. Edited by Angel Nebrada Structured summary: MINT-8045218, MINT-8045231: Hip2 (uniprotkb:P61086) physically interacts (MI:0915) with cyclin-B1 Keywords: Hip2 (uniprotkb:P14635) by pull down (MI:0096) Cyclin B1 Ó 2010 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved. Ubiquitination Apoptosis

1. Introduction speciﬁc protein substrates. The polyubiquitylated proteins are rap- idly degraded by 26S proteasome-mediated pathways [8,9]. E2-25 K/Hip2 is a ubiquitin conjugating enzyme (E2) that inter- Cyclin B1 regulates the entry into mitosis in vertebrates [10]. acts with huntingtin, a protein linked to Huntington’s disease [1], The concentration of cyclin B1 rises in the S phase and peaks dur- and is highly expressed in the frontal cortex and striatum. The ing late G2-M phase [11]. Cyclin B1 is degraded at the metaphase- Hip2 protein also mediates amyloid-b peptide (Ab) neurotoxicity, anaphase transition by a multisubunit complex called APC/C which is associated with the neurodegeneration of Alzheimer’s dis- [12,13]. Cyclin B1 is also a key regulator of apoptosis in various cell ease (AD) [2]. The Hip2 gene has a high similarity to the UBC-1, -4, types [14,15]. and -5 genes of Saccharomyces cerevisiae [3]. The Hip2 protein is The present study shows the interaction between Hip2 and cy- also related to the APC/C (anaphase-promoting complex/cyclo- clin B1 and the regulation of cyclin B1 stability by the ubiquitin some)-dependent assembly of K-48 linked polyubiquitin chains proteasome pathway. Furthermore, the present results show that in mammalian cells [4]. Interestingly, Hip2 is thought to play an Hip2 inhibits cell death induced by cyclin B1, suggesting that important role in the synthesis of K-48 linked multi-ubiquitin Hip2 might be involved in the regulation of cyclin B1-induced chains in the absence of E3 ligases [5]. apoptosis. The ubiquitin proteasome system is involved in regulation of several cellular processes in eukaryotic cells and its function is 2. Materials and methods mediated by the activity of three enzymes, a ubiquitin-activating enzyme (E1), a ubiquitin-conjugating enzyme (E2), and a ubiquitin 2.1. Plasmids, transfections and cell culture ligase (E3) [6,7]. The attachment of ubiquitin molecules to a target protein proceeds through an initial step that involves the forma- Full length cDNAs encoding Hip2 were ampliﬁed through the tion of a thiol ester bond between the C-terminal glycine of polymerase chain reaction (PCR) and cloned into the pCMV-HA ubiquitin and a cysteine residue of E1. In the second step, the vector digested with HindIII and EcoRI. pCMV-Flag-5bHip2 activated ubiquitin is delivered to a conserved cysteine residue of (S86Y), containing a core domain mutation (S86Y) that selectively the ubiquitin-conjugating enzyme E2. In the last step, the ubiquitin inactivates polyubiquitin chain synthesis catalyzed by Hip2, was ligase E3 binds to the ubiquitin-conjugating enzyme and targets kindly provided by Y.K. Jung (University of Seoul, Seoul) [2,5]. Hip2 (S86Y) was subcloned into the pCMV-HA vector digested with ⇑ Corresponding author. Fax: +82 2 927 9028. HindIII and EcoRI. The pBluescriptII Hip2 construct was subcloned E-mail address: [email protected] (S. Kang). into pcDNA-GST digested with BamH1 and EcoRI. Full length

0014-5793/$36.00 Ó 2010 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved. doi:10.1016/j.febslet.2010.10.016 4506 Y. Bae et al. / FEBS Letters 584 (2010) 4505–4510 cDNAs encoding cyclin B1 were generated by PCR and subse- G-sepharose (GE Healthcare) for 1 h at 4 °C. Immunoprecipitation quently cloned into pCMV-His C digested with XbaI and ApaI. was carried out overnight at 4 °C with anti-cyclin B1 antibodies. HEK293 and HEK293T cells were maintained in DMEM medium After washing four times with NETN buffer, the precipitated pro- supplemented with 8% fetal bovine serum (FBS), streptomycin teins were analyzed by immunoblotting against anti-ubiquitin (100 lg/ml), and penicillin (100 U/ml) (Gibco-BRL). HCT116 cells antibodies. were maintained in McCoy’s 5A medium supplemented with 10% fetal bovine serum (FBS), streptomycin (100 lg/ml), and penicillin 2.5. Degradation assay (100 U/ml) (Welgene). The PEI method was used according to the manufacturer’s instructions (Sigma) to transfect various plasmids To measure the stability of the cyclin B1 proteins in HEK293 into HEK293 or HEK293T cells. HCT116 cells were transfected with cells, these cells were transiently transfected with pcDNA/HA- various plasmids by using the TurboFect method (Fermentas). Hip2 or control vector. After a 24 h transfection, the cells were treated with 100 lg/ml of cycloheximide (CHX) for various time 2.2. Co-immunoprecipitation and immunoblot experiments periods. The cell lysates were subjected to SDS–PAGE, transferred to a membrane, and then probed with anti-cyclin B1 and anti-b-ac- HEK293T cells were co-transfected with GST-tagged Hip2 and tin antibodies. His-tagged cyclin B1 constructs. Co-immunoprecipitation experiments and immunoblot analysis were performed as described pre- 2.6. Flow cytometry analysis viously [16]. To measure apoptosis using the annexin V-FITC apoptosis kit 2.3. RNAi (BD Biosciences). HCT116 cells were co-transfected with HA- tagged Hip2 and His-tagged cyclin B1 constructs. After 48 h, the The following sequences were cloned in this study: shHip2, 50- cells were harvested and washed with PBS. FITC-conjugated annex- TGGAATCAGACTGAATTAATTCAAGAGATTAATTCAGTCTGATTCCATT in V (1 lg/ml) and propidium iodide (50 lg/ml) were added to the TTTT-30; and shGFP, 50-GCT GAC CCT GAA GTT CAT CTT CAA GAG cells and incubated for 30 min at room temperature. Analyses were AGA TGA ACT TCA GGG TCA GCT TTT TT-30. The pSilencer 1.0-U6 done using a FACScan ﬂow cytometer (BD Biosciences). vector (Ambion) encoding the hairpin RNAs was transfected into HEK293 cells or HCT116 cells using the PEI method (Sigma). 3. Results and discussion

2.4. Polyubiquitination assay 3.1. Hip2 regulates the stability of the cyclin B1 protein

HCT116 cells were transiently transfected with pcDNA/HA-Hip2 The results of the present study unexpectedly showed that the or pcDNA/HA-Hip2 (S86Y) and pcDNA/Xpress-Ub. After 36 h, the stability of cyclin B1 was affected by the presence of Hip2. To con- transfected cells were treated with or without the proteasome ﬁrm this ﬁnding, human embryonic kidney (HEK) 293 cells were inhibitor MG-132 (10 lM) for an additional 5 h. The cells were transiently transfected with plasmid constructs containing lysed and the lysate supernatants were pre-cleared with protein pcDNA/HA-Hip2 or a negative control vector. The transfected cells

Fig. 1. Hip2 regulates the stability of the cyclin B1 protein. (A) HEK293 cells were transiently transfected with control vector or pcDNA/HA-Hip2. After 24 h, the cells were harvested, and equal amounts of protein (20 lg) were separated by SDS–PAGE and transferred to nitrocellulose membranes. Cyclin B1 was detected using polyclonal anti- cyclin B1 antibodies. HA and actin were used as loading controls. (B) HEK293 cells were transfected with control shRNA or Hip2 shRNA. After 36 h, the cells were harvested under the same conditions as in (A) and lysates were subjected to immunoblot analysis. (C) HEK293 cells were transiently transfected with pcDNA/HA-Hip2 or a negative control vector. The cells were treated with 100 lg/ml cycloheximide (CHX) and incubated for the indicated times. The cell lysates were subjected to SDS–PAGE, transferred to a membrane, and then probed with anti-cyclin B1 antibodies. The membrane was subsequently probed with anti-HA and anti-actin antibodies. (D) Quantification of the band intensities of immunoblot results shown in the panel C was measured using Multi Gauge image analysis software. Since the amount of time 0 h cyclin B1 in the presence of Hip2 was already reduced, it was normalized with that of time 0 h cyclin B1 in the absence of Hip2. Values represent means ± S.D. of three independent experiments. Y. Bae et al. / FEBS Letters 584 (2010) 4505–4510 4507 were grown for 24 h, harvested, and lysed for immunoblot analysis. In the presence of Hip2, the expression level of the cyclin B1 protein was significantly decreased, as shown in Fig. 1A. To further confirm the effect of Hip2 on decreasing the stability of cyclin B1, shRNA experiments were performed to knock down Hip2. HEK293 cells were transiently transfected with Hip2 shRNA or control shRNA, and the expression level of cyclin B1 was determined by immunoblot analysis. As expected, cyclin B1 expression levels were increased in cells depleted of the Hip2 protein (Fig. 1B). The effect of Hip2 on the destabilization of cyclin B1 was also examined in the presence of cycloheximide (CHX) to block de novo protein synthesis in eukaryotic cells. HEK293 cells were transiently transfected with pcDNA/HA-Hip2 or a negative control vector for 24 h, followed by treatment with CHX. The cells were harvested at the times indicated in Fig. 1C, and immunoblot analysis was per- Fig. 2. Hip2 interacts with the cyclin B1 protein. HEK293T cells were transiently co- formed to determine the levels of the cyclin B1 protein. Band inten- transfected with either pcDNA/GST or pcDNA/GST-Hip2. After 36 h, the cell lysates were precipitated with glutathione sepharose beads for 3 h at 4 °C. The bound sities were measured using Multi Gauge image analysis software proteins were eluted and subjected to immunoblot analysis against polyclonal anti- (Fig. 1D). In the presence of CHX, the degradation of cyclin B1 oc- cyclin B1 antibodies. curred at a faster rate in cells transfected with Hip2 than in cells transfected with negative control vector. The expression level of Hip2 also was quickly reduced in the presence of CHX, indicating analysis with cyclin B1 antibodies. As shown in Fig. 2 endogenous that the turnover rate of Hip2 is fast. Taken together, these results cyclin B1 interacts with the Hip2 protein. demonstrate that Hip2 significantly destabilizes cyclin B1. Next, we further investigated whether the interaction between Next, using nocodazole, we synchronized cells to assess the sta- Hip2 and cyclin B1 is also associated with cdc27, which is a mem- bility of cyclin B1 during the metaphase-anaphase transition in the ber of APC/C (anaphase-promoting complex/cyclosome) composed presence of Hip2. Cells treated with nocodazole cannot form meta- of eight protein subunits. As shown in Supplementary Fig. S4, phase spindles due to deficient polymerization of microtubules. in vivo coimmunoprecipitation experiments revealed that GST- We transiently transfected HEK293 cells with pcDNA/HA-Hip2 or Hip2 does not interact with cdc27 in the presence of endogenous control vector. The cells were harvested at the times indicated in cyclin B1, suggesting that Hip2 is not a subunit of APC/C. Supplementary Fig. S1, and the expression level of cyclin B1 was After confirming the interaction between Hip2 and cyclin B1, determined by immunoblot analysis. Cyclin B1 was more reduced the potential role of Hip2 in the degradation of cyclin B1 through in the presence Hip2 than in the absence of Hip2. However, these the proteasome pathway was examined by performing in vivo results did not provide further information whether Hip2 is in- ubiquitination assays. HCT116 cells were transfected with con- volved in cell cycle progression by regulating cyclin B1 stability. structs containing either pcDNA/HA-Hip2 or pcDNA/HA-Hip2 The cyclin B1-cdc2 kinase complex phosphorylates a variety of (S86Y), and pcDNA/Xpress-Ub. Hip2 (S86Y) is a Hip2 mutant that target substrates, which is required for mitotic entry [17].We lacks ubiquitin-conjugating activity. After 36 h, the cells were trea- investigated whether the destability of cyclin B1 in the presence ted with the proteasome inhibitor MG-132 for an additional 5 h. of Hip2 affects the activity of the cdc2 kinase. HEK293 cells were The cell extracts were immunoprecipitated with anti-cyclin B1 transfected with pcDNA/HA-Hip2 or a negative control vector antibodies and then analyzed by immunoblotting with anti-Ub and cdc2 kinase assays were performed using histone H1 substrate. antibodies. As shown in Fig 3A, ubiquitinated cyclin B1 proteins As shown in Supplementary Fig. S2, the activity of the cdc2 kinase were observed in cells overexpressing Hip2, but their level was sig- was more decreased in cells overexpressing Hip2 than in those nificantly decreased in both control and in the Hip2 (S86Y) mutant. transfected with control vector, suggesting that Hip2 might be in- To investigate the effect of Hip2 depletion on the ubiquitination volved in the G2-M transition by regulating cyclin B1 stability. of cyclin B1, the RNAi technique was used to knock down Hip2 expression. The shRNA Hip2 expression vector and pcDNA/ 3.2. Hip-2 interacts with and ubiquitinates cyclin B1 Xpress-Ub were transiently co-transfected into HCT116 cells and in vivo ubiquitination assays were conducted. The levels of ubiqui- Previous studies indicated that cyclin B1 is degraded through tinated cyclin B1 were dramatically decreased when Hip2 expres- the ubiquitin proteasome pathway [14]. To examine whether the sion was knocked down in the cells (Fig. 3B). We further Hip2-mediated destabilization of cyclin B1 is also associated with investigated whether proteasomal inhibition rescues Hip2-medi- the ubiquitin proteasome pathway, the potential role of the ubiq- ated cyclin B1 destabilization. HEK293 cells were transfected with uitin-conjugating enzyme Hip2 in the degradation of cyclin B1 pcDNA/HA-Hip2 or a negative control vector. The cells were trea- was investigated by first examining whether Hip2 interacts with ted with or without the proteasome inhibitor MG-132. As showed the cyclin B1 protein. HEK293T cells were transiently cotransfected in Supplementary Fig. S5, proteasomal inhibition induced accumu- with plasmid constructs containing either pcDNA/GST or pcDNA/ lation of cyclin B1. Taken together, these results demonstrate that GST-Hip2, and pcDNA/HisC-cyclin B1. The cell extracts were incu- Hip2 interacts with and degrades the cyclin B1 protein through the bated with glutathione sepharose beads for 3 h. The bound pro- ubiquitin proteasome pathway. teins were eluted, subjected to SDS–PAGE, and analyzed by immunoblotting with anti-cyclin B1 antibodies. As shown in Sup- 3.3. Hip2 antagonizes the apoptotic activity of cyclin B1 plementary Fig. S3, the His-tagged cyclin B1 protein interacted with GST-Hip2 in the in vivo coimmunoprecipitation experiment. Based on previous reports showing that the overexpression of The interaction between these two proteins was further cyclin B1 induces apoptosis [18], the effect of Hip2 on the regula- confirmed with endogenous cyclin B1 by transiently transfecting tion of apoptosis by cyclin B1 was investigated. HCT116 cells were HEK293T cells with pcDNA/GST or pcDNA/GST-Hip2. The cell ex- transiently co-transfected with pcDNA/HisC-cyclin B1 and pcDNA/ tracts were incubated with glutathione sepharose beads for 3 h. HA-Hip2 (1:1) as shown in Fig. 4. At 48 h after transfection, the The bound proteins were eluted and subjected to immunoblot cells were lysed and prepared for immunoblot analysis. The levels 4508 Y. Bae et al. / FEBS Letters 584 (2010) 4505–4510

Fig. 3. Hip2 ubiquitinates the cyclin B1 protein. (A) HCT116 cells were transiently co-transfected with pcDNA/HA-Hip2 or pcDNA/HA-Hip2 (S86Y), and pcDNA/Xpress-Ub. After 36 h, the cells were incubated with 10 lM MG-132 for an additional 5 h. The cells lysates were immunoprecipitated with anti-cyclin B1 antibodies and bound proteins were analyzed by immunoblotting against anti-ubiquitin antibodies. (B) HCT116 cells were transfected with either control shRNA or Hip2 shRNA, and pcDNA/Xpress-Ub. After 36 h, the cells were incubated with 10 lM MG-132 for an additional 5 hr, and cell lysates were immunoprecipitated and analyzed as described in (A). (C) The efficiency of Hip2 knock down was analyzed by probing against Hip2 antibodies. of cleaved PARP (poly(ADR-ribose) polymerase) were determined pcDNA/HisC-cyclin B1, and pcDNA/HA-Hip2 (1:1), and 48 h after and, as expected, the overexpression of cyclin B1 increased the transfection, the cells were assessed by trypan blue dye exclusion amount of cleaved PARP. However, the amount of cleaved PARP assays. The overexpression of cyclin B1 dramatically decreased cell was dramatically decreased when cyclin B1 was co-expressed with viability and Hip2 prevented cyclin B1-induced cell death (Fig. 4D). Hip-2. The levels of proapoptotic Bax and anti-apoptotic Bcl-2, Cell death was next analyzed using FACS. HCT116 cells were which regulate apoptosis at the mitochondrial level, were also transiently transfected with pcDNA/HisC-cyclin B1 or pcDNA/ examined and quantitated. Cyclin B1 expression caused an in- HisC-cyclin B1 and pcDNA/HA-Hip2 (1:1). Annexin V staining crease in the levels of Bax, and this effect was reversed by Hip2. was carried out, as plasma membrane phosphatidylserine (PS) is However, Bcl-2 levels were decreased during the expression of cy- translocated from the inner to the outer plasma membrane after clin B1 alone, while Bcl-2 levels were increased when cyclin B1 was the induction of apoptosis [19]. As shown in Fig 4E, overexpression co-expressed with Hip2 (Fig. 4A). of cyclin B1 increased the number of annexin V-stained apoptotic To further confirm the effect of Hip2 on the regulation of apop- cells compared to control and Hip2 co-expressing cells (Fig. 4E). tosis induced by cyclin B1, shRNA experiments were performed to The results of the present study indicate that the ubiquitin-con- knock down Hip2 (Fig. 4B). HCT116 cells were transiently transfec- jugating enzyme Hip2 interacts with cyclin B1 and promotes its ted with pcDNA/HisC-cyclin B1 and either Hip2 shRNA or control proteasomal-mediated degradation. Co-expression of Hip2 and cy- shRNA. The efficiency of Hip2 knock down was confirmed by prob- clin B1 significantly blocks cell death, suggesting that Hip2 could ing with anti-Hip2 antibodies (Fig. 4C). The levels of cleaved PARP be involved in the regulation of cyclin B1-mediated apoptosis. were determined by immunoblot analysis. The amount of cleaved The ubiquitin proteasome system is involved in cellular proteol- PARP was increased in cells depleted of the Hip2 protein (Fig. 4B). ysis in eukaryotic cells and employs a series of three enzymes, E1, To examine the effect of Hip2 on cell viability, HCT116 cells E2, and E3 [8]. E3 ubiquitin ligase couples with E2 to bind and then were transiently transfected with either pcDNA/HisC-cyclin B1 or ubiquitinate substrate proteins, and the ubiquitinated substrates Y. Bae et al. / FEBS Letters 584 (2010) 4505–4510 4509

Fig. 4. Hip2 antagonizes the apoptotic activity of cyclin B1. (A) HCT116 cells were transiently transfected with pcDNA/HA-Hip2, or pcDNA/HA-Hip2 and pcDNA/HisC–cyclin B1. At 48 h after transfection, the cells were harvested, separated by 10% SDS–PAGE, and subjected to immunoblot analysis. PARP cleavage was analyzed by probing against polyclonal anti-PARP antibodies. The membrane was subsequently probed against the following antibodies: Bax, Bcl-2, HA, His and actin as a loading control. The graph of the bottom panel was quantified by the immunoblot results shown in the top panel. *P < 0.05 versus the control (student’s t-test) (B) HCT116 cells were transiently transfected with control shRNA or Hip2 shRNA, and pcDNA/HisC–cyclin B1. After 36 h, the cells were harvested under the same conditions as in (A) and lysates were subjected to immunoblot analysis with polyclonal anti-PARP antibodies. The membrane was subsequently probed with anti-His and anti–actin antibodies. (C) The efficiency of Hip2 knock down was detected by probing with Hip2 antibodies. (D) The viability of HCT116 cells co-transfected with pcDNA/HA-Hip2, or pcDNA/HA-Hip2 and pcDNA/HisC–cyclin B1 (1:1), was analyzed by the trypan blue exclusion method. Experiments were repeated three times. (E) Apoptotic cells were detected by using the annexin V and propidium iodide double staining method. are degraded through the 26S proteasome pathway [7]. In the pres- (A084358). Also, we are thank Ok Jeong Noh and Juno Jang for help- ent study, we have not identified E3s that are cognated with Hip2, ful material and method. a ubiquitin-conjugation enzyme, in the cyclin B1 degradation. It was previously reported that Hip-2 seems to be able to play a role Appendix A. Supplementary data as an E2 ubiquitin-conjugating enzyme in the absence of any E3 ligases [20]. Thus, cyclin B1 also might be degraded by Hip2 in Supplementary data associated with this article can be found, in the absence of E3s. However, further studies are required to deter- the online version, at doi:10.1016/j.febslet.2010.10.016. mine whether Hip2 mediates its effects in an E3-independent man- ner or not. References Very recently, we reported that Hip2 significantly blocked cell death induced by staurosporine and Smac [16]. The present study [1] Kalchman, M.A. et al. (1996) Huntingtin is ubiquitinated and interacts with a also revealed that Hip2 blocked cell death induced by the cyclin B1 specific ubiquitin-conjugating enzyme. J. Biol. Chem. 271, 19385–19394. [2] Song, S. et al. (2003) Essential role of E2–25K/Hip-2 in mediating amyloid-beta protein. Based on these results, we speculate that during the apop- neurotoxicity. Mol. Cell 12, 553–563. totic process of a damaged cell, Hip2 might regulate Smac and cy- [3] Lee, S.J., Choi, J.Y., Sung, Y.M., Park, H., Rhim, H. and Kang, S. (2001) E3 ligase clin B1 as follows. In response to apoptotic stimuli, Smac is activity of RING finger proteins that interact with Hip-2, a human ubiquitin- conjugating enzyme. FEBS Lett. 503, 61–64. released into cytosol and inhibits the binding of IAPs to caspases, [4] Rodrigo-Brenni, M.C. and Morgan, D.O. (2007) Sequential E2s drive enhancing apoptosis. Cyclin B1 accumulates in the cells and the in- polyubiquitin chain assembly on APC targets. Cell 130, 127–139. creased proteins block mitotic exit and promotes apoptosis. When [5] Mastrandrea, L.D., Kasperek, E.M., Niles, E.G. and Pickart, C.M. (1998) Core domain mutation (S86Y) selectively inactivates polyubiquitin chain synthesis apoptotic stimuli are vanished, both Smac and cyclin B1 proteins catalyzed by E2–25K. Biochemistry 37, 9784–9792. are degraded by ubiquitin–proteasome process including Hip2, [6] Knecht, E. et al. (2009) Intracellular protein degradation in mammalian cells: which promotes cell survival. Further studies are required to better recent developments. Cell. Mol. Life Sci. 66, 2427–2443. [7] Li, W., Tu, D.Q., Brunger, A.T. and Ye, Y.H. (2007) A ubiquitin ligase transfers understand the detailed mechanisms of Hip2 function in the regu- preformed polyubiquitin chains from a conjugating enzyme to a substrate. lation of apoptosis. Nature 446, 333–337. [8] Hoeller, D. and Dikic, I. (2009) Targeting the ubiquitin system in cancer therapy. Nature 458, 438–444. [9] Hochstrasser, M. (1996) Protein degradation or regulation: Ub the judge. Cell Acknowledgements 84, 813–815. [10] Cogswell, J.P., Godlevski, M.M., Bonham, M., Bisi, J. and Babiss, L. (1995) This work was supported by the National Research Foundation of Upstream stimulatory factor regulates expression of cell cycle-dependent Korea (NRF) Grant funded by the Korea government (200601742) cyclin B1 gene promoter. Mol. Cell. Biol. 15, 2782–2790. [11] Pines, J. and Hunter, T. (1991) Human cyclin-A and cyclin-B1 are differentially and a Grant from the Korea Healthcare Technology R&D Project, located in the cell and undergo cell cycle-depenent nuclear transport. J. Cell Ministry for Health, Welfare & Family Affairs, the Republic of Korea Biol. 115, 1–17. 4510 Y. Bae et al. / FEBS Letters 584 (2010) 4505–4510

[12] Clute, P. and Pines, J. (1999) Temporal and spatial control of cyclin B1 [17] Bassermann, F., Peschel, C. and Duyster, J. (2005) Mitotic entry-A matter of destruction in metaphase. Nat. Cell Biol. 1, 82–87. oscillating destruction. Cell Cycle 4, 1515–1517. [13] Hershko, A. (1999) Mechanisms and regulation of the degradation of cyclin B. [18] Porter, L.A., Singh, G. and Lee, J.M. (2000) Abundance of cyclin B1 regulates Philos. Trans. R Soc. Lond. B Biol. Sci. 354, 1571–1575. gamma-radiation-induced apoptosis. Blood 95, 2645–2650. [14] Zhang, S.M., Sun, Y., Fan, R., Xu, Q.Z., Liu, X.D., Zhang, X.M., Wang, Y. and Zhou, [19] van Engeland, M., Nieland, L.J.W., Ramaekers, F.C.S., Schutte, B. and P.K. (2010) HIV-1 Tat regulates cyclin B1 by promoting both expression and Reutelingsperger, C.P.M. (1998) Annexin V-afﬁnity assay: a review on an degradation. FASEB J. 24, 495–503. apoptosis detection system based on phosphatidylserine exposure. Cytometry [15] Gomez, L.A., de las Pozas, A., Reiner, T., Burnstein, K. and Perez-Stable, C. 31, 1–9. (2007) Increased expression of cyclin B1 sensitizes prostate cancer cells to [20] Chen, Z.J. and Pickart, C.M. (1990) A 25-kilodaton ubiquitn carrier protein (E2) apoptosis induced by chemotherapy. Mol. Cancer Ther. 6, 1534–1543. catalyzes multiubiqutin chain synthesis via lysine-48 of ubiquitin. J. Biol. [16] Bae, Y., Kho, C.W., Lee, S.Y., Rhim, H. and Kang, S. (2010) Hip2 interacts with Chem. 265, 21835–21842. and destabilizes Smac/DIABLO. Biochem. Biophys. Res. Commun. 397, 718– 723.