DOCSLIB.ORG

SSX4 (SSX4B) (NM 001034832) Human Untagged Clone Product Data

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
SSX4 (SSX4B) (NM 001034832) Human Untagged Clone Product Data OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC302796 SSX4 (SSX4B) (NM_001034832) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: SSX4 (SSX4B) (NM_001034832) Human Untagged Clone Tag: Tag Free Symbol: SSX4B Synonyms: CT5.4 Vector: pCMV6 series Fully Sequenced ORF: >NCBI ORF sequence for NM_001034832, the custom clone sequence may differ by one or more nucleotides ATGAACGGAGACGACGCCTTTGCAAGGAGACCCAGGGATGATGCTCAAATATCAGAGAAG TTACGAAAGGCCTTCGATGATATTGCCAAATACTTCTCTAAGAAAGAGTGGGAAAAGATG AAATCCTCGGAGAAAATCGTCTATGTGTATATGAAGCTAAACTATGAGGTCATGACTAAA CTAGGTTTCAAGGTCACCCTCCCACCTTTCATGCGTAGTAAACGGGCTGCAGACTTCCAC GGGAATGATTTTGGTAACGATCGAAACCACAGGAATCAGGTTGAACGTCCTCAGATGACT TTCGGCAGCCTCCAGAGAATCTTCCCGAAGATCATGCCCAAGAAGCCAGCAGAGGAAGAA AATGGTTTGAAGGAAGTGCCAGAGGCATCTGGCCCACAAAATGATGGGAAACAGCTGTGC CCCCCGGGAAATCCAAGTACCTTGGAGAAGATTAACAAGACATCTGGACCCAAAAGGGGG AAACATGCCTGGACCCACAGACTGCGTGAGAGAAAGCAGCTGGTGGTTTATGAAGAGATC AGCGACCCTGAGGAAGATGACGAGTAA Restriction Sites: Please inquire ACCN: NM_001034832 OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. RefSeq: NM_001034832.1, NP_001030004.1 RefSeq Size: 1322 bp RefSeq ORF: 567 bp Locus ID: 548313 This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 SSX4 (SSX4B) (NM_001034832) Human Untagged Clone – SC302796 UniProt ID: O60224 Gene Summary: The product of this gene belongs to the family of highly homologous synovial sarcoma X (SSX) breakpoint proteins. These proteins may function as transcriptional repressors. They are also capable of eliciting spontaneously humoral and cellular immune responses in cancer patients, and are potentially useful targets in cancer vaccine-based immunotherapy. SSX1, SSX2 and SSX4 genes have been involved in the t(X;18) translocation characteristically found in all synovial sarcomas. This translocation results in the fusion of the synovial sarcoma translocation gene on chromosome 18 to one of the SSX genes on chromosome X. Chromosome Xp11 contains a segmental duplication resulting in two identical copies of synovial sarcoma, X breakpoint 4, SSX4 and SSX4B, in tail-to-tail orientation. This gene, SSX4B, represents the more centromeric copy. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (a). ##RefSeq-Attributes-START## RefSeq Select criteria :: based on expression, longest protein ##RefSeq-Attributes-END## COMPLETENESS: complete on the 3' end. This product is to be used for laboratory only. Not for diagnostic or therapeutic use. ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 2 / 2.
Load more

Recommended publications
  • SS18 (SYT) (18Q11) Gene Rearrangement by FISH Indications for Ordering Genetics
    SS18 (SYT) (18q11) Gene Rearrangement by FISH Indications for Ordering Genetics Diagnosis of synovial sarcoma in conjunction with histologic Translocations – SS18-SSX1, SS18-SSX2 and clinical information Structure/function Test Description • SS18 is located on chromosome 18 • SSX1 and SSX2 are located on the X-chromosome Fluorescence in situ hybridization • Each gene in the translocation codes for proteins that have opposite transcriptional functions Tests to Consider o SS18 – activator of oncogenes Primary test o SSX1, SSX2 – tumor suppression SS18 (SYT) (18q11) Gene Rearrangement by FISH 3001303 Test Interpretation • Molecular diagnosis of synovial sarcoma Results Related test • Positive – SS18 rearrangement is detected Chromosome FISH, Interphase 2002298 o SSX translocation partner is not identified with this • Specific probe for SS18 (SYT) rearrangement must be testing methodology requested o Synovial sarcoma likely • Fresh tissue specimens only • Negative – no SS18 rearrangement detected Disease Overview o Does not entirely exclude the presence of an SS18 rearrangement as some translocations are cryptic and Incidence – rare not evaluable by this testing methodology • Synovial sarcomas account for 8-10% of all soft tissue o Does not entirely exclude diagnosis of synovial sarcoma sarcomas Limitations Diagnostic/prognostic issues • Testing using tissue fixed in alcohol-based or non-formalin • Synovial sarcomas may resemble other neoplasms, fixatives has not been validated using this method particularly those displaying an epithelioid, spindle cell, or • SS18 fusion partners are not detected with this test combined morphology • t(X;18)(p11.2;q11.2) translocation serves as a specific marker for synovial sarcoma o SS18 (SYT) gene fuses with SSX gene . Fusion with SSX1 in ~65% of synovial sarcomas .
    [Show full text]
  • A Novel Type of SYT/SSX Fusion
    A Novel Type of SYT/SSX Fusion: Methodological and Biological Implications Maria Törnkvist, M.Sc., Bertha Brodin, Ph.D., Armando Bartolazzi, M.D., Ph.D., Olle Larsson, M.D., Ph.D. Department of Cellular and Molecular Tumor Pathology, Cancer Centrum Karolinska, Karolinska Hospital (MT, BB, AB, OL), Stockholm, Sweden; and Department of Pathology, Regina Elena Cancer Institute (AB), Rome, Italy the presence of SYT/SSX transcripts in two cases Synovial sarcoma (SS) is a rare soft-tissue tumor using the proposed RT-PCR approach. Applications that affects children and young adults. It is charac- of optimized RT-PCR can contribute to reduce false- terized by the chromosomal translocation t(X; negative SYT/SSX SS cases reported in literature. 18)(p11.2;q11.2), which results in the fusion of the SYT gene on chromosome 18 with a SSX gene on KEY WORDS: RT-PCR, Synovial sarcoma, SYT/SSX chromosome X. In the majority of cases, SYT is fusion gene, SYT/SSX variants. fused to exon 5 of SSX1 (64%), SSX2 (36%), or, Mod Pathol 2002;15(6):679–685 rarely, SSX4. A novel fusion transcript variant deriv- ing from the fusion of SYT to exon 6 of SSX4 gene Synovial sarcomas (SS) account for 7 to 10% of all (SYT/SSX4v) was found coexpressed in one of the human soft-tissue sarcomas and are mainly located previously reported SYT/SSX4 cases. In the present in the extremities in the vicinity of large joints (1). investigation, we describe a new SS case that was Depending on histomorphological appearance, SSs previously shown to be negative for SYT/SSX1 and are usually subdivided into two major forms, bipha- SYT/SSX2 expression by conventional reverse tran- sic and monophasic.
    [Show full text]
  • A Novel FISH Assay for SS18–SSX Fusion Type in Synovial Sarcoma
    Laboratory Investigation (2004) 84, 1185–1192 & 2004 USCAP, Inc All rights reserved 0023-6837/04 $30.00 www.laboratoryinvestigation.org A novel FISH assay for SS18–SSX fusion type in synovial sarcoma Cecilia Surace1,2, Ioannis Panagopoulos1, Eva Pa˚lsson1, Mariano Rocchi2, Nils Mandahl1 and Fredrik Mertens1 1Department of Clinical Genetics, Lund University Hospital, Lund, Sweden and 2DAPEG, Section of Genetics, University of Bari, Bari, Italy Synovial sarcoma is a morphologically, clinically and genetically distinct entity that accounts for 5–10% of all soft tissue sarcomas. The t(X;18)(p11.2;q11.2) is the cytogenetic hallmark of synovial sarcoma and is present in more than 90% of the cases. It produces three types of fusion gene formed in part by SS18 from chromosome 18 and by SSX1, SSX2 or, rarely, SSX4 from the X chromosome. The SS18–SSX fusions do not seem to occur in other tumor types, and it has been shown that in synovial sarcoma a clear correlation exists between the type of fusion gene and histologic subtype and, more importantly, clinical outcome. Previous analyses regarding the type of fusion genes have been based on PCR amplification of the fusion transcript, requiring access to good- quality RNA. In order to obtain an alternative tool to diagnose and follow this malignancy, we developed a fluorescence in situ hybridization (FISH) assay that could distinguish between the two most common fusion genes, that is, SS18–SSX1 and SS18–SSX2. The specificity of the selected bacterial artificial chromosome clones used in the detection of these fusion genes, as well as the sensitivity of the analysis in metaphase and interphase cells, was examined in a series of 28 synovial sarcoma samples with known fusion gene status.
    [Show full text]
  • Aneuploidy: Using Genetic Instability to Preserve a Haploid Genome?
    Health Science Campus FINAL APPROVAL OF DISSERTATION Doctor of Philosophy in Biomedical Science (Cancer Biology) Aneuploidy: Using genetic instability to preserve a haploid genome? Submitted by: Ramona Ramdath In partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biomedical Science Examination Committee Signature/Date Major Advisor: David Allison, M.D., Ph.D. Academic James Trempe, Ph.D. Advisory Committee: David Giovanucci, Ph.D. Randall Ruch, Ph.D. Ronald Mellgren, Ph.D. Senior Associate Dean College of Graduate Studies Michael S. Bisesi, Ph.D. Date of Defense: April 10, 2009 Aneuploidy: Using genetic instability to preserve a haploid genome? Ramona Ramdath University of Toledo, Health Science Campus 2009 Dedication I dedicate this dissertation to my grandfather who died of lung cancer two years ago, but who always instilled in us the value and importance of education. And to my mom and sister, both of whom have been pillars of support and stimulating conversations. To my sister, Rehanna, especially- I hope this inspires you to achieve all that you want to in life, academically and otherwise. ii Acknowledgements As we go through these academic journeys, there are so many along the way that make an impact not only on our work, but on our lives as well, and I would like to say a heartfelt thank you to all of those people: My Committee members- Dr. James Trempe, Dr. David Giovanucchi, Dr. Ronald Mellgren and Dr. Randall Ruch for their guidance, suggestions, support and confidence in me. My major advisor- Dr. David Allison, for his constructive criticism and positive reinforcement.
    [Show full text]
  • Li Et Al. 1 Genetic Interactions Between Mediator and the Late G1
    Genetics: Published Articles Ahead of Print, published on July 5, 2005 as 10.1534/genetics.105.043893 Li et al. Genetic interactions between mediator and the late G1-specific transcription factor Swi6 in Saccharomyces cerevisiae. Lihong Li* Tina Quinton*1 Shawna Miles* Linda L. Breeden*2 *Division of Basic Sciences Fred Hutchinson Cancer Research Center Seattle, WA 98109-1024 1Present address: Christensen, O’Connor, Johnson, KindnessPLLC, Seattle, WA 98101 1 Li et al. Running head: Interactions between Swi6 and mediator Key words: Swi6, mediator, transcription, G1, suppressor 2Corresponding author: Fred Hutchinson Cancer Research Center, 1100 Fairview Ave N. Mail stop A2-168, Seattle, WA 98109-1024 telephone (206) 667 4484, fax (206) 667 6526, Email [email protected] 2 Li et al. ABSTRACT Swi6 associates with Swi4 to activate HO and many other late G1-specific transcripts in budding yeast. Genetic screens for suppressors of SWI6 mutants have been carried out. 112 of these mutants have been identified and most fall into seven complementation groups. Six of these genes have been cloned and identified and they all encode subunits of the mediator complex. These mutants restore transcription to the HO-lacZ reporter in the absence of Swi6 and have variable effects on other Swi6 target genes. Deletions of other non- essential mediator components have been tested directly for suppression of, or genetic interaction with swi6. Mutations in half of the known subunits of mediator show suppression and/or growth defects in combination with swi6. These phenotypes are highly variable and do not identify a specific module of the mediator as critical for repression in the absence of Swi6.
    [Show full text]
  • SSX4 Antibody Cat
    SSX4 Antibody Cat. No.: 56-923 SSX4 Antibody Specifications HOST SPECIES: Rabbit SPECIES REACTIVITY: Human This SSX4 antibody is generated from rabbits immunized with a KLH conjugated synthetic IMMUNOGEN: peptide between 63-91 amino acids from the Central region of human SSX4. TESTED APPLICATIONS: WB APPLICATIONS: For WB starting dilution is: 1:1000 PREDICTED MOLECULAR 22 kDa WEIGHT: Properties This antibody is purified through a protein A column, followed by peptide affinity PURIFICATION: purification. CLONALITY: Polyclonal ISOTYPE: Rabbit Ig CONJUGATE: Unconjugated PHYSICAL STATE: Liquid September 25, 2021 1 https://www.prosci-inc.com/ssx4-antibody-56-923.html BUFFER: Supplied in PBS with 0.09% (W/V) sodium azide. CONCENTRATION: batch dependent Store at 4˚C for three months and -20˚C, stable for up to one year. As with all antibodies STORAGE CONDITIONS: care should be taken to avoid repeated freeze thaw cycles. Antibodies should not be exposed to prolonged high temperatures. Additional Info OFFICIAL SYMBOL: SSX4 ALTERNATE NAMES: Protein SSX4, Cancer/testis antigen 54, CT54, SSX4, SSX4A ACCESSION NO.: O60224 GENE ID: 548313, 6759 USER NOTE: Optimal dilutions for each application to be determined by the researcher. Background and References The product of this gene belongs to the family of highly homologous synovial sarcoma X (SSX) breakpoint proteins. These proteins may function as transcriptional repressors. They are also capable of eliciting spontaneously humoral and cellular immune responses in cancer patients, and are potentially useful targets in cancer vaccine-based immunotherapy. SSX1, SSX2 and SSX4 genes have been involved in the t(X;18) BACKGROUND: translocation characteristically found in all synovial sarcomas.
    [Show full text]
  • Product Sheet CA1235
    SSX2 Antibody Applications: WB, IHC Detected MW: 25 kDa Cat. No. CA1235 Species & Reactivity: Human, Mouse, Rat Isotype: Rabbit IgG BACKGROUND SSX2 belongs to the family of highly homologous based immunotherapy.4 Two transcript variants synovial sarcoma X (SSX) breakpoint proteins. encoding distinct isoforms have been identified for The SSX gene family is composed of at least 9 SSX2 gene. SSX2 is thought to function in functional and highly homologous members and development and germ line cells as a repressive shown to be located on chromosome X. The gene regulator. Its control of gene expression is normal testis expresses SSX1, 2, 3, 4, 5, and 7, believed to be epigenetic in nature and to involve but not 6, 8, or 9. In tumors, SSX1, 2, and 4 are chromatin modification and remodeling. It is most expressed at varying frequencies, whereas SSX3, likely mediated by the association of SSX2 with the 5, and 6 are rarely expressed. In addition, no Polycomb gene silencing complex at the SSXRD expression of SSX8, or 9 has been observed. SSX1 domain. Polycomb silencing involves chromatin to SSX5 are also normally expressed in thyroid.1 compaction, DNA methylation, repressive histone The SSX family shares nucleotide homology modifications and inaccessibility of promoter ranging from 88% to 95%, and amino acid regions to transcription machineries. Other SSX2- homology ranging from 77% to 91%. The NH2- interacting partners include the LIM homeobox terminal moieties of the SSX proteins exhibit protein LHX4, a Ras-like GTPase Interactor, homology to the Krüppel-associated box (KRAB) RAB3IP thought to be involved in vesicular domain, a domain that is known to be involved in transport, and SSX2IP, a putative cell transcriptional repression.
    [Show full text]
  • Genomic and Expression Profiling of Human Spermatocytic Seminomas: Primary Spermatocyte As Tumorigenic Precursor and DMRT1 As Candidate Chromosome 9 Gene
    Research Article Genomic and Expression Profiling of Human Spermatocytic Seminomas: Primary Spermatocyte as Tumorigenic Precursor and DMRT1 as Candidate Chromosome 9 Gene Leendert H.J. Looijenga,1 Remko Hersmus,1 Ad J.M. Gillis,1 Rolph Pfundt,4 Hans J. Stoop,1 Ruud J.H.L.M. van Gurp,1 Joris Veltman,1 H. Berna Beverloo,2 Ellen van Drunen,2 Ad Geurts van Kessel,4 Renee Reijo Pera,5 Dominik T. Schneider,6 Brenda Summersgill,7 Janet Shipley,7 Alan McIntyre,7 Peter van der Spek,3 Eric Schoenmakers,4 and J. Wolter Oosterhuis1 1Department of Pathology, Josephine Nefkens Institute; Departments of 2Clinical Genetics and 3Bioinformatics, Erasmus Medical Center/ University Medical Center, Rotterdam, the Netherlands; 4Department of Human Genetics, Radboud University Medical Center, Nijmegen, the Netherlands; 5Howard Hughes Medical Institute, Whitehead Institute and Department of Biology, Massachusetts Institute of Technology, Cambridge, Massachusetts; 6Clinic of Paediatric Oncology, Haematology and Immunology, Heinrich-Heine University, Du¨sseldorf, Germany; 7Molecular Cytogenetics, Section of Molecular Carcinogenesis, The Institute of Cancer Research, Sutton, Surrey, United Kingdom Abstract histochemistry, DMRT1 (a male-specific transcriptional regulator) was identified as a likely candidate gene for Spermatocytic seminomas are solid tumors found solely in the involvement in the development of spermatocytic seminomas. testis of predominantly elderly individuals. We investigated these tumors using a genome-wide analysis for structural and (Cancer Res 2006; 66(1): 290-302) numerical chromosomal changes through conventional kar- yotyping, spectral karyotyping, and array comparative Introduction genomic hybridization using a 32 K genomic tiling-path Spermatocytic seminomas are benign testicular tumors that resolution BAC platform (confirmed by in situ hybridization).
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name synovial sarcoma translocation gene on chromosome 18-like 1 Gene Symbol SS18L1 Organism Human Gene Summary Synovial sarcomas occur most frequently in the extremities around large joints. More than 90% of cases have a recurrent and specific chromosomal translocation t(X;18)(p11.2;q11.2) in which the 5-prime end of the SS18 gene (MIM 600192) is fused in-frame to the 3-prime end of the SSX1 (MIM 312820) SSX2 (MIM 300192) or SSX4 (MIM 300326) gene. The SS18L1 gene is homologous to SS18. Gene Aliases CREST, KIAA0693, LP2261, MGC26711, MGC78386 RefSeq Accession No. NC_000020.10, NT_011362.10 UniGene ID Hs.154429 Ensembl Gene ID ENSG00000184402 Entrez Gene ID 26039 Assay Information Unique Assay ID qHsaCEP0025086 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENST00000331758, ENST00000421564, ENST00000370848 Amplicon Context Sequence ATGTTGAGCAAAGCTTAGGCCAACATGAATTGTTTGTGAAGTGTGGTTGATGGTG CTTTGTTTTTTTCTGACTACTTCTATGGAAGGCCAGTGAAGAAGCAAAGGAAGA Amplicon Length (bp) 79 Chromosome Location 20:60756836-60756944 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 98 R2 0.9992 cDNA Cq 20.19 cDNA Tm (Celsius) 79 gDNA Cq 25 Page 1/5 PrimePCR™Assay Validation Report Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 2/5 PrimePCR™Assay Validation Report SS18L1, Human Amplification Plot Amplification of cDNA generated from 25 ng of universal
    [Show full text]
  • SSX4 Rabbit Pab
    Leader in Biomolecular Solutions for Life Science SSX4 Rabbit pAb Catalog No.: A7929 Basic Information Background Catalog No. The product of this gene belongs to the family of highly homologous synovial sarcoma X A7929 (SSX) breakpoint proteins. These proteins may function as transcriptional repressors. They are also capable of eliciting spontaneously humoral and cellular immune Observed MW responses in cancer patients, and are potentially useful targets in cancer vaccine-based 27kDa immunotherapy. SSX1, SSX2 and SSX4 genes have been involved in the t(X;18) translocation characteristically found in all synovial sarcomas. This translocation results Calculated MW in the fusion of the synovial sarcoma translocation gene on chromosome 18 to one of 17kDa/21kDa the SSX genes on chromosome X. Chromosome Xp11 contains a segmental duplication resulting in two identical copies of synovial sarcoma, X breakpoint 4, SSX4 and SSX4B, in Category tail-to-tail orientation. This gene, SSX4, represents the more telomeric copy. Two transcript variants encoding distinct isoforms have been identified for this gene. Primary antibody Applications WB Cross-Reactivity Human, Mouse Recommended Dilutions Immunogen Information WB 1:500 - 1:2000 Gene ID Swiss Prot 6759 O60224 Immunogen Recombinant fusion protein containing a sequence corresponding to amino acids 70-188 of human SSX4 (NP_005627.1). Synonyms SSX4;CT5.4 Contact Product Information 400-999-6126 Source Isotype Purification Rabbit IgG Affinity purification [email protected] www.abclonal.com.cn Storage Store at -20℃. Avoid freeze / thaw cycles. Buffer: PBS with 0.02% sodium azide,50% glycerol,pH7.3. Validation Data Western blot analysis of extracts of various cell lines, using SSX4 antibody (A7929) at 1:1000 dilution.
    [Show full text]
  • An Integrated Genome-Wide Approach to Discover Tumor- Specific Antigens As Potential Immunologic and Clinical Targets in Cancer
    Published OnlineFirst November 7, 2012; DOI: 10.1158/0008-5472.CAN-12-1656 Cancer Integrated Systems and Technologies Research An Integrated Genome-Wide Approach to Discover Tumor- Specific Antigens as Potential Immunologic and Clinical Targets in Cancer Qing-Wen Xu1, Wei Zhao1, Yue Wang8,9, Maureen A. Sartor11, Dong-Mei Han2, Jixin Deng10, Rakesh Ponnala8,9, Jiang-Ying Yang3, Qing-Yun Zhang3, Guo-Qing Liao4, Yi-Mei Qu4,LuLi5, Fang-Fang Liu6, Hong-Mei Zhao7, Yan-Hui Yin1, Wei-Feng Chen1,†, Yu Zhang1, and Xiao-Song Wang8,9 Abstract Tumor-specific antigens (TSA) are central elements in the immune control of cancers. To systematically explore the TSA genome, we developed a computational technology called heterogeneous expression profile analysis (HEPA), which can identify genes relatively uniquely expressed in cancer cells in contrast to normal somatic tissues. Rating human genes by their HEPA score enriched for clinically useful TSA genes, nominating candidate targets whose tumor-specific expression was verified by reverse transcription PCR (RT-PCR). Coupled with HEPA, we designed a novel assay termed protein A/G–based reverse serological evaluation (PARSE) for quick detection of serum autoantibodies against an array of putative TSA genes. Remarkably, highly tumor-specific autoantibody responses against seven candidate targets were detected in 4% to 11% of patients, resulting in distinctive autoantibody signatures in lung and stomach cancers. Interrogation of a larger cohort of 149 patients and 123 healthy individuals validated the predictive value of the autoantibody signature for lung cancer. Together, our results establish an integrated technology to uncover a cancer-specific antigen genome offering a reservoir of novel immunologic and clinical targets.
    [Show full text]
  • Genome-Wide Analysis of Gene Expression in Synovial Sarcomas Using a Cdna Microarray1
    [CANCER RESEARCH 62, 5859–5866, October 15, 2002] Genome-wide Analysis of Gene Expression in Synovial Sarcomas Using a cDNA Microarray1 Satoshi Nagayama, Toyomasa Katagiri, Tatsuhiko Tsunoda, Taisuke Hosaka, Yasuaki Nakashima, Nobuhito Araki, Katsuyuki Kusuzaki, Tomitaka Nakayama, Tadao Tsuboyama, Takashi Nakamura, Masayuki Imamura, Yusuke Nakamura,2 and Junya Toguchida Laboratory of Molecular Medicine, Human Genome Center, Institute of Medical Science, The University of Tokyo, Tokyo 108-8639, Japan [S. N., T. K., Yu. N.]; Laboratory for Medical Informatics, SNP Research Center, RIKEN (Institute of Physical and Chemical Research), Tokyo 108-8639, Japan [Tat. T.]; Department of Tissue Regeneration, Institute for Frontier Medical Sciences [S. N., T. H., J. T.], and Departments of Orthopaedic Surgery [T. H., To. N., Ta. N.], Pathology [Ya. N], and Surgery and Surgical Basic Science [S. N., M. I.], Graduate School of Medicine, College of Medical Technology [Tad. T.], Kyoto University, Kyoto 606-8507, Japan; Department of Orthopedic Surgery, Osaka Medical Center for Cancer and Cardiovascular Diseases [N. A.], Osaka 537-8511, Japan; Department of Orthopedic Surgery, Kyoto Prefectural University of Medicine [K. K.], Kyoto 602-0841, Japan ABSTRACT (10). These data support the hypothesis that SS may originate from cells that are widely distributed in a variety of tissues. Among a histologically heterogeneous group of soft tissue sarcomas, Among several histological findings, the most distinctive feature of synovial sarcoma (SS) is regarded as a “miscellaneous” entity of uncertain SS is epithelial differentiation. On the basis of the presence or absence origin. Although recent molecular analysis has disclosed involvement of a of an epithelial component, SS is classified into two major subtypes: specific chromosomal translocation in the pathogenesis of SS, its genetic features remain largely unclear.
    [Show full text]