US 20140.0663 O7A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2014/0066307 A1 POree et al. (43) Pub. Date: Mar. 6, 2014

(54) USE OF Publication Classification N-(1,2,5-OXADIAZOL-3-YL)BENZAMIDES FOR CONTROLLING UNWANTED PLANTS (51) Int. Cl. IN AREAS OF TRANSGENC CROPPLANTS AOIN 43/82 (2006.01) BEING TOLERANT TO HPPD INHIBITOR (52) U.S. Cl. HERBCDES CPC ...... A0IN 43/82 (2013.01) USPC ...... 504/139: 548/125; 504/265 (75) Inventors: Fabien Poree, Frankfurt (DE); Andreas Van Almsick, Karben (DE); Arnim (57) ABSTRACT Köhn, Klein-Winternheim (DE); Bernd Use of N-(1,2,5-Oxadiazol-3-yl)benzamides of formula (I) or Laber, Idstein (DE); Ruediger Hain, salts thereof Frankfurt (DE)

(73) Assignee: Bayer Intellectual Property GmbH, (I) Monheim (DE) (21) Appl. No.: 14/006,282 (22) PCT Filed: Mar. 21, 2012 (86). PCT No.: PCT/EP2012/054978 S371 (c)(1), for controlling unwanted plants in areas of transgenic crop (2), (4) Date: Nov. 23, 2013 plants being tolerant to HPPD inhibitor herbicides by con taining one or more chimeric gene(s) comprising (I) a DNA Related U.S. Application Data sequence encoding hydroxyphenylpyruvate dioxygenase (60) Provisional application No. 61/467,631, filed on Mar. (HPPD) derived from a member of a group of organisms 25, 2011. consisting of (a) Avena, (b) Pseudomonas, (c) Synechococ coideae, (d) Blepharismidae, (e) Rhodococcus, (f) Picro (30) Foreign Application Priority Data philaceae, (g) Kordia, or (II) comprising one or more mutated DNA sequences of HPPD encoding genes of the before Mar. 25, 2011 (EP) ...... 11159750.6 defined organisms. US 2014/0066307 A1 Mar. 6, 2014

USE OF the transformation of plants with a gene encoding a PDH N-(1,2,5-OXADIAZOL-3-YL)BENZAMIDES enzyme makes it possible to increase the tolerance of said FOR CONTROLLING UNWANTED PLANTS plants to HPPD inhibitors. IN AREAS OF TRANSGENC CROPPLANTS BEING TOLERANT TO HPPD INHIBITOR (0010. In WO 2002/046387, an gene obtained from Avena HERBCDES sativa encoding an HPPD was described to generate plants overexpressing Such gene and thereby causing tolerance to 0001. The invention relates to the use of N-(1,2,5-oxadia various HPPD-inhobitor herbicides. Zol-3-yl)benzamides for controlling unwanted plants in areas of transgenic crop plants being tolerant to HPPD inhibitor 0011. In WO 2008/150473, the combination of two dis herbicides. tinct tolerance mechanisms—a modified Avena sativa gene 0002 WO2011/035874 (being filed under PCT/EP2010/ coding for a mutant HPPD enzyme and a CYP450 Maize 0.05739 in the name of Bayer CropScience AG on Sep. 18, monooxygenase (nsf1 gene)—was exemplified in order to 2010) discloses several new N-(1,2,5-oxadiazol-3-yl)benza obtain an improved tolerance to HPPD inhibitor herbicides, mides whose phenyl ring is Substituted in the 2-, 3- and but no data have been disclosed demonstrating the Synergistic 4-position by selected radicals and their use as HPPD inhibi effects based on the combination of both proteins. tor herbicides for weed control. 0003. However, the herbicidal activity ofN-(1,2,5-oxadia 0012. In WO 2010/085705, several mutants of the Avena Zol-3-yl)benzamides whose phenyl ring is substituted in the sativa HPPD were described as well as plants comprising 2-, 3- and 4-position by selected radicals might cause dam genes encoding Such mutated HPPD and thereby causing an ages on several crop plants which limit their use in Such crop increased tolerance to various HPPD-inhibitor herbicides growing areas as herbicides for weed control. compared to non-mutated HPPD. 0004 HPPD inhibitor herbicides can be used against grass 0013 Recently, several new genes encoding HPPD and/or broad leaf weeds in crop plants that display metabolic enzymes from various organisms have been identified and tolerance. Such as maize (Zea mays) in which they are rapidly employed for obtaining crop plants that show an agronomi degraded (Schulz et al., (1993). FEBS letters, 318, 162-166; cally useful level of tolerance concerning the application of Mitchell et al., (2001) Pest Management Science, Vol 57, various HPPD inhibitor herbicides. 120-128; Garcia et al., (2000) Biochem., 39, 7501-7507: Pallett et al., (2001) Pest Management Science, Vol 57, 133 0014. The work concerning the implementation of such 142). In order to extend the scope of these HPPD inhibitor tolerance against HPPD inhibitor herbicides have extensively herbicides, several efforts have been developed in order to been described in the PCT-applications being filed in the confer to plants, particularly plants without or with an under name of Bayer CropScience AG on Dec. 22, 2010, having the performing metabolic tolerance, a tolerance level acceptable filing numbers PCT/EP2010/070561 (published as WO 2011/ under agronomic field conditions. 076877; relates to nucleic acid sequences encoding a hydrox 0005 Meanwhile transgeninc plants have been engi yphenylpyruvate dioxygenase (HPPD) obtained from bacte neered by by-passing HPPD-mediated production of ria belonging to the Subfamily Synechococcoideae and homogentisate (U.S. Pat. No. 6,812.010), overexpressing the sensitive enzyme so as to produce quantities of the target certain mutants thereof); PCT/EP2010/070567 (published as enzyme in the plant which are sufficient in relation to the WO 2011/076882; encoding a hydroxyphenylpyruvate herbicide has been performed (WO96/38567). dioxygenase obtained from protists belonging to the family 0006 Alternatively, transgenic plants have been generated Blepharismidae); PCT/EP2010/070578 (published as WO expressing HPPD proteins that have been mutated at various 2011/076892; encoding a hydroxyphenylpyruvate dioxyge positions in order to obtain a target enzyme which, while nase obtained from bacteria belonging to the genus Rhodo retaining its properties of catalysing the transformation of coccus and certain mutants thereof); PCT/EP2010/070570 HPP into homogentisate, is less sensitive to HPPD inhibitor (published as WO 2011/076885; encoding a hydroxyphe herbicides than is the native HPPD before mutation (for nylpyruvate dioxygenase obtained from Euryarchaeota example see at EP496630, WO 99/24585). belonging to the family Picrophilaceae and certain mutants 0007 More recently, the introduction of a Pseudomonas thereof); PCT/EP2010/070575 (published as WO 2011/ HPPD gene into the plastid genome of tobacco and soybean 076889; encoding a hydroxyphenylpyruvate dioxygenase has shown to be more effective than nuclear transformation, conferring eventolerance to post-emergence application of at obtained from bacteria belonging to the genus Kordia and least one HPPD inhibitor (Dufourmantel et al., 2007, Plant certain mutants thereof) and which are hereby incorporated Biotechnol J.5(1):118-33). by reference concerning the production of the respective 0008. In WO 2009/144079, a nucleic acid sequence transgenic plants conferring tolerance to HPPD inhibitor her encoding a mutated hydroxyphenylpyruvate dioxygenase bicides. (HPPD) at position 336 of the Pseudomonas fluorescens HPPD protein and its use for obtaining plants which are 0015. It has now been found that N-(1,2,5-oxadiazol-3-yl) tolerant to HPPD inhibitor herbicides is disclosed. benzamides whose phenyl ring is substituted in the 2-, 3- and 0009. In WO 04/024928, the inventors have sought to 4-position by selected radicals can be employed on transgenic increase the prenylduinone biosynthesis (e.g., synthesis of crop plants being tolerant to HPPD inhibitor herbicides by plastoquinones, tocopherols) in the cells of plants by increas containing one or more genes conferring tolerance to HPPD ing the flux of the HPP precursor into the cells of these plants. inhibitor herbicides. This has been done by connecting the synthesis of said pre 0016 Subject matter of the present invention is the use of cursor to the “shikimate” pathway by overexpression of the N-(1,2,5-oxadiazol-3-yl)benzamides of the formula (I) or prephenate-dehydrogenase (PDH). They have also noted that their salts US 2014/0066307 A1 Mar. 6, 2014

alkyl, phenyl or phenyl-(C-C)-alkyl, where the 12 last (I) mentioned radicals are substituted by s radicals selected from R N O X the group consisting of cyano, halogen, nitro, rhodano, OR, O S(O),R, N(R), NROR, COR, OCOR, SCOR, \ 2 Y, NRCOR, COR, COSR, CONCR), and (C-C)-alkoxy N N (C-C)-alkoxycarbonyl, H R is (C-C)-alkyl, (C-C)-alkenyl, (C-C)-alkynyl, (C- Z C)-cycloalkyl, (C-C)-cycloalkyl-(C-C)-alkyl, phenyl or phenyl-(C-C)-alkyl, where the seven last-mentioned radi cals are Substituted by S radicals from the group consisting of in which cyano, halogen, nitro, thiocyanato, OR, S(O),R, N(R), R is hydrogen, (C-C)-alkyl, (C-C)-cycloalkyl, halo-(C- NROR, COR, OCOR, SCOR, NRCOR, CO.R., C)-alkyl, (C-C)-alkoxy, halo-(C-C)-alkoxy, (C-C)- COSR, CONCR), and (C-C)-alkoxy-(C-C)-alkoxycar alkenyl, (C-C)-alkenyloxy, (C-C)-haloalkenyl, (C-C)- bonyl, alkynyl, (C-C)-alkynyloxy, (C-C)-haloalkynyl, cyano, R is hydrogen, (C-C)-alkyl, (C-C)-alkenyl or (C-C)- nitro, methylsulfenyl, methylsulfinyl, methylsulfonyl, acety alkynyl, lamino, benzoylamino, methoxycarbonyl, ethoxy-carbonyl, R" is (C-C)-alkyl, (C-C)-alkenyl or (C-C)-alkynyl, methoxycarbonylmethyl, ethoxycarbonylmethyl, benzoyl, R is methyl or ethyl, methylcarbonyl, piperidinylcarbonyl, trifluoromethylcarbo n is 0, 1 or 2, nyl, halogen, amino, aminocarbonyl, methyl-aminocarbonyl, s is 0, 1, 2 or 3, dimethylaminocarbonyl, methoxymethyl or heteroaryl, het for controlling unwanted plants in areas of transgenic crop erocyclyl or phenyl, each of which is substituted by S radicals plants being tolerant to HPPD inhibitor herbicides by con selected from the group consisting of methyl, ethyl, methoxy, taining one or more chimeric gene(s) (I) comprising a DNA trifluoromethyl and halogen, sequence encoding hydroxyphenylpyruvate dioxygenase X and Zindependently of one another are in each case nitro, (HPPD) derived from a member of a group of organisms halogen, cyano, formyl, rhodano, (C-C)-alkyl, (C-C)-ha consisting of (a) Avena, preferably Avena sativa, more pref loalkyl, (C-C)-alkenyl, (C-C)-haloalkenyl, (C-C)-alky erably comprising a DNA sequence identical to SEQID No. nyl, (C-C)-haloalkynyl, (C-C)-cycloalkyl, (C-C)-halo 1 encoding HPPD defined by SEQID No. 2, (b) Pseudomo cycloalkyl, (C-C)-cycloalkyl-(C-C)-alkyl, (C-C)- nas, preferably Pseudomonas fluorescens, more preferably halocycloalkyl-(C-C)-alkyl, COR', OR', OCOR', comprising a DNA sequence identical to SEQ ID No. 3 OSOR, S(O).R., SOOR', SON(R'), NRSOR, encoding HPPD defined by SEQID No. 4, (c) Synechococ NR'COR', (C-C)-alkyl-S(O).R., (C-C)-alkyl-OR', (C- coideae, preferably Synechococcus sp., more preferably com C.)-alkyl-OCOR', (C-C)-alkyl-OSOR, (C-C)-alkyl prising a DNA sequence identical to SEQID No. 6, encoding COOR', (C-C)-alkyl-SOOR', (C-C)-alkyl-CONCR'), HPPD defined by SEQID No. 7, (d) Blepharismidae, prefer (C-C)-alkyl-SON(R'), (C-C)-alkyl-NR'COR', (C- ably Blepharisma japonicum, more preferably comprising a C.)-alkyl-NR'SOR, NR, R2, P(O)(OR), or heteroaryl, DNA sequence identical to SEQ ID No. 8 encoding HPPD heterocyclyl or phenyl, each of which is substituted by s defined by SEQ ID No. 9, (e) Rhodococcus, preferably radicals selected from the group consisting of methyl, ethyl, Rhodococcus sp. (strain RHA1), isolate ro03.04.1 more pref methoxy, nitro, trifluoromethyl and halogen, erably comprising a DNA sequence identical to SEQID No. Y is nitro, halogen, cyano, rhodano, (C-C)-alkyl, (C-C)- 10 encoding HPPD defined by SEQID No. 11, or Rhodococ haloalkyl, (C-C)-alkenyl, (C-C)-haloalkenyl, (C-C)- cus sp. (strain RHA1), isolate ro02040, more preferably com alkynyl, (C-C)-haloalkynyl, (C-C)-cycloalkyl, (C-C)- prising a DNA sequence identical to SEQID No. 12 encoding halocycloalkyl, (C-C)-cycloalkyl-(C-C)-alkyl, (C-C)- HPPD defined by SEQID No. 13, (f) Picrophilaceae, prefer halocycloalkyl-(C-C)-alkyl, COR, COR, OR, OCOR', ably Picrophilus torridus, more preferably comprising a OSOR, S(O).R., SOOR', SON(R'), NRSOR, DNA sequence identical to SEQID No. 14 encoding HPPD NR'COR', (C-C)-alkyl-heteroaryl, O (C-C)-alkyl-het defined by SEQ ID No. 15, (g) Kordia, preferably Kordia erocyclyl. O—(C-C)-alkyl-heteroaryl, (C-C)-alkyl-het algicida, more preferably comprising a DNA sequence iden erocyclyl, (C-C)-alkyl-S(O).R., (C-C)-alkyl-OR', (C- tical to SEQ ID No. 16 encoding HPPD defined by SEQ ID C)-alkyl-OCOR', (C-C)-alkyl-OSO.R., (C-C)-alkyl No. 17, or (II) comprising one or more mutated DNA COOR', (C-C)-alkyl-CN, (C-C)-alkyl-SOOR', (C- sequences of HPPD encoding genes of the before defined C)-alkyl-CONCR), (C-C)-alkyl-SON(R'), (C-C)- organisms, preferably mutants as described in WO 2010/ alkyl-NRCOR', (C-C)-alkyl-NR'SOR, NR'R, P(O) 085705, U.S. Pat. No. 6,245,968, WO 2009/144079, PCT/ (OR), tetrahydrofuranyloxymethyl, EP2010/070561, PCT/EP2010/070567, PCT/EP2010/ tetrahydrofuranylmethoxymethyl, O(CH)-3,5-dimethyl-1, 070578, PCT/EP2010/070570, or PCT/EP2010/070575. 2-oxazol-4-yl, O(CH), O(3,5-dimethoxypyrimidin-2-yl, 0017. In formula (I) and all the formulae below, alkyl O(CH)-5-pyrrolidin-2-one, O(CH)-5-2,4-dimethyl-2,4-di radicals having more than two carbon atoms can be straight hydro-3H-1,2,4-triazol-3-one, or heteroaryl or heterocyclyl, chain or branched. Alkyl radicals are, for example, methyl, each of which is substituted by S radicals selected from the ethyl, n- or isopropyl. n-, iso-, t- or 2-butyl, pentyls, hexyls, group consisting of methyl, ethyl, methoxy, halogen and cya Such as n-hexyl, isohexyl and 1,3-dimethylbutyl. Halogen is nomethyl, fluorine, chlorine, bromine or iodine. R" is hydrogen, (C-C)-alkyl, (C-C)-haloalkyl, (C-C)- 0018. Heterocyclyl is a saturated, partially saturated or alkenyl, (C-C)-haloalkenyl, (C-C)-alkynyl, (C-C)-ha fully unsaturated cyclic radical which contains from 3 to 6 loalkynyl, (C-C)-cycloalkyl, (C-C)-halo-cycloalkyl, (C- ring atoms, of which 1 to 4 are from the group consisting of C)-alkyl-O-(C-C)-alkyl, (C-C)-cycloalkyl-(C-C)- oxygen, nitrogen and Sulfur, and which radical can addition US 2014/0066307 A1 Mar. 6, 2014 ally be fused by a benzo ring. For example, heterocyclyl is pyrimidin-4-yl, pyrimidin-5-yl, pyridazin-3-yl and piperidinyl, pyrrolidinyl, tetrahydrofuranyl, dihydrofuranyl, pyridazin-4-yl, which heterocycle is substituted by S radicals 4,5-dihydro-1,2-oxazol-3-yl and oxetanyl. selected from the group consisting of methyl, methoxy, trif 0019 Heteroaryl is an aromatic cyclic radical which con luoromethyl and halogen, or phenyl which is substituted by s tains 3 to 6 ring atoms, of which 1 to 4 are from the group radicals selected from the group consisting of methyl, meth consisting of oxygen, nitrogen and Sulfur, and which radical oxy, trifluoromethyl and halogen, can additionally be fused by a benzo ring. For example, X and Z independently of each other are in each case nitro, heteroaryl is benzimidazol-2-yl, furanyl, imidazolyl, isox halogen, cyano, rhodano, (C-C)-alkyl, (C-C)-haloalkyl, azolyl, isothiazolyl, oxazolyl, pyrazinyl, pyrimidinyl, (C-C)-alkenyl, (C-C)-haloalkenyl, (C-C)-alkynyl, (C- pyridazinyl, pyridinyl, benzisoxazolyl, thiazolyl pyrrolyl, C)-haloalkynyl, (C-C)-cycloalkyl, (C-C)-halocy pyrazolyl, thiophenyl, 1.2.3-oxadiazolyl, 1,2,4-oxadiazolyl, cloalkyl, (C-C)-cycloalkyl-(C-C)-alkyl, (C-C)-halocy 1,2,5-oxadiazolyl, 1.3,4-oxadiazolyl, 1,2,4-triazolyl, 1.2.3- cloalkyl-(C-C)-alkyl, COR, OR, OCOR', OSOR, S(O) triazolyl, 1.2.5-triazolyl, 1,3,4-triazolyl, 1,2,4-triazolyl, 1.2, R., SOOR', SON(R'), NRSOR, NRCOR', (C-C)- 4-thiadiazolyl, 1,3,4-thiadiazolyl, 1,2,3-thiadiazolyl, 1,2,5- alkyl-S(O).R., (C-C)-alkyl-OR', (C-C)-alkyl-OCOR', thiadiazolyl, 2H-1,2,3,4-tetrazolyl, 1H-1,2,3,4-tetrazolyl, (C-C)-alkyl-OSO.R., (C-C)-alkyl-COOR', (C-C)- 1,2,3,4-oxatriazolyl, 1,2,3,5-oxatriazolyl, 1.2.3,4-thiatriaz alkyl-SOOR', (C-C)-alkyl-CON(R'), (C-C)-alkyl olyl and 1,2,3,5-thiatriazolyl. SO.N(R'), (C-C)-alkyl-NR'COR', (C-C)-alkyl 0020. Where a group is substituted by a plurality of radi NR'SOR, benzoxazol-2-yl, 1-ethylbenzimidazol-2-yl, cals, this means that this group is Substituted by one or more piperidin-1-yl or 1,2,4-triazol-1-yl, identical or different representatives of the radicals men Y is nitro, halogen, cyano, rhodano, (C-C)-alkyl, (C-C)- tioned. haloalkyl, (C-C)-alkenyl, (C-C)-haloalkenyl, (C-C)- 0021 Depending on the nature and the attachment of the alkynyl, (C-C)-haloalkynyl, (C-C)-cycloalkyl, (C-C)- Substituents, the compounds of the formula (I) may be present halocycloalkyl, (C-C)-cycloalkyl-(C-C)-alkyl, (C-C)- as Stereoisomers. If, for example, one or more asymmetric halocycloalkyl-(C-C)-alkyl, COR', OR', OCOR', carbon atoms are present, there may be enantiomers and OSOR, S(O).R., SOOR', SON(R'), NRSOR, diastereomers. There may also be stereoisomers if n is 1 NRCOR', (C-C)-alkyl-S(O).R., (C-C)-alkyl-OR', (C- (sulfoxides). Stereoisomers may be obtained from the mix C)-alkyl-OCOR', (C-C)-alkyl-OSOR, (C-C)-alkyl tures resulting from the preparation using customary separa COOR', (C-C)-alkyl-SO,OR', (C-C)-alkyl-CONCR), tion methods, for example by chromatographic separation (C-C)-alkyl-SO.N(R'), (C-C)-alkyl-NR'COR', (C- techniques. It is also possible to prepare stereoisomers selec C)-alkyl-NR'SOR, tetrahydrofuranyloxymethyl, tetrahy tively by using stereoselective reactions employing optically drofuranylmethoxymethyl, O(CH)-3,5-dimethyl-1,2-ox active starting materials and/or auxiliaries. The invention also azol-4-yl, O(CH), O(3,5-dimethoxypyrimidin-2-yl, relates to all stereoisomers and mixtures thereof embraced by O(CH)-5-pyrrolidin-2-one or O(CH)-5-2,4-dimethyl-2,4- the general formula (I) but not specifically defined. dihydro-3H-1,2,4-triazol-3-one, 0022 Preference is given to the inventive use of com R" is hydrogen, (C-C)-alkyl, (C-C)-alkenyl, (C-C)- pounds of the general formula (I) in which alkynyl, (C-C)-cycloalkyl, (C-C)-cycloalkyl-(C-C)- R is hydrogen, (C-C)-alkyl, (C-C)-cycloalkyl, halo-(C- alkyl, phenyl or phenyl-(C-C)-alkyl, where the seven last C)-alkyl, (C-C)-alkoxy, halo-(C-C)-alkoxy, cyano, mentioned radicals are substituted by s radicals selected from nitro, methylsulfenyl, methylsulfinyl, methylsulfonyl, acety the group consisting of cyano, halogen, nitro, thiocyanato, lamino, benzoylamino, methoxycarbonyl, ethoxycarbonyl, OR, S(O),R, N(R), NROR, COR, OCOR, SCOR, benzoyl, methylcarbonyl, piperidinylcarbonyl, trifluorom NRCOR, COR, COSR, CONCR), and (C-C)-alkoxy ethylcarbonyl, halogen, amino, aminocarbonyl, methylami (C-C)-alkoxycarbonyl, nocarbonyl, dimethylaminocarbonyl, methoxymethyl, R is (C-C)-alkyl, (C-C)-alkenyl, (C-C)-alkynyl, (C- a heterocycle selected from the group consisting of pyridin C)-cycloalkyl, (C-C)-cycloalkyl-(C-C)-alkyl, phenyl or 2-yl, pyridin-3-yl pyridin-4-yl, piperidin-2-yl, piperidin-3- phenyl-(C-C)-alkyl, where the seven last-mentioned radi yl, piperidin-4-yl, benzisoxazol-2-yl, 1,2,4-oxadiazol-3-yl, cals are substituted by S radicals selected from the group 1,2,4-triazol-3-yl, 1-ethylbenzimidazol-2-yl 4-methylthi consisting of cyano, halogen, nitro, thiocyanato, OR, S(O) azol-2-yl, thiophen-2-yl, furan-2-yl, furan-3-yl, tetrahydro R, N(R), NROR, COR, OCOR, SCOR, NRCOR, furan-2-yl, tetrahydrofuran-3-yl, isoxazol-2-yl, isoxazol-3- COR, COSR, CONCR), and (C-C)-alkoxy-(C-C)- yl, oxazol-2-yl, oxazol-3-yl, pyrrol-2-yl, pyrrol-3-yl, alkoxycarbonyl, imidazol-2-yl, imidazol-5-yl, imidazol-4-yl, pyrazol-3-yl, R is hydrogen, (C-C)-alkyl, (C-C)-alkenyl or (C-C)- pyrazol-5-yl, pyrazol-4-yl, isoxazol-3-yl, isoxazol-4-yl, alkynyl, isoxazol-5-yl, oxazol-2-yl, oxazol-4-yl, oxazol-5-yl, isothia R" is (C-C)-alkyl, (C-C)-alkenyl or (C-C)-alkynyl, Zol-3-yl, isothiazol-4-yl, isothiazol-5-yl, thiazol-2-yl, thia n is 0, 1 or 2, Zol-4-yl, thiazol-5-yl, 1,2,3-triazol-4-yl, 1,2,3-triazol-5-yl, s is 0, 1, 2 or 3, 1,2,5-triazol-3-yl, 1,3,4-triazol-2-yl, 1,2,4-triazol-3-yl, 1.2, for controlling unwanted plants in areas of transgenic crop 4-triazol-5-yl, 1,2,4-oxadiazol-3-yl, 1,2,4-oxadiazol-5-yl, plants being tolerant to HPPD inhibitor herbicides by con 1,3,4-oxadiazol-2-yl, 1.2.3-oxadiazol-4-yl, 1.2.3-oxadiazol taining one or more chimeric gene(s) (I) comprising a DNA 5-yl, 1,2,5-oxadiazol-3-yl, 1,2,4-thiadiazol-3-yl, 1,2,4-thia sequence encoding hydroxyphenylpyruvate dioxygenase diazol-5-yl, 1,3,4-thiadiazol-2-yl, 1,2,3-thiadiazol-4-yl, 1.2, (HPPD) derived from a member of a group of organisms 3-thiadiazol-5-yl, 1,2,5-thiadiazol-3-yl, 2H-1,2,3,4-tetrazol consisting of (a) Avena, preferably Avena sativa, more pref 5-yl, 1H-1,2,3,4-tetrazol-1-yl, 1,2,3,4-oxatriazol-5-yl, 1.2.3, erably comprising a DNA sequence identical to SEQID No. 5-oxatriazol-4-yl, 1,2,3,4-thiatriazol-5-yl, 1,2,3,5- 1 encoding HPPD defined by SEQID No. 2, (b) Pseudomo thiatriazol-4-yl, pyrazin-2-yl, pyrazin-3-yl pyrimidin-2-yl, nas, preferably Pseudomonas fluorescens, more preferably US 2014/0066307 A1 Mar. 6, 2014 comprising a DNA sequence identical to SEQ ID No. 3 C)-haloalkynyl, (C-C)-cycloalkyl, (C-C)-halocy encoding HPPD defined by SEQID No. 4, (c) Synechococ cloalkyl, (C-C)-cycloalkyl-(C-C)-alkyl, (C-C)-halocy coideae, preferably Synechococcus sp., more preferably com cloalkyl-(C-C)-alkyl, COR', OR, OCOR', OSOR, S(O) prising a DNA sequence identical to SEQID No. 6, encoding R, SOOR', SON(R'), NRSOR, NRCOR', (C-C)- HPPD defined by SEQID No. 7, (d) Blepharismidae, prefer alkyl-S(O),R, (C-C)-alkyl-OR', (C-C)-alkyl-OCOR', ably Blepharisma japonicum, more preferably comprising a (C-C)-alkyl-OSOR, (C-C)-alkyl-COOR', (C-C)- DNA sequence identical to SEQ ID No. 8 encoding HPPD alkyl-SOOR', (C-C)-alkyl-CONCR), (C-C)-alkyl defined by SEQ ID No. 9, (e) Rhodococcus, preferably SO.N(R'), (C-C)-alkyl-NR'COR', (C-C)-alkyl Rhodococcus sp. (strain RHA1), isolate ro03.04.1 more pref NR'SOR, benzoxazol-2-yl, 1-ethylbenzimidazol-2-yl, erably comprising a DNA sequence identical to SEQID No. piperidin-1-yl or 1,2,4-triazol-1-yl, 10 encoding HPPD defined by SEQID No. 11, or Rhodococ Y is nitro, halogen, cyano, rhodano, (C-C)-alkyl, (C-C)- cus sp. (strain RHA1), isolate ro02040, more preferably com haloalkyl, (C-C)-alkenyl, (C-C)-haloalkenyl, (C-C)- prising a DNA sequence identical to SEQID No. 12 encoding alkynyl, (C-C)-haloalkynyl, (C-C)-cycloalkyl, (C-C)- HPPD defined by SEQID No. 13, (f) Picrophilaceae, prefer halocycloalkyl, (C-C)-cycloalkyl-(C-C)-alkyl, (C-C)- ably Picrophilus torridus, more preferably comprising a halocycloalkyl-(C-C)-alkyl, COR', OR', OCOR', DNA sequence identical to SEQID No. 14 encoding HPPD OSOR, S(O),R, SOOR', SON(R'), NRSOR, defined by SEQ ID No. 15, (g) Kordia, preferably Kordia NR'COR', (C-C)-alkyl-S(O).R., (C-C)-alkyl-OR', (C- algicida, more preferably comprising a DNA sequence iden C)-alkyl-OCOR', (C-C)-alkyl-OSOR, (C-C)-alkyl tical to SEQID No. 16 encoding HPPD defined by SEQ ID COOR', (C-C)-alkyl-SOOR', (C-C)-alkyl-CONCR'), No. 17, or (II) comprising one or more mutated DNA (C-C)-alkyl-SO.N(R'), (C-C)-alkyl-NR'COR', (C- sequences of HPPD encoding genes of the before defined C.)-alkyl-NR'SOR, tetrahydrofuranyloxymethyl, tetrahy organisms, preferably mutants as described in WO 2010/ drofuranylmethoxymethyl, O(CH)-3,5-dimethyl-1,2-ox 085705, U.S. Pat. No. 6,245,968, WO 2009/144079, PCT/ azol-4-yl, O(CH), O(3,5-dimethoxypyrimidin-2-yl, EP2010/070561, PCT/EP2010/070567, PCT/EP2010/ O(CH)-5-pyrrolidin-2-one or O(CH)-5-2,4-dimethyl-2,4- 07.0578, PCT/EP2010/070570, or PCT/EP2010/070575. dihydro-3H-1,2,4-triazol-3-one, 0023 Particular preference is given to the inventive use of R" is hydrogen, (C-C)-alkyl, (C-C)-alkenyl, (C-C)- compounds of the general formula (I) in which alkynyl, (C-C)-cycloalkyl, (C-C)-cycloalkyl-(C-C)- R is hydrogen, (C-C)-alkyl, (C-C)-cycloalkyl, halo-(C- alkyl, phenyl or phenyl-(C-C)-alkyl, where the seven last C)-alkyl, (C-C)-alkoxy, halo-(C-C)-alkoxy, cyano, mentioned radicals are substituted by s radicals selected from nitro, methylsulfenyl, methylsulfinyl, methylsulfonyl, acety the group consisting of cyano, halogen, nitro, thiocyanato, lamino, benzoylamino, methoxycarbonyl, ethoxycarbonyl, OR, S(O),R, N(R), NROR, COR, OCOR, SCOR, benzoyl, methylcarbonyl, piperidinylcarbonyl, trifluorom NRCOR, COR, COSR, CONCR), and (C-C)-alkoxy ethylcarbonyl, halogen, amino, aminocarbonyl, methylami (C-C)-alkoxycarbonyl, nocarbonyl, dimethylaminocarbonyl, methoxymethyl, R is (C-C)-alkyl, (C-C)-alkenyl, (C-C)-alkynyl, (C- a heterocycle selected from the group consisting of pyridin C)-cycloalkyl, (C-C)-cycloalkyl-(C-C)-alkyl, phenyl or 2-yl, pyridin-3-yl pyridin-4-yl, piperidin-2-yl, piperidin-3- phenyl-(C-C)-alkyl, where the seven last-mentioned radi yl, piperidin-4-yl, benzisoxazol-2-yl, 1,2,4-oxadiazol-3-yl, cals are substituted by S radicals selected from the group 1,2,4-triazol-3-yl, 1-ethylbenzimidazol-2-yl 4-methylthi consisting of cyano, halogen, nitro, thiocyanato, OR, S(O) azol-2-yl, thiophen-2-yl, furan-2-yl, furan-3-yl, tetrahydro R, N(R), NROR, COR, OCOR, SCOR, NRCOR, furan-2-yl, tetrahydrofuran-3-yl, isoxazol-2-yl, isoxazol-3- COR, COSR, CONCR), and (C-C)-alkoxy-(C-C)- yl, oxazol-2-yl, oxazol-3-yl, pyrrol-2-yl, pyrrol-3-yl, alkoxycarbonyl, imidazol-2-yl, imidazol-5-yl, imidazol-4-yl, pyrazol-3-yl, R is hydrogen, (C-C)-alkyl, (C-C)-alkenyl or (C-C)- pyrazol-5-yl, pyrazol-4-yl, isoxazol-3-yl, isoxazol-4-yl, alkynyl, isoxazol-5-yl, oxazol-2-yl, oxazol-4-yl, oxazol-5-yl, isothia R" is (C-C)-alkyl, (C-C)-alkenyl or (C-C)-alkynyl, Zol-3-yl, isothiazol-4-yl, isothiazol-5-yl, thiazol-2-yl, thia n is 0, 1 or 2, Zol-4-yl, thiazol-5-yl, 1,2,3-triazol-4-yl, 1,2,3-triazol-5-yl, s is 0, 1, 2 or 3 1,2,5-triazol-3-yl, 1,3,4-triazol-2-yl, 1,2,4-triazol-3-yl, 1.2, for controlling unwanted plants in areas of transgenic crop 4-triazol-5-yl, 1,2,4-oxadiazol-3-yl, 1,2,4-oxadiazol-5-yl, plants being tolerant to HPPD inhibitor herbicides by con 1,3,4-oxadiazol-2-yl, 1.2.3-oxadiazol-4-yl, 1.2.3-oxadiazol taining one or more chimeric gene(s) (I) comprising a DNA 5-yl, 1,2,5-oxadiazol-3-yl, 1,2,4-thiadiazol-3-yl, 1,2,4-thia sequence encoding hydroxyphenylpyruvate dioxygenase diazol-5-yl, 1,3,4-thiadiazol-2-yl, 1,2,3-thiadiazol-4-yl, 1.2, (HPPD) derived from a member of a group of organisms 3-thiadiazol-5-yl, 1,2,5-thiadiazol-3-yl, 2H-1,2,3,4-tetrazol consisting of (a) Avena, preferably Avena sativa, more pref 5-yl, 1H-1,2,3,4-tetrazol-1-yl, 1,2,3,4-oxatriazol-5-yl, 1.2.3, erably comprising a DNA sequence identical to SEQID No. 5-oxatriazol-4-yl, 1,2,3,4-thiatriazol-5-yl, 1,2,3,5- 1 encoding HPPD defined by SEQID No. 2, (b) Pseudomo thiatriazol-4-yl, pyrazin-2-yl, pyrazin-3-yl pyrimidin-2-yl, nas, preferably Pseudomonas fluorescens, more preferably pyrimidin-4-yl, pyrimidin-5-yl, pyridazin-3-yl and comprising a DNA sequence identical to SEQ ID No. 3 pyridazin-4-yl, which heterocycle is substituted by S radicals encoding HPPD defined by SEQID No. 4, (c) Synechococ selected from the group consisting of methyl, methoxy, trif coideae, preferably Synechococcus sp., more preferably com luoromethyl and halogen, or phenyl which is substituted by s prising a DNA sequence identical to SEQID No. 6, encoding radicals selected from the group consisting of methyl, meth HPPD defined by SEQID No. 7, (d) Blepharismidae, prefer oxy, trifluoromethyl and halogen, ably Blepharisma japonicum, more preferably comprising a X and Z independently of each other are in each case nitro, DNA sequence identical to SEQ ID No. 8 encoding HPPD halogen, cyano, rhodano, (C-C)-alkyl, (C-C)-haloalkyl, defined by SEQ ID No. 9, (e) Rhodococcus, preferably (C-C)-alkenyl, (C-C)-haloalkenyl, (C-C)-alkynyl, (C- Rhodococcus sp. (strain RHA1), isolate ro03.04.1 more pref US 2014/0066307 A1 Mar. 6, 2014 erably comprising a DNA sequence identical to SEQID No. sp. (strain RHA1), isolate ro03.04.1 more preferably compris 10 encoding HPPD defined by SEQID No. 11, or Rhodococ ing a DNA sequence identical to SEQ ID No. 10 encoding cus sp. (strain RHA1), isolate ro02040, more preferably com HPPD defined by SEQID No. 11, or Rhodococcus sp. (strain prising a DNA sequence identical to SEQID No. 12 encoding RHA1), isolate ro02040, more preferably comprising a DNA HPPD defined by SEQID No. 13, (f) Picrophilaceae, prefer sequence identical to SEQID No. 12 encoding HPPD defined ably Picrophilus torridus, more preferably comprising a by SEQID No. 13, (f) Picrophilaceae, preferably Picrophilus DNA sequence identical to SEQID No. 14 encoding HPPD torridus, more preferably comprising a DNA sequence iden defined by SEQ ID No. 15, (g) Kordia, preferably Kordia tical to SEQ ID No. 14 encoding HPPD defined by SEQ ID algicida, more preferably comprising a DNA sequence iden No. 15, (g) Kordia, preferably Kordia algicida, more prefer tical to SEQID No. 16 encoding HPPD defined by SEQ ID ably comprising a DNA sequence identical to SEQID No. 16 No. 17, or (II) comprising one or more mutated DNA encoding HPPD defined by SEQID No. 17, or(II) comprising sequences of HPPD encoding genes of the before defined one or more mutated DNA sequences of HPPD encoding organisms, preferably mutants as described in WO 2010/ genes of the before defined organisms, preferably mutants as 085705, U.S. Pat. No. 6,245,968, WO 2009/144079, PCT/ described in WO 2010/085705, U.S. Pat. No. 6,245,968, WO EP2010/070561, PCT/EP2010/070567, PCT/EP2010/ 2009/144079, PCT/EP2010/070561, PCT/EP2010/070567, 07.0578, PCT/EP2010/070570, or PCT/EP2010/070575. PCT/EP2010/070578, PCT/EP2010/070570, or PCT/ 0024 Very particular preference is given to the inventive EP2010/070575. use of compounds of the general formula (I) in which 0026. In all of the formulae below, the substituents and R is hydrogen, (C-C)-alkyl, (C-C)-cycloalkyl, halo-(C- symbols have the same definition as described under formula C)-alkyl, (C-C)-alkoxy, halogen-(C-C)-alkoxy, cyano, (I), unless otherwise defined. nitro, methylsulfenyl, methylsulfinyl, methylsulfonyl, acety 0027 Compounds to be used according to the invention lamino, benzoylamino, methoxycarbonyl, ethoxycarbonyl, can be prepared for example by the method specified in benzoyl, methylcarbonyl, piperidinylcarbonyl, trifluorom scheme 1 by reacting, with base catalysis, a benzoyl chloride ethylcarbonyl, halogen, amino, aminocarbonyl, methylami (II) with a 4-amino-1,2,5-oxadiazole (III): nocarbonyl, dimethylaminocarbonyl, methoxymethyl, X and Zindependently of one another are in each case nitro, halogen, cyano, (C-C)-alkyl, (C-C)-haloalkyl, (C-C)- Scheme 1 cycloalkyl, OR', S(O).R., (C-C)-alkyl-S(O).R., (C-C)- alkyl-OR', (C-C)-alkyl-CON(R'), (C-C)-alkyl-SON O X (R'), (C-C)-alkyl-NR'COR', (C-C)-alkyl-NR'SOR N R Y M s C base or 1,2,4-triazol-1-yl, O -- Hos Y is S(O),R, 4.5-dihydro-1,2-oxazol-3-yl, 5-cyanomethyl \ 2 4,5-dihydro-1,2-oxazol-3-yl or 5-methoxymethyl-4,5-dihy N NH2 Z dro-1,2-oxazol-3-yl, R" is hydrogen, (C-C)-alkyl, (C-C)-alkenyl, (C-C)- (III) (II) alkynyl, (C-C)-cycloalkyl, (C-C)-cycloalkyl-(C-C)- alkyl, phenyl or phenyl-(C-C)-alkyl, where the seven last mentioned radicals are substituted by s radicals selected from the group consisting of halogen and OR, R is (C-C)-alkyl, (C-C)-cycloalkyl or (C-C)-cy cloalkyl-(C-C)-alkyl, where the three last-mentioned radi cals are Substituted by S radicals selected from the group (I) consisting of halogen and OR, R is hydrogen or (C-C)-alkyl, (0028. The benzoyl chlorides of the formula (II), or the n is 0, 1 or 2, benzoic acids on which they are based, are known in principle s is 0, 1, 2 or 3, and can be prepared for example according to the methods for controlling unwanted plants in areas of transgenic crop described in U.S. Pat. No. 6,376,429 B1, EP 1 585 742 A1, plants being tolerant to and EP 1 202978 A1. 0025 HPPD inhibitor herbicides by containing one or more chimeric gene(s) (I) comprising a DNA sequence 0029 Compounds according to the invention can also be encoding hydroxyphenylpyruvate dioxygenase (HPPD) prepared by the method specified in Scheme 2 by reacting a derived from a member of a group of organisms consisting of benzoic acid of the formula (IV) with a 4-amino-1,2,5-oxa (a) Avena, preferably Avena sativa, more preferably compris diazole (III): ing a DNA sequence identical to SEQ ID No. 1 encoding HPPD defined by SEQ ID No. 2, (b) Pseudomonas, prefer ably Pseudomonas fluorescens, more preferably comprising a Scheme 2 DNA sequence identical to SEQ ID No. 3 encoding HPPD O X defined by SEQID No. 4, (c) Synechococcoideae, preferably N R Y Synechococcus sp., more preferably comprising a DNA / N HO activation sequence identical to SEQID No. 6, encoding HPPD defined O -- -- by SEQ ID No. 7, (d) Blepharismidae, preferably Blepha N -2 risma japonicum, more preferably comprising a DNA N NH2 Z sequence identical to SEQID No. 8 encoding HPPD defined (III) (IV) by SEQID No. 9, (e) Rhodococcus, preferably Rhodococcus US 2014/0066307 A1 Mar. 6, 2014

-continued TABLE 1 N R M s O X Compounds of the general formula (I) according to the invention in O which R is methyl N e Y Me N O X H O Z \ -2 Y (I) H Z 0030 Dehydrating reagents which are conventionally used for amidation reactions, such as, for example, 1,1'-car No. X Y Z. bonyldiimidazole (CD), dicyclohexylcarbodiimide (DCC), -1 CF OCH2CON(Me)Et SO-Me 2,4,6-tripropyl-1,3,5,2,4,6-trioXatriphosphinane 2,4,6-triox -2 CF OCH2CON(Me)Et SOE -4 CF 2-(1H-pyrazol-1-yl)ethoxyl SOMe ide (T3P) and the like may be employed for the activation. -S CF 2-(1H-pyrazol-1-yl)ethoxyl SOE 0031. In detail, the synthesis of specific compounds -6 CF tetrahydrofuran-2-yl- SO-Me belonging to the class of N-(1,2,5-oxadiazol-3-yl)benza methoxy -7 CF tetrahydrofuran-2-yl- SOE mides whose phenyl ring is Substituted in the 2-, 3- and methoxy 4-position is exemplified in PCT/EP2010/005739, which is -8 CF OH SO-Me hereby incorporated by reference. -9 CF OH SOE -10 CF SH SOMe 0032. The compounds listed in the tables hereinbelow are -11 CF SH SOE very specially preferred to be used for controlling unwanted -15 CF SMe SO-Me plants in areas of transgenic plants containing one or more -16 CF SMe SOE chimeric gene(s) (I) comprising a DNA sequence encoding -17 CF S(O)Me SO-Me -24 CF S(O)Me SOE hydroxyphenylpyruvate dioxygenase (HPPD) derived from a -2S CF S(O)-Me SO-Me member of a group of organisms consisting of (a) Avena, -26 CF S(O). Me SOE preferably Avena sativa, more preferably comprising a DNA -27 CF 2-(methylsulfonyl) SOM amino)ethoxy sequence identical to SEQID No. 1 encoding HPPD defined -28 CF 2-(methylsulfonyl)- SO-Me by SEQID No. 2, (b) Pseudomonas, preferably Pseudomonas aminoethylsulfanyl fluorescens, more preferably comprising a DNA sequence -29 CF 2-(methylsulfonyl)- SO-Et identical to SEQID No. 3 encoding HPPD defined by SEQID aminoethylsulfanyl No. 4, (c) Synechococcoideae, preferably Synechococcus sp., -30 NO, O(CH2)2OMe OMe -31 NO, OMe Me more preferably comprising a DNA sequence identical to -32 NO, NH, OMe SEQID No. 6, encoding HPPD defined by SEQID No. 7 (d) -33 NO, NH, SO-Et Blepharismidae, preferably Blepharisma japonicum, more -34 NO, NH, C preferably comprising a DNA sequence identical to SEQID -35 NO, NHMe C -36 NO, N.Me, C No. 8 encoding HPPD defined by SEQID No. 9, (e) Rhodo -37 NO, NH, Br coccus, preferably Rhodococcus sp. (strain RHA1), isolate -38 NO, NHMe Br ro03.04.1 more preferably comprising a DNA sequence iden -39 NO, N.Me, Br tical to SEQID No. 10 encoding HPPD defined by SEQ ID -40 NO, NH, -41 NO, NHMe No. 11 or Rhodococcus sp. (strain RHA1), isolate ro02040, -42 NO, N.Me, more preferably comprising a DNA sequence identical to -43 NO, NH, SOMe SEQ ID No. 12 encoding HPPD defined by SEQID No. 13, -44 NO, NHMe SO-Me (f) Picrophilaceae, preferably Picrophilus torridus, more -45 NO, N.Me, SO-Me -46 NO, NH, H-1,2,4- preferably comprising a DNA sequence identical to SEQID triazol-1-yl No. 14 encoding HPPD defined by SEQID No. 15, (g) Kor -47 NO, NHMe H-1,2,4- dia, preferably Kordia algicida, more preferably comprising triazol-1-yl -48 NO, N.Me, H-1,2,4- a DNA sequence identical to SEQID No. 16 encoding HPPD triazol-1-yl defined by SEQ ID No. 17, or (II) comprising one or more -49 Me F mutated DNA sequences of HPPD encoding genes of the -SO Me F C before defined organisms, preferably mutants as described in -S1 Me SMe CF WO 2010/085705, U.S. Pat. No. 6,245,968, WO 2009/ -52 Me C SO-Me -53 Me SO-Me SO-Me 144079, PCT/EP2010/070561, PCT/EP2010/070567, PCT/ -54 Me SO-Me CF EP2010/070578, PCT/EP2010/070570, or PCT/EP2010/ -55 Me C CF O70575. -S6 Me S(O)Me CF -57 Me SEt OMe 0033. The abbreviations used are: -58 Me N.Me, SO-Me -59 Me NH(CH),OMe SOMe -60 Me O(CH2)OMe SO-Me -61 Me NH, SO-Me Et = ethyl Me = methyl n-Pr= n-propyl i-Pr = isopropyl -62 Me O(CH2)2—O(3,5-di- SO-Me Pen = pentyl Ph = phenyl Ac = acetyl BZ = benzoyl methoxypyrimidin-2-yl c-Pr = cyclopropyl -63 Me O(CH2)2—O NMe2 C -64 Me O(CH), NH(CO)NMe2 C

US 2014/0066307 A1 Mar. 6, 2014 58

TABLE 11-continued TABLE 11-continued Compounds of the general formula (I) according to the invention Compounds of the general formula (I) according to the invention (I) (I) R N R / N O X R le Y

H Z,

No. R No. R X Y Z. yl 11-2S3 BZ Me S(O)Me SOCH -201 c-Pr 4,5-dihydro-1,2- SOMe 11-254 BZ Me SO.Me SOCH oxazol-3-yl 11-2SS BZ F SMe CF -2O2 c-Pr SO Me C 11-256 BZ F S(O)Me CF -2O3 c-Pr SO Me SO-Me 11-257 BZ F SO-Me CF -204 c-Pr SOMe CF -205 c-Pr N.Me, SO-Me -2O6 c-Pr O(CH2)2OMe C 0034. As already disclosed in PCT/EP2010/005739, the -2O7 c-Pr NH(CH2)2OMe SO-Me compounds of the formula (I) and/or their salts to be used -208 c-Pr O(CH)NHSO.Me SOMe -209 piperidin-1-yl SMe SO-Me according to the invention, hereinbelow also referred to -210 piperidin-1-yl S(O)Me CF together as "compounds according to the invention’, have -211 piperidin-1-yl (tetrahydrofuran-2- SO-Me excellent herbicidal efficacy against abroad spectrum of eco ylmethoxy)methyl nomically important monocotyledonous and dicotyledonous -212 piperidin-1-yl SO-Et -213 piperidin-1-yl SO-Me annual harmful plants. The active compounds act efficiently -214 piperidin-1-yl SO-Me even on perennial weeds which produce shoots from rhi -215 piperidin-1-yl SO.MeSOMe Zomes, rootstocks and other perennial organs and which are -216 piperidin-1-yl CF difficult to control. -217 piperidin-1-yl SOMe -218 NO, S(O)Me CF 0035. The present invention therefore relates to a method -219 NH, (tetrahydrofuran-2- SOMe for controlling unwanted plants, in areas of transgenic crop ylmethoxy)methyl plants being tolerant to HPPD inhibitor herbicides by con -22O NH, 1,2,3-triazol-1-yl SO-Me taining one or more chimeric gene(s) (I) comprising a DNA -221 CO-Me S(O)Me CF sequence encoding hydroxyphenylpyruvate dioxygenase -222 CO-Me (tetrahydrofuran-2- SO-Me ylmethoxy)methyl (HPPD) derived from a member of a group of organisms -223 CO-Me C SO-Me consisting of (a) Avena, preferably Avena sativa, more pref -224 COMe S(O)Me CF erably comprising a DNA sequence identical to SEQID No. -225 CO-Me 1H-pyrazol-1-yl SO-Me -226 CO-Me F SO-Me 1 encoding HPPD defined by SEQID No. 2, (b) Pseudomo -227 CO-Me 1,2,4-Triazol-1-yl SO-Me nas, preferably Pseudomonas fluorescens, more preferably -228 COMe C SOMe comprising a DNA sequence identical to SEQ ID No. 3 -229 CO-Me Me SMe encoding HPPD defined by SEQID No. 4, (c) Synechococ -23O CO-Me Me C -231 CO-Me F Me coideae, preferably Synechococcus sp., more preferably com -232 COMe SMe SOMe prising a DNA sequence identical to SEQID No. 6, encoding -233 CO2Et SO Me CF HPPD defined by SEQID No. 7, (d) Blepharismidae, prefer -234 CO2H SO Me CF ably Blepharisma japonicum, more preferably comprising a -235 piperidin-1-yl 5-cyanomethyl-4,5- SO-Et carbonyl dihydro-1,2-oxazol-3- DNA sequence identical to SEQ ID No. 8 encoding HPPD yl defined by SEQ ID No. 9, (e) Rhodococcus, preferably -236 piperidin-1-yl C CHOCH2CF SO-Me Rhodococcus sp. (strain RHA1), isolate ro03.04.1 more pref carbonyl erably comprising a DNA sequence identical to SEQID No. -237 piperidin-1-yl SOMe CF carbonyl 10 encoding HPPD defined by SEQID No. 11, or Rhodococ -238 piperidin-1-yl C SO-Me cus sp. (strain RHA1), isolate ro02040, more preferably com carbonyl prising a DNA sequence identical to SEQID No. 12 encoding -239 SEt CF HPPD defined by SEQID No. 13, (f) Picrophilaceae, prefer -240 SP CF -241 SO-Me CF ably Picrophilus torridus, more preferably comprising a -242 Br SOMe DNA sequence identical to SEQID No. 14 encoding HPPD -243 S(O)Me CF defined by SEQ ID No. 15, (g) Kordia, preferably Kordia -244 S(O)Me SO-Me algicida, more preferably comprising a DNA sequence iden -245 c-Pr S(O)Me CF -246 c-Pr (tetrahydrofuran-2- SOMe tical to SEQ ID No. 16 encoding HPPD defined by SEQ ID ylmethoxy)methyl No. 17, or (II) comprising one or more mutated DNA -247 C SO-Me sequences of HPPD encoding genes of the before defined -248 Me SO-Me organisms, preferably mutants as described in WO 2010/ -249 SMe CF -2SO S(O)Me CF 085705, U.S. Pat. No. 6,245,968, WO 2009/144079, PCT/ -251 SO Me CF EP2010/070561, PCT/EP2010/070567, PCT/EP2010/ -2S2 SMe SOCH 070578, PCT/EP2010/070570, or PCT/EP2010/070575, comprising the application of one or more N-(1,2,5-oxadia US 2014/0066307 A1 Mar. 6, 2014 59

Zol-3-yl)benzamides whose phenyl ring is substituted in the erably comprising a DNA sequence identical to SEQID No. 2-, 3- and 4-position as defined above to the plants (for 12 encoding HPPD defined by SEQ ID No. 13, (f) Picro example harmful plants such as monocotyledonous ordicoty philaceae, preferably Picrophilus torridus, more preferably ledonous weeds or undesired crop plants), to the seed (for comprising a DNA sequence identical to SEQ ID No. 14 example grains, seeds or vegetative propagules such as tubers encoding HPPD defined by SEQ ID No. 15, (g) Kordia, or shoot parts with buds) or to the area on which the plants preferably Kordia algicida, more preferably comprising a grow (for example the area under cultivation). Specific DNA sequence identical to SEQID No. 16 encoding HPPD examples may be mentioned of Some representatives of the defined by SEQ ID No. 17, or (II) comprising one or more monocotyledonous and dicotyledonous weed flora which can mutated DNA sequences of HPPD encoding genes of the be controlled by the compounds according to the invention, before defined organisms, preferably mutants as described in without the enumeration being restricted to certain species. WO 2010/085705, U.S. Pat. No. 6,245,968, WO 2009/ 0036 Monocotyledonous harmful plants of the genera: 144079, PCT/EP2010/070561, PCT/EP2010/070567, PCT/ Aegilops, Agropyron, Agrostis, Alopecurus, Apera, Avena, EP2010/070578, PCT/EP2010/070570, or PCT/EP2010/ Brachiaria, Bromus, Cenchrus, Commelina, Cynodon, Cype 07.0575, comprising the application of one or more N-(1,2,5- rus, Dactyloctenium, Digitaria, Echinochloa, Eleocharis, oxadiazol-3-yl)benzamides whose phenyl ring is Substituted Eleusine, Eragrostis, Eriochloa, Festuca, Fimbristylis, Het in the 2-, 3- and 4-position as defined above to the plants (for eranthera, Imperata, Ischaemum, Leptochloa, Lolium, example harmful plants such as monocotyledonous ordicoty Monochoria, Panicum, Paspalum, Phalaris, Phleum, Poa, ledonous weeds or undesired crop plants), to the seed (for Rottboelia, Sagittaria, Scirpus, Setaria, Sorghum. example grains, seeds or vegetative propagules Such as tubers 0037 Dicotyledonous weeds of the genera: Abutilon, or shoot parts with buds) or to the area on which the plants Amaranthus, Ambrosia, Anoda, Anthemis, Aphanes, Artemi grow (for example the area under cultivation) in dicotyledon sia, Atriplex, Bellis, Bidens, Capsella, Carduus, Cassia, Cen ous crops of the genera Arachis, Beta, Brassica, Cucumis, taurea, Chenopodium, Cirsium, Convolvulus, Datura, Des Cucurbita, Helianthus, Daucus, Glycine, Gossypium, Ipo modium, Emex, Erysimum, Euphorbia, Galeopsis, moea, Lactuca, Linum, Lycopersicon, Nicotiana, Phaseolus, Galinsoga, Galium, Hibiscus, Ipomoea, Kochia, Lamium, Pisum, Solanum, Vicia, or monocotyledonous crops of the Lepidium, Lindernia, Matricaria, Mentha, Mercurialis, Mul genera Allium, Ananas, Asparagus, Avena, Hordeum, Oryza, lugo, Myosotis, Papaver; Pharbitis, Plantago, Polygonum, Panicum, Saccharum, Secale, Sorghum, Triticale, Triticum, Portulaca, Ranunculus, Raphanus, Rorippa, Rotala, Rumex, Zea, in particular Zea and Triticum. Salsola, Senecio, Sesbania, Sida, Sinapis, Solanum, Sonchus, 0040. It is preferred to use the N-(1,2,5-oxadiazol-3-yl) Sphenoclea, Stellaria, Taraxacum, Thlaspi, Trifolium, benzamides whose phenyl ring is substituted in the 2-, 3- and Urtica, Veronica, Viola, Xanthium. 4-position by selected radicals as defined above or their salts 0038 Trangenic crop plants of economically important in economically important transgenic crops of useful plants crops to which the N-(1,2,5-oxadiazol-3-yl)benzamides and ornamentals, for example of cereals such as wheat, bar whose phenyl ring is Substituted in the 2-, 3- and 4-position as ley, rye, oats, Sorghum/millet, rice, cassava and maize or else defined above might be applied are, for example dicotyledon crops of Sugar beet, Sugarcane, cotton, soybean, oilseed rape, ous crops of the genera Arachis, Beta, Brassica, Cucumis, potato, tomato, peas and other vegetables, which crops con Cucurbita, Helianthus, Daucus, Glycine, Gossypium, Ipo tain one or more chimeric gene(s) (I) comprising a DNA moea, Lactuca, Linum, Lycopersicon, Nicotiana, Phaseolus, sequence encoding hydroxyphenylpyruvate dioxygenase Pisum, Solanum, Vicia, or monocotyledonous crops of the (HPPD) derived from a member of a group of organisms genera Allium, Ananas, Asparagus, Avena, Hordeum, Oryza, consisting of (a) Avena, preferably Avena sativa, more pref Panicum, Saccharum, Secale, Sorghum, Triticale, Triticum, erably comprising a DNA sequence identical to SEQID No. Zea, in particular Zea and Triticum. 1 encoding HPPD defined by SEQID No. 2, (b) Pseudomo 0039. This is why the present invention preferably relates nas, preferably Pseudomonas fluorescens, more preferably to the method for controlling unwanted plants, in areas of comprising a DNA sequence identical to SEQ ID No. 3 transgenic crop plants being tolerant to HPPD inhibitor her encoding HPPD defined by SEQID No. 4, (c) Synechococ bicides by containing one or more chimeric gene(s) (I) com coideae, preferably Synechococcus sp., more preferably com prising a DNA sequence encoding hydroxyphenylpyruvate prising a DNA sequence identical to SEQID No. 6, encoding dioxygenase (HPPD) derived from a member of a group of HPPD defined by SEQID No. 7, (d) Blepharismidae, prefer organisms consisting of (a) Avena, preferably Avena sativa, ably Blepharisma japonicum, more preferably comprising a more preferably comprising a DNA sequence identical to DNA sequence identical to SEQ ID No. 8 encoding HPPD SEQID No. 1 encoding HPPD defined by SEQID No. 2, (b) defined by SEQ ID No. 9, (e) Rhodococcus, preferably Pseudomonas, preferably Pseudomonas fluorescens, more Rhodococcus sp. (strain RHA1), isolate ro03.04.1 more pref preferably comprising a DNA sequence identical to SEQID erably comprising a DNA sequence identical to SEQID No. No. 3 encoding HPPD defined by SEQ ID No. 4, (c) Syn 10 encoding HPPD defined by SEQID No. 11 or Rhodococ echococcoideae, preferably Synechococcus sp., more prefer cus sp. (strain RHA1), isolate ro02040, more preferably com ably comprising a DNA sequence identical to SEQID No. 6, prising a DNA sequence identical to SEQID No. 12 encoding encoding HPPD defined by SEQID No. 7, (d) Blepharismi HPPD defined by SEQID No. 13, (f) Picrophilaceae, prefer dae, preferably Blepharisma japonicum, more preferably ably Picrophilus torridus, more preferably comprising a comprising a DNA sequence identical to SEQ ID No. 8 DNA sequence identical to SEQID No. 14 encoding HPPD encoding HPPD defined by SEQID No. 9, (e) Rhodococcus, defined by SEQ ID No. 15, (g) Kordia, preferably Kordia preferably Rhodococcus sp. (strain RHA1), isolate ro03.041 algicida, more preferably comprising a DNA sequence iden more preferably comprising a DNA sequence identical to tical to SEQ ID No. 16 encoding HPPD defined by SEQ ID SEQID No. 10 encoding HPPD defined by SEQID No. 11, or No. 17, or (II) comprising one or more mutated DNA Rhodococcus sp. (strain RHA1), isolate ro02040, more pref sequences of HPPD encoding genes of the before defined US 2014/0066307 A1 Mar. 6, 2014 60 organisms, preferably mutants as described in WO 2010/ different herbicides so that growers could tailor the choice of 085705, U.S. Pat. No. 6,245,968, WO 2009/144079, PCT/ herbicides for a particular situation. EP2010/070561, PCT/EP2010/070567, PCT/EP2010/ 0043. While a number of herbicide-tolerant crop plants are 07.0578, PCT/EP2010/070570, or PCT/EP2010/070575 presently commercially available, one issue that has arisen for many commercial herbicides and herbicide/crop combi 0041. The invention also relates to the use, in a method for nations is that individual herbicides typically have incom transforming plants, of a nucleic acid which encodes an plete spectrum of activity against commonweed species. For HPPD as a marker gene or as a coding sequence which makes most individual herbicides which have been in use for some it possible to confer to the plant tolerance to herbicides which time, populations of herbicide resistant weed species and are HPPD inhibitors, and the use of N-(1,2,5-oxadiazol-3-yl) biotypes have become more prevalent (see, e.g., Tranel and benzamides whose phenyl ring is substituted in the 2-, 3- and Wright (2002) Weed Science 50: 700-712: Owen and Zelaya 4-position by selected radicals as defined above or their salts (2005) Pest Manag. Sci. 61: 301–311). Transgenic plants on plants containing one or more chimeric gene(s) (I) com which are resistant to more than one herbicide have been prising a DNA sequence encoding hydroxyphenylpyruvate described (see, e.g., WO2005/012515). However, improve dioxygenase (HPPD) derived from a member of a group of ments in every aspect of crop production, weed control organisms consisting of (a) Avena, preferably Avena sativa, options, extension of residual weed control, and improvement more preferably comprising a DNA sequence identical to in crop yield are continuously in demand. SEQID No. 1 encoding HPPD defined by SEQID No. 2, (b) Pseudomonas, preferably Pseudomonas fluorescens, more 0044) The above defined chimeric gene(s) encoding one or preferably comprising a DNA sequence identical to SEQID more HPPD protein(s) or mutants thereof being functional in No. 3 encoding HPPD defined by SEQ ID No. 4, (c) Syn transgenic plants in order to perform tolerance to HPPD echococcoideae, preferably Synechococcus sp., more prefer inhibitor herbicides belonging to the class of N-(1,2,5-oxa ably comprising a DNA sequence identical to SEQID No. 6, diazol-3-yl)benzamides whose phenyl ring is substituted in encoding HPPD defined by SEQID No. 7, (d) Blepharismi the 2-, 3- and 4-position by selected radicals as defined above dae, preferably Blepharisma japonicum, more preferably or their salts is/are advantageously combined in plants with comprising a DNA sequence identical to SEQ ID No. 8 other genes which encode proteins or RNAs that confer useful encoding HPPD defined by SEQID No. 9, (e) Rhodococcus, agronomic properties to such plants. Among the genes which preferably Rhodococcus sp. (strain RHA1), isolate ro03.041 encode proteins or RNAS that confer useful agronomic prop more preferably comprising a DNA sequence identical to erties on the transformed plants, mention can be made of the SEQID No. 10 encoding HPPD defined by SEQID No. 11 or DNA sequences encoding proteins which confer tolerance to Rhodococcus sp. (strain RHA1), isolate ro02040, more pref one or more herbicides that, according to their chemical struc erably comprising a DNA sequence identical to SEQID No. ture, differ from HPPD inhibitor herbicides, and others which 12 encoding HPPD defined by SEQ ID No. 13, (f) Picro confer tolerance to certain insects, those which confer toler philaceae, preferably Picrophilus torridus, more preferably ance to certain diseases and or biotic and abiotic stresses, comprising a DNA sequence identical to SEQ ID No. 14 DNAs that encodes RNAs that provide nematode or insect encoding HPPD defined by SEQ ID No. 15, (g) Kordia, control, etc. preferably Kordia algicida, more preferably comprising a 0045. Such genes are in particular described in published DNA sequence identical to SEQID No. 16 encoding HPPD PCT Patent Applications WO 91/02071 and WO95/06128. defined by SEQ ID No. 17, or (II) comprising one or more 0046 Among the DNA sequences encoding proteins mutated DNA sequences of HPPD encoding genes of the which confer tolerance to certain herbicides on the trans before defined organisms, preferably mutants as described in formed plant cells and plants, mention can be made of a bar or WO 2010/085705, U.S. Pat. No. 6,245,968, WO 2009/ PAT gene or the Streptomyces coelicolor gene described in 144079, PCT/EP2010/070561, PCT/EP2010/070567, PCT/ WO2009/152359 which confers tolerance to glufosinate her EP2010/070578, PCT/EP2010/070570, or PCT/EP2010/ bicides, a gene encoding a suitable EPSPS which confers O70575. tolerance to herbicides having EPSPS as a target, such as 0042. In the commercial production of crops, it is desir glyphosate and its salts (U.S. Pat. No. 4,535,060, U.S. Pat. able to eliminate under reliable pesticidial management No. 4,769,061, U.S. Pat. No. 5,094,945, U.S. Pat. No. 4,940, unwanted plants (i.e., “weeds') from a field of crop plants. An 835, U.S. Pat. No. 5,188,642, U.S. Pat. No. 4,971,908, U.S. ideal treatment would be one which could be applied to an Pat. No. 5,145,783, U.S. Pat. No. 5,310,667, U.S. Pat. No. entire field but which would eliminate only the unwanted 5,312.910, U.S. Pat. No. 5,627,061, U.S. Pat. No. 5,633,435), plants while leaving the crop plants unaffected. One Such or a gene encoding glyphosate oxydoreductase (U.S. Pat. No. treatment system would involve the use of crop plants which 5,463,175). are tolerant to an herbicide so that when the herbicide is 0047 Among the DNA sequences encoding a suitable sprayed on a field of herbicide-tolerant crop plants, the crop EPSPS which confer tolerance to the herbicides which have plants would continue to thrive while non-herbicide-tolerant EPSPS as a target, mention will more particularly be made of weeds are killed or severely damaged. Ideally, Such treatment the gene which encodes a plant EPSPS, in particular maize systems would take advantage of varying herbicide properties EPSPS, particularly a maize EPSPS which comprises two so that weed control could provide the best possible combi mutations, particularly a mutation at amino acid position 102 nation of flexibility and economy. For example, individual and a mutation at amino acid position 106 (WO 2004/ herbicides have different longevities in the field, and some 074443), and which is described in U.S. Pat. No. 6,566,587, herbicides persist and are effective for a relatively long time hereinafter named double mutant maize EPSPS or 2mEPSPS, after they are applied to a field while other herbicides are or the gene which encodes an EPSPS isolated from Agrobac quickly broken down into other and/or non-active com terium and which is described by SEQID No. 2 and SEQ ID pounds. An ideal treatment system would allow the use of No. 3 of U.S. Pat. No. 5,633,435, also named CP4. US 2014/0066307 A1 Mar. 6, 2014

0048. Among the DNA sequences encoding a suitable HPPD defined by SEQID No. 11, or Rhodococcus sp. (strain EPSPS which confer tolerance to the herbicides which have RHA1), isolate ro02040, more preferably comprising a DNA EPSPS as a target, mention will more particularly be made of sequence identical to SEQID No. 12 encoding HPPD defined the gene which encodes an EPSPSGRG23 from Arthrobacter by SEQID No. 13, (f) Picrophilaceae, preferably Picrophilus globiformis, but also the mutants GRG23 ACE1, GRG23 torridus, more preferably comprising a DNA sequence iden ACE2, or GRG23 ACE3, particularly the mutants or variants tical to SEQ ID No. 14 encoding HPPD defined by SEQ ID of GRG23 as described in WO2008/100353, such as GRG23 No. 15, (g) Kordia, preferably Kordia algicida, more prefer (ace3)R173K of SEQID No. 29 in WO2008/100353. ably comprising a DNA sequence identical to SEQID No. 16 0049. In the case of the DNA sequences encoding EPSPS, encoding HPPD defined by SEQID No. 17 or (II) comprising and more particularly encoding the above genes, the sequence one or more mutated DNA sequences of HPPD encoding encoding these enzymes is advantageously preceded by a genes of the before defined organisms, preferably mutants as sequence encoding a transit peptide, in particular the “opti described in WO 2010/085705, U.S. Pat. No. 6,245,968, WO mized transit peptide' described in U.S. Pat. No. 5,510,471 or 2009/144079, PCT/EP2010/070561, PCT/EP2010/070567, 5,633,448. PCT/EP2010/070578, PCT/EP2010/070570, or PCT/ 0050. In WO 2007/024782, plants being tolerant to gly EP2010/070575. phosate and at least one ALS (acetolactate synthase) inhibitor 0056 Among the DNA sequences encoding proteins con are disclosed. More specifically plants containing genes cerning properties of tolerance to insects, mention will more encoding a GAT (Glyphosate-N-Acetyltransferase) polypep particularly be made of the Bt proteins widely described in the tide and a polypeptide conferring resistance to ALS inhibitors literature and well known to those skilled in the art. Mention are disclosed. will also be made of proteins extracted from bacteria such as 0051. In U.S. Pat. No. 6,855,533, transgenic tobacco Photorhabdus (WO 97/17432 & WO 98/08932). plants containing mutated Arabidopsis ALS/AHAS genes 0057. Among such DNA sequences encoding proteins of were disclosed. interest which confer novel properties of tolerance to insects, 0052. In U.S. Pat. No. 6,153,401, plants containing genes mention will more particularly be made of the Bt Cry or VIP encoding 2,4-D-monooxygenases conferring tolerance to proteins widely described in the literature and well known to 2,4-D (2,4-dichlorophenoxyacetic acid) by metabolisation those skilled in the art. These include the Cry 1F protein or are disclosed. hybrids derived from a Cry1F protein (e.g., the hybrid Cry1A 0053. In US 2008/01 19361 and US 2008/0120739, plants Cry1F proteins described in U.S. Pat. No. 6,326,169; U.S. containing genes encoding Dicamba monooxygenases con Pat. No. 6,281,016; U.S. Pat. No. 6,218,188, or toxic frag ferring tolerance to dicamba (3,6-dichloro-2-methoxyben ments thereof), the Cry1A-type proteins or toxic fragments Zoic acid) by metabolisation are disclosed. thereof, preferably the Cry1Ac protein or hybrids derived 0054. In WO2011/028833 and WO2011/028832 plants from the Cry1Ac protein (e.g., the hybrid Cry1Ab-Cry1Ac containing genes encoding mutagenized or recombinant protein described in U.S. Pat. No. 5,880,275) or the Cry1Ab Acetyl-coenzyme-A carboylase (ACCase) conferring toler or Bt2 protein or insecticidal fragments thereofas described ance to at least one herbicide is selected from the group in EP451878, the Cry2Ae, Cry2Afor Cry2Ag proteins as consisting of alloxydim, butroxydim, clethodim, cloproxy described in WO02/057664 or toxic fragments thereof, the dim, cycloxydim, Sethoxydim, tepraloxydim, tralkoxydim, Cry1A.105 protein described in WO 2007/140256 (SEQ ID chlorazifop, clodinafop, clofop, diclofop, fenoxaprop, fenox No. 7) or a toxic fragment thereof, the VIP3Aa19 protein of aprop-P, fenthiaprop, fluazifop, fluazifop-P haloxyfop, NCBI accession ABG20428, the VIP3Aa20 protein of NCBI haloxyfop-P, isoxapyrifop, propaquizafop, quizalofop, accession ABG20429 (SEQID No. 2 in WO 2007/142840), quizalofop-P trifop, and pinoxaden or agronomically accept the VIP3A proteins produced in the COT202 or COT203 able salts or esters of any of these herbicides are disclosed. cotton events (WO 2005/054479 and WO 2005/054480, 0055 All the above mentioned herbicide tolerance traits respectively), the Cry proteins as described in WOO1/47952, can be combined with those performing HPPD tolerance in the VIP3Aa protein oratoxic fragment thereofas described in plants concerning N-(1,2,5-oxadiazol-3-yl)benzamides Estruch et al. (1996), Proc Natl AcadSci U S A. 28: 93(11): whose phenyl ring is Substituted in the 2-, 3- and 4-position by 5389-94 and U.S. Pat. No. 6.291,156, the insecticidal proteins selected radicals as defined above or their salts by containing from Xenorhabdus (as described in WO98/50427), Serratia one or more chimeric gene(s) (I) comprising a DNA sequence (particularly from S. entomophila) or Photorhabdus species encoding hydroxyphenylpyruvate dioxygenase (HPPD) strains, such as Tc-proteins from Photorhabdus as described derived from a member of a group of organisms, consisting of in WO98/08932 (e.g., Waterfield et al., 2001, Appl Environ (a) Avena, preferably Avena sativa, more preferably compris Microbiol. 67(11):5017-24; Ffrench-Constant and Bowen, ing a DNA sequence identical to SEQ ID No. 1 encoding 2000, Cell Mol Life Sci.; 57(5):828-33). Also any variants or HPPD defined by SEQ ID No. 2, (b) Pseudomonas, prefer mutants of any one of these proteins differing in some (1-10, ably Pseudomonas fluorescens, more preferably comprising a preferably 1-5) amino acids from any of the above sequences, DNA sequence identical to SEQ ID No. 3 encoding HPPD particularly the sequence of their toxic fragment, or which are defined by SEQID No. 4, (c) Synechococcoideae, preferably fused to a transit peptide. Such as a plastid transit peptide, or Synechococcus sp., more preferably comprising a DNA another protein or peptide, is included herein. sequence identical to SEQID No. 6, encoding HPPD defined 0058. The present invention also relates to the use of N-(1, by SEQ ID No. 7, (d) Blepharismidae, preferably Blepha 2,5-oxadiazol-3-yl)benzamides whose phenyl ring is Substi risma japonicum, more preferably comprising a DNA tuted in the 2-, 3- and 4-position by selected radicals as sequence identical to SEQID No. 8 encoding HPPD defined defined above or their salts in transgenic plants comprising a by SEQID No. 9, (e) Rhodococcus, preferably Rhodococcus chimeric gene (or expression cassette) which comprises a sp. (strain RHA1), isolate ro03.04.1 more preferably compris coding sequence as well as heterologous regulatory elements, ing a DNA sequence identical to SEQ ID No. 10 encoding at the 5' and/or 3' position, at least at the 5' position, which are US 2014/0066307 A1 Mar. 6, 2014 62 able to function in a host organism, in particular plant cells or DNA sequence identical to SEQID No. 16 encoding HPPD plants, with the coding sequence containing at least one defined by SEQ ID No. 17, or (II) encoded by a mutated nucleic acid sequence which encodes an HPPD (I) derived nucleic acid sequence of HPPD encoding genes of the before from a member of a group of organisms, consisting of (a) defined organisms, preferably mutants as described in WO Avena, preferably Avena sativa, more preferably comprising 2010/085705, U.S. Pat. No. 6,245,968, WO 2009/144079, a DNA sequence identical to SEQID No. 1 encoding HPPD PCT/EP2010/070561, PCT/EP2010/070567, PCT/EP2010/ defined by SEQ ID No. 2, (b) Pseudomonas, preferably 070578, PCT/EP2010/070570, or PCT/EP2010/070575, a Pseudomonas fluorescens, more preferably comprising a nucleic acid sequence which encodes a plant transit peptide, DNA sequence identical to SEQ ID No. 3 encoding HPPD with this sequence being arranged between the promoter defined by SEQID No. 4, (c) region and the nucleic acid sequence encoding hydroxyphe 0059. Synechococcoideae, preferably Synechococcus sp., nylpyruvate dioxygenase (HPPD) (I) derived from a member more preferably comprising a DNA sequence identical to of a group of organisms, consisting of (a) Avena, preferably SEQID No. 6, encoding HPPD defined by SEQID No. 7, (d) Avena sativa, more preferably comprising a DNA sequence Blepharismidae, preferably Blepharisma japonicum, more identical to SEQID No. 1 encoding HPPD defined by SEQID preferably comprising a DNA sequence identical to SEQID No. 2, (b) Pseudomonas, preferably Pseudomonas fluore No. 8 encoding HPPD defined by SEQID No. 9, (e) Rhodo scens, more preferably comprising a DNA sequence identical coccus, preferably Rhodococcus sp. (strain RHA1), isolate to SEQID No. 3 encoding HPPD defined by SEQID No. 4, ro03.04.1 more preferably comprising a DNA sequence iden (c) Synechococcoideae, preferably Synechococcus sp., more tical to SEQID No. 10 encoding HPPD defined by SEQ ID preferably comprising a DNA sequence identical to SEQID No. 11, or Rhodococcus sp. (strain RHA1), isolate ro02040, No. 6, encoding HPPD defined by SEQ ID No. 7, (d) Ble more preferably comprising a DNA sequence identical to pharismidae, preferably Blepharisma japonicum, more pref SEQID No.12 encoding HPPD defined by SEQID No. 13, (f) erably comprising a DNA sequence identical to SEQID No. Picrophilaceae, preferably Picrophilus torridus, more prefer 8 encoding HPPD defined by SEQID No. 9, (e) Rhodococ ably comprising a DNA sequence identical to SEQID No. 14 cus, preferably Rhodococcus sp. (strain RHA1), isolate encoding HPPD defined by SEQ ID No. 15, (g) Kordia, ro03.04.1 more preferably comprising a DNA sequence iden preferably Kordia algicida, more preferably comprising a tical to SEQ ID No. 10 encoding HPPD defined by SEQ ID DNA sequence identical to SEQID No. 16 encoding HPPD No. 11 or Rhodococcus sp. (strain RHA1), isolate ro02040, defined by SEQID No. 17, or (II) represents HPPD encoded more preferably comprising a DNA sequence identical to by a mutated nucleic acid sequence of HPPD encoding genes SEQID No. 12 encoding HPPD defined by SEQID No. 13, (f) of the before defined organisms, preferably mutants as Picrophilaceae, preferably Picrophilus torridus, more prefer described in WO 2010/085705, U.S. Pat. No. 6,245,968, WO ably comprising a DNA sequence identical to SEQID No. 14 2009/144079, PCT/EP2010/070561, PCT/EP2010/070567, encoding HPPD defined by SEQ ID No. 15, (g) Kordia, PCT/EP2010/070578, PCT/EP2010/070570, or PCT/ preferably Kordia algicida, more preferably comprising a EP2010/070575. DNA sequence identical to SEQID No. 16 encoding HPPD 0060. In another particular embodiment, the present defined by SEQ ID No. 17 or (II) encoded by a mutated invention relates to the use of N-(1,2,5-oxadiazol-3-yl)ben nucleic acid sequence of HPPD encoding genes of the before Zamides whose phenyl ring is substituted in the 2-, 3- and defined organisms, preferably mutants as described in WO 4-position by selected radicals as defined above or their salts 2010/085705, U.S. Pat. No. 6,245,968, WO 2009/144079, in transgenic plant comprising a chimeric gene as previously PCT/EP2010/070561, PCT/EP2010/070567, PCT/EP2010/ described, wherein the chimeric gene contains in the 5' posi 070578, PCT/EP2010/070570, or PCT/EP2010/070575, so tion of the nucleic acid sequence encoding hydroxyphe as to permit expression of a transit peptide/HPPD fusion nylpyruvate dioxygenase (HPPD) (I) derived from a member protein. of a group of organisms, consisting of (a) Avena, preferably 0061. In a further particular embodiment, the present Avena sativa, more preferably comprising a DNA sequence invention relates to the use of N-(1,2,5-oxadiazol-3-yl)ben identical to SEQID No. 1 encoding HPPD defined by SEQID Zamides whose phenyl ring is substituted in the 2-, 3- and No. 2, (b) Pseudomonas, preferably Pseudomonas fluore 4-position by selected radicals as defined above or their salts scens, more preferably comprising a DNA sequence identical on plants, plant parts, or plant seeds containing one or more to SEQID No. 3 encoding HPPD defined by SEQID No. 4, chimeric gene(s) (I) comprising a DNA sequence encoding (c) Synechococcoideae, preferably Synechococcus sp., more hydroxyphenylpyruvate dioxygenase (HPPD) derived from a preferably comprising a DNA sequence identical to SEQID member of a group of organisms consisting of (a) Avena, No. 6, encoding HPPD defined by SEQ ID No. 7, (d) Ble preferably Avena sativa, more preferably comprising a DNA pharismidae, preferably Blepharisma japonicum, more pref sequence identical to SEQID No. 1 encoding HPPD defined erably comprising a DNA sequence identical to SEQID No. by SEQID No. 2, (b) Pseudomonas, preferably Pseudomonas 8 encoding HPPD defined by SEQID No. 9, (e) Rhodococ fluorescens, more preferably comprising a DNA sequence cus, preferably Rhodococcus sp. (strain RHA1), isolate identical to SEQID No. 3 encoding HPPD defined by SEQID ro03.04.1 more preferably comprising a DNA sequence iden No. 4, (c) Synechococcoideae, preferably Synechococcus sp., tical to SEQID No. 10 encoding HPPD defined by SEQ ID more preferably comprising a DNA sequence identical to No. 11, or Rhodococcus sp. (strain RHA1), isolate ro02040, SEQID No. 6, encoding HPPD defined by SEQID No. 7, (d) more preferably comprising a DNA sequence identical to Blepharismidae, preferably Blepharisma japonicum, more SEQID No.12 encoding HPPD defined by SEQID No. 13, (f) preferably comprising a DNA sequence identical to SEQID Picrophilaceae, preferably Picrophilus torridus, more prefer No. 8 encoding HPPD defined by SEQID No. 9, (e) Rhodo ably comprising a DNA sequence identical to SEQID No. 14 coccus, preferably Rhodococcus sp. (strain RHA1), isolate encoding HPPD defined by SEQ ID No. 15, (g) Kordia, ro03.04.1 more preferably comprising a DNA sequence iden preferably Kordia algicida, more preferably comprising a tical to SEQ ID No. 10 encoding HPPD defined by SEQ ID US 2014/0066307 A1 Mar. 6, 2014

No. 11, or Rhodococcus sp. (strain RHA1), isolate ro02040, before defined organisms, preferably mutants as described in more preferably comprising a DNA sequence identical to WO 2010/085705, U.S. Pat. No. 6,245,968, WO 2009/ SEQID No.12 encoding HPPD defined by SEQID No. 13, (f) 144079, PCT/EP2010/070561, PCT/EP2010/070567, PCT/ Picrophilaceae, preferably Picrophilus torridus, more prefer EP2010/070578, PCT/EP2010/070570, or PCT/EP2010/ ably comprising a DNA sequence identical to SEQID No. 14 O70575. encoding HPPD defined by SEQ ID No. 15, (g) Kordia, 0063 As a regulatory sequence which functions as a pro preferably Kordia algicida, more preferably comprising a moter in plant cells and plants, use may be made of any DNA sequence identical to SEQID No. 16 encoding HPPD promoter sequence of a gene which is naturally expressed in defined by SEQ ID No. 17, or (II) comprising one or more plants, in particular a promoter which is expressed especially mutated DNA sequences of HPPD encoding genes of the in the leaves of plants, such as for example “constitutive' before defined organisms, preferably mutants as described in promoters of bacterial, viral or plant origin, or “light-depen WO 2010/085705, U.S. Pat. No. 6,245,968, WO 2009/ dent promoters, such as that of a plantribulose-biscarboxy 144079, PCT/EP2010/070561, PCT/EP2010/070567, PCT/ lase/oxygenase (RuBisCO) Small subunit gene, or any Suit EP2010/070578, PCT/EP2010/070570, or PCT/EP2010/ able known promoter-expressible which may be used. 07.0575, or to the use of N-(1,2,5-oxadiazol-3-yl)benzamides Among the promoters of plant origin, mention will be made whose phenyl ring is Substituted in the 2-, 3- and 4-position by of the histone promoters as described in EP0507698 A1, the selected radicals as defined above or their salts on soil where rice actin promoter (U.S. Pat. No. 5,641,876), or a plant Such plants, plant parts or seeds are to be grown or Sown, ubiquitin promoter (U.S. Pat. No. 5,510.474). Among the either alone or in combination with one or more other known promoters of a plant virus gene, mention will be made of that herbicides acting in a different matter to HPPD inhibitors. of the cauliflower mosaic virus (CaMV 19S or 35S, Sanders 0062. In a further particular embodiment, the N-(1,2,5- etal. (1987), Nucleic Acids Res. 15(4): 1543-58.), the circovi oxadiazol-3-yl)benzamides whose phenyl ring is Substituted rus (AU 689 311) or the Cassava vein mosaic virus (CsVMV. in the 2-, 3- and 4-position by selected radicals as defined U.S. Pat. No. 7,053,205). above or their salts herbicide can applied in combination 0064. In a further particular embodiment, present inven either in mixture, simultaneously or successively with HPPD tion relates to the use of N-(1,2,5-oxadiazol-3-yl)benzamides inhibitor herbicides selected from the group consisting of whose phenyl ring is substituted in the 2-, 3- and 4-position by triketones (named triketone HPPD inhibitor), such as tembot selected radicals as defined above or their salts on plants, rione, Sulcotrione mesotrione, bicyclopyrone, tefuryltrione, plant parts, or plant seeds comprising a promoter sequence particularly tembotrione, of the class diketone such as dike specific for particular regions or tissues of plants can be used tonitrile of the class of isoxazoles such as isoxaflutole or of to express one or more chimeric gene(s) (I) comprising a the class of pyrazolinates (named pyrazolinate HPPD inhibi DNA sequence encoding hydroxyphenylpyruvate dioxyge tor). Such as pyrasulfotole, pyrazolate, toprameZone, ben nase (HPPD) derived from a member of a group of organisms Zofenap, even more specifically present invention relates to consisting of (a) Avena, preferably Avena sativa, more pref the application of tembotrione, mesotrione, diketonitrile, erably comprising a DNA sequence identical to SEQID No. bicyclopyrone, tefuryltrione, benzofenap, pyrasulfotole, 1 encoding HPPD defined by SEQID No. 2, (b) Pseudomo pyrazolate and sulcotrione to such HPPD inhibitor tolerant nas, preferably Pseudomonas fluorescens, more preferably plants, plant parts or plant seeds containing one or more comprising a DNA sequence identical to SEQ ID No. 3 chimeric gene(s) (I) comprising a DNA sequence encoding encoding HPPD defined by SEQID No. 4, (c) Synechococ hydroxyphenylpyruvate dioxygenase (HPPD) derived from a coideae, preferably Synechococcus sp., more preferably com member of a group of organisms consisting of (a) Avena, prising a DNA sequence identical to SEQID No. 6, encoding preferably Avena sativa, more preferably comprising a DNA HPPD defined by SEQID No. 7, (d) Blepharismidae, prefer sequence identical to SEQID No. 1 encoding HPPD defined ably Blepharisma japonicum, more preferably comprising a by SEQID No. 2, (b) Pseudomonas, preferably Pseudomonas DNA sequence identical to SEQ ID No. 8 encoding HPPD fluorescens, more preferably comprising a DNA sequence defined by SEQ ID No. 9, (e) Rhodococcus, preferably identical to SEQID No. 3 encoding HPPD defined by SEQID Rhodococcus sp. (strain RHA1), isolate ro03.04.1 more pref No. 4, (c) Synechococcoideae, preferably Synechococcus sp., erably comprising a DNA sequence identical to SEQID No. more preferably comprising a DNA sequence identical to 10 encoding HPPD defined by SEQID No. 11, or Rhodococ SEQID No. 6, encoding HPPD defined by SEQID No. 7, (d) cus sp. (strain RHA1), isolate ro02040, more preferably com Blepharismidae, preferably Blepharisma japonicum, more prising a DNA sequence identical to SEQID No. 12 encoding preferably comprising a DNA sequence identical to SEQID HPPD defined by SEQID No. 13, (f) Picrophilaceae, prefer No. 8 encoding HPPD defined by SEQID No. 9, (e) Rhodo ably Picrophilus torridus, more preferably comprising a coccus, preferably Rhodococcus sp. (strain RHA1), isolate DNA sequence identical to SEQID No. 14 encoding HPPD ro03.04.1 more preferably comprising a DNA sequence iden defined by SEQ ID No. 15, (g) Kordia, preferably Kordia tical to SEQID No. 10 encoding HPPD defined by SEQ ID algicida, more preferably comprising a DNA sequence iden No. 11, or Rhodococcus sp. (strain RHA1), isolate ro02040, tical to SEQ ID No. 16 encoding HPPD defined by SEQ ID more preferably comprising a DNA sequence identical to No. 17, or (II) comprising one or more mutated DNA SEQID No.12 encoding HPPD defined by SEQID No. 13, (f) sequences of HPPD encoding genes of the before defined Picrophilaceae, preferably Picrophilus torridus, more prefer organisms, preferably mutants as described in WO 2010/ ably comprising a DNA sequence identical to SEQID No. 14 085705, U.S. Pat. No. 6,245,968, WO 2009/144079, PCT/ encoding HPPD defined by SEQ ID No. 15, (g) Kordia, EP2010/070561, PCT/EP2010/070567, PCT/EP2010/ preferably Kordia algicida, more preferably comprising a 070578, PCT/EP2010/070570, or PCT/EP2010/070575, DNA sequence identical to SEQID No. 16 encoding HPPD such as promoters specific for seeds (Datla, R. et al., 1997, defined by SEQ ID No. 17, or (II) comprising one or more Biotechnology Ann. Rev. 3, 269-296), especially the napin mutated DNA sequences of HPPD encoding genes of the promoter (EP 255 378 A1), the phaseolin promoter, the glu US 2014/0066307 A1 Mar. 6, 2014 64 tenin promoter, the helianthinin promoter (WO 92/17580), preferably Avena sativa, more preferably comprising a DNA the albumin promoter (WO 98/45460), the oleosin promoter sequence identical to SEQID No. 1 encoding HPPD defined (WO 98/45461), the SAT1 promoter or the SAT3 promoter by SEQID No. 2, (b) Pseudomonas, preferably Pseudomonas (PCT/US98/06978). fluorescens, more preferably comprising a DNA sequence 0065. Use may also be made of an inducible promoter identical to SEQID No. 3 encoding HPPD defined by SEQID advantageously chosen from the phenylalanine ammonia No. 4, (c) Synechococcoideae, preferably Synechococcus sp., lyase (PAL), HMG-CoA reductase (HMG), chitinase, gluca more preferably comprising a DNA sequence identical to nase, proteinase inhibitor (PI), PR1 family gene, nopaline SEQID No. 6, encoding HPPD defined by SEQID No. 7, (d) synthase (nos) and vspl3 promoters (U.S. Pat. No. 5,670,349. Blepharismidae, preferably Blepharisma japonicum, more Table 3), the HMG2 promoter (U.S. Pat. No. 5,670,349), the preferably comprising a DNA sequence identical to SEQID apple beta-galactosidase (ABG1) promoter and the apple No. 8 encoding HPPD defined by SEQID No. 9, (e) Rhodo aminocyclopropane carboxylate synthase (ACC synthase) coccus, preferably Rhodococcus sp. (strain RHA1), isolate promoter (WO 98/45445). ro03.04.1 more preferably comprising a DNA sequence iden 0066. The genes encoding hydroxyphenylpyruvate dioxy tical to SEQ ID No. 10 encoding HPPD defined by SEQ ID genase (HPPD) (I) derived from a member of a group of No. 11, or Rhodococcus sp. (strain RHA1), isolate ro02040, organisms, consisting of (a) Avena, preferably Avena sativa, more preferably comprising a DNA sequence identical to more preferably comprising a DNA sequence identical to SEQID No.12 encoding HPPD defined by SEQID No. 13, (f) SEQID No. 1 encoding HPPD defined by SEQID No. 2, (b) Picrophilaceae, preferably Picrophilus torridus, more prefer Pseudomonas, preferably Pseudomonas fluorescens, more ably comprising a DNA sequence identical to SEQID No. 14 preferably comprising a DNA sequence identical to SEQID encoding HPPD defined by SEQ ID No. 15, (g) Kordia, No. 3 encoding HPPD defined by SEQ ID No. 4, (c) Syn preferably Kordia algicida, more preferably comprising a echococcoideae, preferably Synechococcus sp., more prefer DNA sequence identical to SEQID No. 16 encoding HPPD ably comprising a DNA sequence identical to SEQID No. 6, defined by SEQ ID No. 17, or (II) comprising one or more encoding HPPD defined by SEQID No. 7, (d) Blepharismi mutated DNA sequences of HPPD encoding genes of the dae, preferably Blepharisma japonicum, more preferably before defined organisms, preferably mutants as described in comprising a DNA sequence identical to SEQ ID No. 8 WO 2010/085705, U.S. Pat. No. 6,245,968, WO 2009/ encoding HPPD defined by SEQID No. 9, (e) Rhodococcus, 144079, PCT/EP2010/070561, PCT/EP2010/070567, PCT/ preferably Rhodococcus sp. (strain RHA1), isolate ro03.041 EP2010/070578, PCT/EP2010/070570, or PCT/EP2010/ more preferably comprising a DNA sequence identical to 070575 and also containing a CYP450 Maize SEQID No. 10 encoding HPPD defined by SEQID No. 11, or monooxygenase (insfl gene) gene being under the control of Rhodococcus sp. (strain RHA1), isolate ro02040, more pref an identical or different plant expressible promoter in order to erably comprising a DNA sequence identical to SEQ ID confer tolerance to N-(1,2,5-oxadiazol-3-yl)benzamides No.12 encoding HPPD defined by SEQID No. 13, (f) Picro whose phenyl ring is substituted in the 2-, 3- and 4-position by philaceae, preferably Picrophilus torridus, more preferably selected radicals as defined above or their salts. comprising a DNA sequence identical to SEQ ID No. 14 0068. As a regulatory terminator or polyadenylation encoding HPPD defined by SEQ ID No. 15, (g) Kordia, sequence, use may be made of any corresponding sequence of preferably Kordia algicida, more preferably comprising a bacterial origin, such as for example the nos terminator of DNA sequence identical to SEQID No. 16 encoding HPPD Agrobacterium tumefaciens, of viral origin, Such as for defined by SEQ ID No. 17 or (II) represented by a mutated example the CaMVS terminator, or of plant origin, such as DNA sequence of HPPD encoding genes of the before for example a histone terminator as described in published defined organisms, preferably represented by mutants as Patent Application EP 0 633317 A1. described in WO 2010/085705, U.S. Pat. No. 6,245,968, WO 0069. It is to be understood that in order to obtain an 2009/144079, PCT/EP2010/070561, PCT/EP2010/070567, optimized expression by a host adapted codon usage of the PCT/EP2010/070578, PCT/EP2010/070570, or PCT/ respective chimeric gene(s), one could adopt non-planta EP2010/070575 may also be used in combination with the genes to the codon usage of the respective plant organism in promoter, of other regulatory sequences, which are located which Such chimeric genes will be inserted. Accordingly, in between the promoter and the coding sequence, Such as tran all of the described chimeric genes expressing HPPD of non Scription activators ("enhancers'), for instance the translation planta origin, the respective HPPD encoding DNA sequence activator of the tobacco mosaic virus (TMV) described in can be replaced by an amended DNA sequence encoding the Application WO87/07644, or of the tobacco etch virus (TEV) identical amino acid sequence, i.e. SEQ ID No. 3 can be described by Carrington & Freed 1990, J. Virol. 64: 1590 replaced by SEQID No. 5., SEQID No. 6 can be replaced by 1597, for example, or introns such as the adh1 intron of maize SEQID No. 18, SEQID No. 8 can be replaced by SEQID No. or intron 1 of rice actin in order to perform a sufficient toler 19, SEQID No. 10 can be replaced by SEQID No. 20, SEQ ance to N-(1,2,5-oxadiazol-3-yl)benzamides whose phenyl ID No. 12 can be replaced by SEQID No. 21, SEQID No. 14 ring is Substituted in the 2-, 3- and 4-position by selected can be replaced by SEQ ID No. 22, SEQ ID No. 16 can be radicals as defined above or their salts. replace by SEQID No.23. 0067. In a further particular embodiment, the present (0070. The term “gene”, as used herein refers to a DNA invention relates to the use of N-(1,2,5-oxadiazol-3-yl)ben coding region flanked by 5' and/or 3' regulatory sequences Zamides whose phenyl ring is substituted in the 2-, 3- and allowing a RNA to be transcribed which can be translated to 4-position by selected radicals as defined above or their salts a protein, typically comprising at least a promoter region. A on plants, plant parts, or plant seeds containing one or more "chimeric gene', when referring to an HPPD encoding DNA, chimeric gene(s) (I) comprising a DNA sequence encoding refers to an HPPD encoding DNA sequence having 5' and/or hydroxyphenylpyruvate dioxygenase (HPPD) derived from a 3' regulatory sequences different from the naturally occurring member of a group of organisms consisting of (a) Avena, bacterial 5' and/or 3' regulatory sequences which drive the US 2014/0066307 A1 Mar. 6, 2014

expression of the HPPD protein in its native host cell (also acid substitutions, additions or deletions thereto. Preferably referred to as "heterologous promoter' or "heterologous the variant amino acid sequence has a sequence identity of at regulatory sequences”). least about 80%, or 85 or 90%, 95%, 97%, 98% or 99% with 0071. The terms “DNA/protein comprising the sequence the amino acid sequence of SEQID No. 2, SEQ ID No. 4, X and “DNA/protein with the sequence comprising SEQID No. 7, SEQID No. 9, SEQID No. 11, SEQID No. 13, sequence X', as used herein, refer to a DNA or protein includ SEQ ID No. 15, and SEQ ID No. 17, respectively. Also ing or containing at least the sequence X in their nucleotide or preferably, a polypeptide comprising the variant amino acid amino acid sequence, so that other nucleotide or amino acid sequence has HPPD enzymatic activity. Methods to deter sequences can be included at the 5' (or N-terminal) and/or 3' mine HPPD enzymatic activity are well known in the art and (or C-terminal) end, e.g., a N-terminal transit or signal pep include assays as extensively described in WO 2009/144079 tide. The term "comprising, as used herein, is open-ended or in WO 2002/046387, or in PCT/EP2010/070561. language in the meaning of “including, meaning that other 0074. Substitutions encompass amino acid alterations in elements then those specifically recited can also be present. which an amino acid is replaced with a different naturally The term “consisting of, as used herein, is closed-ended occurring or a non-conventional amino acid residue. Such language, i.e., only those elements specifically recited are substitutions may be classified as “conservative', in which an present. The term “DNA encoding a protein comprising amino acid residue contained in an HPPD protein of this sequence X', as used herein, refers to a DNA comprising a invention is replaced with another naturally-occurring amino coding sequence which after transcription and translation acid of similar character, for example Glye ) Ala, Vale Ile results in a protein containing at least amino acid sequence X. (-) Leu, Asp(-) Glu, Lyse Arg, ASne Gln or Phee Trp A DNA encoding a protein need not be a naturally occurring () Tyr. Substitutions encompassed by the present invention DNA, and can be a semi-synthetic, fully synthetic or artificial may also be “non-conservative', in which an amino acid DNA and can include introns and 5' and/or 3' flanking regions. residue which is present in an HPPD protein of the invention The term “nucleotide sequence', as used herein, refers to the is substituted with an amino acid with different properties, sequence of a DNA or RNA molecule, which can be in single Such as a naturally-occurring amino acid from a different or double-stranded form. group (e.g. Substituting a charged or hydrophobic amino acid 0072 HPPD proteins according to the invention may be with alanine. Amino acid Substitutions are typically of single equipped with a signal peptide according to procedures residues, but may be of multiple residues, either clustered or known in the art, see, e.g., published PCT patent application dispersed. Amino acid deletions will usually be of the order of WO 96/10083, or they can be replaced by another peptide about 1-10 amino acid residues, while insertions may be of Such as a chloroplast transit peptide (e.g., Van Den Broecket any length. Deletions and insertions may be made to the al., 1985, Nature 313, 358, or a modified chloroplast transit N-terminus, the C-terminus or be internal deletions or inser peptide of U.S. Pat. No. 5,510.471) causing transport of the tions. Generally, insertions within the amino acid sequence protein to the chloroplasts, by a secretory signal peptide or a will be Smaller than amino- or carboxy-terminal fusions and peptide targeting the protein to other plastids, mitochondria, of the order of 1 to 4 amino acid residues. “Similar amino the ER, or another organelle, or it can be replaced by a acids, as used herein, refers to amino acids that have similar methionine amino acid or by a methionine-alanine dipeptide. amino acid side chains, i.e. amino acids that have polar, Signal sequences for targeting to intracellular organelles or non-polar or practically neutral side chains. "Non-similar for secretion outside the plant cell or to the cell wall are found amino acids, as used herein, refers to amino acids that have in naturally targeted or secreted proteins, preferably those different amino acid side chains, for example an amino acid described by Klosgen et al. (1989, Mol. Gen. Genet. 217, with a polar side chain is non-similar to an amino acid with a 155-161), Klosgen and Weil (1991, Mol. Gen. Genet. 225, non-polar side chain. Polar side chains usually tend to be 297-304), Neuhaus & Rogers (1998, Plant Mol. Biol. 38, present on the Surface of a protein where they can interact 127-144), Bihetal. (1999, J. Biol. Chem. 274,22884-22894), with the aqueous environment found in cells (“hydrophilic' Morris et al. (1999, Biochem. Biophys. Res. Commun. 255, amino acids). On the other hand, “non-polar amino acids 328-333), Hesse et al. (1989, EMBO J. 82453-2461), Tavla tend to reside within the center of the protein where they can doraki et al. (1998, FEBS Lett. 426, 62-66), Terashima et al. interact with similar non-polar neighbours (“hydrophobic' (1999, Appl. Microbiol. Biotechnol. 52,516-523), Parket al. amino acids'). Examples of amino acids that have polar side (1997, J. Biol. Chem. 272, 6876-6881), Shcherban et al. chains are arginine, asparagine, aspartate, cysteine, (1995, Proc. Natl. Acad. Sci. USA 92, 9245-9249), all of glutamine, glutamate, histidine, lysine, serine, and threonine which are incorporated herein by reference, particularly the (all hydrophilic, except for cysteine which is hydrophobic). signal peptide sequences from targeted or secreted proteins of Examples of amino acids that have non-polar side chains are corn, cotton, Soybean, or rice. A DNA sequence encoding alanine, glycine, isoleucine, leucine, methionine, phenylala Such a plant signal peptide can be inserted in the chimeric nine, proline, and tryptophan (all hydrophobic, except for gene encoding the HPPD protein for expression in plants. glycine which is neutral). 0073. The invention also encompasses variant HPPD 0075. Unless otherwise stated in the examples, all proce enzymes which are amino acid sequences similar to the dures for making and manipulating recombinant DNA are HPPD amino acid sequence of SEQID No. 2, SEQID No. ID carried out by the standard procedures described in Sambrook No. 4, SEQID No. 7, SEQID No. 9, SEQID No. 11, SEQID et al., Molecular Cloning A Laboratory Manual, Second No. 13, SEQID No. 15, and SEQID No. 17 wherein in each Ed., Cold Spring Harbor Laboratory Press, NY (1989), and in of the before one or more amino acids have been inserted, Volumes 1 and 2 of Ausubeletal. (1994) Current Protocols in deleted or substituted. In the present context, variants of an Molecular Biology, Current Protocols, USA. Standard mate amino acid sequence refer to those polypeptides, enzymes or rials and methods for plant molecular biology work are proteins which have a similar catalytic activity as the amino described in Plant Molecular Biology Labfax (1993) by R. R. acid sequences described herein, notwithstanding any amino D. Croy, jointly published by BIOS Scientific Publications US 2014/0066307 A1 Mar. 6, 2014 66

Ltd (UK) and Blackwell Scientific Publications (UK). Proce plants comprising one or more foreign or heterologous gene dures for PCR technology can be found in “PCR protocols: a (s) stably inserted in their genome. guide to methods and applications, Edited by M. A. Innis, D. 0080. In order perform tolerance to N-(1,2,5-oxadiazol-3- H. Gelfand, J. J. Sninsky and T. J. White (Academic Press, yl)benzamides whose phenyl ring is substituted in the 2-, 3 Inc., 1990). and 4-position by selected radicals as defined above or their 0076. The terms “tolerance', “tolerant’ or “less sensitive' salts, any promoter sequence of a gene which is expressed are interchangeable used and mean the relative levels of naturally in plants, or any hybrid or combination of promoter inherent tolerance of the HPPD screened according to a vis elements of genes expressed naturally in plants, including ible indicator phenotype of the strain or plant transformed Agrobacterium or plant virus promoters, or any promoter with a nucleic acid comprising the gene coding for the respec which is suitable for controlling the transcription of a herbi tive HPPD protein in the presence of different concentrations cide tolerance gene in plants, can be used as the promoter of the various HPPD inhibitor herbicides. Dose responses and sequence in the plants of the invention (named “plant-ex relative shifts in dose responses associated with these indica pressible promoter herein). Examples of such suitable plant tor phenotypes (formation of brown colour, growth inhibi expressible promoters are described above. In one embodi tion, bleaching, herbicidal effect, etc) are conveniently ment of this invention, Such plant-expressible promoters are expressed in terms, for example, of GR50 (concentration for operably-linked to a (I) DNA sequence encoding hydrox 50% reduction of growth) or MIC (minimum inhibitory con yphenylpyruvate dioxygenase (HPPD) that is derived from a centration) values where increases in values correspond to member of a group of organisms consisting of (a) Avena, increases in inherent tolerance of the expressed HPPD, in the preferably Avena sativa, more preferably comprising a DNA normal manner based upon plant damage, meristematic sequence identical to SEQID No. 1 encoding HPPD defined bleaching symptoms etc. at a range of different concentra by SEQID No. 2, (b) Pseudomonas, preferably Pseudomonas tions of herbicides. These data can be expressed in terms of fluorescens, more preferably comprising a DNA sequence for example, GR50 values derived from dose/response curves identical to SEQID No. 3 encoding HPPD defined by SEQID having "dose” plotted on the x-axis and “percentage kill', No. 4, (c) Synechococcoideae, preferably Synechococcus sp., “herbicidal effect”, “numbers of emerging green plants' etc. more preferably comprising a DNA sequence identical to plotted on the y-axis where increased GR50 values corre SEQID No. 6, encoding HPPD defined by SEQID No. 7, (d) spond to increased levels of inherent tolerance of the Blepharismidae, preferably Blepharisma japonicum, more expressed HPPD. Herbicides can suitably be applied pre preferably comprising a DNA sequence identical to SEQID emergence or post emergence. Likewise, tolerance level is No. 8 encoding HPPD defined by SEQID No. 9, (e) Rhodo screened via transgenesis, regeneration, breeding and spray coccus, preferably Rhodococcus sp. (strain RHA1), isolate testing of a test plant Such as tobacco, or a crop plant such as ro03.04.1 more preferably comprising a DNA sequence iden Soybean or cotton and according to these results. Such plants tical to SEQ ID No. 10 encoding HPPD defined by SEQ ID are at least 2-4x more tolerant to HPPD inhibitor herbicides, No. 11, or Rhodococcus sp. (strain RHA1), isolate ro02040, like N-(1,2,5-oxadiazol-3-yl)benzamides whose phenyl ring more preferably comprising a DNA sequence identical to is substituted in the 2-, 3- and 4-position by selected radicals SEQID No.12 encoding HPPD defined by SEQID No. 13, (f) as defined above or their salts than plants that do not contain Picrophilaceae, preferably Picrophilus torridus, more prefer any exogenous gene encoding an HPPD protein, ably comprising a DNA sequence identical to SEQID No. 14 encoding HPPD defined by SEQ ID No. 15, (g) Kordia, 0077 “Host organism' or “host’ is understood as being preferably Kordia algicida, more preferably comprising a any unicellular or multicellular heterologous organism into DNA sequence identical to SEQID No. 16 encoding HPPD which the nucleic acid or chimeric gene according to the defined by SEQID No. 17, or (II) a mutated DNA sequence of invention can be introduced for the purpose of producing HPPD of the before defined organisms, preferably a mutated HPPD. These organisms are, in particular, bacteria, for example E. coli, yeast, in particular of the genera Saccharo DNA sequence as described in WO 2010/085705, U.S. Pat. myces or Kluyveromyces, Pichia, fungi, in particular No. 6,245,968, WO 2009/144079, PCT/EP2010/070561, Aspergillus, a baculovirus or, preferably, plant cells and PCT/EP2010/070567, PCT/EP2010/070578, PCT/EP2010/ plants. 070570, or PCT/EP2010/070575 and also containing. I0081. According to the invention, it is also possible to use, 0078 “Plant cell' is understood, according to the inven in combination with the promoter regulatory sequence, other tion, as being any cell which is derived from or found in a regulatory sequences which are located between the promoter plant and which is able to form or is part of undifferentiated and the coding sequence, Such as intron sequences, or tran tissues, such as calli, differentiated tissues such as embryos, Scription activators (enhancers) in order to perform tolerace parts of plants, plants or seeds. This includes protoplasts and to N-(1,2,5-oxadiazol-3-yl)benzamides whose phenyl ring is pollen, cultivated plants cells or protoplasts grown in vitro, substituted in the 2-, 3- and 4-position by selected radicals as and plant cells that can regenerate into a complete plant. defined above or their salts. Examples of such suitable regu 0079. “Plant' is understood, according to the invention, as latory sequences are described above. being any differentiated multicellular organism which is I0082) Any corresponding sequence of bacterial or viral capable of photosynthesis, in particular a monocotyledonous origin, Such as the nos terminator from Agrobacterium tume or dicotyledonous organism, more especially cultivated faciens, or of plant origin, such as a histone terminator as plants which are or are not intended for animal or human described in application EP 0 633 317 A1, may be used as nutrition, Such as maize or corn, wheat, Brassica spp. plants transcription termination (and polyadenylation) regulatory Such as Brassica napus or Brassica iuncea, soya spp., rice, Sequence. Sugarcane, beetroot, tobacco, cotton, vegetable plants such as I0083. In a further particular embodiment, the present cucumber, leek, carrot, tomato, lettuce, peppers, melon, invention relates to the use of N-(1,2,5-oxadiazol-3-yl)ben watermelon, etc. Transgenic plants, as used herein, refer to Zamides whose phenyl ring is substituted in the 2-, 3- and US 2014/0066307 A1 Mar. 6, 2014 67

4-position by selected radicals as defined above or their salts I0085. In a further particular embodiment, the present on plants, plant parts, or plant seeds containing a nucleic acid invention relates to the use of N-(1,2,5-oxadiazol-3-yl)ben sequence which encodes a transit peptide is employed 5' Zamides whose phenyl ring is substituted in the 2-, 3- and (upstream) of the nucleic acid sequence encoding the exog 4-position by selected radicals as defined above or their salts enous chimeric gene(s) (I) comprising a DNA sequence on plants, plant parts, or plant seeds obtained by cloning, encoding hydroxyphenylpyruvate dioxygenase (HPPD) transformation with a expression vector, which expression derived from a member of a group of organisms consisting of vector contains at least one chimeric gene encoding the (a) Avena, preferably Avena sativa, more preferably compris hydroxyphenylpyruvate dioxygenase (HPPD) derived from a ing a DNA sequence identical to SEQ ID No. 1 encoding member of a group of organisms consisting of (a) Avena, HPPD defined by SEQ ID No. 2, (b) Pseudomonas, prefer preferably Avena sativa, more preferably comprising a DNA ably Pseudomonas fluorescens, more preferably comprising a sequence identical to SEQID No. 1 encoding HPPD defined DNA sequence identical to SEQ ID No. 3 encoding HPPD by SEQID No. 2, (b) Pseudomonas, preferably Pseudomonas defined by SEQID No. 4, (c) Synechococcoideae, preferably fluorescens, more preferably comprising a DNA sequence Synechococcus sp., more preferably comprising a DNA identical to SEQID No. 3 encoding HPPD defined by SEQID sequence identical to SEQID No. 6, encoding HPPD defined No. 4, (c) Synechococcoideae, preferably Synechococcus sp., by SEQ ID No. 7, (d) Blepharismidae, preferably Blepha more preferably comprising a DNA sequence identical to risma japonicum, more preferably comprising a DNA SEQID No. 6, encoding HPPD defined by SEQID No. 7, (d) sequence identical to SEQID No. 8 encoding HPPD defined Blepharismidae, preferably Blepharisma japonicum, more by SEQID No. 9, (e) Rhodococcus, preferably Rhodococcus preferably comprising a DNA sequence identical to SEQID sp. (strain RHA1), isolate ro03.04.1 more preferably compris No. 8 encoding HPPD defined by SEQID No. 9, (e) Rhodo ing a DNA sequence identical to SEQ ID No. 10 encoding coccus, preferably Rhodococcus sp. (strain RHA1), isolate HPPD defined by SEQID No. 11, or Rhodococcus sp. (strain ro03.04.1 more preferably comprising a DNA sequence iden RHA1), isolate ro02040, more preferably comprising a DNA tical to SEQ ID No. 10 encoding HPPD defined by SEQ ID sequence identical to SEQID No. 12 encoding HPPD defined No. 11, or Rhodococcus sp. (strain RHA1), isolate ro02040, by SEQID No. 13, (f) Picrophilaceae, preferably Picrophilus more preferably comprising a DNA sequence identical to torridus, more preferably comprising a DNA sequence iden SEQID No.12 encoding HPPD defined by SEQID No. 13, (f) tical to SEQID No. 14 encoding HPPD defined by SEQ ID Picrophilaceae, preferably Picrophilus torridus, more prefer No. 15, (g) Kordia, preferably Kordia algicida, more prefer ably comprising a DNA sequence identical to SEQID No. 14 ably comprising a DNA sequence identical to SEQID No. 16 encoding HPPD defined by SEQ ID No. 15, (g) Kordia, encoding HPPD defined by SEQID No. 17, or(II) comprising preferably Kordia algicida, more preferably comprising a one or more mutated DNA sequences of HPPD encoding DNA sequence identical to SEQID No. 16 encoding HPPD genes of the before defined organisms, preferably mutants as defined by SEQ ID No. 17, or (II) comprising one or more described in WO 2010/085705, U.S. Pat. No. 6,245,968, WO mutated DNA sequences of HPPD encoding genes of the 2009/144079, PCT/EP2010/070561, PCT/EP2010/070567, before defined organisms, preferably mutants as described in PCT/EP2010/070578, PCT/EP2010/070570, or PCT/ WO 2010/085705, U.S. Pat. No. 6,245,968, WO 2009/ EP2010/070575 and also containing with this transit peptide 144079, PCT/EP2010/070561, PCT/EP2010/070567, PCT/ sequence being arranged between the promoter region and EP2010/070578, PCT/EP2010/070570, or PCT/EP2010/ the sequence encoding the exogenous HPPD So as to permit 07.0575. In addition to the above chimeric gene, this vector expression of a transit peptide-HPPD fusion protein. The can contain an origin of replication. This vector can be a transit peptide makes it possible to direct the HPPD into the plasmid or plasmidportion, a cosmid, or a bacteriophage or a plastids, more especially the chloroplasts, with the fusion virus which has been transformed by introducing the chi protein being cleaved between the transit peptide and the meric gene according to the invention. Transformation vec HPPD protein when the latter enters the plastid. The transit tors are well knownto the skilled person and widely described peptide may be a single peptide, such as an EPSPS transit in the literature. The transformation vector which can be used, peptide (described in U.S. Pat. No. 5,188,642) or a transit in particular, for transforming plant cells or plants may be a peptide of the plantribulose bisphosphate carboxylase/oxy virus, which can be employed for transforming plant cells or genase Small Subunit (RuBisCO SSu), where appropriate, plants and which additionally contains its own replication and including a few amino acids of the N-terminal part of the expression elements. The vector for transforming plant cells mature RuBisCOssu (EP 189707 A1), or else may be a fusion or plants is preferably a plasmid, Such as a disarmed Agro of several transit peptides such as a transit peptide which bacterium Tiplasmid. comprises a first plant transit peptide which is fused to a part I0086. In a further particular embodiment, the present of the N-terminal sequence of a mature protein having a invention relates to the use of N-(1,2,5-oxadiazol-3-yl)ben plastid location, with this part in turn being fused to a second Zamides whose phenyl ring is substituted in the 2-, 3- and plant transit peptide as described in patent EP 508 909 A1, 4-position by selected radicals as defined above or their salts and, more especially, the optimized transit peptide which on plants, plant parts, or plant seeds containing a chimeric comprises a transit peptide of the sunflower RuBisCO issu gene which comprises a sequence encoding the hydroxyphe fused to 22 amino acids of the N-terminal end of the maize nylpyruvate dioxygenase (HPPD) derived from a member of RuBisCO issu, in turn fused to the transit peptide of the maize a group of organisms, consisting of (a) Avena, preferably RuBisCO SSu, as described, with its coding sequence, in Avena sativa, more preferably comprising a DNA sequence patent EP 508 909 A1. identical to SEQID No. 1 encoding HPPD defined by SEQID 0084. The present invention also relates to the transit pep No. 2, (b) Pseudomonas, preferably Pseudomonas fluore tide HPPD fusion protein and a nucleic acid or plant-express scens, more preferably comprising a DNA sequence identical ible chimeric gene encoding Such fusion protein, wherein the to SEQID No. 3 encoding HPPD defined by SEQID No. 4, two elements of this fusion protein are as defined above. (c) Synechococcoideae, preferably Synechococcus sp., more US 2014/0066307 A1 Mar. 6, 2014

preferably comprising a DNA sequence identical to SEQID EP2010/070561, PCT/EP2010/070567, PCT/EP2010/ No. 6, encoding HPPD defined by SEQ ID No. 7, (d) Ble 070578, PCT/EP2010/070570, or PCT/EP2010/070575. and pharismidae, preferably Blepharisma japonicum, more pref in addition further contains a chimeric gene comprising a erably comprising a DNA sequence identical to SEQID No. plant-expressible promoter as described above, operably 8 encoding HPPD defined by SEQID No. 9, (e) Rhodococ linked to a nucleic acid sequence encoding a PDH (prephen cus, preferably Rhodococcus sp. (strain RHA1), isolate ate dehydrogenase) enzyme (US 2005/0257283) in order to ro03.04.1 more preferably comprising a DNA sequence iden confer tolerance to N-(1,2,5-oxadiazol-3-yl)benzamides tical to SEQID No. 10 encoding HPPD defined by SEQ ID whose phenyl ring is substituted in the 2-, 3- and 4-position by No. 11, or Rhodococcus sp. (strain RHA1), isolate ro02040, selected radicals as defined above or their salts. A plant com more preferably comprising a DNA sequence identical to prising Such two transgenes can be obtained by transforming SEQID No.12 encoding HPPD defined by SEQID No. 13, (f) a plant with one transgene, and then re-transforming this Picrophilaceae, preferably Picrophilus torridus, more prefer transgenic plant with the second transgene, or by transform ably comprising a DNA sequence identical to SEQID No. 14 ing a plant with the two transgenes simultaneously (in the encoding HPPD defined by SEQ ID No. 15, (g) Kordia, same or in 2 different transforming DNAS or vectors), or by preferably Kordia algicida, more preferably comprising a crossing a plant comprising the first transgene with a plant DNA sequence identical to SEQID No. 16 encoding HPPD comprising the second transgene, as is well known in the art. defined by SEQ ID No. 17 or (II) comprising one or more 0088. One transformation method in order to obtain mutated DNA sequences of HPPD encoding genes of the plants, plant parts or seeds being tolerant to N-(1,2,5-oxadia before defined organisms, preferably mutants as described in Zol-3-yl)benzamides whose phenyl ring is substituted in the WO 2010/085705, U.S. Pat. No. 6,245,968, WO 2009/ 2-, 3- and 4-position by selected radicals as defined above or 144079, PCT/EP2010/070561, PCT/EP2010/070567, PCT/ their salts by containing one or more chimeric gene(s) (I) EP2010/070578, PCT/EP2010/070570, or PCT/EP2010/ comprising a DNA sequence encoding hydroxyphenylpyru 07.0575, and the use of the plants or seeds in a field to grow a vate dioxygenase (HPPD) derived from a member of a group crop and harvest a plant product, e.g., soya spp., rice, wheat, of organisms, consisting of (a) Avena, preferably Avena barley or corn grains or cotton bolls, where in one embodi sativa, more preferably comprising a DNA sequence identi ment said use involves the application of an N-(1,2,5-oxadia cal to SEQID No. 1 encoding HPPD defined by SEQID No. Zol-3-yl)benzamides whose phenyl ring is substituted in the 2, (b) Pseudomonas, preferably Pseudomonas fluorescens, 2-, 3- and 4-position by selected radicals as defined above or more preferably comprising a DNA sequence identical to their salts to such plants to control weeds. SEQID No. 3 encoding HPPD defined by SEQID No. 4, (c) 0087. In another particular embodiment, the present Synechococcoideae, preferably Synechococcus sp., more invention relates to the use of N-(1,2,5-oxadiazol-3-yl)ben preferably comprising a DNA sequence identical to SEQID Zamides whose phenyl ring is substituted in the 2-, 3- and No. 6, encoding HPPD defined by SEQ ID No. 7 (d) Ble 4-position by selected radicals as defined above or their salts pharismidae, preferably Blepharisma japonicum, more pref on plants, plant parts, or plant seeds characterized in that it erably comprising a DNA sequence identical to SEQID No. contains one or more chimeric gene(s) (I) comprising a DNA 8 encoding HPPD defined by SEQID No. 9, (e) Rhodococ sequence encoding hydroxyphenylpyruvate dioxygenase cus, preferably Rhodococcus sp. (strain RHA1), isolate (HPPD) derived from a member of a group of organisms ro03.04.1 more preferably comprising a DNA sequence iden consisting of (a) Avena, preferably Avena sativa, more pref tical to SEQ ID No. 10 encoding HPPD defined by SEQ ID erably comprising a DNA sequence identical to SEQID No. No. 11 or Rhodococcus sp. (strain RHA1), isolate ro02040, 1 encoding HPPD defined by SEQID No. 2, (b) Pseudomo more preferably comprising a DNA sequence identical to nas, preferably Pseudomonas fluorescens, more preferably SEQID No.12 encoding HPPD defined by SEQID No. 13, (f) comprising a DNA sequence identical to SEQ ID No. 3 Picrophilaceae, preferably Picrophilus torridus, more prefer encoding HPPD defined by SEQID No. 4, (c) Synechococ ably comprising a DNA sequence identical to SEQID No. 14 coideae, preferably Synechococcus sp., more preferably com encoding HPPD defined by SEQ ID No. 15, (g) Kordia, prising a DNA sequence identical to SEQID No. 6, encoding preferably Kordia algicida, more preferably comprising a HPPD defined by SEQID No. 7, (d) Blepharismidae, prefer DNA sequence identical to SEQID No. 16 encoding HPPD ably Blepharisma japonicum, more preferably comprising a defined by SEQ ID No. 17 or (II) comprising one or more DNA sequence identical to SEQ ID No. 8 encoding HPPD mutated DNA sequences of HPPD encoding genes of the defined by SEQ ID No. 9, (e) Rhodococcus, preferably before defined organisms, preferably mutants as described in Rhodococcus sp. (strain RHA1), isolate ro03.04.1 more pref WO 2010/085705, U.S. Pat. No. 6,245,968, WO 2009/ erably comprising a DNA sequence identical to SEQID No. 144079, PCT/EP2010/070561, PCT/EP2010/070567, PCT/ 10 encoding HPPD defined by SEQID No. 11, or Rhodococ EP2010/070578, PCT/EP2010/070570, or PCT/EP2010/ cus sp. (strain RHA1), isolate ro02040, more preferably com 07.0575 comprises bombarding cells, protoplasts or tissues prising a DNA sequence identical to SEQID No. 12 encoding with solid or liquid particles to which DNA is attached, or HPPD defined by SEQID No. 13, (f) Picrophilaceae, prefer containing DNA. Another transformation method comprises ably Picrophilus torridus, more preferably comprising a using, as mean for transfer into the plant, a chimeric gene DNA sequence identical to SEQID No. 14 encoding HPPD which is inserted into an Agrobacterium tumefaciens Tiplas defined by SEQ ID No. 15, (g) Kordia, preferably Kordia mid oran Agrobacterium rhizogenes Ri plasmid. Other meth algicida, more preferably comprising a DNA sequence iden ods may be used, such as microinjection or electroporation or tical to SEQID No. 16 encoding HPPD defined by SEQ ID otherwise direct gene transfer using PEG. The skilled person No. 17, or (II) comprising one or more mutated DNA can select any appropriate method for transforming the host sequences of HPPD encoding genes of the before defined organism of choice, in particular the plant cell or the plant. As organisms, preferably mutants as described in WO 2010/ examples, the technology for soybean transformation has 085705, U.S. Pat. No. 6,245,968, WO 2009/144079, PCT/ been extensively described in the examples 1 to 3 disclosed in US 2014/0066307 A1 Mar. 6, 2014 69

EP 1186666 A1, incorporated herein by reference. For rice, 0090 The present invention also relates to a method for Agrobacterium-mediated transformation (Hiei et al., 1994 obtaining a plant tolerant to N-(1,2,5-oxadiazol-3-yl)benza Plant J 6:271-282, and Hiei et al., 1997 Plant Mol. Biol. mides whose phenyl ring is substituted in the 2-, 3- and 35:205-21, incorporated herein by reference), electropora 4-position by selected radicals as defined above or their salts, tion (U.S. Pat. No. 5,641,664 and U.S. Pat. No. 5,679,558, characterized in that the plant is transformed with one or more incorporated herein by reference), or bombardment (Christou chimeric gene(s) (I) comprising a DNA sequence encoding et al., 1991, Biotechnology 9:957 incorporated herein by hydroxyphenylpyruvate dioxygenase (HPPD) derived from a reference) could be performed. A suitable technology for member of a group of organisms consisting of (a) Avena, transformation of monocotyledonous plants, and particularly preferably Avena sativa, more preferably comprising a DNA rice, is described in WO92/09696, incorporated herein by sequence identical to SEQID No. 1 encoding HPPD defined reference. For cotton, Agrobacterium-mediated transforma by SEQID No. 2, (b) Pseudomonas, preferably Pseudomonas tion (Gould J. H. and Magallanes-Cedeno M., 1998 Plant fluorescens, more preferably comprising a DNA sequence Molecular Biology reporter, 16:1-10 and Zapata C., 1999, identical to SEQID No. 3 encoding HPPD defined by SEQID Theoretical Applied Genetics, 98(2): 1432-2242 incorporated No. 4, (c) Synechococcoideae, preferably Synechococcus sp., herein by reference), polybrene and/or treatment-mediated more preferably comprising a DNA sequence identical to transformation (Sawahel W. A., 2001, Plant Molecular SEQID No. 6, encoding HPPD defined by SEQID No. 7, (d) Biology reporter, 19:377a-377f, incorporated herein by ref Blepharismidae, preferably Blepharisma japonicum, more erence) have been described. preferably comprising a DNA sequence identical to SEQID 0089 Alternatively, N-(1,2,5-oxadiazol-3-yl)benzamides No. 8 encoding HPPD defined by SEQID No. 9, (e) Rhodo whose phenyl ring is Substituted in the 2-, 3- and 4-position by coccus, preferably Rhodococcus sp. (strain RHA1), isolate selected radicals as defined above or their salts may be used ro03.04.1 more preferably comprising a DNA sequence iden on plants, plant parts, or plant seeds containing one or more tical to SEQ ID No. 10 encoding HPPD defined by SEQ ID chimeric gene(s) (I) comprising a DNA sequence encoding No. 11, or Rhodococcus sp. (strain RHA1), isolate ro02040, hydroxyphenylpyruvate dioxygenase (HPPD) derived from a more preferably comprising a DNA sequence identical to member of a group of organisms consisting of (a) Avena, SEQID No.12 encoding HPPD defined by SEQID No. 13, (f) preferably Avena sativa, more preferably comprising a DNA Picrophilaceae, preferably Picrophilus torridus, more prefer sequence identical to SEQID No. 1 encoding HPPD defined ably comprising a DNA sequence identical to SEQID No. 14 by SEQID No. 2, (b) Pseudomonas, preferably Pseudomonas encoding HPPD defined by SEQ ID No. 15, (g) Kordia, fluorescens, more preferably comprising a DNA sequence preferably Kordia algicida, more preferably comprising a identical to SEQID No. 3 encoding HPPD defined by SEQID DNA sequence identical to SEQID No. 16 encoding HPPD No. 4, (c) Synechococcoideae, preferably Synechococcus sp., defined by SEQ ID No. 17, or (II) comprising one or more more preferably comprising a DNA sequence identical to mutated DNA sequences of HPPD encoding genes of the SEQID No. 6, encoding HPPD defined by SEQID No. 7, (d) before defined organisms, preferably mutants as described in Blepharismidae, preferably Blepharisma japonicum, more WO 2010/085705, U.S. Pat. No. 6,245,968, WO 2009/ preferably comprising a DNA sequence identical to SEQID 144079, PCT/EP2010/070561, PCT/EP2010/070567, PCT/ No. 8 encoding HPPD defined by SEQID No. 9, (e) Rhodo EP2010/070578, PCT/EP2010/070570, or PCT/EP2010/ coccus, preferably Rhodococcus sp. (strain RHA1), isolate O70575. ro03.04.1 more preferably comprising a DNA sequence iden 0091. Therefore, the present invention also relates to a tical to SEQID No. 10 encoding HPPD defined by SEQ ID method for obtaining a plant tolerant to N-(1,2,5-oxadiazol No. 11, or Rhodococcus sp. (strain RHA1), isolate ro02040, 3-yl)benzamides whose phenyl ring is substituted in the 2-, 3 more preferably comprising a DNA sequence identical to and 4-position by selected radicals as defined above or their SEQID No.12 encoding HPPD defined by SEQID No. 13, (f) salts by containing one or more chimeric gene(s) (I) compris Picrophilaceae, preferably Picrophilus torridus, more prefer ing a DNA sequence encoding hydroxyphenylpyruvate ably comprising a DNA sequence identical to SEQID No. 14 dioxygenase (HPPD) derived from a member of a group of encoding HPPD defined by SEQ ID No. 15, (g) Kordia, organisms consisting of (a) Avena, preferably Avena sativa, preferably Kordia algicida, more preferably comprising a more preferably comprising a DNA sequence identical to DNA sequence identical to SEQID No. 16 encoding HPPD SEQID No. 1 encoding HPPD defined by SEQID No. 2, (b) defined by SEQ ID No. 17, or (II) comprising one or more Pseudomonas, preferably Pseudomonas fluorescens, more mutated DNA sequences of HPPD encoding genes of the preferably comprising a DNA sequence identical to SEQID before defined organisms, preferably mutants as described in No. 3 encoding HPPD defined by SEQ ID No. 4, (c) Syn WO 2010/085705, U.S. Pat. No. 6,245,968, WO 2009/ echococcoideae, preferably Synechococcus sp., more prefer 144079, PCT/EP2010/070561, PCT/EP2010/070567, PCT/ ably comprising a DNA sequence identical to SEQID No. 6, EP2010/070578, PCT/EP2010/070570, or PCT/EP2010/ encoding HPPD defined by SEQID No. 7, (d) Blepharismi 070575 which HPPD is expressed directly in the plastids, dae, preferably Blepharisma japonicum, more preferably Such as the chloroplasts, using transformation of the plastid, comprising a DNA sequence identical to SEQ ID No. 8 Such as the chloroplast genome. A Suitable method comprises encoding HPPD defined by SEQID No. 9, (e) Rhodococcus, the bombardment of plant cells or tissue by solid particles preferably Rhodococcus sp. (strain RHA1), isolate ro03.041 coated with the DNA or liquid particles comprising the DNA, more preferably comprising a DNA sequence identical to and integration of the introduced gene by homologous recom SEQID No. 10 encoding HPPD defined by SEQID No. 11, or bination. Suitable vectors and selection systems are known to Rhodococcus sp. (strain RHA1), isolate ro02040, more pref the person skilled in the art. An example of means and meth erably comprising a DNA sequence identical to SEQ ID ods which can be used for Such integration into the chloro No.12 encoding HPPD defined by SEQID No. 13, (f) Picro plast genome of tobacco plants is given in WOO6/108830, the philaceae, preferably Picrophilus torridus, more preferably content of which is hereby incorporated by reference comprising a DNA sequence identical to SEQ ID No. 14 US 2014/0066307 A1 Mar. 6, 2014 70 encoding HPPD defined by SEQ ID No. 15, (g) Kordia, a plant crop, by application of a N-(1,2,5-oxadiazol-3-yl) preferably Kordia algicida, more preferably comprising a benzamides whose phenyl ring is substituted in the 2-, 3- and DNA sequence identical to SEQID No. 16 encoding HPPD 4-position by selected radicals as defined above or their salts defined by SEQ ID No. 17, or (II) comprising one or more to such field or plant crop, which method is characterized in mutated DNA sequences of HPPD encoding genes of the that this N-(1,2,5-oxadiazol-3-yl)benzamides whose phenyl before defined organisms, preferably mutants as described in ring is Substituted in the 2-, 3- and 4-position by selected WO 2010/085705, U.S. Pat. No. 6,245,968, WO 2009/ radicals as defined above or their salts is applied to plants 144079, PCT/EP2010/070561, PCT/EP2010/070567, PCT/ which have been transformed in accordance with one or more EP2010/070578, PCT/EP2010/070570, or PCT/EP2010/ chimeric gene(s) (I) comprising a DNA sequence encoding 07.0575, characterized in that the plant contains one or more hydroxyphenylpyruvate dioxygenase (HPPD) derived from a chimeric gene(s) (I) comprising a DNA sequence encoding member of a group of organisms consisting of (a) Avena, hydroxyphenylpyruvate dioxygenase (HPPD) derived from a preferably Avena sativa, more preferably comprising a DNA member of a group of organisms consisting of (a) Avena, sequence identical to SEQID No. 1 encoding HPPD defined preferably Avena sativa, more preferably comprising a DNA by SEQID No. 2, (b) Pseudomonas, preferably Pseudomonas sequence identical to SEQID No. 1 encoding HPPD defined fluorescens, more preferably comprising a DNA sequence by SEQID No. 2, (b) Pseudomonas, preferably Pseudomonas identical to SEQID No. 3 encoding HPPD defined by SEQID fluorescens, more preferably comprising a DNA sequence No. 4, (c) Synechococcoideae, preferably Synechococcus sp., identical to SEQID No. 3 encoding HPPD defined by SEQID more preferably comprising a DNA sequence identical to No. 4, (c) Synechococcoideae, preferably Synechococcus sp., SEQID No. 6, encoding HPPD defined by SEQID No. 7, (d) more preferably comprising a DNA sequence identical to Blepharismidae, preferably Blepharisma japonicum, more SEQID No. 6, encoding HPPD defined by SEQID No. 7 (d) preferably comprising a DNA sequence identical to SEQID Blepharismidae, preferably Blepharisma japonicum, more No. 8 encoding HPPD defined by SEQID No. 9, (e) Rhodo preferably comprising a DNA sequence identical to SEQID coccus, preferably Rhodococcus sp. (strain RHA1), isolate No. 8 encoding HPPD defined by SEQID No. 9, (e) Rhodo ro03.04.1 more preferably comprising a DNA sequence iden coccus, preferably Rhodococcus sp. (strain RHA1), isolate tical to SEQ ID No. 10 encoding HPPD defined by SEQ ID ro03.04.1 more preferably comprising a DNA sequence iden No. 11, or Rhodococcus sp. (strain RHA1), isolate ro02040, tical to SEQID No. 10 encoding HPPD defined by SEQ ID more preferably comprising a DNA sequence identical to No. 11 or Rhodococcus sp. (strain RHA1), isolate ro02040, SEQID No.12 encoding HPPD defined by SEQID No. 13, (f) more preferably comprising a DNA sequence identical to Picrophilaceae, preferably Picrophilus torridus, more prefer SEQID No.12 encoding HPPD defined by SEQID No. 13, (f) ably comprising a DNA sequence identical to SEQID No. 14 Picrophilaceae, preferably Picrophilus torridus, more prefer encoding HPPD defined by SEQ ID No. 15, (g) Kordia, ably comprising a DNA sequence identical to SEQID No. 14 preferably Kordia algicida, more preferably comprising a encoding HPPD defined by SEQ ID No. 15, (g) Kordia, DNA sequence identical to SEQID No. 16 encoding HPPD preferably Kordia algicida, more preferably comprising a defined by SEQ ID No. 17, or (II) comprising one or more DNA sequence identical to SEQID No. 16 encoding HPPD mutated DNA sequences of HPPD encoding genes of the defined by SEQ ID No. 17, or (II) comprising one or more before defined organisms, preferably mutants as described in mutated DNA sequences of HPPD encoding genes of the WO 2010/085705, U.S. Pat. No. 6,245,968, WO 2009/ before defined organisms, preferably mutants as described in 144079, PCT/EP2010/070561, PCT/EP2010/070567, PCT/ WO 2010/085705, U.S. Pat. No. 6,245,968, WO 2009/ EP2010/070578, PCT/EP2010/070570, or PCT/EP2010/ 144079, PCT/EP2010/070561, PCT/EP2010/070567, PCT/ 07.0575, either before sowing the crop (hereinafter named EP2010/070578, PCT/EP2010/070570, or PCT/EP2010/ pre-planting application), before emergence of the crop 07.0575, which comprises a coding sequence as well as a (hereinafter named pre-emergence application), or after heterologous regulatory element in the 5' and optionally in the emergence of the crop (hereinafter named post-emergence 3' positions, which are able to function in a host organism, application). characterized in that the coding sequence comprises at least a nucleic acid sequence defining a gene encoding an HPPD of 0094. The invention also relates to a method for control the invention as previously described in order to perform a ling in an area or a field which contains transformed seeds as sufficiently high level of tolerance to N-(1,2,5-oxadiazol-3- previously described in the present invention, which method yl)benzamides whose phenyl ring is substituted in the 2-, 3 comprises applying, to the said area of the field, a dose of an and 4-position by selected radicals as defined above or their N-(1,2,5-oxadiazol-3-yl)benzamides whose phenyl ring is salts. substituted in the 2-, 3- and 4-position by selected radicals as defined above or their salts which is toxic for the said weeds, 0092. In one embodiment of this invention, the HPPD without significantly affecting the seeds or plants containing inhibitor in the above method is a N-(1,2,5-oxadiazol-3-yl) one or more chimeric gene(s) (I) comprising a DNA sequence benzamides whose phenyl ring is substituted in the 2-, 3- and encoding hydroxyphenylpyruvate dioxygenase (HPPD) 4-position by selected radicals as defined above or their salts derived from a member of a group of organisms consisting of either alone or in combination with one or more HPPD inhibi (a) Avena, preferably Avena sativa, more preferably compris tor herbicides selected from the group consisting of triketone ing a DNA sequence identical to SEQ ID No. 1 encoding or pyrazolinate herbicide, preferably tembotrione, mesotri HPPD defined by SEQ ID No. 2, (b) Pseudomonas, prefer one, bicyclopyrone, tefuryltrione pyrasulfotole, pyrazolate, ably Pseudomonas fluorescens, more preferably comprising a diketonitrile, benzofenap, or Sulcotrione, particularly tembot DNA sequence identical to SEQ ID No. 3 encoding HPPD 1O. defined by SEQID No. 4, (c) Synechococcoideae, preferably 0093. The invention also relates to a method for selectively Synechococcus sp., more preferably comprising a DNA removing weeds or preventing the germination of weeds in a sequence identical to SEQID No. 6, encoding HPPD defined field to be planted with plants or to be sown with seeds, or in by SEQ ID No. 7, (d) Blepharismidae, preferably Blepha US 2014/0066307 A1 Mar. 6, 2014 risma japonicum, more preferably comprising a DNA the desired Stage of maturity and, where appropriate, in sepa sequence identical to SEQID No. 8 encoding HPPD defined rating the seeds from the harvested plants. by SEQID No. 9, (e) Rhodococcus, preferably Rhodococcus 0096. In the above methods, the N-(1,2,5-oxadiazol-3-yl) sp. (strain RHA1), isolate ro03.04.1 more preferably compris benzamides whose phenyl ring is substituted in the 2-, 3- and ing a DNA sequence identical to SEQ ID No. 10 encoding 4-position by selected radicals as defined above or their salts HPPD defined by SEQID No. 11, or Rhodococcus sp. (strain can be applied in accordance with the invention, either before RHA1), isolate ro02040, more preferably comprising a DNA Sowing the crop, before the crop emerges or after the crop sequence identical to SEQID No. 12 encoding HPPD defined emerges. by SEQID No. 13, (f) Picrophilaceae, preferably Picrophilus 0097. Within the meaning of the present invention, “her torridus, more preferably comprising a DNA sequence iden bicide' is understood as being a herbicidally active substance tical to SEQID No. 14 encoding HPPD defined by SEQ ID on its own or such a Substance which is combined with an No. 15, (g) Kordia, preferably Kordia algicida, more prefer additive which alters its efficacy, such as, for example, an ably comprising a DNA sequence identical to SEQID No. 16 agent which increases its activity (a synergistic agent) or encoding HPPD defined by SEQID No. 17, or(II) comprising which limits its activity (a safener). It is of course to be one or more mutated DNA sequences of HPPD encoding understood that, for their application in practice, the above herbicides are combined, in a manner which is known perse, genes of the before defined organisms, preferably mutants as with the formulation adjuvants which are customarily described in WO 2010/085705, U.S. Pat. No. 6,245,968, WO employed in agricultural chemistry. 2009/144079, PCT/EP2010/070561, PCT/EP2010/070567, 0098. Thus, transgenic plants can be obtained which in PCT/EP2010/070578, PCT/EP2010/070570, or PCT/ addition to the one or more chimeric gene(s) (I) comprising a EP2010/070575. DNA sequence encoding hydroxyphenylpyruvate dioxyge 0095. The present invention also relates to a method for nase (HPPD) derived from a member of a group of organisms, cultivating the plants which have been transformed with one consisting of (a) Avena, preferably Avena sativa, more pref or more chimeric gene(s) (I) comprising a DNA sequence erably comprising a DNA sequence identical to SEQID No. encoding hydroxyphenylpyruvate dioxygenase (HPPD) 1 encoding HPPD defined by SEQID No. 2, (b) Pseudomo derived from a member of a group of organisms, consisting of nas, preferably Pseudomonas fluorescens, more preferably (a) Avena, preferably Avena sativa, more preferably compris comprising a DNA sequence identical to SEQ ID No. 3 ing a DNA sequence identical to SEQ ID No. 1 encoding encoding HPPD defined by SEQID No. 4, (c) Synechococ HPPD defined by SEQID No. 2, (b) Pseudomonas, prefer coideae, preferably Synechococcus sp., more preferably com ably Pseudomonas fluorescens, more preferably comprising a prising a DNA sequence identical to SEQID No. 6, encoding DNA sequence identical to SEQ ID No. 3 encoding HPPD HPPD defined by SEQID No. 7 (d) Blepharismidae, prefer defined by SEQID No. 4, (c) Synechococcoideae, preferably ably Blepharisma japonicum, more preferably comprising a Synechococcus sp., more preferably comprising a DNA DNA sequence identical to SEQ ID No. 8 encoding HPPD sequence identical to SEQID No. 6, encoding HPPD defined defined by SEQ ID No. 9, (e) Rhodococcus, preferably by SEQ ID No. 7, (d) Blepharismidae, preferably Blepha Rhodococcus sp. (strain RHA1), isolate ro03.04.1 more pref risma japonicum, more preferably comprising a DNA erably comprising a DNA sequence identical to SEQID No. sequence identical to SEQID No. 8 encoding HPPD defined 10 encoding HPPD defined by SEQID No. 11 or Rhodococ by SEQID No. 9, (e) Rhodococcus, preferably Rhodococcus cus sp. (strain RHA1), isolate ro02040, more preferably com sp. (strain RHA1), isolate ro03.04.1 more preferably compris prising a DNA sequence identical to SEQID No. 12 encoding ing a DNA sequence identical to SEQ ID No. 10 encoding HPPD defined by SEQID No. 13, (f) Picrophilaceae, prefer HPPD defined by SEQID No. 11, or Rhodococcus sp. (strain ably Picrophilus torridus, more preferably comprising a RHA1), isolate ro02040, more preferably comprising a DNA DNA sequence identical to SEQID No. 14 encoding HPPD sequence identical to SEQID No. 12 encoding HPPD defined defined by SEQ ID No. 15, (g) Kordia, preferably Kordia by SEQID No. 13, (f) Picrophilaceae, preferably Picrophilus algicida, more preferably comprising a DNA sequence iden torridus, more preferably comprising a DNA sequence iden tical to SEQ ID No. 16 encoding HPPD defined by SEQ ID tical to SEQID No. 14 encoding HPPD defined by SEQ ID No. 17 or (II) comprising one or more mutated DNA No. 15, (g) Kordia, preferably Kordia algicida, more prefer sequences of HPPD encoding genes of the before defined ably comprising a DNA sequence identical to SEQID No. 16 organisms, preferably mutants as described in WO 2010/ encoding HPPD defined by SEQID No. 17 or (II) comprising 085705, U.S. Pat. No. 6,245,968, WO 2009/144079, PCT/ one or more mutated DNA sequences of HPPD encoding EP2010/070561, PCT/EP2010/070567, PCT/EP2010/ genes of the before defined organisms, preferably mutants as 070578, PCT/EP2010/070570, or PCT/EP2010/070575 described in WO 2010/085705, U.S. Pat. No. 6,245,968, WO have modified properties as the result of overexpression, 2009/144079, PCT/EP2010/070561, PCT/EP2010/070567, Suppression or inhibition of homologous (natural) genes or PCT/EP2010/070578, PCT/EP2010/070570, or PCT/ gene sequences or expression of heterologous (foreign) EP2010/070575, which method comprises planting seeds genes or gene Sequences. comprising a chimeric gene of before, in an area of a field 0099. On the plants, plant cells or seeds containing one or which is appropriate for cultivating the said plants, and in more chimeric gene(s) (I) comprising a DNA sequence applying, if weeds are present, a dose, which is toxic for the encoding hydroxyphenylpyruvate dioxygenase (HPPD) weeds, of one or more N-(1,2,5-oxadiazol-3-yl)benzamides derived from a member of a group of organisms, consisting of whose phenyl ring is Substituted in the 2-, 3- and 4-position by (a) Avena, preferably Avena sativa, more preferably compris selected radicals as defined above or their salts to the said area ing a DNA sequence identical to SEQ ID No. 1 encoding of the said field, without significantly affecting the said trans HPPD defined by SEQ ID No. 2, (b) Pseudomonas, prefer formed seeds or the said transformed plants, and in then ably Pseudomonas fluorescens, more preferably comprising a harvesting the cultivated plants or plant parts when they reach DNA sequence identical to SEQ ID No. 3 encoding HPPD US 2014/0066307 A1 Mar. 6, 2014 72 defined by SEQID No. 4, (c) Synechococcoideae, preferably torridus, more preferably comprising a DNA sequence iden Synechococcus sp., more preferably comprising a DNA tical to SEQ ID No. 14 encoding HPPD defined by SEQ ID sequence identical to SEQID No. 6, encoding HPPD defined No. 15, (g) Kordia, preferably Kordia algicida, more prefer by SEQ ID No. 7 (d) Blepharismidae, preferably Blepha ably comprising a DNA sequence identical to SEQID No. 16 risma japonicum, more preferably comprising a DNA encoding HPPD defined by SEQID No. 17, or(II) comprising sequence identical to SEQID No. 8 encoding HPPD defined one or more mutated DNA sequences of HPPD encoding by SEQID No. 9, (e) Rhodococcus, preferably Rhodococcus genes of the before defined organisms, preferably mutants as sp. (strain RHA1), isolate ro03.04.1 more preferably compris described in WO 2010/085705, U.S. Pat. No. 6,245,968, WO ing a DNA sequence identical to SEQ ID No. 10 encoding 2009/144079, PCT/EP2010/070561, PCT/EP2010/070567, HPPD defined by SEQID No. 11 or Rhodococcus sp. (strain PCT/EP2010/070578, PCT/EP2010/070570, or PCT/ RHA1), isolate ro02040, more preferably comprising a DNA EP2010/070575 for controlling harmful plants (i.e. weeds) sequence identical to SEQID No. 12 encoding HPPD defined which also extends to transgenic crop plants comprising a by SEQID No. 13, (f) Picrophilaceae, preferably Picrophilus second or more herbicide resistance(s) beside the resistance torridus, more preferably comprising a DNA sequence iden against one or more N-(1,2,5-oxadiazol-3-yl)benzamides tical to SEQID No. 14 encoding HPPD defined by SEQ ID whose phenyl ring is substituted in the 2-, 3- and 4-position by No. 15, (g) Kordia, preferably Kordia algicida, more prefer selected radicals as defined above or their salts. ably comprising a DNA sequence identical to SEQID No. 16 0101 N-(1,2,5-oxadiazol-3-yl)benzamides whose phenyl encoding HPPD defined by SEQID No. 17 or (II) comprising ring is Substituted in the 2-, 3- and 4-position by selected one or more mutated DNA sequences of HPPD encoding radicals as defined above or their salts can be formulated in genes of the before defined organisms, preferably mutants as various ways, depending on the prevailing biological and/or described in WO 2010/085705, U.S. Pat. No. 6,245,968, WO physico-chemical parameters. Examples of possible formu 2009/144079, PCT/EP2010/070561, PCT/EP2010/070567, lations are: wettable powders (WP), water-soluble powders PCT/EP2010/070578, PCT/EP2010/070570, or PCT/ (SP), water-soluble concentrates, emulsifiable concentrates EP2010/070575, it is preferred to employ one or more of the (EC), emulsions (EW), such as oil-in-water and water-in-oil N-(1,2,5-oxadiazol-3-yh)benzamides whose phenyl ring is emulsions, sprayable solutions, Suspension concentrates substituted in the 2-, 3- and 4-position by selected radicals as (SC), oil- or water-based dispersions, oil-miscible solutions, defined above or their salts in combination with one or more capsule Suspensions (CS), dusts (DP), seed-dressing prod further HPPD inhibitor herbicides belonging to the class of ucts, granules for application by broadcasting and on the soil. triketones, such as tembotrione, Sulcotrione and mesotrione, granules (GR) in the form of microgranules, spray granules, or of the class of pyrazolinates, such as pyrasulfotole and coated granules and adsorption granules, water-dispersible toprameZone, particularly selected from tembotrione, Sulcot granules (WG), water-soluble granules (SG), ULV formula rione, toprameZone, bicyclopyrone, tefuryltrione and mesot tions, microcapsules and waxes. rione, more particularly tembotrione in transgenic crops 0102 These individual types of formulation are known in which are also resistant to growth regulators such as, for principle and are described, for example, in: Winnacker example, 2,4-D or dicamba, or against herbicides which Küchler, “Chemische Technologie” Chemical technology, inhibit essential plant enzymes, for example acetolactate Syn volume 7, C. Hanser Verlag Munich, 4th Ed. 1986: Wade van thases (ALS), EPSP synthases, glutamine synthases (GS), Valkenburg, “Pesticide Formulations’, Marcel Dekker, N.Y., Acetyl-coenzyme A carboxylase (ACCase), or against herbi 1973; K. Martens, “Spray Drying Handbook, 3rd Ed. 1979, cides from the group of the Sulfonylureas, imidazolinones, G. Goodwin Ltd. London. glyphosate, glufosinate, ACCase inhibitors and analogous 0103) The formulation auxiliaries required, such as inert active Substances. materials, Surfactants, solvents and further additives, are also 0100. The invention therefore also relates to the use of known and are described, for example, in: Watkins, “Hand herbicides applied to HPPD tolerant plants containing one or book of Insecticide Dust Diluents and Carriers', 2nd Ed., more chimeric gene(s) (I) comprising a DNA sequence Darland Books, Caldwell N.J., H. V. Olphen, “Introduction to encoding hydroxyphenylpyruvate dioxygenase (HPPD) Clay Colloid Chemistry': 2nd Ed., J. Wiley & Sons, N.Y.: C. derived from a member of a group of organisms consisting of Marsden, “Solvents Guide'; 2nd Ed., Interscience, N.Y. (a) Avena, preferably Avena sativa, more preferably compris 1963; McCutcheon’s “Detergents and Emulsifiers Annual, ing a DNA sequence identical to SEQ ID No. 1 encoding MC Publ. Corp., Ridgewood N.J.; Sisley and Wood, “Ency HPPD defined by SEQ ID No. 2, (b) Pseudomonas, prefer clopedia of Surface Active Agents”, Chem. Publ. Co. Inc., ably Pseudomonas fluorescens, more preferably comprising a N.Y. 1964: Schonfeldt, “Grenzfláchenaktive Athylenoxidad DNA sequence identical to SEQ ID No. 3 encoding HPPD dukte' Interface-active ethylene oxide adducts, Wiss. Ver defined by SEQID No. 4, (c) Synechococcoideae, preferably lagsgesell. Stuttgart 1976: Winnacker-Kichler, “Chemische Synechococcus sp., more preferably comprising a DNA Technologie” Chemical technology, volume 7, C. Hanser sequence identical to SEQID No. 6, encoding HPPD defined Verlag Munich, 4th Ed. 1986. by SEQ ID No. 7, (d) Blepharismidae, preferably Blepha 0104 Based on these formulations, it is also possible to risma japonicum, more preferably comprising a DNA prepare combinations with other pesticidally active Sub sequence identical to SEQID No. 8 encoding HPPD defined stances such as, for example, insecticides, acaricides, herbi by SEQID No. 9, (e) Rhodococcus, preferably Rhodococcus cides, fungicides, and with Safeners, fertilizers and/or growth sp. (strain RHA1), isolate ro03.04.1 more preferably compris regulators, for example in the form of a ready mix or a tank ing a DNA sequence identical to SEQ ID No. 10 encoding mix. HPPD defined by SEQID No. 11 or Rhodococcus sp. (strain 0105 Wettable powders are preparations which are uni RHA1), isolate ro02040, more preferably comprising a DNA formly dispersible in water and which, besides the active sequence identical to SEQID No. 12 encoding HPPD defined Substance, also comprise ionic and/or nonionic Surfactants by SEQID No. 13, (f) Picrophilaceae, preferably Picrophilus (wetters, dispersers), for example polyoxyethylated alky US 2014/0066307 A1 Mar. 6, 2014

lphenols, polyoxyethylated fatty alcohols, polyoxyethylated Control Handbook’, 5th Ed., Blackwell Scientific Publica fatty amines, fatty alcohol polyglycol ether Sulfates, alkane tions, Oxford, 1968, pages 101-103. Sulfonates, alkylbenzenesulfonates, sodium lignoSulfonate, 0.115. As a rule, the agrochemical preparations comprise sodium 2,2'-dinaphthylmethane-6,6'-disulfonate, sodium from 0.1 to 99% by weight, in particular from 0.1 to 95% by dibutylnaphthalenesulfonate or else sodium oleoylmethyl weight, of compounds according to the invention. In wettable taurinate, besides a diluent or inert Substance. To prepare the powders, the active Substance concentration is, for example, wettable powders, the herbicidally active substances are approximately 10 to 90% by weight, the remainder to 100% ground finely, for example in customary apparatuses Such as by weight being composed of customary formulation con hammer mills, blower mills and air-jet mills, and mixed with stituents. In the case of emulsifiable concentrates, the active the formulation auxiliaries, either simultaneously or Subse Substance concentration can amount to approximately 1 to 90. quently. preferably 5 to 80% by weight. Formulations in the form of 0106 Emulsifiable concentrates are prepared by dissolv dusts comprise from 1 to 30% by weight of active substance, ing the active Substance in an organic solvent, for example preferably in most cases from 5 to 20% by weight of active butanol, cyclohexanone, dimethylformamide, Xylene or else Substance, and sprayable solutions comprise approximately higher-boiling aromatics or hydrocarbons or mixtures of the from 0.05 to 80, preferably from 2 to 50% by weight of active organic solvents with addition of one or more ionic and/or Substance. In the case of water-dispersible granules, the nonionic Surfactants (emulsifiers). Examples of emulsifiers active Substance content depends partly on whether the active which may be used are: calcium alkylarylsulfonates Such as compound is in liquid or solid form, and on the granulation calcium dodecylbenzenesulfonate, or nonionic emulsifiers auxiliaries, fillers and the like which are being used. In the Such as fatty acid polyglycol esters, alkylarylpolyglycol case of the water-dispersible granules, for example, the active ethers, fatty alcohol polyglycol ethers, propylene oxide/eth substance content is between 1 and 95% by weight, prefer ylene oxide condensates, alkyl polyethers, Sorbitan esters ably between 10 and 80% by weight. Such as, for example, Sorbitan fatty acid esters or polyoxyeth 0116. In addition, the active substance formulations men ylene Sorbitan esters such as, for example, polyoxyethylene tioned comprise, if appropriate, the auxiliaries which are sorbitan fatty acid esters. conventional in each case, Such as Stickers, wetters, dispers 0107 Dusts are obtained by grinding the active substance ants, emulsifiers, penetrations, preservatives, antifreeze with finely divided solid materials such as, for example, tal agents, solvents, fillers, carriers, colorants, antifoams, evapo cum, natural clays Such as kaolin, bentonite and pyrophyllite, ration inhibitors, and pH and viscosity regulators. or diatomaceous earth. 0117 Based on these formulations, it is also possible to 0108 Suspension concentrates can be water- or oil-based. prepare combinations of an HPPD inhibitor herbicide of the They can be prepared for example by wet-grinding by means class of triketones, such as tembotrione, Sulcotrione and of commercially available bead mills, if appropriate with mesotrione, or of the class of pyrazolinates, such as pyrasul addition of surfactants as already listed above for example in fotole and toprameZone, particularly selected from tembotri the case of the other formulation types. one, Sulcotrione, toprameZone, bicyclopyrone, tefuryltrione 0109 Emulsions, for example oil-in-water emulsions and mesotrione, more particularly tembotrione with other (EW), can be prepared for example by means of stirrers, pesticidally active Substances such as, for example, insecti colloid mills and/or static mixers using aqueous organic Sol cides, acaricides, herbicides, fungicides, and with Safeners, vents and, if appropriate, Surfactants, as have already been fertilizers and/or growth regulators, for example in the form mentioned for example above for the otherformulation types. of a ready mix or a tank mix to be applied to HPPD tolerant 0110 Granules can be prepared either by spraying the plants according to the invention. active Substance onto adsorptive, granulated inert material, or by applying active substance concentrates to the Surface of FORMULATION EXAMPLES carriers such as sand, kaolinites or granulated inert material 0118 a) Adust is obtained by mixing 10 parts by weight of with the aid of stickers, for example polyvinyl alcohol, a compound of the formula (I) and/or a salt thereof and 90 Sodium polyacrylate or else mineral oils. parts by weight of talc as inert Substance and comminuting 0111 Suitable active substances can also be granulated in the mixture in a hammer mill. the manner which is customary for the production offertilizer 0119 b) A wettable powder which is readily dispersible in granules, if desired as a mixture with fertilizers. water is obtained by mixing 25 parts by weight of a com 0112 Water-dispersible granules are generally prepared pound of the formula (I) and/or a salt thereof, 64 parts by by customary methods such as spray drying, fluidized-bed weight of kaolin-containing quartz as inert Substance, 10 granulation, disk granulation, mixing with high-speed stir parts by weight of potassium lignoSulfonate and 1 part by rers, and extrusion without solid inert material. weight of Sodium oleoylmethyltaurinate as wetting agent 0113 To prepare disk granules, fluidized-bed granules, and dispersant, and grinding the mixture in a pinned-disk extruder granules and spray granules, see, for example, meth mill. ods in “Spray-Drying Handbook' 3rd ed. 1979, G. Goodwin I0120 c) A readily water-dispersible dispersion concen Ltd., London; J. E. Browning, "Agglomeration’, Chemical trate is obtained by mixing 20 parts by weight of a com and Engineering 1967, pages 147 et seq.; “Perry's Chemical pound of the formula (I) and/or a salt thereof with 6 parts by Engineers Handbook”, 5th Ed., McGraw-Hill, New York weight of alkylphenol polyglycol ether (RTriton X 207), 3 1973, p. 8-57. parts by weight of isotridecanol polyglycol ether (8 EO) 0114 For further details of the formulation of crop pro and 71 parts by weight of paraffinic mineral oil (boiling tection products see, for example, G. C. Klingman, “Weed range for example about 255 to above 277°C.) and grind Control as a Science'. John Wiley and Sons, Inc., New York, ing the mixture in a ball mill to a fineness of below 5 1961, pages 81-96 and J. D. Freyer, S. A. Evans, “Weed microns. US 2014/0066307 A1 Mar. 6, 2014 74

0121 d) An emulsifiable concentrate is obtained from 15 144079, PCT/EP2010/070561, PCT/EP2010/070567, PCT/ parts by weight of a compound of the formula (I) and/or a EP2010/070578, PCT/EP2010/070570, or PCT/EP2010/ salt thereof, 75 parts by weight of cyclohexanone as solvent 07.0575 in combination with further HPPD inhibitor and 10 parts by weight of oxethylated nonylphenol as herbicide belonging to the class of triketones, such as tem emulsifier. botrione, Sulcotrione and mesotrione, or belonging to the 0122 e) Water-dispersible granules are obtained by mix class of pyrazolinates, such as pyrasulfotole and topram ing eZone, particularly selected from tembotrione, Sulcotrione, I0123 75 parts by weight of a compound of the formula toprameZone, bicyclopyrone, tefuryltrione and mesotrione, (I) and/or a salt thereof, more particularlytembotrione in mixed formulations or in the 0.124 10 parts by weight of calcium lignosulfonate, tank mix, and/or with further known active substances which 0.125 5 parts by weight of sodium lauryl sulfate, are based on the inhibition of for example, acetolactate Syn 0.126 3 parts by weight of polyvinyl alcohol and thase, acetyl-CoA carboxylase, cellulose synthase, enolpyru I0127 7 parts by weight of kaolin, Vylshikimate-3-phosphate synthase, glutamine synthetase, I0128 grinding the mixture in a pinned-disk mill, and p-hydroxyphenylpyruvate dioxygenase, phytoene desatu granulating the powder in a fluidized bed by spraying on rase, photosystem I, photosystem II, protoporphyrinogen oxi water as granulating liquid. dase, as are described in, for example, Weed Research 26 0129 f) Water-dispersible granules are also obtained by (1986) 441-445 or “The Pesticide Manual, 14th edition, The homogenizing and precomminuting, in a colloid mill, British Crop Protection Council and the Royal Soc. of Chem 0.130 25 parts by weight of a compound of the formula istry, 2003 and the literature cited therein. Known herbicides (I) and/or a salt thereof, or plant growth regulators which can be combined with the I0131 5 parts by weight of sodium 2,2'-dinaphthyl compounds according to the invention are, for example, the methane-6,6'-disulfonate, following active Substances (the compounds are either desig I0132) 2 parts by weight of sodium oleoylmethyltauri nated by the common name according to the International nate, Organization for Standardization (ISO) or by a chemical 0.133 1 part by weight of polyvinyl alcohol, name, if appropriate together with the code number) and 0.134 17 parts by weight of calcium carbonate and always comprise all use forms such as acids, salts, esters and I0135 50 parts by weight of water, isomers such as stereoisomers and optical isomers. In this 0.136 subsequently grinding the mixture in a bead mill context, one and in Some cases also several use forms are and atomizing and drying the resulting Suspension in a mentioned by way of example: spray tower by means of a single-substance nozzle. acetochlor, acibenzolar, acilbenzolar-5-methyl, acifluorfen, 0.137 A further aspect of present invention is the use of acifluorfen-sodium, aclonifen, alachlor, allidochlor, alloxy one or more N-(1,2,5-oxadiazol-3-yl)benzamides whose dim, alloxydim-Sodium, ametryne, amicarbazone, amidoch phenyl ring is Substituted in the 2-, 3- and 4-position by lor, amidosulfuron, aminocyclopyrachlor, aminopyralid, selected radicals as defined above or their salts to HPPD amitrole, ammonium Sulfamate, ancymidol, anilofos, asu tolerant plants containing one or more chimeric gene(s) (I) lam, atrazine, azafenidin, azimsulfuron, aziprotryne. BAH comprising a DNA sequence encoding hydroxyphenylpyru 043, BAS-140H, BAS-693H, BAS-714H, BAS-762H, BAS vate dioxygenase (HPPD) derived from a member of a group 776H, BAS-800H, beflubutamid, benazolin, benazolin-ethyl, of organisms, consisting of (a) Avena, preferably Avena bencarbazone, benfluralin, benfuresate, bensulide, bensulfu sativa, more preferably comprising a DNA sequence identi ron-methyl, bentaZone, benzfendizone, benzobicyclon, ben cal to SEQID No. 1 encoding HPPD defined by SEQID No. Zofenap, benzofluor, benzoylprop, bifenox, bilanafos, 2, (b) Pseudomonas, preferably Pseudomonas fluorescens, bilanafos-Sodium, bispyribac, bispyribac-Sodium, bromacil, more preferably comprising a DNA sequence identical to bromobutide, bromofenoxim, bromoxynil, bromuron, SEQID No. 3 encoding HPPD defined by SEQID No. 4, (c) buminafos, buSoxinone, butachlor, butafenacil, butamifos, Synechococcoideae, preferably Synechococcus sp., more butenachlor, butralin, butroxydim, butylate, cafenstrole, car preferably comprising a DNA sequence identical to SEQID betamide, carfentraZone, carfentraZone-ethyl, chlomethoxy No. 6, encoding HPPD defined by SEQ ID No. 7, (d) Ble fen, chloramben, chlorazifop, chlorazifop-butyl, chlorbro pharismidae, preferably Blepharisma japonicum, more pref muron, chlorbufam, chlorfenac, chlorfenac-Sodium, erably comprising a DNA sequence identical to SEQID No. chlorfemprop, chlorflurenol, chlorflurenol-methyl, chlorida 8 encoding HPPD defined by SEQID No. 9, (e) Rhodococ Zon, chlorimuron, chlorimuron-ethyl, chlormeduat-chloride, cus, preferably Rhodococcus sp. (strain RHA1), isolate chlornitrofen, chlorophthalim, chlorthal-dimethyl, chloro ro03.04.1 more preferably comprising a DNA sequence iden toluron, chlorSulfuron, cinidon, cinidon-ethyl, cinmethylin, tical to SEQID No. 10 encoding HPPD defined by SEQ ID cinosulfuron, clethodim, clodinafop clodinafop-propargyl. No. 11, or Rhodococcus sp. (strain RHA1), isolate ro02040, clofencet, clomaZone, clomeprop, cloprop, clopyralid, clo more preferably comprising a DNA sequence identical to ranSulam, cloranSulam-methyl, cumyluron, cyanamide, SEQID No.12 encoding HPPD defined by SEQID No. 13, (f) cyanazine, cyclanilide, cycloate, cyclosulfamuron, cycloxy Picrophilaceae, preferably Picrophilus torridus, more prefer dim, cycluron, cyhalofop, cyhalofop-butyl, cyperquat, cypra ably comprising a DNA sequence identical to SEQID No. 14 Zine, cyprazole, 2,4-D, 2.4-DB, daimuron/dymron, dalapon, encoding HPPD defined by SEQ ID No. 15, (g) Kordia, daminozide, dazomet, n-decanol, desmedipham, desmetryn, preferably Kordia algicida, more preferably comprising a detosyl-pyrazolate (DTP), di-allate, dicamba, dichlobenil, DNA sequence identical to SEQID No. 16 encoding HPPD dichlorprop, dichlorprop-P, diclofop, diclofop-methyl, diclo defined by SEQ ID No. 17 or (II) comprising one or more fop-P-methyl, diclosulam, diethatyl, diethatyl-ethyl, mutated DNA sequences of HPPD encoding genes of the difenoXuron, difenZoquat, diflufenican, diflufenZopyr, before defined organisms, preferably mutants as described in diflufenZopyr-sodium, dimefuron, dikegulac-Sodium, dime WO 2010/085705, U.S. Pat. No. 6,245,968, WO 2009/ furon, dimepiperate, dimethachlor, dimethametryn, dimeth US 2014/0066307 A1 Mar. 6, 2014

enamid, dimethenamid-P, dimethipin, dimetrasulfuron, dinit line, profoxydim, prohexadione, prohexadione-calcium, pro ramine, dinoseb, dinoterb, diphenamid, dipropetryn, diguat, hydrojasmone, prometon, prometryn, propachlor, propanil, diquat-dibromide, dithiopyr, diuron, DNOC, eglinazine propaquizafop, propazine, propham, propisochlor, propoxy ethyl, endothal, EPTC, esprocarb, ethalfluralin, ethametsul carbazone, propoxycarbazone-sodium, propyZamide, prosul furon-methyl, ethephon, ethidimuron, ethiozin, ethofume falin, prosulfocarb, prosulfuron, prynachlor, pyraclonil. sate, ethoxyfen, ethoxyfen-ethyl, ethoxysulfuron, pyraflufen, pyraflufen-ethyl, pyrazolynate (pyrazolate), pyra etobenzanid, F-5331, i.e. N-2-chloro-4-fluoro-5-4-(3- ZoSulfuron-ethyl, pyrazoxyfen, pyribambenz, pyribambenz fluoro-propyl)-4,5-dihydro-5-oxo-1H-tetrazol-1-yl-phenyl isopropyl pyribenZOXim, pyributicarb, pyridafol, pyridate, ethanesulfonamide, fenoprop, fenoxaprop, fenoxaprop-P, pyriftalid, pyriminobac, pyriminobac-methyl, pyrimisulfan, fenoxaprop-ethyl, fenoxaprop-P-ethyl, fentraZamide, fenu pyrithiobac, pyrithiobac-Sodium, pyroxasulfone, pyroxSu ron, flamprop, flamprop-M-isopropyl, flamprop-M-methyl, lam, quinclorac, quinmerac, quinoclamine, quizalofop, flazasulfuron, florasulam, fluazifop, fluazifop-P, fluazifop quizalofop-ethyl, quizalofop-P, quizalofop-P-ethyl, quizalo butyl, fluazifop-P-butyl, fluazolate, flucarbazone, flucarba fop-P-tefuryl, rimsulfuron, saflufenacil, secbumeton, set Zone-sodium, flucetosulfuron, fluchloralin, flufenacet (thi hoxydim, siduron, simazine, simetryn, SN-106279, sulf-al afluamide), flufenpyr, flufenpyr-ethyl, flumetralin, late (CDEC), sulfentraZone, sulfometuron, sulfometuron flumetSulam, flumiclorac, flumiclorac-pentyl, flumioxazin, methyl, Sulfosate (glyphosate-trimesium), Sulfosulfuron, flumipropyn, fluometuron, fluorodifen, fluoroglycofen, fluo SYN-523, SYP-249, SYP-298, SYP-300, tebutam, tebuthi roglycofen-ethyl, flupoxam, flupropacil, flupropanate, uron, tecnaZene, tepraloxydim, terbacil, terbucarb, ter flupyrsulfuron, flupyrsulfuron-methyl-sodium, flurenol, buchlor, terbumeton, terbuthylazine, terbutryne, TH-547, flurenol-butyl, fluridone, fluorochloridone, fluoroxypyr, flu thenylchlor, thiafluamide, thiazafluoron, thiazopyr, thidiaz oroxypyr-meptyl, flurprimidol, flurtamone, fluthiacet, fluthi imin, thidiaZuron, thiencarbazone, thiencarbazone-methyl, acet-methyl, fluthiamide, fomesafen, foramsulfuron, forchlo rfenuron, fosamine, furyloxyfen, gibberellic acid, thifensulfuron, thifensulfuron-methyl, thiobencarb, tiocarba glufosinate, L-glufosinate, L-glufosinate-ammonium, glufo Zil, tralkoxydim, tri-allate, triasulfuron, triaziflam, triazofe sinate-ammonium, glyphosate, glyphosate-isopropylammo namide, tribenuron, tribenuron-methyl, trichloroacetic acid nium, H-9201, halosafen, halosulfuron, halosulfuron-me (TCA), triclopyr, tridiphane, trietazine, trifloxysulfuron, tri thyl, haloxyfop, haloxyfop-P, haloxyfop-ethoxyethyl, floxysulfuron-sodium, trifluralin, triflusulfuron, triflusulfu haloxyfop-P-ethoxyethyl, haloxyfop-methyl, haloxyfop-P- ron-methyl, trimeturon, trinexapac, trinexapac-ethyl, trito methyl, hexazinone, HNPC-9908, HOK-201, HW-02, Sulfuron, tsitode?, uniconazole, uniconazole-P. Vernolate, imazamethabenZ, imazamethabenz-methyl, imaZamox, ZJ-0166, ZJ-0270, ZJ-0543, ZJ-0862 and the following com imazapic, imazapyr, imaZaquin, imazethapyr, imaZoSulfuron, pounds inabenfide, indanofan, indoleacetic acid (IAA), 4-indol-3-

ylbutyric acid (IBA), iodosulfuron, iodosulfuron-methyl-so dium, ioxynil, isocarbamid, isopropalin, isoproturon, isou ron, isoxaben, isoxachlortole, isoxaflutole, isoxapyrifop, KUH-043, KUH-071, karbutilate, ketospiradox, lactofen, lenacil, linuron, maleic hydrazide, MCPA, MCPB, MCPB methyl, -ethyl and -sodium, mecoprop, mecoprop-sodium, mecoprop-butotyl, mecoprop-P-butotyl, mecoprop-P-dim ethylammonium, mecoprop-P-2-ethylhexyl, mecoprop-P- potassium, mefenacet, mefluidide, mepiduat-chloride, meso Sulfuron, mesosulfuron-methyl, methabenzthiaZuron, metam, metamifop, metamitron, metaZachlor, methazole, methoxyphenone, methyldymron, 1-methylcyclopropene, methyl isothiocyanate, metobenzuron, metobenzuron, meto bromuron, metolachlor, S-metolachlor, metoSulam, metoXu ron, metribuzin, metSulfuron, metSulfuron-methyl, molinate, monalide, monocarbamide, monocarbamide dihydrogen Sul fate, monolinuron, monosulfuron, monuron, MT 128, MT-5950, i.e. N4-3-chloro-4-(1-methylethyl)-phenyl-2- methylpentanamide, NGGC-011, naproanilide, napropam ide, naptalam, NC-310, i.e. 4-(2,4-dichlorobenzoyl)-1-me thyl-5-benzyloxypyrazole, neburon, nicosulfuron, nipyraclofen, nitralin, nitrofen, nitrophenolat-sodium (iso mer mixture), nitrofluorfen, nonanoic acid, norflurazon, orbencarb, orthosulfamuron, oryzalin, oxadiargyl, oxadia EtOCCH2O Zon, oxasulfuron, oxaziclomefone, oxyfluorfen, paclobutra O H3C Zole, paraquat, paraquat dichloride, pelargonic acid CH3CH3 (nonanoic acid), pendimethalin, pendralin, penoXSulam, pen tanochlor, pentoxazone, perfluidone, pethoxamid, phen ( isopham, phenmedipham, phenmedipham-ethyl, picloram, Y S picolinafen, pinoxaden, piperophos, pirifenop, pirifenop-bu M OH MV tyl, pretilachlor, primisulfuron, primisulfuron-methyl, H3C O O probenazole, profluaZol, procyazine, prodiamine, priflura US 2014/0066307 A1 Mar. 6, 2014 76

-continued ably Pseudomonas fluorescens, more preferably comprising a O HC DNA sequence identical to SEQ ID No. 3 encoding HPPD defined by SEQID No. 4, (c) Synechococcoideae, preferably Synechococcus sp., more preferably comprising a DNA sequence identical to SEQID No. 6, encoding HPPD defined by SEQ ID No. 7, (d) Blepharismidae, preferably Blepha O O risma japonicum, more preferably comprising a DNA sequence identical to SEQID No. 8 encoding HPPD defined by SEQID No. 9, (e) Rhodococcus, preferably Rhodococcus sp. (strain RHA1), isolate ro03.04.1 more preferably compris 0.138. The application rate required of an N-(1,2,5-oxadia ing a DNA sequence identical to SEQ ID No. 10 encoding Zol-3-yl)benzamides whose phenyl ring is substituted in the HPPD defined by SEQID No. 11 or Rhodococcus sp. (strain 2-, 3- and 4-position by selected radicals as defined above or RHA1), isolate ro02040, more preferably comprising a DNA their salts to be applied to areas where HPPD tolerant plants sequence identical to SEQID No. 12 encoding HPPD defined containing one or more chimeric gene(s) (I) comprising a by SEQID No. 13, (f) Picrophilaceae, preferably Picrophilus DNA sequence encoding hydroxyphenylpyruvate dioxyge torridus, more preferably comprising a DNA sequence iden nase (HPPD) derived from a member of a group of organisms tical to SEQ ID No. 14 encoding HPPD defined by SEQ ID consisting of (a) Avena, preferably Avena sativa, more pref No. 15, (g) Kordia, preferably Kordia algicida, more prefer erably comprising a DNA sequence identical to SEQID No. ably comprising a DNA sequence identical to SEQID No. 16 1 encoding HPPD defined by SEQID No. 2, (b) Pseudomo nas, preferably Pseudomonas fluorescens, more preferably encoding HPPD defined by SEQID No. 17 or (II) comprising comprising a DNA sequence identical to SEQ ID No. 3 one or more mutated DNA sequences of HPPD encoding encoding HPPD defined by SEQID No. 4, (c) Synechococ genes of the before defined organisms, preferably mutants as coideae, preferably Synechococcus sp., more preferably com described in WO 2010/085705, U.S. Pat. No. 6,245,968, WO prising a DNA sequence identical to SEQID No. 6, encoding 2009/144079, PCT/EP2010/070561, PCT/EP2010/070567, HPPD defined by SEQID No. 7, (d) Blepharismidae, prefer PCT/EP2010/070578, PCT/EP2010/070570, or PCT/ ably Blepharisma japonicum, more preferably comprising a EP2010/070575, these mixtures may cause crop injury, based DNA sequence identical to SEQ ID No. 8 encoding HPPD on the presence herbicides different to N-(1,2,5-oxadiazol-3- defined by SEQ ID No. 9, (e) Rhodococcus, preferably yl)benzamides whose phenyl ring is substituted in the 2-, 3 Rhodococcus sp. (strain RHA1), isolate ro03.04.1 more pref and 4-position by selected radicals as defined above or their erably comprising a DNA sequence identical to SEQID No. salts. In order to reduce/eliminate such crop injuries, appro 10 encoding HPPD defined by SEQID No. 11 or Rhodococ priate safeners may be added. These safeners, which are cus sp. (strain RHA1), isolate ro02040, more preferably com employed in antidotically active amounts, reduce the phyto prising a DNA sequence identical to SEQID No. 12 encoding toxic side effects of herbicides/pesticides used, for example HPPD defined by SEQID No. 13, (f) Picrophilaceae, prefer in economically important crops, such as cereals (wheat, ably Picrophilus torridus, more preferably comprising a barley, rye, corn, rice, millet), alfalfa, Sugar beet, Sugarcane, DNA sequence identical to SEQID No. 14 encoding HPPD oilseed rape, cotton and soya spp., preferably corn, cotton, defined by SEQ ID No. 15, (g) Kordia, preferably Kordia Sugarbeet, or soya spp. algicida, more preferably comprising a DNA sequence iden 0140. The safeners are preferably selected from the group tical to SEQID No. 16 encoding HPPD defined by SEQ ID consisting of: No. 17, or (II) comprising one or more mutated DNA sequences of HPPD encoding genes of the before defined A) compounds of the formula (S-I) organisms, preferably mutants as described in WO 2010/ 085705, U.S. Pat. No. 6,245,968, WO 2009/144079, PCT/ EP2010/070561, PCT/EP2010/070567, PCT/EP2010/ (S-I) 07.0578, PCT/EP2010/070570, or PCT/EP2010/070575 are 1N O growing varies as a function of the external conditions such as (R'), l temperature, humidity, the nature of the herbicide used and 2 W R? the like. It can vary within wide limits, for example between 0.001 and 1.0 kg/ha and more of active substance, but it is preferably between 0.005 and 750 g/ha. 0.139. In case of combined applications of N-(1,2,5-oxa where the symbols and indices have the following meanings: diazol-3-yh)benzamides whose phenyl ring is substituted in I0141 n is a natural number from 0 to 5, preferably from the 2-, 3- and 4-position by selected radicals as defined above O to 3: or their salts herbicides that differ from HPPD N-(1,2,5- I0142 R is halogen, (C-C)-alkyl, (C-C)-alkoxy, nitro oxadiazol-3-yh)benzamides whose phenyl ring is Substituted or (C-C)-haloalkyl; in the 2-, 3- and 4-position by selected radicals as defined above or their salts to the HPPD tolerant plants containing one I0143 W is an unsubstituted or substituted divalent het or more chimeric gene(s) (I) comprising a DNA sequence erocyclic radical from the group consisting of partially encoding hydroxyphenylpyruvate dioxygenase (HPPD) unsaturated or aromatic five-membered heterocycles hav derived from a member of a group of organisms, consisting of ing 1 to 3 hetero ring atoms of the type N or O, where at (a) Avena, preferably Avena sativa, more preferably compris least one nitrogen atom and at most one oxygen atom is ing a DNA sequence identical to SEQ ID No. 1 encoding present in the ring, preferably a radical from the group HPPD defined by SEQ ID No. 2, (b) Pseudomonas, prefer consisting of (W) to (W), US 2014/0066307 A1 Mar. 6, 2014 77

c) compounds of the type of the triazolecarboxylic acids, preferably compounds Such as fenchlorazole(-ethyl ester), N (W) i.e. ethyl 1-(2,4-dichlorophenyl)-5-trichloro-methyl-(1H)-1, NY N 2,4-triazole-3-carboxylate (S1-6), and related compounds, as described in EP-A-174562 and EP-A-346 620; d) compounds of the type of the 5-benzyl- or 5-phenyl-2- R. R. isoxazoline-3-carboxylic acid or the 5,5-diphenyl-2-isoxazo N (W) line-3-carboxylic acid, preferably compounds such as ethyl 5-(2,4-dichlorobenzyl)-2-isoxazoline-3-carboxylate (S1-7) NY N or ethyl 5-phenyl-2-isoxazoline-3-carboxylate (S1-8) and related compounds, as described in WO 91/08202, or ethyl 5,5-diphenyl-2-isoxazolinecarboxylate (S1-9) (“isoxadifen R ethyl) or n-propyl 5,5-diphenyl-2-isoxazolinecarboxylate N (W) (S1-10) or ethyl 5-(4-fluorophenyl)-5-phenyl-2-isoxazoline 3-carboxylate (S1-11), as described in the patent application NY Y WO-A-95/07897. B) Quinoline derivatives of the formula (S-III) R)= (W) (S-II) 21 N21 "Dr.-R ? O-N (R'), N 1s O 0144 m is 0 or 1; O ls (0145 R is OR, SR or NR'R' or a saturated NT, Rp. 0146 or unsaturated 3- to 7-membered heterocycle having at least one nitrogen atom and up to 3 heteroat where the symbols and indices have the following meanings: oms, preferably from the group consisting of O and S. R" is halogen, (C-C)-alkyl, (C-C)-alkoxy, nitro or (C- which is attached via the nitrogen atom to the carbonyl Cl)-haloalkyl; group in (S I) and which is unsubstituted or substituted n is a natural number from 0 to 5, preferably from 0 to 3: by radicals from the group consisting of (C-C)-alkyl, ROR, SR or NR'R' or a saturated or unsaturated 3 (C-C)-alkoxy and optionally substituted phenyl, pref to 7-membered heterocycle having at least one nitrogenatom erably a radical of the formula OR, NHR, or N(CH) and up to 3 heteroatoms, preferably from the group consisting 2, in particular of the formula OR; of O and S, which is attached via the nitrogen atom to the 0147 R is hydrogen or an unsubstituted or substituted carbonyl group in (S-II) and is unsubstituted or substituted by aliphatic hydrocarbon radical having preferably a total of 1 radicals from the group consisting of (C-C)-alkyl, (C-C)- to 18 carbon atoms; alkoxy or optionally substituted phenyl, preferably a radical 0148 R is hydrogen, (C-C)-alkyl, (C-C)-alkoxy or of the formula OR, NHR' or N(CH), in particular of the substituted or unsubstituted phenyl: formula OR; I0149 R is H., (C-Cs)-alkyl, (C-Cs)-haloalkyl), (C- R is hydrogen or an unsubstituted or substituted aliphatic Cl)-alkoxy-(C-C)-alkyl, cyano or COOR, where R is hydrocarbon radical having preferably a total of 1 to 18 car hydrogen, (C-C)-alkyl, (C-C)-haloalkyl, (C-C)- bon atoms; alkoxy-(C-C)-alkyl, (C-C)-hydroxyalkyl, (C-C)- R" is hydrogen, (C-C)-alkyl, (C-C)-alkoxy or substi cycloalkyl or tri-(C-C)-alkylsilyl; tuted or unsubstituted phenyl: T is a (C- or C)-alkanediyl chain which is unsubstituted or 0150. R. R. R. are identical or different and are substituted by one or two (C-C)-alkyl radicals or by (C- hydrogen, (C-C)-alkyl, (C-C)-haloalkyl, (C-C)-cy C)-alkoxycarbonyl: cloalkyl or substituted or unsubstituted phenyl: preferably: preferably: a) compounds of the type of the 8-quinolinoxyacetic acid a) compounds of the type of the dichlorophenylpyrazoline-3- (S2), preferably 1-methylhexyl (5-chloro-8-quinolinoxy)ac carboxylic acid, preferably compounds such as ethyl 1-(2,4- etate (common name "cloquintocet-mexyl (S2-1) (see Pes dichlorophenyl)-5-(ethoxycarbonyl)-5-methyl-2-pyrazo tic. Man.), line-3-carboxylate (S1-1) (“mefenpyr-diethyl, see Pestic. 0151 1,3-dimethylbut-1-yl (5-chloro-8-quinolinoxy)ac Man.), and related compounds, as described in WO etate (S2-2), 91/07874; 0152 4-allyloxybutyl (5-chloro-8-quinolinoxy)acetate b) derivatives of dichlorophenylpyrazolecarboxylic acid, (S2-3), preferably compounds Such as ethyl 1-(2,4-dichlorophenyl)- 0153. 1-allyloxyprop-2-yl (5-chloro-8-quinolinoxy)ac 5-methylpyrazole-3-carboxylate (S1-2), ethyl 1-(2,4-dichlo etate- (S2-4), rophenyl)-5-isopropylpyrazole-3-carboxylate (S1-3), ethyl 0154 ethyl (5-chloro-8-quinolinoxy)acetate (S2-5), 1-(2,4-dichlorophenyl)-5-(1,1-dimethylethyl)pyrazole-3- 0155 methyl (5-chloro-8-quinolinoxy)acetate (S2-6). carboxylate (S1-4), ethyl 1-(2,4-dichlorophenyl)-5-phe 0156 allyl (5-chloro-8-quinolinoxy)acetate (S2-7), nylpyrazole-3-carboxylate (S1-5) and related compounds, as 0157 2-(2-propylideneiminoxy)-1-ethyl (5-chloro-8- described in EP-A-333 131 and EP-A-269806; quinolinoxy)acetate (S2-8), 2-oxoprop-1-yl (5-chloro-8- US 2014/0066307 A1 Mar. 6, 2014

quinolinoxy)acetate (S2-9) and related compounds, as described in EP-A-86 750, EP-A-94 349 and EP-A-191 4 (S-IV) 736 or EP-A-0492366, and also their hydrates and salts, as O Rip O (RD).np described in WO-A-2002/034048. R/FYC | D S4^S b) Compounds of the type of the (5-chloro-8-quinolinoxy) malonic acid, preferably compounds such as diethyl {) O- CX5 (5-chloro-8-quinolinoxy)malonate, diallyl (5-chloro-8- (RD),D quinolinoxy)malonate, methyl ethyl (5-chloro-8-quinoli noxy)malonate and related compounds, as described in EP A-O 582 198. in which C) Compounds of the formula (S-III) X, is CH or N: R" is CO NRR, or NHCO-R,": (S-III) O (0167 R is halogen, (C-C)-haloalkyl, (C-C)-ha loalkoxy, nitro, (C-C)-alkyl, (C-C)-alkoxy, (C-C)- ls Y R? alkylsulfonyl, (C-C)-alkoxycarbonyl or (C-C)-alkylcar RC bonyl: R. R is hydrogen, (C-C)-alkyl, (C-C)-alkenyl or (C-C)- alkynyl: R" is halogen, nitro, (C-C)-alkyl, (C-C)-haloalkyl, (C- where the symbols and indices have the following meanings: Cl)-haloalkoxy, (C-C)-cycloalkyl, phenyl, (C-C)-alkoxy, R" is (C-C)-alkyl, (C-C)-haloalkyl, (C-C)-alkenyl, cyano, (C-C)-alkylthio, (C-C)-alkylsulfinyl, (C-C)- (C-C)-haloalkenyl, (C-C)-cycloalkyl, preferably dichlo alkylsulfonyl, (C-C)-alkoxycarbonyl or (C-C)-alkylcar romethyl: bonyl: R. Rare identical or different and are hydrogen, (C-C)- Riis hydrogen, (C-C)-alkyl, (C-C)-cycloalkyl, (C-C)- alkyl, (C-C)-alkenyl, (C-C)-alkynyl, (C-C)-haloalkyl, alkenyl, (C-C)-alkynyl, (C-C)-cycloalkenyl, phenyl or 3 (C-C)-haloalkenyl, (C-C)-alkylcarbamoyl-(C-C)- to 6-membered heterocyclyl containing V, heteroatoms from alkyl, (C-C)-alkenylcarbamoyl-(C-C)-alkyl, (C-C)- the group consisting of nitrogen, oxygen and sulfur, where the alkoxy-(C-C)-alkyl, dioxolanyl-(C-C)-alkyl, thiazolyl, seven last-mentioned radicals are substituted by V, Substitu furyl, furylalkyl, thienyl, piperidyl, substituted or unsubsti ents from the group consisting of halogen, (C-C)-alkoxy, tuted phenyl, or R and R together form a substituted or (C-C)-haloalkoxy, (C-C)-alkylsulfinyl, (C-C)-alkylsul unsubstituted heterocyclic ring, fonyl, (C-C)-cycloalkyl, (C-C)-alkoxycarbonyl, (C-C)- alkylcarbonyl and phenyl and, in the case of cyclic radicals, preferably an oxazolidine, thiazolidine, piperidine, morpho also (C-C)-alkyl and (C-C)-haloalkyl; line, hexahydropyrimidine or benzoxazine ring; R, is hydrogen, (C-C)-alkyl, (C-C)-alkenyl or (C-C)- preferably: alkynyl, where the three last-mentioned radicals are substi 0158 Active compounds of the type of the dichloroaceta tuted by V, radicals from the group consisting of halogen, mides which are frequently used as pre-emergence safener hydroxy, (C-C)-alkyl, (C-C)-alkoxy and (C-C)-alky (Soil-acting safeners). Such as, for example, lthio, or 0159) “dichlormid' (see Pestic. Man.) (—N,N-diallyl-2.2- R, and R, together with the nitrogen atom carrying them form a pyrrolidinyl or piperidinyl radical; dichloroacetamide), R’ is hydrogen, (C-C)-alkylamino, di-(C-C)-alky (0160 “R-29148” (3-dichloroacetyl-2,2,5-trimethyl-1,3- lamino, (C-C)-alkyl, (C-C)-cycloalkyl, where the 2 last oxazolidine from Stauffer), mentioned radicals are substituted by V, Substituents from the (0161 “R-28725” (3-dichloroacetyl-2,2-dimethyl-1,3- group consisting of halogen, (C-C)-alkoxy, halogen-(C- oxazolidine from Stauffer), C)-alkoxy and (C-C)-alkylthio and, in the case of cyclic 0162 “benoxacor (see Pestic. Man.) (=4-dichloroacetyl radicals, also (C-C)-alkyl and (C-C)-haloalkyl; 3,4-dihydro-3-methyl-2H-1,4-benzoxazine), n, is 0, 1 or 2: (0163 “PPG-1292 (—N-allyl-N-(1,3-dioxolan-2-yl)me m, is 1 or 2; thyldichloroacetamide from PPG Industries), V, is 0, 1, 2 or 3: 0164 “DKA-24” (=N-allyl-N-(allylaminocarbonyl) from among these, preference is given to compounds of the methyldichloroacetamide from Sagro-Chem), type of the N-acylsulfonamides, for example of the formula (S-V) below, which are known, for example, from WO (0165 “AD-67 or “MON 4660” (=3-dichloroacetyl-1- 97/45O16 oxa-3-aza-spiro4.5 decane from Nitrokemia or Mon Santo). (0166 “TI-35” (=1-dichloroacetylazepane from TRI Chemical RT) “diclonon' (dicyclonone) or “BAS145138” or “LAB145138” (=3-dichloroacetyl-2.5.5-trimethyl-1,3- diazabicyclo4.3.0nonane from BASF) and “furilazole' or “MON 13900” (see Pestic. Man.) (=(RS)-3-dichloro acetyl-5-(2-furyl)-2,2-dimethyloxazolidine). D) N-Acylsulfonamides of the Formula (S-IV) and their Salts US 2014/0066307 A1 Mar. 6, 2014 79 in which described in WO 2004084631, WO 2005015994, WO R" is (C-C)-alkyl, (C-C)-cycloalkyl, where the 2 last 2006007981, WO 2005016001; mentioned radicals are substituted by V, substituents from H) active compounds from the class of the 1,2-dihydroqui the group consisting of halogen, (C-C)-alkoxy, halogen noxalin-2-ones, for example 1-methyl-3-(2-thienyl)-1,2-di (C-C)-alkoxy and (C-C)-alkylthio and, in the case of hydroquinoxalin-2-one, 1-methyl-3-(2-thienyl)-1,2-dihydro cyclic radicals, also (C-C)-alkyl and (C-C)-haloalkyl; quinoxaline-2-thione, 1-(2-aminoethyl)-3-(2-thienyl)-1,2- R" is halogen, (C-C)-alkyl, (C-C)-alkoxy, CFs, dihydroquinoxalin-2-one hydrochloride, 1-(2- m, is 1 or 2; methylsulfonylaminoethyl)-3-(2-thienyl)-1,2-dihydro V, is 0, 1, 2 or 3: quinoxalin-2-one, as described in WO 2005.112630, and also I) active compounds which, in addition to a herbicidal action acylsulfamoylbenzamides, for example of the formula (S-VI) against harmful plants, also have safeneraction on crop plants below, which are known, for example, from WO 99/16744, such as rice, such as, for example, “dimepiperate' or “MY 93 (see Pestic. Man.) (=S-1-methyl-1-phenylethyl piperi dine-1-thiocarboxylate), which is known as safener for rice (S-VI) against damage by the herbicide molinate, Rp. “daimuron’ or “SK23 (see Pestic. Man.) (=1-(1-methyl-1- - -N O (RD").np phenylethyl)-3-p-tolyl-urea), which is known as safener for rice against damage by the herbicide imaZosulfuron, O I h “cumyluron’="JC-940” (3-(2-chlorophenylmethyl)-1-(1- methyl-1-phenyl-ethyl)urea, see JP-A-60087254), which is known as safener for rice against damage by a number of for example those in which herbicides, “methoxyphenone” or “NK 049 (3,3'-dim Re-cyclopropyl and (R)-2-OMe ("cyprosulfamide', ethyl-4-methoxybenzophenone), which is known as Safener S3-1), for rice against damage by a number of herbicides, “CSB' Re-cyclopropyl and (R)=5-C1-2-OMe (S3-2), (=1-bromo-4-(chloromethylsulfonyl)benzene) (CAS Reg. R=ethyl and (R)=2-OMe (S3-3), No. 54091-06-4 from Kumiai), which is known as safener Re-isopropyl and (R)=5-C1-2-OMe (S3-4) and against damage by a number of herbicides in rice, R-isopropyl and (R)-2-OMe (S3-5); and also K) compounds of the formula (S-IIX), compounds of the type of the N-acylsulfamoylphenylureas of (0172 as described in WO-A-1998/38856 the formula (S-VII), which are known, for example, from EP-A-365484 (S-LX) A (S-VII) He1 R8 Q O O o 4 (p. &N N S-N- I ( )." C RD H O H (RK)K2 - - H(R) 2 21 in which R, and R, independently of one another are hydrogen, in which the symbols and indices have the following mean (C-C)-alkyl, (C-C)-cycloalkyl, (C-C)-alkenyl, (C- ings: C)-alkynyl, R. R. independently of one another are halogen, (C-C)- R" is halogen, (C-C)-alkyl, (C-C)-alkoxy, CF alkyl, (C-C)-alkoxy, (C-C)-haloalkyl, (C-C)-alky m, is 1 or 2; from among these in particular lamino, di-(C-C)-alkylamino, nitro: (0168 1-4-(N-methoxybenzoylsulfamoyl)phenyl-3- methylurea, A is COOR or COOR." (0169. 1-4-(N-methoxybenzoylsulfamoyl)phenyl)-3,3- (0173 R. R. independently of one another are hydro dimethylurea, gen, (C-C)-alkyl, (C-C)-alkenyl, (C-C)-alkynyl, 0170 1-4-(N4,5-dimethylbenzoylsulfamoyl)phenyl-3- cyanoalkyl, (C-C)-haloalkyl, phenyl, nitrophenyl, benzyl, methylurea, halobenzyl, pyridinylalkyl or alkylammonium, 1-4-(N-naphthoylsulfamoyl)phenyl-3,3-dimethylurea, 0171 G) active compounds from the class of the nk' is 0 or 1, hydroxyaromatics and aromatic-aliphatic carboxylic acid nk, n independently of one another are 0, 1 or 2 preferably: derivatives, for example ethyl 3,4,5-triacetoxybenzoate, 3.5- methyl(diphenylmethoxy)acetate (CAS Reg. No.: 41858-19 dimethoxy-4-hydroxybenzoic acid, 3.5-dihydroxybenzoic 9), acid, 4-hydroxysalicylic acid, 4-fluorosalicyclic acid, 1.2- dihydro-2-oxo-6-trifluoromethylpyridine-3-carboxamide, L) compounds of the formula (S-X), 2-hydroxycinnamic acid, 2,4-dichlorocinnamic acid, as 0.174 as described in WOA-98/27049 US 2014/0066307 A1 Mar. 6, 2014

0182 O.O-diethyl S-2-ethylthioethyl phosphorodithioate (S-X) (disulfoton), R O 0183 4-chlorophenyl methylcarbamate (mephenate), 0.184 O,O-diethyl O-phenyl phosphorothioate (dietho 1-g N late), RI)- H 0185 4-carboxy-3,4-dihydro-2H-1-benzopyran-4-acetic (RL) L l D F R acid (CL-304415, CAS Reg. No.: 31541-57-8), 0186 2-propenyl 1-Oxa-4-azaspiro4.5 decane-4-car bodithioate (MG-838, CAS Reg. No.: 133993-74-5), in which the symbols and indices have the following mean 0187 methyl(3-oxo-1H-2-benzothiopyran-4(3H)- ings: ylidene)methoxyacetate (from WO-A-98/13361; CAS (0175 X, is CH or N, Reg. No.: 205121-04-6), 0176 n is, in the case that X—N, an integer from 0 to 4 0188 cyanomethoxyimino(phenyl)acetonitrile (cyo and, in the case that X—CH, an integer from 0 to 5, metrinil), (0177 R. is halogen, (C-C)-alkyl, (C-C)-haloalkyl, 0189 1,3-dioxolan-2-ylmethoxyimino(phenyl)acetoni (C-C)-alkoxy, (C-C)-haloalkoxy, nitro, (C-C)-alky trile (oxabetrinil), lthio, (C-C)-alkylsulfonyl, (C-C)-alkoxycarbonyl, 0.190 4'-chloro-2.2.2-trifluoroacetophenone O-1,3-diox optionally substituted phenyl, optionally substituted phe olan-2-ylmethyloxime (fluxofenim), noXy, 0191 4,6-dichloro-2-phenylpyrimidine (fenclorim), (0178 R, is hydrogen or (C-C)-alkyl, 0.192 benzyl 2-chloro-4-trifluoromethyl-1,3-thiazole-5- (0179 R, is hydrogen, (C-Cs)-alkyl, (C-C)-alkenyl, carboxylate (flurazole), (C-C)-alkynyl oraryl, where each of the carbon-contain 0193 2-dichloromethyl-2-methyl-1,3-dioxolane (MG ing radicals mentioned above is unsubstituted or Substi 191), tuted by one or more, preferably by up to three, identical or including the stereoisomers, and the salts customary in agri different radicals from the group consisting of halogen and culture. alkoxy; or salts thereof, 0.194. A mixture N-(1,2,5-oxadiazol-3-yl)benzamides M) active compounds from the class of the 3-(5-tetrazolyl whose phenyl ring is substituted in the 2-, 3- and 4-position by carbonyl)-2-quinolones, for example selected radicals as defined above or their salts to be applied 1,2-dihydro-4-hydroxy-1-ethyl-3-(5-tetrazolylcarbonyl)-2- in connection with other known active compounds, such as quinolone (CAS Reg. No.: 219479-18-2), 1,2-dihydro-4-hy fungicides, insecticides, acaricides, nematicides, bird repel droxy-1-methyl-3-(5-tetrazolylcarbonyl)-2-quinolone (CAS lents, plant nutrients and soil structure improvers to trans Reg. No.: 95855-00-8), as described in WO-A-1999000020, genic plants containing one or more chimeric gene(s) (I) N) compounds of the formula (S-XI) or (S-XII), comprising a DNA sequence encoding hydroxyphenylpyru 0180 as described in WO-A-2007023719 and WO-A- vate dioxygenase (HPPD) derived from a member of a group 2007023764 of organisms, consisting of (a) Avena, preferably Avena sativa, more preferably comprising a DNA sequence identi cal to SEQID No. 1 encoding HPPD defined by SEQID No. (S-XI) 2, (b) Pseudomonas, preferably Pseudomonas fluorescens, O more preferably comprising a DNA sequence identical to N O SEQID No. 3 encoding HPPD defined by SEQID No. 4, (c) (RN),N -H N -- Y-R2 Synechococcoideae, preferably Synechococcus sp., more 2 s/ preferably comprising a DNA sequence identical to SEQID MV No. 6, encoding HPPD defined by SEQ ID No. 7, (d) Ble O O pharismidae, preferably Blepharisma japonicum, more pref (S-XII) erably comprising a DNA sequence identical to SEQID No. O Z-R 8 encoding HPPD defined by SEQID No. 9, (e) Rhodococ cus, preferably Rhodococcus sp. (strain RHA1), isolate ro03.04.1 more preferably comprising a DNA sequence iden (RN),N. - 1n O O tical to SEQ ID No. 10 encoding HPPD defined by SEQ ID 2 | -S-I-y- No. 11, or Rhodococcus sp. (strain RHA1), isolate ro02040, M H more preferably comprising a DNA sequence identical to O SEQID No.12 encoding HPPD defined by SEQID No. 13, (f) Picrophilaceae, preferably Picrophilus torridus, more prefer ably comprising a DNA sequence identical to SEQID No. 14 in which encoding HPPD defined by SEQ ID No. 15, (g) Kordia, Rw' is halogen, (C-C)-alkyl, methoxy, nitro, cyano, CFs, preferably Kordia algicida, more preferably comprising a OCF, DNA sequence identical to SEQID No. 16 encoding HPPD Y, Z independently of one another are O or S, defined by SEQ ID No. 17 or (II) comprising one or more ny is an integer from 0 to 4. mutated DNA sequences of HPPD encoding genes of the R is (C-C)-alkyl, (C-C)-alkenyl, (C-C)-cycloalkyl, before defined organisms, preferably mutants as described in aryl, benzyl, halobenzyl, WO 2010/085705, U.S. Pat. No. 6,245,968, WO 2009/ R is hydrogen, (C-C)alkyl, 144079, PCT/EP2010/070561, PCT/EP2010/070567, PCT/ O) one or more compounds from the group consisting of EP2010/070578, PCT/EP2010/070570, or PCT/EP2010/ 0181 1.8-naphthalic anhydride, 070575 is likewise possible. US 2014/0066307 A1 Mar. 6, 2014

0.195 Some of the safeners are already known as herbi 0201 SEQ ID No. 5: Nucleic acid sequence encoding cides and accordingly, in addition to the herbicidal action Pseudomonas fluorescens HPPD mutated at at position against harmful plants, also act by protecting the crop plants. 336; mutation Gly=>Trp; optimized for the expression in The weight ratios of herbicide (mixture) to safener generally Soybean and cotton depend on the herbicide application rate and the effectiveness 0202 SEQ ID No. 6: Nucleic acid sequence encoding of the safenerinquestion and may vary within widelimits, for Synechococcus sp. HPPD example in the range from 200:1 to 1:200, preferably from (0203 SEQID No. 7: Protein encoded by SEQID No. 6 100:1 to 1:100, in particular from 20:1 to 1:20. The safeners 0204 SEQ ID No. 8: Nucleic acid sequence encoding may be formulated analogously to the compounds of the Blepharisma japonicum HPPD formula (I) or their mixtures with other herbicides/pesticides 0205 SEQID No. 9: Protein encoded by SEQID No. 8 and be provided and used as a finished formulation or as a tank 0206 SEQ ID No. 10: Nucleic acid sequence encoding mix with the herbicides. Rhodococcus sp. (strain RHA1), isolate ro03.04.1 HPPD 0196. The required application rate of the N-(1,2,5-Oxa 0207 SEQID No. 11: Protein encoded by SEQID No. 10 diazol-3-yl)benzamides as defined above to areas where such 0208 SEQ ID No. 12: Nucleic acid sequence encoding transgenic plants containing one or more chimeric gene(s) (I) Rhodococcus sp. (strain RHA1), isolate ro02040 HPPD comprising a DNA sequence encoding hydroxyphenylpyru 0209 SEQID No. 13: Protein encoded by SEQID No. 12 vate dioxygenase (HPPD) derived from a member of a group 0210 SEQ ID No. 14: Nucleic acid sequence encoding of organisms, consisting of (a) Avena, preferably Avena Picrophilus torridus HPPD sativa, more preferably comprising a DNA sequence identi 0211 SEQID No. 15: Protein encoded by SEQID No. 14 cal to SEQID No. 1 encoding HPPD defined by SEQID No. 0212 SEQ ID No. 16: Nucleic acid sequence encoding 2, (b) Pseudomonas, preferably Pseudomonas fluorescens, Kordia algicida HPPD more preferably comprising a DNA sequence identical to 0213 SEQID No. 17: Protein encoded by SEQID No. 16 SEQID No. 3 encoding HPPD defined by SEQID No. 4, (c) 0214 SEQ ID No. 18: Nucleic acid sequence encoding Synechococcoideae, preferably Synechococcus sp., more Synechococcus sp. HPPD optimized for the expression in preferably comprising a DNA sequence identical to SEQID Soybean and cotton No. 6, encoding HPPD defined by SEQ ID No. 7, (d) Ble 0215 SEQ ID No. 19: Nucleic acid sequence encoding pharismidae, preferably Blepharisma japonicum, more pref Blepharisma japonicum HPPD optimized for the expres erably comprising a DNA sequence identical to SEQID No. sion in Soybean and cotton 8 encoding HPPD defined by SEQID No. 9, (e) Rhodococ 0216 SEQ ID No. 20: Nucleic acid sequence encoding cus, preferably Rhodococcus sp. (strain RHA1), isolate Rhodococcus sp. (strain RHA1), isolate ro0341 HPPD ro03.04.1 more preferably comprising a DNA sequence iden optimized for the expression in Soybean and cotton tical to SEQID No. 10 encoding HPPD defined by SEQ ID 0217 SEQ ID No. 21: Nucleic acid sequence encoding No. 11, or Rhodococcus sp. (strain RHA1), isolate ro02040, Rhodococcus sp. (strain RHA1), isolate ro0240 HPPD more preferably comprising a DNA sequence identical to optimized for the expression in Soybean and cotton SEQID No.12 encoding HPPD defined by SEQID No. 13, (f) 0218 SEQ ID No. 22: Nucleic acid sequence encoding Picrophilaceae, preferably Picrophilus torridus, more prefer Picropphilus torridus HPPD optimized for the expression ably comprising a DNA sequence identical to SEQID No. 14 in Soybean and cotton encoding HPPD defined by SEQ ID No. 15, (g) Kordia, 0219 SEQ ID No. 23: Nucleic acid sequence encoding preferably Kordia algicida, more preferably comprising a Kordia algicida HPPD optimized for the expression in DNA sequence identical to SEQID No. 16 encoding HPPD Soybean and cotton defined by SEQ ID No. 17 or (II) comprising one or more 0220. The examples which follow illustrate the invention mutated DNA sequences of HPPD encoding genes of the I. Cloning of Specific Genes Coding for HPPDs from Various before defined organisms, preferably mutants as described in Organisms WO 2010/085705, U.S. Pat. No. 6,245,968, WO 2009/ A. Cloning of Avena HPPD (according WO02/46387) 144079, PCT/EP2010/070561, PCT/EP2010/070567, PCT/ A1—Cloning for Expression in E. coli Cells EP2010/070578, PCT/EP2010/070570, or PCT/EP2010/ 0221) cDNA coding for Avena sativa HPPD (AVHPPD; 07.0575 varies depending, inter alia, on external conditions SEQ ID No. 1) was ordered at GeneArt (Regensburg, Ger Such as temperature, humidity and the type of herbicide used. many) using the codon usage optimized for the expression of It can vary within widelimits, for example between 0.001 and the gene in Escherichia coli cells. Upstream to the start codon 10 000 g/ha or more of active substance; however, it is pref ATG, was added the sequence corresponding to the recogni erably between 0.5 and 5000 g/ha, particularly preferably tion site of the restriction enzyme BamHI, and downstream to between 0.5 and 1000 g/ha and very particularly preferably the stop codon was added the sequence stretch corresponding between 0.5 and 500 g/ha. to the recognition site of the enzyme HindIII. The synthesized fragment was cloned using the restriction enzymes BamHI SEQUENCES LISTING and HindIII in the previously opened vector plT32a (Novagen, Darmstadt, Germany), in order to obtain a fusion 0.197 SEQ ID No. 1: Nucleic acid sequence encoding with the HisTag present in the vector at the N-Terminal Avena sativa HPPD optimized for the expression in E. coli extremity from the AvHPPD protein (SEQ ID No. 2). The cells resulting vector was named pBT32a-AvHPPDe. (0198 SEQID No. 2: Protein encoded by SEQID No. 1 0222. The protein was produced in E. coli and isolated (0199 SEQ ID No. 3: Nucleic acid sequence encoding following the standard protocol (as described for example in Pseudomonas fluorescens HPPD mutated at position 336: WO2009/144097). mutation Gly=>Trp A2 Cloning of the AvHPPD Gene in the pBin 19 Binary (0200 SEQID No. 4: Protein encoded by SEQID No. 3 Vector for Expression in Tobacco Plants US 2014/0066307 A1 Mar. 6, 2014

0223) The cDNA corresponding to the gene coding for 0227. The Arabidopsis thaliana AthPPD coding AvHPPD protein was cut out from the plasmid plT32a sequence (1335 bp: Genebank AF047834; WO 96/38567) AvHPPDe using the restriction enzymes NcoI and NotI. The was initially cloned into the expression vector pGE-30 overhang sequence resulting from the Not restriction was (QIAGEN. Hilden, Germany) in between the restriction sites filled up, and the consequent fragment was then cloned in the of BamHI and HindIII. The obtained vector was called vector pRT100-OTPc (see for example Töpfer (1987), “pOE30-AthPPD (see WO 2009/144079). Nucleic Acids Res. 15:5890, and PCT/EP2010/070561) pre 0228. The plasmid possesses the trp-lac (trc) promoter and viously restricted with the enzymes NcoI and SmaI. In this the lac1 gene that provides the lac repressor in every E. coli vector, the sequence coding for the AVHPPD was located host strain. The lac repressor binds to the lac operator (lacO) downstream to the sequence corresponding to an optimized and restricts expression of the target gene; this inhibition can transit peptide responsible for the translocation of the protein be alleviated by induction with Isopropyl 8-D-1-thiogalacto to the chloroplast, itself downstream of the sequence corre pyranoside (IPTG). sponding to the CaMV 35S promoter (see for example 0229. All above defined E. coli expression vectors were WO2009/144097). The nucleotide sequence corresponding used to transform Escherichia coli BL21 cells (Merck, Darm to the expression cassette CaMV35S-OTPc-AvHPPDe-S stadt, Germany). was restricted using the enzyme SbfI and further cloned into 0230. For the AthPPD (Arabidopsis thaliana HPPD) that the previously opened vector pBin 19 with the same enzyme. was used as reference see WO 2009/144079. The resulting plasmid was named pBin 19-CaMV35S-OTPc 0231 Expression of HPPD was carried out in E. coli K-12 AvHPPDe-35S, and was used to transform Agrobacterium BL21 containing pOE30-AthPPD, pET32a-AvHPPDe or tumefaciens strain ATHV (see for example PCT/EP2010/ pSE4.20(RI)NX-FMP27 or pSE4.20(RI)NX-FMP37. Cells 070561). were allowed to grow until OD reached 0.5, then expression was initiated from the trp-lac (trc) promoter by induction with B Cloning of PfHPPD-G336W 1 mM IPTG which binds to the lac repressor and causes its dissociation from the lac operon. Expression was carried out B1 - Cloning of PfHPPD-G336W for the Expression in E. over 15 h at 28°C. Coli Cells 0232 To prepare the pre-starter culture, 2 mL of TB 0224. The gene coding for the mutant HPPD G336W medium (100 ugmL carbenicillin) were inoculated with (SEQID No.3) (U.S. Pat. No. 6.245,968) from Pseudomonas 50 uL of an E. coli K-12 BL21 glycerol stock. The pre-starter fluorescens in the plasmid pKK233-2 (Clontech) (U.S. Pat. culture was incubated at 37°C. with shaking at 140 rpm for 15 No. 6.245,968) was used as template for a PCR to add to the h. 200 ul of the pre-starter culture was used to initiate the sequence at it 5' extremity the sequence corresponding to the starter culture (5 mLTB supplement with 100 ugL), which recognition site of the enzyme NcoI and at its 3' extremity the was incubated 3 h at 37° C. sequence corresponding to the recognition site of the enzyme 0233. To prepare the main culture, 400 mL of TB medium Xbal. (see WO 2009/144079). The cloning was made in order (100 ugmL carbenicillin) were inoculated with 4 mL of to obtain a His tag fusion protein at the N-terminal extremity the starter culture. This starter culture was incubated at 37°C. of the Pseudomonas HPPD G336W (SEQID No. 4), named with shaking at 140 rpm until ODoo 0.5 was reached. Then “pSE4.20(R1)NX-PfG336W. recombinant protein expression was induced with 400 ul of B2. Cloning of PfHPPD-G336W for the Expression in 1M IPTG solution. The cells were allowed to grow for an Tobacco Plants pFCO117 additional hour under these conditions, then the temperature 0225. A binary vector for tobacco or soybean transforma was lowered to 28°C. and the culture was shaken at 140 rpm tion is, for example, constructed with the CaMV35 promoter for 15h. Cells were harvested by centrifugation at 6000xg for driving the expression of the gene PfHPPD-G336W (SEQID 15 min at 4°C. Then cell pellets were stored at -80° C. No 5), with a codon usage optimized for the expression in 0234 Isolation and purification of His-AthPPD. His6 dicotyledoneous plants and at its 5' extremity was added a AvHPPD, PfIPPD-G336W, His-FMP27 and His-FMP37 sequence coding for an OTP and further upstream a sequence in native form TEV (Tobacco etch virus) to improve the stability of the mRNA in plants followed by the CaMV35S terminator. Addi Lysis of Cells tionally, the transformation vector also contains a PAT gene 0235 Cells were lysed using Lysozyme, an enzyme that cassette in which the gene is driven by a CaVM35S promoter cleaves the 1,4-B-linkages between N-acetylmuramic acid and followed by a CaMV35S terminator for glufosinate based and N-acetyl-D-glucosamine residues in peptidoglycan selection during the transformation process and a 2mEPSPS which forms the bacterial cell wall. Cell membranes were gene cassette in which the gene is driven by an histone pro then disrupted by the internal pressure of the bacterial cell. In moter from Arabidopsis to confer tolerance to the herbicide addition, the lysis buffer contained Benzonase(R) Nuclease, an glyphosate to the transformed plants. The binary vector was endonuclease that hydrolyzes all forms of DNA and RNA called pFCO117. without damaging proteins and thereby largely reduces vis C Cloning of HPPD Obtained from Blepharisma and Kor cosity of the cell lysate. Lysis under native conditions was dia for Expression in E. Coli or in Tobacco Plants carried out on ice. 0226. These clonings were done as described in PCT/ 0236. For purification of His-tagged proteins the QIAex EP2010/070567 (Blepharisma japonicum, FMP37, Example press(R Ni-NTA Fast Start Kit was used following the user 1, named “pSE4.20(R1)NX-FMP37) and PCT/EP2010/ manual instruction. 070575 (Kordia algicida, FMP27, Example 1, named Purification of his-Tagged Proteins by Immobilized Metal “pSE4.20(R1)NX-FMP27). Ion Affinity Chromatography (IMAC) D Production of HPPD Protein in E Coli, Purification Via 0237. The cleared cell lysate (10 mL) obtained after cen his-Tag trifugation of the lysis reaction was loaded onto a Ni-NTA US 2014/0066307 A1 Mar. 6, 2014

Fast Start Column from the QIAexpress(R Ni-NTA Fast Start to N-(1,2,5-oxadiazol-3-yl)benzamides than the Arabidopsis Kit (Qiagen, Hilden, Germany) and purification was carried thaliana HPPD (AthPPD) under identical experimental con out according to the instruction manual. The His-tagged ditions. protein was eluted with 2.5 mL of elution buffer. 0247 Table E 1: Determination of percentage of inhibition in presence of 5.0x10M of Compound “1-56” compared to Desalting of HPPD Solutions by Gel Filtration the activity measured in absence of Compound No. 1-56 with HPPD originated from Arabidopsis thaliana (AthPPD), 0238 HPPD solutions eluted from a Ni-NTA Fast Start FMP27 (derived from Kordia algicida) and FMP37 (derived Column with 2.5 mL of elution buffer were applied to a from Blepharisma japonicum). Sephadex G-25 PD-10 column (GE Healthcare, Freiburg, Germany) following the user manual instruction. After the E1 Compound “1-56” whole sample had entered the gel bed, elution was performed 0248 with 3.5 mL of storage buffer. The HPPD solutions eluted from the desalting column were frozen at -80° C. in 1 mL aliquots. 0239) Determination of HPPD protein concentration Protein Inihibition% using the Bradford protein assay Protein concentration was AtEHPPD 90 determined using the standard Bradford assay (Bradford, FMP27 85 (1976), Anal Biochem 72: 248-254). FMP37 79 0240. Determination of purity of HPPD solutions using SDS-PAGE 0249. These data show that the HPPD derived from Kordia 0241 The integrity of the eluted protein was checked by algicida and Blepharisma japonicum is less sensitive to N-(1, SDS-PAGE protein gel electrophoresis using the gel 2.5-oxadiazol-3-yl)benzamides compared to the inhibition NuPAGE(R) Novex 4-12% Bis-Tris Gels (Invitrogen, observed with the HPPD derived from Arabidopsis thaliana, Karlsruhe, Germany), approximately 10 ug of protein were as shown for Compound “1-56”. loaded. 10 uI of Laemmli Sample Buffer was added to 1-10 uL of protein solution and the mixture was incubated at 90° C. F Evaluation of Tolerance to HPPD Inhibitors of Tobacco for 10 min. After short centrifugation step, the whole mixture Plants Expressing Tolerant HPPD Enzymes was loaded into a slot of an SDS gel previously fixed in a (0250 Genes coding for the selected HPPD were obtained XCell SureLockTM Novex Mini-Cell gel chamber filled with from a member of the group of organisms consisting of Avena NuPAGE(R) MOPS SDS Running Buffer (diluted from the sativa, Pseudomonas fluorescens mutant G336W. Blepha 20x-solution withddHO). A voltage of 150 was then applied risma japonicum and Kordia algicida and cloned into the to the gel chamber for 1 h. For staining of protein bands, the binary vector p3in 19 allowing the integration of DNA into gel was immersed in Coomassie Brilliant Blue R-250 Stain the tobacco genome, under the control of the CaMV35S ing Solution. For destaining of the polyacrylamide gel, it was promoter. For the cloning procedures, see A2 above for Avena immersed in Coomassie Brilliant Blue R-250 Destaining sativa, see B2 above for Pseudomonas fluorescens, mutant Solution until protein bands appear blue on a white gel. G336W, see PCT/EP2010/070567, Example 5; for Blepha 0242 Evaluation of Tolerance to HPPD Inhibitors of risma japonicum (FMP37) and see PCT/EP2010/070575, HPPD Enzymes Example 5 for Kordia algicida (FMP27). 0243 The HPPD activity was checked by the standard 0251 Between the sequence corresponding to the pro spectrophotmetric assay (method extensively described in moter and the sequence coding for the HPPD was inserted a WO 2009/144079) DNA sequence coding for a transit peptide to the chloroplast, in order to add at the N-terminal extremity of the protein a E Evaluation of Tolerance to Several HPPD Inhibitor target signal to allow the localization of the HPPD protein Herbicides into the plant chloroplast. Seeds harvested from TO transfor mants will be put on standard Soil for germination. Three 0244. Determination of HPPD activity in presence of sev weeks later plantlets will be transferred to single pots and eral HPPD inhibitors grown under standard cultivation conditions (PCT/EP2010/ 0245 Level of tolerance of HPPD proteins obtained from 07.0575). Two weeks later plants we be sprayed with several different organisms was determined according to the proce N-(1,2,5-oxadiazol-3-yl)benzamides whose phenyl ring is dure as described in PCT/EP2010/070575. substituted in the 2-, 3- and 4-position by selected radicals as 0246. On the below Table E1, it can be clearly seen, that defined above. the HPPDs obtained from Kordia algicida (FMP27), Blepha 0252 One week later, the symptoms due to the application risma japonicum (FMP37) showed superior level oftolerance of the herbicides will be evaluated.

SEQUENCE LISTING

<16 Os NUMBER OF SEO ID NOS: 23

<21 Os SEQ ID NO 1 &211s LENGTH: 1323 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence

US 2014/0066307 A1 Mar. 6, 2014 85

- Continued

Ala Pro Tyr Ala Pro Pro Pro Glin Glu Ala Ala Thr Ala Ala Ala Thr 1OO 105 11 O Ala Ser Ile Pro Ser Phe Ser Ala Asp Ala Ala Arg Thr Phe Ala Ala 115 12 O 125 Ala His Gly Lieu Ala Val Arg Ser Val Gly Val Arg Val Ala Asp Ala 13 O 135 14 O Ala Glu Ala Phe Arg Val Ser Val Ala Gly Gly Ala Arg Pro Ala Phe 145 150 155 160 Ala Pro Ala Asp Lieu. Gly His Gly Phe Gly Lieu Ala Glu Val Glu Lieu 1.65 17O 17s Tyr Gly Asp Val Val Lieu. Arg Phe Val Ser Tyr Pro Asp Glu Thir Asp 18O 185 19 O Lieu Pro Phe Leu Pro Gly Phe Glu Arg Val Ser Ser Pro Gly Ala Val 195 2OO 2O5 Asp Tyr Gly Lieu. Thir Arg Phe Asp His Val Val Gly Asn Val Pro Glu 21 O 215 22O Met Ala Pro Val Ile Asp Tyr Met Lys Gly Phe Leu Gly Phe His Glu 225 23 O 235 24 O Phe Ala Glu Phe Thr Ala Glu Asp Val Gly Thr Thr Glu Ser Gly Lieu. 245 250 255

Asn Ser Wal Wall Lieu Ala Asn. Asn. Ser Glu Ala Wall Lieu. Lieu Pro Lieu. 26 O 265 27 O Asn Glu Pro Val His Gly Thr Lys Arg Arg Ser Glin Ile Glin Thr Tyr 27s 28O 285 Lieu. Glu Tyr His Gly Gly Pro Gly Val Glin His Ile Ala Lieu Ala Ser 29 O 295 3 OO Asn Asp Val Lieu. Arg Thr Lieu. Arg Glu Met Arg Ala Arg Thr Pro Met 3. OS 310 315 32O Gly Gly Phe Glu Phe Met Ala Pro Pro Glin Ala Lys Tyr Tyr Glu Gly 3.25 330 335 Val Arg Arg Ile Ala Gly Asp Val Lieu. Ser Glu Glu Glin Ile Lys Glu 34 O 345 35. O Cys Glin Glu Lieu. Gly Val Lieu Val Asp Arg Asp Asp Glin Gly Val Lieu. 355 360 365 Lieu. Glin Ile Phe Thr Lys Pro Val Gly Asp Arg Pro Thr Phe Phe Leu 37 O 375 38O Glu Met Ile Glin Arg Ile Gly Cys Met Glu Lys Asp Glu Val Gly Glin 385 390 395 4 OO Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe Gly Lys Gly Asn Phe Ser 4 OS 41O 415 Glu Lieu. Phe Llys Ser Ile Glu Asp Tyr Glu Lys Ser Lieu. Glu Val Lys 42O 425 43 O Glin Ser Val Val Ala Glin Llys Ser 435 44 O

<210s, SEQ ID NO 3 &211s LENGTH: 1077 &212s. TYPE: DNA <213s ORGANISM: Pseudomonas fluorescens 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1006) . . (1008) <223> OTHER INFORMATION: GGT codon is replaced by codon TGG

US 2014/0066307 A1 Mar. 6, 2014 87

- Continued Lell Glu Gly Val Glu Arg Asn Pro Val Gly Ala Gly Lieu Lys Val Ile 145 150 155 160

Asp His Luell Thr His Asn Val Tyr Arg Gly Arg Met Wall Tyr Trp Ala 1.65 17O 17s

Asn Phe Glu Lys Lieu. Phe Asn Phe Arg Glu Ala Arg Tyr Phe Asp 18O 185 19 O

Ile Gly Glu Tyr Thr Gly Lieu Thir Ser Lys Ala Met Ser Ala Pro 195

Asp Gly Met Ile Arg Ile Pro Lieu. Asn. Glu Glu Ser Ser Gly Ala 21 O 215 22O

Gly Glin Ile Glu Glu Phe Leu Met Glin Phe Asn Gly Glu Gly Ile Glin 225 23 O 235 24 O

His Wall Ala Phe Lieu. Thir Asp Asp Lieu Val Lys Thir Trp Asp Ala Lieu 245 250 255

Ile Gly Met Arg Phe Met Thir Ala Pro Pro Asp Thir 26 O 265 27 O

Glu Met Luell Glu Gly Arg Lieu Pro Asp His Gly Glu Pro Wall Asp Glin 285

Lell Glin Ala Arg Gly Ile Lieu. Lieu. Asp Gly Ser Ser Wall Glu Gly Asp 29 O 295 3 OO

Lys Arg Luell Lieu. Lieu. Glin Ile Phe Ser Glu Thir Lell Met Gly Pro Wall 3. OS 310 315 32O

Phe Phe Glu Phe Ile Glin Arg Lys Gly Asp Asp Gly Phe Gly Glu Trp 3.25 330 335

Asn Phe Ala Lieu. Phe Glu Ser Ile Glu Arg Asp Glin Wall Arg Arg 34 O 345 35. O

Gly Wall Luell Thir Ala Asp 355

SEO ID NO 5 LENGTH: 1077 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Nucleic acid sequence encoding Pseudomonas fluorescens HPPD mutated at the position 336 (Gly to Trp ) optimized for the expression in soybean and cotton FEATURE: NAMEAKEY: misc feature LOCATION: (1006) ... (1008) OTHER INFORMATION: GGT codon is replaced by codon TGG

<4 OOs, SEQUENCE: 5 atggctgatc titt atgagaa CCC tatgggit Ctt atgggct tcq agttitat tgagttcgct 6 O to tcct acco ctgg tact ct tgaac ctatt titcgagat.ca tgggctt cac talaggttgca 12 O acticacaggt Ctaagaacgt. t cacott tact aggcagggtg agat caacct tat Cottaac 18O aacgagccta act coattgc ttct tatt to gctgctgagc atggit coat c tgtttgcggit 24 O atggctitt ca gagittaagga ttct cagaag gcttacaiaca gggct Cttga acttggtgct 3OO cagoctatt c at attgatac cggacctatg gaact caacc titcctgctat taaggg tatt 360 ggtggtgctic citott tacct tattgataga titcggtgagg gct cotc cat citacgatatt gattitcgttt accttgaggg cgttgagaga aac cctdttg gtgctggtct taaggittatc gat caccitta cc cacaacgt. ttacagaggit aggatggittt actgggctaa cittctacgag 54 O aagttgttca actitcagaga ggct cqttac titcgatatta agggcgagta cactggit citt

US 2014/0066307 A1 Mar. 6, 2014 89

- Continued

Gly Ser Lieu. Arg Lieu. Arg Lieu. Ser Glin Pro Ala Arg Ala Gly Asp Glu SO 55 6 O Val Asp Arg His Lieu. Glin Arg His Gly Pro Gly Val Val Asp Wall Ala 65 70 7s 8O Lieu Ala Val Gly Glu Glin Glu Lieu Pro Ala Lieu Ala Glu Lieu. Lieu. Arg 85 90 95 Gly Arg Gly Ala Glin Lieu Ala Trp Ile Pro Ala Ala Ala Ala Lieu. Cys 1OO 105 11 O Lieu. His Thr Pro Tyr Gly Ile Arg His Ser Lieu. Ile Pro Gly Pro Leu 115 12 O 125 Asp Ala Ala Pro Ala Glu Ala Gly Lieu. Phe Ser His Trp Asp His Val 13 O 135 14 O Val Lieu. Asn Val Glu Glin Gly Ser Lieu. Glin Ala Ala Ala Asp Trp Tyr 145 150 155 160 Gly Arg Val Lieu. Gly Trp Arg Arg Lieu. Tyr Arg Tyr Ser Ile Gly. Thir 1.65 17O 17s Ala Thir Ser Gly Lieu. Glu Ser Val Val Val Gly Asp Pro Glu Ala Gly 18O 185 19 O Ile Gln Trp Ala Ile Asn Glu Pro Thr Cys Ala Ala Ser Glin Ile Glin 195 2OO 2O5 Glu Phe Lieu. His Ala His Gly Gly Pro Gly Ile Glin His Ala Ala Lieu. 21 O 215 22O His Ser Ser Asp Ile Val Ala Ser Lieu. Arg Arg Lieu. Arg Glin Gly Gly 225 23 O 235 24 O Val Asp Phe Leu Glin Val Ala Pro Glin Tyr Tyr Thr Ser Lieu. Glu Arg 245 250 255 Glu Lieu. Gly Lieu Ala Lieu. Arg Ser Ala Lieu. Gly Glin Ala Ile Ser Trp 26 O 265 27 O Glin Asp Lieu Val Glu Glin Glin Ile Lieu. Lieu. Asp Ala Thr Lieu Pro Ala 27s 28O 285 Ser Asp Gly Glin Asp Arg Pro Leu Lieu. Leu Gln Thr Phe Thr Glin Pro 29 O 295 3 OO Lieu. Phe Gly Arg Pro Thr Phe Phe Phe Glu Val Ile Glin Arg Lieu. Gly 3. OS 310 315 32O Gly Ala Thr Gly Phe Gly Glu Ala Asn. Phe Glin Ala Lieu. Phe Glu Ala 3.25 330 335 Lieu. Glu Arg Glin Glin Arg Glin Arg His Glin Ala Lieu. Thr Pro 34 O 345 35. O

<210s, SEQ ID NO 8 &211s LENGTH: 1149 &212s. TYPE: DNA <213> ORGANISM: Blepharisma japonicum

<4 OOs, SEQUENCE: 8 atgact tatt acgacaagca agaaacg.cgt ccagatc.ttg gcgaatticta tdgtttccat 6 O cacgttcgtt tttacgt.ctic caact cagag caa.gc.cgctt cqttctacac atctogctitt 12 O gggttittctic cqgttgccta taaggattg gaaac aggaa accaaaaatt Ctgtaccaat 18O gtcgt.ccgaa goalaccatgt agt catcgct tttacct cag ct ct cactic c tdaagacaat 24 O gaagtgalacc gtcacgttgg caa.gcatagt gatggagttcaagacattgc ctittagtgta 3OO agtgacgcaa gagggatgta tagaaag.cg at agctaaag gctgtaaaag Ctt cogtgag 360 US 2014/0066307 A1 Mar. 6, 2014 90

- Continued ccacaggttt tacaagat.ca atttggat.ct gttataatag cqt ct ct coa gact tatgga 42O gacactgttc acacattagt ccaaaatgtc gactatacag gaccc.tttitt gcc toggcttic 48O agagcaatca caaaagatga t cc attaaac totgc ctitt.c ct caggtaaa titatgacatt 54 O attgat catgttgtaggaaa t cagoctggt ggcgatatga citcct acagt agaatggitat 6OO gagaaatat c tagaattt catcgatattgg totgctgatg agt ctd taat ccataccgat 660 tatt cagc at taaggit ctgt ttggttgct gattgggatg aagtgat cala aatgcct att 72 O aatgagcctg. Ctgatggact tagaaaaagt caaatcCaag aatatgtcga at attatggit 78O ggagcaggcg tacaa.cat at togc cittaaaa gtcaatgata ttattt cagt aataagcacc 84 O ttaagggcta gaggtgtgga attcttagaa gttcct ccta aat attatga tagcttalaga 9 OO aaaagacittg cgcattctgc ggtacaaatt gaagaag act taaaaagaat talagacctt 96.O catattittgg ttgactittga cqaccgtggg tatt tactitc agattitt cac aaaac cagta 1 O2O gaagacagac ctactctgtt titatgaaatt attcaaagac ataataacaa toggatt.cgga 108 O attggaaatt ttaaag.ccct atttgaat cattggaacaag agcaagaaag aagaggtaat 114 O ttgatctaa 1149

<210s, SEQ ID NO 9 &211s LENGTH: 382 212. TYPE: PRT <213> ORGANISM: Blepharisma japonicum

<4 OOs, SEQUENCE: 9 Met Thr Tyr Tyr Asp Lys Glin Glu Thr Arg Pro Asp Leu Gly Glu Phe 1. 5 1O 15 Tyr Gly Phe His His Val Arg Phe Tyr Val Ser Asn Ser Glu Glin Ala 2O 25 3O Ala Ser Phe Tyr Thr Ser Arg Phe Gly Phe Ser Pro Val Ala Tyr Glu 35 4 O 45 Gly Lieu. Glu Thr Gly Asn Gln Llys Phe Cys Thr Asn Val Val Arg Ser SO 55 6 O Asn His Val Val Ile Ala Phe Thr Ser Ala Lieu. Thr Pro Glu Asp Asn 65 70 7s 8O Glu Val Asn Arg His Val Gly Llys His Ser Asp Gly Val Glin Asp Ile 85 90 95 Ala Phe Ser Val Ser Asp Ala Arg Gly Met Tyr Glu Lys Ala Ile Ala 1OO 105 11 O Lys Gly Cys Llys Ser Phe Arg Glu Pro Glin Val Lieu. Glin Asp Glin Phe 115 12 O 125 Gly Ser Val Ile Ile Ala Ser Leu Gln Thr Tyr Gly Asp Thr Val His 13 O 135 14 O Thr Lieu Val Glin Asn Val Asp Tyr Thr Gly Pro Phe Leu Pro Gly Phe 145 150 155 160 Arg Ala Ile Thir Lys Asp Asp Pro Lieu. Asn. Ser Ala Phe Pro Glin Val 1.65 17O 17s Asn Tyr Asp Ile Ile Asp His Val Val Gly Asn Gln Pro Gly Gly Asp 18O 185 19 O Met Thr Pro Thr Val Glu Trp Tyr Glu Lys Tyr Lieu. Glu Phe His Arg 195 2OO 2O5 Tyr Trp Ser Ala Asp Glu Ser Val Ile His Thr Asp Tyr Ser Ala Lieu.

US 2014/0066307 A1 Mar. 6, 2014 92

- Continued atcggcaact tcaaag.ccct Ctt.cgaggcc atcgaacgcg aacaa.gc.cgc cc.gcggaaac 12 OO ttctga 12O6

<210s, SEQ ID NO 11 &211s LENGTH: 4 O1 212. TYPE: PRT <213> ORGANISM: Rhodococcus sp. <4 OOs, SEQUENCE: 11 Met Thir Ile Glu Glin Thr Lieu. Thir Asp Llys Glu Arg Lieu Ala Gly Lieu. 1. 5 1O 15 Asp Lieu. Gly Glin Lieu. Glu Glin Lieu Val Gly Lieu Val Glu Tyr Asp Gly 2O 25 3O Thr Arg Asp Pro Phe Pro Val Ser Gly Trp Asp Ala Val Val Trp Val 35 4 O 45 Val Gly Asn Ala Thr Glin Thr Ala His Tyr Phe Glin Ser Ala Phe Gly SO 55 6 O Met Thr Lieu Val Ala Tyr Ser Gly Pro Thr Thr Gly Asn Arg Asp His 65 70 7s 8O His Ser Phe Val Lieu. Glu Ser Gly Ala Val Arg Phe Val Ile Lys Gly 85 90 95 Ala Val Asn. Pro Asp Ser Pro Lieu. Ile Asp His His Arg Thr His Gly 1OO 105 11 O Asp Gly Val Val Asp Ile Ala Lieu Ala Val Pro Asp Wall Asp Llys Cys 115 12 O 125 Ile Ala His Ala Arg Ala Glin Gly Ala Thr Val Lieu. Asp Glu Pro His 13 O 135 14 O Asp Val Thir Asp Asp His Gly Thr Val Arg Lieu Ala Ala Ile Ala Thr 145 150 155 160 Tyr Gly Asp Thr Arg His Thr Lieu Val Asp Arg Ser His Tyr Thr Gly 1.65 17O 17s Pro Tyr Lieu Pro Gly Tyr Thr Ala Arg Thr Ser Gly His Thr Lys Arg 18O 185 19 O Asp Gly Ala Pro Lys Arg Lieu. Phe Glin Ala Lieu. Asp His Val Val Gly 195 2OO 2O5 Asn Val Glu Lieu. Gly Llys Met Asp His Trp Val Asp Phe Tyr Asn Arg 21 O 215 22O Val Met Gly Phe Thr Asn Met Ala Glu Phe Val Gly Glu Asp Ile Ala 225 23 O 235 24 O Thir Asp Tyr Ser Ala Lieu Met Ser Llys Val Val Ser Asn Gly Asn His 245 250 255 Arg Val Llys Phe Pro Lieu. Asn. Glu Pro Ala Lieu Ala Lys Lys Arg Ser 26 O 265 27 O Glin Ile Asp Glu Tyr Lieu. Asp Phe Tyr Arg Gly Pro Gly Ala Gln His 27s 28O 285 Lieu Ala Lieu Ala Thr Asn Asp Ile Lieu. Thir Ala Val Asp Gln Lieu. Thir 29 O 295 3 OO Ala Glu Gly Val Glu Phe Lieu Ala Thr Pro Asp Ser Tyr Tyr Glu Asp 3. OS 310 315 32O Pro Glu Lieu. Arg Ala Arg Ile Gly Asn Val Arg Ala Pro Ile Ala Glu 3.25 330 335

Lieu. Glin Lys Arg Gly Ile Lieu Val Asp Arg Asp Glu Asp Gly Tyr Lieu.

US 2014/0066307 A1 Mar. 6, 2014 94

- Continued Asp Ala Ser Asp Pro Phe Pro Val Val Ala Met Asp Ala Val Val Phe 35 4 O 45 Val Cys Gly Asn Ala Thr Glin Ser Thr Glin Tyr Phe Val Ser Thr Trp SO 55 6 O Gly Met Thr Lieu Val Ala Tyr Ala Gly Pro Glu Thr Gly Glin Arg Ser 65 70 7s 8O His Llys Ser Phe Val Lieu. Glu Ser Gly Ser Ala Arg Phe Val Lieu. His 85 90 95 Gly Ala Val Asp Pro Llys Ser Pro Lieu Ala Asp His His Arg Ala His 1OO 105 11 O Gly Asp Gly Val Val Asp Lieu Ala Met Glu Val Lieu. Asp Wall Asp Arg 115 12 O 125 Cys Ile Ala His Ala Arg Ser Glin Gly Ala Thir Ile Lieu. Glu Glu Pro 13 O 135 14 O Arg Asp Val Thr Asp Glin Phe Gly. Thr Val Arg Lieu Ala Ala Ile Ala 145 150 155 160 Thr Tyr Gly Ser Thr Arg His Thr Ile Val Asp Arg Ser Arg Tyr Asp 1.65 17O 17s Gly Pro Tyr Lieu Pro Gly Phe Val Ala Arg Ser Ser Gly Phe Ala Ala 18O 185 19 O Arg Pro Gly Llys Pro Pro Arg Lieu. Phe Glin Ala Lieu. Asp His Ala Val 195 2OO 2O5 Gly ASn Val Glu Met Gly Arg Met Asp His Trp Val Arg Phe Tyr Asn 21 O 215 22O Arg Val Met Gly Phe Thr Asn Met Ala Glu Phe Val Gly Asp Asp Ile 225 23 O 235 24 O Ala Thr Glu Tyr Ser Ala Lieu Met Ser Llys Val Val Ala Asn Gly Asn 245 250 255 His Arg Val Llys Phe Pro Lieu. Asn. Glu Pro Ala Val Gly Lys Llys Llys 26 O 265 27 O Ser Glin Ile Asp Glu Tyr Lieu. Glu Phe Tyr Gly Glu Pro Gly Cys Glin 27s 28O 285 His Lieu Ala Lieu Ala Thr Gly Asp Ile Lieu Ala Thr Val Asp Ala Lieu. 29 O 295 3 OO Arg Ala Glu Gly Val Glu Phe Lieu. Asn Thr Pro Asp Ala Tyr Tyr Glu 3. OS 310 315 32O Asp Pro Glin Lieu. Arg Ala Arg Ile Gly Arg Val Arg Val Pro Val Glu 3.25 330 335 Glu Lieu Gln Lys Arg Gly Ile Lieu Val Asp Arg Asp Glu Asp Gly Tyr 34 O 345 35. O Lieu. Leu Glin Ile Phe Thr Lys Pro Leu Gly Asp Arg Pro Thr Val Phe 355 360 365 Phe Glu Val Ile Glu Arg His Gly Ser Lieu. Gly Phe Gly Ala Gly Asn 37 O 375 38O Phe Glin Ala Lieu. Phe Glu Ser Ile Glu Arg Glu Glin Ala Ala Arg Gly 385 390 395 4 OO

ASn Luell

<210s, SEQ ID NO 14 &211s LENGTH: 1107 &212s. TYPE: DNA <213> ORGANISM: Picrophilus torridus US 2014/0066307 A1 Mar. 6, 2014 95

- Continued <4 OOs, SEQUENCE: 14 atgitatggca aaaatttaat ct cagaacta agggaaaagg agatctittaa acgattacat 6 O cacgtggaat tttacgittag cagtgccalaa acatggt cat attt catgala Caggggit Ctt 12 O ggatttaaaa cagtgg cata to cqgtc.ca gaalaccggga taagggacaa gat at CCtat 18O gttatgtc.cc agggcactgc aaggatat ct tttacat cat caatgaatga tigatagot at 24 O at atcgaatc atgttaaaaa acacggggat ggcgtaaagg atatagc act taggtogat 3OO gatctggacg aggcaaaaag cct gatagala aagtatggaa caaaggttt C aaaaataaat 360 gaaataaagg atggaaatgg aaagataaga actgcagaga taaaaacgta C9gtgaalacc 42O gttcatacat taatagaaac C9gggattac aatggcgitat t catgc.ccgg ttatgaggaa 48O tctgaaataa attcaaaaaa cactgggata aaaaagat.cg at catatagt toggaaatgtc 54 O tatgagggcg agatggatag Ctgggittaat ttitta catag aaaaacttgg Ctttgagcat 6OO ttaataacct ttgatgataa agatataaga actgattaca gcgcattaag atcaaaggitt 660 gtaaaataca atgacgatat cqtatttcca ataaatgagc ctdcaaaggg cittaagaaaa 72 O t cacagatag aggaat at ct tact attac aggtotgagg gcgttcagca Catagcactg 78O ttaactgatg atataataaa aactgtatico atgatggagg aaaacggcat agaatttitta 84 O aaaacaccag gat catacta tdaatcc.cta t catcaagga taggct caat agacgaggat 9 OO ttaaatgaaa tagagaaaca taa catactt gtggat.cgtg atgagaacgg atacct atta 96.O cagatct tca caaag.cctgt tactgacagg ccaacgttct tctittgaggit catacagaga 1 O2O aagggtgcaa ggt catt.cgg caacggtaac tittaaggcac tttittgaggc gatagaaagg 108 O gaggaggcaa agagaggaaa cct atga 1107

<210s, SEQ ID NO 15 &211s LENGTH: 368 212. TYPE: PRT <213> ORGANISM: Picrophilus torridus <4 OOs, SEQUENCE: 15 Met Tyr Gly Lys Asn Lieu. Ile Ser Glu Lieu. Arg Glu Lys Glu Ile Phe 1. 5 1O 15 Lys Arg Lieu. His His Val Glu Phe Tyr Val Ser Ser Ala Lys Thir Trp 2O 25 3O Ser Tyr Phe Met Asn Arg Gly Lieu. Gly Phe Llys Thr Val Ala Tyr Ala 35 4 O 45 Gly Pro Glu Thr Gly Ile Arg Asp Lys Ile Ser Tyr Val Met Ser Glin SO 55 6 O Gly Thr Ala Arg Ile Ser Phe Thr Ser Ser Met Asn Asp Asp Ser Tyr 65 70 7s 8O Ile Ser Asn His Val Llys Llys His Gly Asp Gly Wall Lys Asp Ile Ala 85 90 95 Lieu. Glu Val Asp Asp Lieu. Asp Glu Ala Lys Ser Lieu. Ile Glu Lys Tyr 1OO 105 11 O Gly. Thir Lys Val Ser Lys Ile Asn. Glu Ile Lys Asp Gly Asin Gly Lys 115 12 O 125 Ile Arg Thr Ala Glu Ile Llys Thr Tyr Gly Glu Thr Val His Thr Lieu. 13 O 135 14 O

Ile Glu Thr Gly Asp Tyr Asn Gly Val Phe Met Pro Gly Tyr Glu Glu 145 150 155 160 US 2014/0066307 A1 Mar. 6, 2014 96

- Continued

Ser Glu Ile Asn. Ser Lys Asn Thr Gly Ile Llys Lys Ile Asp His Ile 1.65 17O 17s Val Gly Asn Val Tyr Glu Gly Glu Met Asp Ser Trp Val Asin Phe Tyr 18O 185 19 O Ile Glu Lys Lieu. Gly Phe Glu. His Lieu. Ile Thr Phe Asp Asp Lys Asp 195 2OO 2O5 Ile Arg Thr Asp Tyr Ser Ala Lieu. Arg Ser Llys Val Val Lys Tyr Asn 21 O 215 22O Asp Asp Ile Val Phe Pro Ile Asn. Glu Pro Ala Lys Gly Lieu. Arg Llys 225 23 O 235 24 O Ser Glin Ile Glu Glu Tyr Lieu. Asp Tyr Tyr Arg Ser Glu Gly Val Glin 245 250 255 His Ile Ala Lieu. Lieu. Thir Asp Asp Ile Ile Llys Thr Val Ser Met Met 26 O 265 27 O Glu Glu Asn Gly Ile Glu Phe Leu Lys Thr Pro Gly Ser Tyr Tyr Glu 27s 28O 285 Ser Lieu. Ser Ser Arg Ile Gly Ser Ile Asp Glu Asp Lieu. Asn. Glu Ile 29 O 295 3 OO Glu Lys His Asn. Ile Lieu Val Asp Arg Asp Glu Asn Gly Tyr Lieu. Lieu. 3. OS 310 315 32O Glin Ile Phe Thr Lys Pro Val Thr Asp Arg Pro Thr Phe Phe Phe Glu 3.25 330 335 Val Ile Glin Arg Lys Gly Ala Arg Ser Phe Gly Asn Gly Asn. Phe Lys 34 O 345 35. O Ala Lieu. Phe Glu Ala Ile Glu Arg Glu Glin Ala Lys Arg Gly Asn Lieu 355 360 365

<210s, SEQ ID NO 16 &211s LENGTH: 1164 &212s. TYPE: DNA <213> ORGANISM: Kordia algicida <4 OOs, SEQUENCE: 16 atggcagoag aaataaaaaa cittaaaagat ttacaaaata cagaatacgg act caaaaaa 6 O ttatttgacg aag cagaaga ctittct tcca cittittaggaa cagacitacgt agaattatac 12 O gtcgggaacg ccaaacaatc ggcacatttic tacaaaacgg cittittggittt toaat cagaa 18O gcttacgcag gattggaaac aggattalacc gacagagttt Catacg tatt aaaacaagat 24 O aaaatt cqct toggtc.ttaac aacac catta ggaaaaggtg gcgaaat caa tdagcatatic 3OO gatttacacg gcgatggcgt aaaagtag ta gcactittggg tagaagatgc tacaaaa.gc.c 360 tittgaagaaa Caccaaaag aggcgcaaaa ccgtacatgg aaccaacaaa agaagaagat 42O gaaaacggat atgtaatticg Ctcaggaatc tatacgtacg gagaaacggit t catgtttitt 48O gtagaacgta aaaactataa cqgagt ctitt ttaccaggat atcaaagatg ggaat ct cac 54 O tacaatcc.gg agc.cagttgg Cttaaaattic atcgat caca ttaggaala totaggttgg 6OO ggagaaatga aagaatggtg tdaattctac gcgaaagtaa tdggatttgc gcaaattatic 660 t cctttacag atgatgat at ttctaccg at titt actg.cgt tdatgagtaa agtaatgagt 72 O aatggaaatg gtagaatcaa atttic caatc aatgaac ccg Cagaaggaala aaagaaatcg 78O caaattgaag aatat citaga ctitttacaat gigttcaggag tacaa catat td.cggttgct 84 O acagacaata ttattgatac gig titt cqcaa atgcgcgaac gtggagtaga attcttatac 9 OO US 2014/0066307 A1 Mar. 6, 2014 97

- Continued gttcCagata cat attatga tigacittgtta gaacgtgttg gcgacat catalagatgta 96.O gaagaactica aaaaac acgg aatcttaatt gatcgtgatg aagaaggata ctt attgcag 1 O2O ttatttacca aaaccattgt agacagacca acaatgttct ttgaagt cat t cagogtaaa 108 O ggcgcacaat catttggagt aggaaactitt aaa.gctitt at ttgaagcgat agaaagagaa 114 O

Caagctgctic gcggalacatt gtaa 1164.

<210s, SEQ ID NO 17 &211s LENGTH: 387 212. TYPE: PRT <213> ORGANISM: Kordia algicida

<4 OOs, SEQUENCE: 17 Met Ala Ala Glu Ile Lys Asn Lieu Lys Asp Lieu. Glin Asn Thr Glu Tyr 1. 5 1O 15 Gly Lieu Lys Llys Lieu. Phe Asp Glu Ala Glu Asp Phe Lieu Pro Lieu. Lieu. 2O 25 3O Gly. Thir Asp Tyr Val Glu Lieu. Tyr Val Gly Asn Ala Lys Glin Ser Ala 35 4 O 45 His Phe Tyr Lys Thr Ala Phe Gly Phe Glin Ser Glu Ala Tyr Ala Gly SO 55 6 O Lieu. Glu Thr Gly Lieu. Thir Asp Arg Val Ser Tyr Val Lieu Lys Glin Asp 65 70 7s 8O Lys Ile Arg Lieu Val Lieu. Thir Thr Pro Lieu. Gly Lys Gly Gly Glu Ile 85 90 95 Asn Glu. His Ile Asp Lieu. His Gly Asp Gly Val Llys Val Val Ala Lieu 1OO 105 11 O Trp Val Glu Asp Ala Thr Lys Ala Phe Glu Glu Thir Thr Lys Arg Gly 115 12 O 125 Ala Lys Pro Tyr Met Glu Pro Thr Lys Glu Glu Asp Glu Asn Gly Tyr 13 O 135 14 O Val Ile Arg Ser Gly Ile Tyr Thr Tyr Gly Glu Thr Val His Val Phe 145 150 155 160 Val Glu Arg Lys Asn Tyr Asn Gly Val Phe Lieu Pro Gly Tyr Glin Arg 1.65 17O 17s Trp. Glu Ser His Tyr Asn Pro Glu Pro Val Gly Lieu Lys Phe Ile Asp 18O 185 19 O His Met Val Gly Asn Val Gly Trp Gly Glu Met Lys Glu Trp Cys Glu 195 2OO 2O5 Phe Tyr Ala Lys Val Met Gly Phe Ala Glin Ile Ile Ser Phe Thr Asp 21 O 215 22O Asp Asp Ile Ser Thr Asp Phe Thr Ala Leu Met Ser Lys Val Met Ser 225 23 O 235 24 O Asn Gly Asn Gly Arg Ile Llys Phe Pro Ile Asn. Glu Pro Ala Glu Gly 245 250 255 Llys Llys Llys Ser Glin Ile Glu Glu Tyr Lieu. Asp Phe Tyr Asn Gly Ser 26 O 265 27 O Gly Val Glin His Ile Ala Wall Ala Thr Asp Asn. Ile Ile Asp Thr Val 27s 28O 285 Ser Gln Met Arg Glu Arg Gly Val Glu Phe Leu Tyr Val Pro Asp Thr 29 O 295 3 OO

Tyr Tyr Asp Asp Lieu. Lieu. Glu Arg Val Gly Asp Ile Asp Glu Asp Wall US 2014/0066307 A1 Mar. 6, 2014 98

- Continued

3. OS 310 315 32O Glu Glu Lieu Lys Llys His Gly Ile Lieu. Ile Asp Arg Asp Glu Glu Gly 3.25 330 335 Tyr Lieu. Leu Gln Leu Phe Thr Lys Thr Ile Val Asp Arg Pro Thr Met 34 O 345 35. O Phe Phe Glu Val Ile Glin Arg Lys Gly Ala Glin Ser Phe Gly Val Gly 355 360 365 Asn Phe Lys Ala Lieu. Phe Glu Ala Ile Glu Arg Glu Glin Ala Ala Arg 37 O 375 38O Gly Thr Lieu. 385

<210s, SEQ ID NO 18 &211s LENGTH: 1056 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Nucleic acid sequence encoding Synechococcus sp. HPPD optimized for the expression in soybean and cotton

<4 OOs, SEQUENCE: 18 atggctaacc catccattag gatcgttcag ggaatccatc acctt cact t c tacctittgg 6 O gatctt CC aa ggtggagaga gcatttctgt agagtttggg gattcagagt tottctgat 12 O gctggaaaca citcttgaact tdagcaagga t ct cittaggc titaggctitt c ticaac cagot 18O agagctggtg atgaagttga taggcatctt Caaagacatg gaccaggtgt tttgatgtt 24 O gct Cttgctg ttggagaa.ca agaact tcca gct Cttgctgaacttct tag aggaaggggit 3OO gct caacttg cittggattico agctgctgct gct ctittgcc tt catactic catacggaatt 360 aggcactic cc titatt coagg accacttgat gctgctic cag ctgaggctgg acttittittct 42O cattgggat.c acgttgttct taatgtggag cagggat.ctic ttcaa.gctgc tigctgattgg 48O tatggaagag ttcttggatg gcgtagacitt taccgttact c catcggaac togctact tca 54 O ggacttgagt ctgttgttgt tagatcca gaggctggca ttcaatgggc tat caacgaa 6OO cc tacttgcg ctgcttctica gattcaagag titcct tcatg ct catggtgg accagg tatt 660 caacatgctg ct citcc actic titcagatatt gtggcttct c ttagaaggct taggcaaggit 72 O ggagttgatt t ccttcaagt ggctic cacag tactatactt Ctcttgagag agagcttgga 78O Cttgct Ctta gatctgct ct tacaggct attt Cttggc aggat Cttgt tagcagcag 84 O attcttcttg atgctact ct tccagcttct gatggacaag at aggcc act tttgctic caa 9 OO actitt cactic aaccacttitt cqgaaggcca acatt cittct tcgaagtgat tcaaagacitt 96.O ggaggtgcta Ctggatttgg agaggctaat titcCaagctic titt to gaggc ticttgaaagg 1 O2O caacaaaggc aaaggcatca agctct tact c catga 1056

<210s, SEQ ID NO 19 &211s LENGTH: 1152 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Nucleic acid sequence encoding Blepharisma japonicum HPPD optimized for the expression in soybean and cotton

<4 OOs, SEQUENCE: 19 atggct actt act acgataa gCaagagact agaccagatc ttggagagtt Ctacggattic 6 O