SSX4 Antibody Cat

Total Page：16

File Type：pdf, Size：1020Kb

SSX4 Antibody Cat. No.: 56-923 SSX4 Antibody Specifications HOST SPECIES: Rabbit SPECIES REACTIVITY: Human This SSX4 antibody is generated from rabbits immunized with a KLH conjugated synthetic IMMUNOGEN: peptide between 63-91 amino acids from the Central region of human SSX4. TESTED APPLICATIONS: WB APPLICATIONS: For WB starting dilution is: 1:1000 PREDICTED MOLECULAR 22 kDa WEIGHT: Properties This antibody is purified through a protein A column, followed by peptide affinity PURIFICATION: purification. CLONALITY: Polyclonal ISOTYPE: Rabbit Ig CONJUGATE: Unconjugated PHYSICAL STATE: Liquid September 25, 2021 1 https://www.prosci-inc.com/ssx4-antibody-56-923.html BUFFER: Supplied in PBS with 0.09% (W/V) sodium azide. CONCENTRATION: batch dependent Store at 4˚C for three months and -20˚C, stable for up to one year. As with all antibodies STORAGE CONDITIONS: care should be taken to avoid repeated freeze thaw cycles. Antibodies should not be exposed to prolonged high temperatures. Additional Info OFFICIAL SYMBOL: SSX4 ALTERNATE NAMES: Protein SSX4, Cancer/testis antigen 54, CT54, SSX4, SSX4A ACCESSION NO.: O60224 GENE ID: 548313, 6759 USER NOTE: Optimal dilutions for each application to be determined by the researcher. Background and References The product of this gene belongs to the family of highly homologous synovial sarcoma X (SSX) breakpoint proteins. These proteins may function as transcriptional repressors. They are also capable of eliciting spontaneously humoral and cellular immune responses in cancer patients, and are potentially useful targets in cancer vaccine-based immunotherapy. SSX1, SSX2 and SSX4 genes have been involved in the t(X;18) BACKGROUND: translocation characteristically found in all synovial sarcomas. This translocation results in the fusion of the synovial sarcoma translocation gene on chromosome 18 to one of the SSX genes on chromosome X. Chromosome Xp11 contains a segmental duplication resulting in two identical copies of synovial sarcoma, X breakpoint 4, SSX4 and SSX4B, in tail-to-tail orientation. This gene, SSX4B, represents the more centromeric copy. Two transcript variants encoding distinct isoforms have been identified for this gene. REFERENCES: 1) Ayyoub, M., et al. J. Immunol. 174(8):5092-5099(2005) 2) Ross, M.T., et al. Nature 434(7031):325-337(2005) 3) Gure, A.O., et al. Int. J. Cancer 101(5):448-453(2002) 4) Brodin, B., et al. Gene 268 (1-2), 173-182 (2001) : ANTIBODIES FOR RESEARCH USE ONLY. For additional information, visit ProSci's Terms & Conditions Page. September 25, 2021 2 https://www.prosci-inc.com/ssx4-antibody-56-923.html.

Copy Link

Recommended publications

SS18 (SYT) (18Q11) Gene Rearrangement by FISH Indications for Ordering Genetics
SS18 (SYT) (18q11) Gene Rearrangement by FISH Indications for Ordering Genetics Diagnosis of synovial sarcoma in conjunction with histologic Translocations – SS18-SSX1, SS18-SSX2 and clinical information Structure/function Test Description • SS18 is located on chromosome 18 • SSX1 and SSX2 are located on the X-chromosome Fluorescence in situ hybridization • Each gene in the translocation codes for proteins that have opposite transcriptional functions Tests to Consider o SS18 – activator of oncogenes Primary test o SSX1, SSX2 – tumor suppression SS18 (SYT) (18q11) Gene Rearrangement by FISH 3001303 Test Interpretation • Molecular diagnosis of synovial sarcoma Results Related test • Positive – SS18 rearrangement is detected Chromosome FISH, Interphase 2002298 o SSX translocation partner is not identified with this • Specific probe for SS18 (SYT) rearrangement must be testing methodology requested o Synovial sarcoma likely • Fresh tissue specimens only • Negative – no SS18 rearrangement detected Disease Overview o Does not entirely exclude the presence of an SS18 rearrangement as some translocations are cryptic and Incidence – rare not evaluable by this testing methodology • Synovial sarcomas account for 8-10% of all soft tissue o Does not entirely exclude diagnosis of synovial sarcoma sarcomas Limitations Diagnostic/prognostic issues • Testing using tissue fixed in alcohol-based or non-formalin • Synovial sarcomas may resemble other neoplasms, fixatives has not been validated using this method particularly those displaying an epithelioid, spindle cell, or • SS18 fusion partners are not detected with this test combined morphology • t(X;18)(p11.2;q11.2) translocation serves as a specific marker for synovial sarcoma o SS18 (SYT) gene fuses with SSX gene . Fusion with SSX1 in ~65% of synovial sarcomas .
[Show full text]
A Novel Type of SYT/SSX Fusion
A Novel Type of SYT/SSX Fusion: Methodological and Biological Implications Maria Törnkvist, M.Sc., Bertha Brodin, Ph.D., Armando Bartolazzi, M.D., Ph.D., Olle Larsson, M.D., Ph.D. Department of Cellular and Molecular Tumor Pathology, Cancer Centrum Karolinska, Karolinska Hospital (MT, BB, AB, OL), Stockholm, Sweden; and Department of Pathology, Regina Elena Cancer Institute (AB), Rome, Italy the presence of SYT/SSX transcripts in two cases Synovial sarcoma (SS) is a rare soft-tissue tumor using the proposed RT-PCR approach. Applications that affects children and young adults. It is charac- of optimized RT-PCR can contribute to reduce false- terized by the chromosomal translocation t(X; negative SYT/SSX SS cases reported in literature. 18)(p11.2;q11.2), which results in the fusion of the SYT gene on chromosome 18 with a SSX gene on KEY WORDS: RT-PCR, Synovial sarcoma, SYT/SSX chromosome X. In the majority of cases, SYT is fusion gene, SYT/SSX variants. fused to exon 5 of SSX1 (64%), SSX2 (36%), or, Mod Pathol 2002;15(6):679–685 rarely, SSX4. A novel fusion transcript variant deriv- ing from the fusion of SYT to exon 6 of SSX4 gene Synovial sarcomas (SS) account for 7 to 10% of all (SYT/SSX4v) was found coexpressed in one of the human soft-tissue sarcomas and are mainly located previously reported SYT/SSX4 cases. In the present in the extremities in the vicinity of large joints (1). investigation, we describe a new SS case that was Depending on histomorphological appearance, SSs previously shown to be negative for SYT/SSX1 and are usually subdivided into two major forms, bipha- SYT/SSX2 expression by conventional reverse tran- sic and monophasic.
[Show full text]
A Novel FISH Assay for SS18–SSX Fusion Type in Synovial Sarcoma
Laboratory Investigation (2004) 84, 1185–1192 & 2004 USCAP, Inc All rights reserved 0023-6837/04 $30.00 www.laboratoryinvestigation.org A novel FISH assay for SS18–SSX fusion type in synovial sarcoma Cecilia Surace1,2, Ioannis Panagopoulos1, Eva Pa˚lsson1, Mariano Rocchi2, Nils Mandahl1 and Fredrik Mertens1 1Department of Clinical Genetics, Lund University Hospital, Lund, Sweden and 2DAPEG, Section of Genetics, University of Bari, Bari, Italy Synovial sarcoma is a morphologically, clinically and genetically distinct entity that accounts for 5–10% of all soft tissue sarcomas. The t(X;18)(p11.2;q11.2) is the cytogenetic hallmark of synovial sarcoma and is present in more than 90% of the cases. It produces three types of fusion gene formed in part by SS18 from chromosome 18 and by SSX1, SSX2 or, rarely, SSX4 from the X chromosome. The SS18–SSX fusions do not seem to occur in other tumor types, and it has been shown that in synovial sarcoma a clear correlation exists between the type of fusion gene and histologic subtype and, more importantly, clinical outcome. Previous analyses regarding the type of fusion genes have been based on PCR amplification of the fusion transcript, requiring access to good- quality RNA. In order to obtain an alternative tool to diagnose and follow this malignancy, we developed a fluorescence in situ hybridization (FISH) assay that could distinguish between the two most common fusion genes, that is, SS18–SSX1 and SS18–SSX2. The specificity of the selected bacterial artificial chromosome clones used in the detection of these fusion genes, as well as the sensitivity of the analysis in metaphase and interphase cells, was examined in a series of 28 synovial sarcoma samples with known fusion gene status.
[Show full text]
Aneuploidy: Using Genetic Instability to Preserve a Haploid Genome?
Health Science Campus FINAL APPROVAL OF DISSERTATION Doctor of Philosophy in Biomedical Science (Cancer Biology) Aneuploidy: Using genetic instability to preserve a haploid genome? Submitted by: Ramona Ramdath In partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biomedical Science Examination Committee Signature/Date Major Advisor: David Allison, M.D., Ph.D. Academic James Trempe, Ph.D. Advisory Committee: David Giovanucci, Ph.D. Randall Ruch, Ph.D. Ronald Mellgren, Ph.D. Senior Associate Dean College of Graduate Studies Michael S. Bisesi, Ph.D. Date of Defense: April 10, 2009 Aneuploidy: Using genetic instability to preserve a haploid genome? Ramona Ramdath University of Toledo, Health Science Campus 2009 Dedication I dedicate this dissertation to my grandfather who died of lung cancer two years ago, but who always instilled in us the value and importance of education. And to my mom and sister, both of whom have been pillars of support and stimulating conversations. To my sister, Rehanna, especially- I hope this inspires you to achieve all that you want to in life, academically and otherwise. ii Acknowledgements As we go through these academic journeys, there are so many along the way that make an impact not only on our work, but on our lives as well, and I would like to say a heartfelt thank you to all of those people: My Committee members- Dr. James Trempe, Dr. David Giovanucchi, Dr. Ronald Mellgren and Dr. Randall Ruch for their guidance, suggestions, support and confidence in me. My major advisor- Dr. David Allison, for his constructive criticism and positive reinforcement.
[Show full text]
Li Et Al. 1 Genetic Interactions Between Mediator and the Late G1
Genetics: Published Articles Ahead of Print, published on July 5, 2005 as 10.1534/genetics.105.043893 Li et al. Genetic interactions between mediator and the late G1-specific transcription factor Swi6 in Saccharomyces cerevisiae. Lihong Li* Tina Quinton*1 Shawna Miles* Linda L. Breeden*2 *Division of Basic Sciences Fred Hutchinson Cancer Research Center Seattle, WA 98109-1024 1Present address: Christensen, O’Connor, Johnson, KindnessPLLC, Seattle, WA 98101 1 Li et al. Running head: Interactions between Swi6 and mediator Key words: Swi6, mediator, transcription, G1, suppressor 2Corresponding author: Fred Hutchinson Cancer Research Center, 1100 Fairview Ave N. Mail stop A2-168, Seattle, WA 98109-1024 telephone (206) 667 4484, fax (206) 667 6526, Email [email protected] 2 Li et al. ABSTRACT Swi6 associates with Swi4 to activate HO and many other late G1-specific transcripts in budding yeast. Genetic screens for suppressors of SWI6 mutants have been carried out. 112 of these mutants have been identified and most fall into seven complementation groups. Six of these genes have been cloned and identified and they all encode subunits of the mediator complex. These mutants restore transcription to the HO-lacZ reporter in the absence of Swi6 and have variable effects on other Swi6 target genes. Deletions of other non- essential mediator components have been tested directly for suppression of, or genetic interaction with swi6. Mutations in half of the known subunits of mediator show suppression and/or growth defects in combination with swi6. These phenotypes are highly variable and do not identify a specific module of the mediator as critical for repression in the absence of Swi6.
[Show full text]
Product Sheet CA1235
SSX2 Antibody Applications: WB, IHC Detected MW: 25 kDa Cat. No. CA1235 Species & Reactivity: Human, Mouse, Rat Isotype: Rabbit IgG BACKGROUND SSX2 belongs to the family of highly homologous based immunotherapy.4 Two transcript variants synovial sarcoma X (SSX) breakpoint proteins. encoding distinct isoforms have been identified for The SSX gene family is composed of at least 9 SSX2 gene. SSX2 is thought to function in functional and highly homologous members and development and germ line cells as a repressive shown to be located on chromosome X. The gene regulator. Its control of gene expression is normal testis expresses SSX1, 2, 3, 4, 5, and 7, believed to be epigenetic in nature and to involve but not 6, 8, or 9. In tumors, SSX1, 2, and 4 are chromatin modification and remodeling. It is most expressed at varying frequencies, whereas SSX3, likely mediated by the association of SSX2 with the 5, and 6 are rarely expressed. In addition, no Polycomb gene silencing complex at the SSXRD expression of SSX8, or 9 has been observed. SSX1 domain. Polycomb silencing involves chromatin to SSX5 are also normally expressed in thyroid.1 compaction, DNA methylation, repressive histone The SSX family shares nucleotide homology modifications and inaccessibility of promoter ranging from 88% to 95%, and amino acid regions to transcription machineries. Other SSX2- homology ranging from 77% to 91%. The NH2- interacting partners include the LIM homeobox terminal moieties of the SSX proteins exhibit protein LHX4, a Ras-like GTPase Interactor, homology to the Krüppel-associated box (KRAB) RAB3IP thought to be involved in vesicular domain, a domain that is known to be involved in transport, and SSX2IP, a putative cell transcriptional repression.
[Show full text]
Identification of SYT-SSX Transcripts from Synovial Sarcomas Using RT-Multiplex PCR and Capillary Electrophoresis
Modern Pathology (2006) 19, 641–647 & 2006 USCAP, Inc All rights reserved 0893-3952/06 $30.00 www.modernpathology.org Identification of SYT-SSX transcripts from synovial sarcomas using RT-multiplex PCR and capillary electrophoresis John A Thorson, Helmut C Weigelin, Robert E Ruiz, Jennifer K Howard and David R Lucas Department of Pathology, University of Michigan, Ann Arbor, MI, USA Synovial sarcomas are highly malignant tumors of soft tissue which are characterized by the t(X;18) resulting in SYT-SSX fusion transcript production. Diagnosis of these tumors based on histology can be challenging, particularly when minimal biopsy specimens are presented to the pathologist. Demonstration by molecular methods of SYT-SSX transcripts is a useful adjunct for diagnosis in these situations. We have developed an assay, which combines one-step RT-multiplex PCR with capillary electrophoresis to detect and genotype the SYT-SSX transcripts from synovial sarcomas. Small amplicons from chimeric transcripts as well as GAPD transcripts are differentially labeled with fluorophores, allowing detection and size discrimination by capillary electrophoresis. In a study of 32 formalin-fixed soft tissue tumor specimens, the assay detected chimeric transcripts from 17/22 (77%) synovial sarcomas. All five assay negative specimens yielded no intact RNA as evidenced by lack of a GAPD amplicon. Chimeric transcripts were not detected in 9/9 malignant peripheral nerve sheath tumors or 1/1 epithelioid sarcoma. Representative amplicons were sequenced and confirmed the genotype results obtained by capillary electrophoresis. One-step RT-multiplex PCR combined with capillary electrophoresis is a rapid and accurate method for the detection and genotypic classification of SYT-SSX transcripts from fixed tissue specimens.
[Show full text]
Genomic and Expression Profiling of Human Spermatocytic Seminomas: Primary Spermatocyte As Tumorigenic Precursor and DMRT1 As Candidate Chromosome 9 Gene
Research Article Genomic and Expression Profiling of Human Spermatocytic Seminomas: Primary Spermatocyte as Tumorigenic Precursor and DMRT1 as Candidate Chromosome 9 Gene Leendert H.J. Looijenga,1 Remko Hersmus,1 Ad J.M. Gillis,1 Rolph Pfundt,4 Hans J. Stoop,1 Ruud J.H.L.M. van Gurp,1 Joris Veltman,1 H. Berna Beverloo,2 Ellen van Drunen,2 Ad Geurts van Kessel,4 Renee Reijo Pera,5 Dominik T. Schneider,6 Brenda Summersgill,7 Janet Shipley,7 Alan McIntyre,7 Peter van der Spek,3 Eric Schoenmakers,4 and J. Wolter Oosterhuis1 1Department of Pathology, Josephine Nefkens Institute; Departments of 2Clinical Genetics and 3Bioinformatics, Erasmus Medical Center/ University Medical Center, Rotterdam, the Netherlands; 4Department of Human Genetics, Radboud University Medical Center, Nijmegen, the Netherlands; 5Howard Hughes Medical Institute, Whitehead Institute and Department of Biology, Massachusetts Institute of Technology, Cambridge, Massachusetts; 6Clinic of Paediatric Oncology, Haematology and Immunology, Heinrich-Heine University, Du¨sseldorf, Germany; 7Molecular Cytogenetics, Section of Molecular Carcinogenesis, The Institute of Cancer Research, Sutton, Surrey, United Kingdom Abstract histochemistry, DMRT1 (a male-specific transcriptional regulator) was identified as a likely candidate gene for Spermatocytic seminomas are solid tumors found solely in the involvement in the development of spermatocytic seminomas. testis of predominantly elderly individuals. We investigated these tumors using a genome-wide analysis for structural and (Cancer Res 2006; 66(1): 290-302) numerical chromosomal changes through conventional kar- yotyping, spectral karyotyping, and array comparative Introduction genomic hybridization using a 32 K genomic tiling-path Spermatocytic seminomas are benign testicular tumors that resolution BAC platform (confirmed by in situ hybridization).
[Show full text]
Primepcr™Assay Validation Report
PrimePCR™Assay Validation Report Gene Information Gene Name synovial sarcoma translocation gene on chromosome 18-like 1 Gene Symbol SS18L1 Organism Human Gene Summary Synovial sarcomas occur most frequently in the extremities around large joints. More than 90% of cases have a recurrent and specific chromosomal translocation t(X;18)(p11.2;q11.2) in which the 5-prime end of the SS18 gene (MIM 600192) is fused in-frame to the 3-prime end of the SSX1 (MIM 312820) SSX2 (MIM 300192) or SSX4 (MIM 300326) gene. The SS18L1 gene is homologous to SS18. Gene Aliases CREST, KIAA0693, LP2261, MGC26711, MGC78386 RefSeq Accession No. NC_000020.10, NT_011362.10 UniGene ID Hs.154429 Ensembl Gene ID ENSG00000184402 Entrez Gene ID 26039 Assay Information Unique Assay ID qHsaCEP0025086 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENST00000331758, ENST00000421564, ENST00000370848 Amplicon Context Sequence ATGTTGAGCAAAGCTTAGGCCAACATGAATTGTTTGTGAAGTGTGGTTGATGGTG CTTTGTTTTTTTCTGACTACTTCTATGGAAGGCCAGTGAAGAAGCAAAGGAAGA Amplicon Length (bp) 79 Chromosome Location 20:60756836-60756944 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 98 R2 0.9992 cDNA Cq 20.19 cDNA Tm (Celsius) 79 gDNA Cq 25 Page 1/5 PrimePCR™Assay Validation Report Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 2/5 PrimePCR™Assay Validation Report SS18L1, Human Amplification Plot Amplification of cDNA generated from 25 ng of universal
[Show full text]
The Chromatin Landscape of Primary Synovial Sarcoma Organoids Is Linked to Specific Epigenetic Mechanisms and Dependencies
Published Online: 23 December, 2020 | Supp Info: http://doi.org/10.26508/lsa.202000808 Downloaded from life-science-alliance.org on 25 September, 2021 Research Article The chromatin landscape of primary synovial sarcoma organoids is linked to specific epigenetic mechanisms and dependencies Gaylor Boulay3,4,*, Luisa Cironi1,2,* , Sara P Garcia3,†, Shruthi Rengarajan3,†, Yu-Hang Xing3, Lukuo Lee3, Mary E Awad3, Beverly Naigles3 , Sowmya Iyer3, Liliane C Broye1,2, Tugba Keskin1,2, Alexandra Cauderay1,3, Carlo Fusco1,2, Igor Letovanec1, Ivan Chebib3, Petur Gunnalugur Nielsen3,Stephane´ Tercier6 ,Stephane´ Cherix5 , Tu Nguyen-Ngoc7 , Gregory Cote8 , Edwin Choy8 , Paolo Provero9,10 , Mario L Suva` 3,4, Miguel N Rivera3,4, Ivan Stamenkovic1,2 , Nicolo` Riggi1,2 Synovial sarcoma (SyS) is an aggressive mesenchymal malig- Introduction nancy invariably associated with the chromosomal transloca- tion t(X:18; p11:q11), which results in the in-frame fusion of the Synovial sarcoma (SyS) is the second most common soft tissue BAF complex gene SS18 to one of three SSX genes. Fusion of SS18 malignancy in the adolescent and young adult population, in which it to SSX generates an aberrant transcriptional regulator, which, in comprises 10–20% of all soft tissue sarcomas (Nielsen et al, 2015). Its permissive cells, drives tumor development by initiating major defining genetic feature is the chromosomal translocation t(X:18; p11: chromatin remodeling events that disrupt the balance between q11), which generates fusions between the nearly entire coding BAF-mediated gene activation and polycomb-dependent re- sequence of the SS18 gene and a portion of an SSX gene family pression. Here, we developed SyS organoids and performed member (SSX1 and SSX2 being the two most commonly implicated genome-wide epigenomic profiling of these models and mes- [Nielsen et al, 2015; Riggi et al, 2018]).
[Show full text]
Thesis for Word XP
Thesis for doctoral degree (Ph.D.) 2008 Thesis for doctoral degree (Ph.D.) 2008 Molecular Mechanisms Underlying the Oncogenic Function of SS18 and SSX Molecular Mechanisms Underlying the Oncogenic Function of SS18 and SSX Pádraig D’Arcy Fredrik Bredin Pádraig D’Arcy Department of Oncology-Pathology Cancer Center Karolinska Karolinska Institutet, Stockholm, Sweden MOLECULAR MECHANISMS UNDERLYING THE ONCOGENIC FUNCTION OF SS18 AND SSX. Pádraig D'Arcy Stockholm 2008 All previously published papers were reproduced with permission from the publisher. Published by Karolinska Institutet. Printed by Larserics Digital Print AB © Pádraig D'Arcy, 2008 ISBN 978-91-7357-481-5 I’m digging for fire The Pixies To my parents Abstract The SS18 and SSX genes were initially identified based on their reoccurrence as fusion partners in synovial sarcoma. As a result of the specific chromosomal translocation t(X:18), the SS18 gene from chromosome 18 becomes fused with members of the SSX gene family on the X chromosome resulting in the generation of a novel chimeric fusion gene SS18-SSX. The SS18 gene encodes a ubiquitously expressed transcriptional activator, whereas the SSX gene encodes a transcriptional repressor whose expression is restricted to germ cells and numerous cancers. Thus, the resultant SS18-SSX fusion gene encodes a transcription factor with dual trans activation and repression properties; the expression of which is the initiating event of synovial sarcoma. We present the findings that SSX, along with several other members of the CT-antigen family is expressed in mesenchymal stem cells and their expression is down regulated following differentiation. Knockdown of SSX could effectively impair cell migration, a phenotype associated with down regulation of MMP2 expression adding a functional role for SSX in stem and tumor cell migration.
[Show full text]
The Impact of Chromosomal Translocation Locus and Fusion Oncogene Coding Sequence in Synovial Sarcomagenesis
HHS Public Access Author manuscript Author ManuscriptAuthor Manuscript Author Oncogene Manuscript Author . Author manuscript; Manuscript Author available in PMC 2016 September 23. Published in final edited form as: Oncogene. 2016 September 22; 35(38): 5021–5032. doi:10.1038/onc.2016.38. The impact of chromosomal translocation locus and fusion oncogene coding sequence in synovial sarcomagenesis Kevin B. Jones1,2,3,*, Jared J. Barrott1,2,3, Mingchao Xie4, Malay Haldar5, Huifeng Jin1,2,3, Ju-Fen Zhu1,2,3, Michael J. Monument1,3, Tim L. Mosbruger3,6, Ellen M. Langer5, R. Lor Randall1,3, Richard K. Wilson4,7,8,9, Bradley R. Cairns2,3,10, Li Ding4,7,8,9, and Mario R. Capecchi5 1Department of Orthopaedics, University of Utah, Salt Lake City, Utah 84112, USA 2Department of Oncological Sciences, University of Utah, Salt Lake City, Utah 84112, USA 3Huntsman Cancer Institute, University of Utah, Salt Lake City, Utah 84112, USA 4Department of Medicine, Washington University, St. Louis, Missouri 63108, USA 5Department of Human Genetics, University of Utah, Salt Lake City, Utah, USA 6Deparment of Bioinformatics, University of Utah, Salt Lake City, Utah, 84112, USA 7McDonnell Genome Institute, Washington University, St. Louis, Missouri 63108, USA 8Department of Genetics, Washington University, St. Louis, Missouri 63108, USA 9Siteman Cancer Center, Washington University, St. Louis, Missouri 63108, USA 10Howard Hughes Medical Institute, University of Utah, Salt Lake City, UT 84112, USA Abstract Synovial sarcomas are aggressive soft-tissue malignancies that express chromosomal translocation-generated fusion genes, SS18-SSX1 or SS18-SSX2 in most cases. Here, we report a mouse sarcoma model expressing SS18-SSX1, complementing our prior model expressing SS18- SSX2.
[Show full text]