SSX4 (SSX4B) (NM 001034832) Human Untagged Clone Product Data

SSX4 (SSX4B) (NM 001034832) Human Untagged Clone Product Data

OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC302796 SSX4 (SSX4B) (NM_001034832) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: SSX4 (SSX4B) (NM_001034832) Human Untagged Clone Tag: Tag Free Symbol: SSX4B Synonyms: CT5.4 Vector: pCMV6 series Fully Sequenced ORF: >NCBI ORF sequence for NM_001034832, the custom clone sequence may differ by one or more nucleotides ATGAACGGAGACGACGCCTTTGCAAGGAGACCCAGGGATGATGCTCAAATATCAGAGAAG TTACGAAAGGCCTTCGATGATATTGCCAAATACTTCTCTAAGAAAGAGTGGGAAAAGATG AAATCCTCGGAGAAAATCGTCTATGTGTATATGAAGCTAAACTATGAGGTCATGACTAAA CTAGGTTTCAAGGTCACCCTCCCACCTTTCATGCGTAGTAAACGGGCTGCAGACTTCCAC GGGAATGATTTTGGTAACGATCGAAACCACAGGAATCAGGTTGAACGTCCTCAGATGACT TTCGGCAGCCTCCAGAGAATCTTCCCGAAGATCATGCCCAAGAAGCCAGCAGAGGAAGAA AATGGTTTGAAGGAAGTGCCAGAGGCATCTGGCCCACAAAATGATGGGAAACAGCTGTGC CCCCCGGGAAATCCAAGTACCTTGGAGAAGATTAACAAGACATCTGGACCCAAAAGGGGG AAACATGCCTGGACCCACAGACTGCGTGAGAGAAAGCAGCTGGTGGTTTATGAAGAGATC AGCGACCCTGAGGAAGATGACGAGTAA Restriction Sites: Please inquire ACCN: NM_001034832 OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. RefSeq: NM_001034832.1, NP_001030004.1 RefSeq Size: 1322 bp RefSeq ORF: 567 bp Locus ID: 548313 This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 SSX4 (SSX4B) (NM_001034832) Human Untagged Clone – SC302796 UniProt ID: O60224 Gene Summary: The product of this gene belongs to the family of highly homologous synovial sarcoma X (SSX) breakpoint proteins. These proteins may function as transcriptional repressors. They are also capable of eliciting spontaneously humoral and cellular immune responses in cancer patients, and are potentially useful targets in cancer vaccine-based immunotherapy. SSX1, SSX2 and SSX4 genes have been involved in the t(X;18) translocation characteristically found in all synovial sarcomas. This translocation results in the fusion of the synovial sarcoma translocation gene on chromosome 18 to one of the SSX genes on chromosome X. Chromosome Xp11 contains a segmental duplication resulting in two identical copies of synovial sarcoma, X breakpoint 4, SSX4 and SSX4B, in tail-to-tail orientation. This gene, SSX4B, represents the more centromeric copy. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (a). ##RefSeq-Attributes-START## RefSeq Select criteria :: based on expression, longest protein ##RefSeq-Attributes-END## COMPLETENESS: complete on the 3' end. This product is to be used for laboratory only. Not for diagnostic or therapeutic use. ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 2 / 2.

View Full Text

Details

  • File Type
    pdf
  • Upload Time
    -
  • Content Languages
    English
  • Upload User
    Anonymous/Not logged-in
  • File Pages
    2 Page
  • File Size
    -

Download

Channel Download Status
Express Download Enable

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

  • Not to be reproduced or distributed without explicit permission.
  • Not used for commercial purposes outside of approved use cases.
  • Not used to infringe on the rights of the original creators.
  • If you believe any content infringes your copyright, please contact us immediately.

Support

For help with questions, suggestions, or problems, please contact us