Molecular Epidemiology of Hepatitis C Virus Genotypes in Different Geographical Regions of Punjab Province in Pakistan and A

Home , Gujranwala Division

CORE Metadata, citation and similar papers at core.ac.uk

Provided by Elsevier - Publisher Connector

International Journal of Infectious Diseases 17 (2013) e247–e253

Contents lists available at SciVerse ScienceDirect

International Journal of Infectious Diseases

jou rnal homepage: www.elsevier.com/locate/ijid

Molecular epidemiology of hepatitis C virus genotypes in different geographical

regions of Punjab Province in Pakistan and a phylogenetic analysis

a, a a b a a c

Hafsa Aziz *, Abida Raza , Shahnaz Murtaza , Yasir Waheed , Ali Khalid , Javaid Irfan , Zahoor Samra ,

Muhammad Amin Athar

Diagnostic Laboratories, Nuclear Medicine Oncology and Radiotherapy Institute, Hanna Road, G-8/3, Islamabad, Pakistan

NUST Center of Virology and Immunology, National University of Sciences and Technology, Islamabad, Pakistan

Institute of Biochemistry and Biotechnology, University of the Punjab, Lahore, Pakistan

A R T I C L E I N F O S U M M A R Y

Article history: Background: Hepatitis C virus (HCV) is a causative agent of chronic liver disease, cirrhosis, and

Received 11 April 2012

hepatocellular carcinoma. In Pakistan, more than 10 million people are living with HCV. Very little is

Received in revised form 29 August 2012

known about the genotype distribution in Punjab Province, the largest province of Pakistan.

Accepted 26 September 2012

Pretreatment genotype identiﬁcation is very important, as different HCV genotypes respond differently

Corresponding Editor: Mark Holodniy,

to interferon therapy.

California, USA

Methods: In this study we performed HCV genotyping for 1537 HCV-infected patients from different

districts of Punjab Province, Pakistan. Sequencing of partial HCV NS5B sequences from 14 samples

Keywords: belonging to genotypes 3 and 1 was also done. A sequence comparison was made of our reported

Hepatitis C virus

sequences with those reported in the National Center for Biotechnology Information (NCBI), and a

Genotypes

phylogenetic tree was constructed.

Phylogenetic analysis

Results: Our study showed that the most frequent HCV genotype was 3a (in 88.1% of infected

NS5B gene

individuals), followed by 1a (3.5%), 3b (3.0%), 1b (0.8%), and 2a (1.0%). A mixed genotype infection was

found in 3.6% of infected individuals, with 0.3% living with 1a + 1b co-infection, 3.1% with 3a + 3b, and

0.2% suffering from 3a + 1b co-infection. The sequence comparison showed that HCV NS5B motif B

residues G283, T287, and N291 were highly conserved in both genotype 1 and genotype 3 sequences,

while the motif B residue T286 was mutated to proline in all the genotype 3 sequences. The GDD motif,

which forms the catalytic pocket and binding site for the divalent cations, was highly conserved in all the

reported sequences. The phylogenetic tree suggests clustering of genotype 1 sequences with sequences

from the USA, UK, Germany, and France, while genotype 3 sequences are clustered with sequences from

Japan and the UK.

Conclusions: The major prevalent genotype in Punjab Province of Pakistan was genotype 3a, followed by

genotype 1a, and only 3.6% of infected individuals had a mixed genotype infection. Sequencing of the

HCV NS5B gene suggested that the active site residues were highly conserved in all the reported

sequences. Our sequences, which are clustered with sequences from the USA, UK, France, and Japan,

show the diversity in origin of the different genotypes prevalent in Pakistan.

Available data from the Pakistani population reveal that the

1. Introduction 6

prevalence of hepatitis C is 4–6%, while a community-based study

in Karachi revealed a hepatitis C prevalence of 6.6% and a study in

Hepatitis C virus (HCV) constitutes a major public health issue 7,8

1 Punjab (Haﬁzabad) reported a prevalence of 6.5%. Government

around the world in general, and in Pakistan in particular. About

agencies acknowledge that the overall prevalence of hepatitis C in

200 million people are infected with HCV worldwide, which covers 9

2,3 the general Pakistani population is 5.3%.

about 3.3% of the world’s population. In the Asia-Paciﬁc region,

4 HCV isolates show nucleotide sequence variability throughout

the prevalence of HCV infection ranges from 0.3% to 12%, and in

5 the viral genome and this has consequences for the effectiveness of

Pakistan more than 10 million people are living with HCV.

treatment. The nucleotide sequence variability of HCV is probably

related to replication errors by the RNA-dependent RNA polymer-

10,11

ase. Each HCV genotype and subtype is distributed differently

* Corresponding author.

in different parts of the world, and certain genotypes predominate

E-mail address: [email protected] (H. Aziz).

e248 H. Aziz et al. / International Journal of Infectious Diseases 17 (2013) e247–e253

in certain areas. HCV genotypes 1, 2, and 3 are distributed all over each), 25 pmol antisense external primer, 40 U of RNAse inhibitor

the world. The most abundant subtype in South America, Europe, (Fermentas, Canada), and 200 U of Moloney murine leukemia virus

and Australia is HCV subtype 1a, while subtype 1b is found in North reverse transcriptase (Fermentas) and incubated for 1 h at 42 8C,

12,13

America and Europe and is also found in parts of Asia. followed by 2 min at 90 8C.

The response to interferon therapy is related to the HCV PCR ampliﬁcation was performed in a 20 ml volume containing

genotype. Therefore knowledge about the diversity of HCV may 10 ml of Green Go Taq Master Mix (Promega, USA), 25 pmol of each

have important implications for prognosis and therapy. Using outside sense and outside antisense primer, and 4 ml of cDNA and

multivariate analysis, Tsubota et al. concluded that HCV genotype subjected to the ﬁrst round of PCR for 20 cycles at 94 8C for 1 min,

1b was an independent predictor of a poor response to interferon 45 8C for 1 min, and 72 8C for 1 min, and 20 cycles at 94 8C for

therapy when compared to genotypes 2 and 3. In another study 1 min, 60 8C for 1 min, and 72 8C for 1 min, as reported by Ohno

we found 76% of genotype 3 patients to have a sustained virological et al. The second round PCR reaction was performed in two

response (SVR) compared to 55% of genotype 1 patients. separate mixtures with genotype-speciﬁc primers. The PCR

Few studies have attempted to determine the overall distribu- product was analyzed on 2% agarose gel.

tion of HCV genotypes in Pakistan. The distribution of HCV

genotypes in the different geographical divisions of Punjab is 2.4. Partial sequencing of the HCV NS5B region

unknown. We know that knowledge of the HCV genotype is of

prime importance in the clinical management of HCV. In this Partial NS5B (nucleotides 688–978) sequencing was performed

regard, less frequent genotypes deserve the same attention as the and used to validate our HCV genotyping results. To amplify DNA

more common genotypes. Therefore this research was planned to fragments to be sequenced from the NS5B region, a single primer

determine the geographic distribution of HCV genotypes in the pair considered to be highly conserved amongst the different

different geographical divisions of Punjab Province, Pakistan. We variants of HCV was used. A 50 ml volume containing 25 ml of

also sought to perform a sequence comparison and phylogenetic Green Go Taq Master Mix (Promega), 1.25 pmol of each outside

analysis of the dominant genotypes. sense (GACACCCGCTGTTTTGACTC) and outside antisense

(TTCACGGAGGCTATGACCAGGTA) primer, and 5 ml of cDNA as

2. Materials and methods template was used for the PCR ampliﬁcation. The ampliﬁcation

conditions were: 5 min at 94 8C, followed by 35 cycles each

2.1. Patient selection and study design consisting of 95 8C for 30 s, 68 8C for 45 s, and 72 8C for 60 s, in a

GeneAmp PCR System 9700 (Applied Biosystems). The PCR product

Human HCV-positive blood samples from 1537 HCV-infected was analyzed on 2% agarose gel. The PCR product was puriﬁed from

patients were collected from hospitals of the different divisions of the gel using the PureLink Quick Gel Extraction Kit (Invitrogen)

Punjab: 569 from Lahore, 340 from Rawalpindi, 150 from in accordance with the manufacturer’s protocol. Puriﬁed samples

Sargodha, 100 from Gujranwala, 150 from Dera Ghazi Khan, of selected genotypes were subjected to sequencing using an ABI

Multan, and Bahawalpur, and 228 from Faisalabad. Eligible Automated Sequencer (Applied Biosystems). The nucleotide

patients were male and female, aged >18 years, with a sequences were viewed using Chromas version 2.0. Electropher-

documented chronic HCV infection according to the following ograms of each sample were analyzed and ambiguities in the

criteria: patient positive for anti-HCV antibody by Abbott Architect sequence data were solved by comparison of the results of both

Anti-HCV assay and with a positive PCR for HCV RNA. None of the forward and reverse primers. These sequences were aligned using

patients selected for the study had started antiviral therapy, and CLC Workbench software (http://www.clcbio.com) to draw a

none were habitual alcohol or active intravenous drug users. consensus sequence. The consensus sequences have been submit-

This study was conducted at the Nuclear Medicine Oncology ted to the National Center for Biotechnology Information (NCBI).

and Radiotherapy Institute of Islamabad from June 2010 through Fourteen representative NS5B gene sequences of HCV from this

November 2011. All patients signed a form containing their study and 24 sequences of HCV genotypes 1 and 3 retrieved from

demographic information. This form was approved by the ethics the NCBI nucleotide databank were used for the construction of a

committee of the institute. Written informed consent was also phylogenetic tree. The phylogenetic tree was constructed using

obtained from all the patients who participated in this study. Anti- CLC Workbench and the neighbor-joining method.

HCV antibody-positive patients were screened for HCV RNA using a

commercial kit and a real-time PCR. Patients who were negative for 3. Results

HCV RNA were excluded.

In this study we performed the molecular genotyping of 1537

2.2. HCV RNA extraction and detection HCV samples from Punjab Province, Pakistan, followed by

genotype conﬁrmation by sequencing of a few samples. We found

Plasma was isolated and the extraction of RNA was carried out that surgery and dental treatments were the main modes of

with an INSTANT Virus RNA Kit (AJ Roboscreen, GmbH, Leipzig, acquiring HCV, however almost a third of patients did not know the

Germany) in accordance with the manufacturer’s protocol. The source of their infection. The characteristics of the HCV patients are

HCV viral load was determined using a RoboGene HCV RNA summarized in Table 1.

Quantiﬁcation Kit (AJ Roboscreen) on a real-time PCR instrument Serum samples from these HCV patients were subjected to

(RotorGene 3000; Corbett Research, Sydney, Australia). genotyping based on HCV core region-speciﬁc primers, by the

method of Ohno et al., with some modiﬁcations. This method is

2.3. HCV genotyping very effective and is able to type all HCV-positive plasma samples.

Genotypes 3a, 3b, 2a, 2b, 1a, and 1b were detected, and in some

Samples from HCV patients were subjected to genotyping based cases a mixed infection with more than one genotype was also

on HCV core region-speciﬁc primers, using the method of Ohno seen. The predominant genotypes were 3a and 3b followed by 1a,

et al., with some modiﬁcations. RNA was reverse-transcribed HCV genotype 2 was found less frequently.

into cDNA using an antisense primer of the core region. Brieﬂy, The speciﬁcity of the test was evaluated by testing HCV

10 ml of extracted RNA was mixed with 10 ml of Master Mix serologically negative plasma samples. The genotype primers were

containing 4 ml of 5Â reaction buffer, 2 ml dNTPs mix (10 mmol/l found to be speciﬁc, they gave no false-positive results and showed

H. Aziz et al. / International Journal of Infectious Diseases 17 (2013) e247–e253 e249

Table 1

3.2. Distribution of HCV genotypes by geographical area of Punjab

Demographic characteristics of patients enrolled in the study Province

Variable No. (%)

Sex 3.2.1. Rawalpindi Division

Male 870 (56.6%) Three hundred and forty HCV-positive patients, 135 male

Female 667 (43.4%) (39.7%) and 205 female (60.3%), with a mean age of 42.44 Æ 10.38

Source of infection

years were screened for HCV genotype. The most commonly detected

Surgery 200 (13.0%)

genotype in Rawalpindi Division was genotype 3 (n = 318, 93.5%),

Surgery + transfusion 220 (14.3%)

with predominant subtype 3a (n = 304, 89.4%), 3a + 3b (n = 12, 3.5%),

Transfusion 131 (8.5%)

Dental treatment 511 (33.2%) and 3b (n = 2, 0.6%). Genotype 1 (n = 19, 5.6%) comprised the subtypes

Unknown source 475 (30.9%)

1a (n = 12, 3.5%), 1b (n = 5, 1.5%), and 1a + 1b (n = 2, 0.6%). Mixed

Age, years

genotype 3a + 1b was found in 0.3% of patients (Table 2).

<40 788 (51.3%)

40–49 471 (30.6%)

50–59 250 (16.3%) 3.2.2. Sargodha Division

60 28 (1.8%) Of 150 HCV-infected individuals from Sargodha Division, 88

HCV RNA level IU/ml

(58.7%) were male and 62 (41.3%) were female. Their mean age was

<100 000 85 (5.5%)

39.69 Æ 10.33 years. Table 2 shows that 140 (93.3%) had genotype 3a,

100 000–500 000 276 (18.0%)

while six (4.0%) had genotype 1a. A mixed infection of genotype 3

>500 000–1 000 000 303 (19.7%)

>1 000 000 873 (56.8%) subtypes, i.e., 3a + 3b, was observed in four (2.7%) patients.

Serum ALT levels

Normal ALT 346 (22.5%)

3.2.3. Gujranwala Division

Raised ALT 1191 (77.5%)

One hundred blood samples were collected from HCV-infected

ALT, alanine aminotransferase; ULN, upper limit of the normal range.

individuals in Gujranwala Division and screened for HCV genotype.

Raised ALT: patients with serum ALT ULN, i.e., male 41 U/l, female 31 U/l;

Only genotype 3a was found; no other genotype was detected in

normal ALT: patients with serum ALT

blood samples from this division.

100% speciﬁcity. The assay had 100% sensitivity for HCV genotype 3.2.4. Dera Ghazi Khan, Multan, and Bahawalpur

determination and also 100% reproducibility. The genotypes were The HCV genotype distribution was evaluated in 150 subjects in

conﬁrmed by sequencing of the HCV NS5B gene, which is this division. HCV genotyping showed that HCV genotype 3a was

considered the gold standard for genotyping. most prevalent, found in 87.3%; 12 patients (8.0%) were infected

with genotype 3b and seven (4.7%) had a mixed infection with

3.1. Prevalence of HCV genotypes in Punjab genotypes 3a + 3b (Table 2).

To investigate the burden of HCV genotypes in HCV-positive 3.2.5. Lahore Division

patients in Punjab, a total of 1537 HCV-positive patient samples Five hundred and sixty-nine HCV-positive samples were

were screened for HCV genotyping analysis. Six hundred and sixty- collected for HCV genotyping from Lahore Division; 236 (41.5%)

seven patients were male and 870 were female, and their mean age were from male patients and 333 (58.5%) from female patients. The

was 41.90 Æ 10.66 years. The distribution of HCV genotypes in the mean age of the patients was 41.79 Æ 10.61 years. Genotype 3a was

province of Punjab is shown in Figure 1. The most frequent genotype predominant, found in 461 (81.0%), followed by 3b in 30 (5.3%), 1a in

was 3a (88.1%), followed by 1a (3.5%), 3b (3.0%), 1b (0.8%), 2a (1.0%), 33 (5.8%), and 1b in ﬁve (0.9%). A mixed genotype 3a + 3b infection

1a + 1b (0.3%), 3a + 3b (3.1%), and 3a + 1b (0.2%). The distribution of was observed in 25 (4.4%), of 3a + 1b in two (0.4%), and of 1a + 1b in

the HCV genotypes varied in the different divisions of the province. two (0.4%) (Table 2).

Figure 1. Distribution of HCV genotypes in Punjab Province.

e250 H. Aziz et al. / International Journal of Infectious Diseases 17 (2013) e247–e253

Table 2

Distribution of HCV genotypes in different divisions of Punjab

Divisions of Punjab HCV genotype

3a 3b 1a 1b 2a 3a + 3b 3a + 1b 1a + 1b

Lahore 461 (81.0%) 30 (5.3%) 33 (5.8%) 5 (0.9%) 11 (1.9%) 25 (4.4%) 2 (0.4%) 2 (0.4%)

Rawalpindi 304 (89.4%) 2 (0.6%) 12 (3.5%) 5 (1.5%) 2 (0.6%) 12 (3.5%) 1 (0.3%) 2 (0.6%)

Faisalabad 218 (95.6%) 2 (0.9%) 3 (1.3%) 3 (1.3%) 2 (0.9%)

Sargodha 140 (93.3%) 6 (4%) 4 (2.7%)

Dera Ghazi Khan, Multan, and Bahawalpur 131 (87.3%) 12 (8%) 7 (4.7%)

Gujranwala 100 (100%)

3.2.6. Faisalabad Division 7850.1), NORI-HCV-15 (JQ957851.1), NORI-HCV-16 (JQ957852.1),

HCV genotype 3a was found to be most prevalent in the 228 NORI-HCV-17 (JQ957853.1), NORI-HCV-18 (JQ957854.1).

HCV samples (95.6%), followed by genotype 1a (1.3%), 1b (1.3%), 2a Our reported genotype 1a sequences are clustered with

(0.9%), and 3b (0.9%) (Table 2). sequences from the USA, UK, and Germany, while our 1b sequences

are clustered with sequences from Japan, France, and Germany.

3.3. Phylogenetic analysis and sequence comparison The genotype 3b sequences are clustered with 3b sequences from

Japan, while genotype 3a sequences are clustered with sequences

These results were further conﬁrmed through phylogenetic from the UK and Japan, as shown in the phylogenetic tree in

analysis by constructing a phylogenetic tree using the NS5B gene Figure 2.

sequence as a phylogenetic marker. Fourteen HCV NS5B gene The genotype 3 and 1 sequences reported in this study were

sequences reported in this study, along with 24 sequences obtained aligned with genotype 3 (NzL, K3a) and genotype 1 (H77)

from NCBI belonging to different HCV genotypes were used for the sequences taken from NCBI. Our reported HCV NS5B sequences

construction of the phylogenetic tree. HCV NS5B sequences reported were from the HCV NS5B gene, amino acids 229 to 326. The

in this study have been submitted to NCBI and have been assigned the sequence comparison suggests that the HCV NS5B gene residues

following accession numbers: NORI\PU-2 (HQ661847.1), NORI\PU-5 that form the motif B – G283, T287, and N291 – are highly

(HQ661850.1), NORI\PU-6 (HQ661851.1), NORI\PU-7 (HQ661852.1), conserved in both genotype 1 and genotype 3 sequences, while the

NORI\PU-8 (HQ661853.1), NORI\PU-9 (HQ661854.1), NORI\PU-12 motif B residue T286 is mutated to proline in all the genotype 3

(HQ661857.1), NORI\PU-10 (HQ661855.1), NORI-HCV-14 (JQ95 sequences. The GDD motif which forms the catalytic pocket for the

Figure 2. Phylogenetic tree of the NS5B gene of HCV showing the relationship of the 13 partial NS5B nucleotide sequences in representative HCV subtype 1a, 1b, 3a, and 3b

strains isolated from chronic HCV patients reported in this study, with sequences from the NCBI having different genotypes and origins. The tree was constructed using CLC

Workbench software.

H. Aziz et al. / International Journal of Infectious Diseases 17 (2013) e247–e253 e251

Figure 3. Comparison of amino acid sequence alignment in the NS5B region (292 bp) (position 8212–8510).

e252 H. Aziz et al. / International Journal of Infectious Diseases 17 (2013) e247–e253

divalent cations was highly conserved in all the reported Another important ﬁnding is the observation of the absence of

sequences, as shown in Figure 3. genotype 4 in all studied divisions of Punjab. We think that this

may be due to the rare occurrence of genotype 4 in neighboring

4. Discussion countries like Iran.

In the current study, mixed genotype infections were found in

Knowledge of HCV genotype has gained importance because it 55 (3.6%) of the HCV-infected individuals. This information

has a role in elucidating the therapeutic, prognostic, and the suggests that a person suffering from one HCV genotype is also

clinical status of the HCV infection. Several clinical trials have at risk of acquiring infection with another genotype. The frequency

found that the HCV genotype is strongly associated with the of individuals suffering from mixed infections is comparable to

17 20

response to combination therapy, and the pathogenesis of the that reported by Idrees and Riazuddin, who found a 4.8%

disease also varies according to the type of virus. Hence prevalence of mixed HCV genotype infections in Pakistan. In

pretreatment determination of HCV genotype helps in determining another report by Butt et al., mixed genotype distribution

the suitability of the treatment regimen and duration. Further- occurred in decreasing order of 3a + 3b, 3a + 1b, 1a + 1b, etc., but in

more, epidemiological patterns of HCV genotype vary in different our study we found small mixed genotype samples in the

geographical areas, even among regions of the same country. decreasing order of 3a + 3b,1a + 1b, 3a + 1b. The difference in the

However, little is known about the epidemiology of HCV genotypes order of mixed genotypes may be due to regional differences, the

in Punjab Province of Pakistan. Therefore this study was carried out use of different assays for genotyping, or sample size differences.

to gain an understanding of the prevalence of the various The sequence comparison showed that the HCV NS5B motif B

genotypes among the different divisions of Punjab Province; this residues G283, T287, and N291 were highly conserved in both

will help to guide the therapeutic choices and identify the genotype 1 and genotype 3 sequences, while the motif B residue

prognostic implications of HCV infection in Punjab.The results of T286 was mutated to proline in all the genotype 3 sequences. The

the present study indicated that the predominant HCV genotype in GDD motif, which forms the catalytic pocket and binding site for

infected patients of Punjab Province was subtype 3a, with a the divalent cations, was highly conserved in all the reported

prevalence rate of 88.1%. This ﬁnding is in accordance with those of sequences suggesting the great importance of these structures in

19 29,30

different studies conducted in different parts of Pakistan. In a its function.

study carried out by Idrees and Riazuddin on 3351 HCV-infected In conclusion, the use of core region genotype-speciﬁc primers

patients, 1664 (49.7%) patients had genotype 3a, 592 (17.7%) had and sequence analysis of the NS5B gene of HCV for genotype

genotype 3b, 280 (8.4%) had genotype 1a, 252 (7.5%) had genotype identiﬁcation provided an accurate epidemiological picture of the

2a, 101 (3.0%) had genotype 1b, and 50 (1.5%) had genotype 4. In circulating viral strains in Punjab Province, Pakistan. The most

another study from the Pakistan Medical and Research Council, prevalent genotype was 3, followed by genotype 1. Our reported

79.5% (17l/275) of HCV patients were reported to have a genotype genotype 1 sequences have high homology with sequences

3 infection. Genotype 3 is also the most prevalent genotype in reported from the USA, Germany, and France, while our genotype

22–24

India, Nepal, and Bangladesh. 3 sequences have high homology with sequences reported from

Our study reports a high prevalence of HCV genotype 3 in the Japan. Pretreatment genotype determination is very important, as

different divisions of Punjab, as shown in Figure 1. Our results are infections with genotype 3a have a rapid response to therapeutic

similar to those of Shah et al., who reported an 87% prevalence of regimens and this may be used as a marker for a short duration of

genotype 3, and with the consensus statement on HCV genotypes therapy, thereby decreasing the economic burden on the country.

reported by a team of gastroenterologists, who reported a 75–90%

6,25

prevalence of genotype 3 in Pakistan. The phylogenetic analysis Acknowledgements

of our reported HCV 3a and 3b genotype sequences showed

clustering with genotype 3a and 3b sequences reported from

The authors of this study would like to acknowledge the

Japan; this observation is in accordance with a previously reported

contribution of the participating patients.

phylogenetic analysis of HCV core sequences by Waheed et al.

Ethical approval: Ethical approval and informed consent were

The second most frequent HCV genotype reported in our study obtained.

was genotype 1. Our data are in agreement with the largest report

Conﬂict of interest: No conﬂict of interest to declare.

of HCV genotypes from Pakistan, reported by Idrees and Riazuddin

in 2008, stating that the second most prevalent HCV genotype in

20 References

Pakistan is genotype 1. The phylogenetic analysis of HCV

genotypes from Pakistan suggests that the different HCV geno-

1. Aziz H, Gil ML, Waheed Y, Adeeb U, Raza A, Bilal I, Athar MA. Evaluation of

types evolved from genotype 1a. These data are in agreement with prognostic factors for peg interferon alfa-2b plus ribavirin treatment on HCV

infected patients in Pakistan. Infect Genet Evol 2011;11:640–5.

the analysis of HCV polymerase sequences by Waheed et al.

2. Wands JR. Prevention of hepatocellular carcinoma. N Engl J Med 2004;351:1567–

(unpublished data), while Sarwar et al. reported the evolution of 70.

different HCV genotypes from genotype 1b. The phylogenetic 3. The C. Everett Koop Institute, Dartmouth College. Hepatitis C: an epidemic for

anyone. Worldwide prevalence. Hanover, NH: The C. Everett Koop Institute;

analysis shown in Figure 2 suggests that the Pakistani subtype 1a

2012. Available at: http://www.epidemic.org/thefacts/theepidemic/worldPreva-

sequences are clustered with 1a sequences from the USA and

lence/ (accessed October 2012).

Germany, while subtype 1b sequences are clustered with 4. McCaughan GW, Omata M, Amarapurkar D, Bowden S, Chow WC, Chutaputti A,

et al., Asian Paciﬁc Association for the Study of the Liver (APASL) Hepatitis C

sequences from Germany and France; these sequences might

Working Party. Asian Paciﬁc Association for the Study of the Liver consensus

have some evolutionary relationship.

statements on the diagnosis, management and treatment of hepatitis C virus

We found genotype 2 in plasma samples of infected individuals infection. J Gastroenterol Hepatol 2007;22:615–33.

from Faisalabad, Lahore, and Rawalpindi divisions. This genotype is 5. Waheed Y, Tahir S, Ahmad T, Qadri I. Sequence comparison and phylogenetic

analysis of core gene of hepatitis C virus from Pakistani population. African

uncommon in Pakistan, although this ﬁnding is not surprising in

Journal of Biotechnology 2010;9:4561–7.

light of the fact that studies from the neighboring country India

6. Hamid S, Umar M, Alam A, Siddiqui A, Qureshi H, Butt J, et al. PSG Consensus

have also reported a low level incidence of HCV genotype 2. The Statement on management of hepatitis C virus infection—2003. J Pak Med Assoc

2004;54:146–50.

lower prevalence rates of other genotypes may be explained as

7. Luby SP, Qamruddin K, Shah AA, Omair A, Pahsa O, Khan AJ, et al. The relationship

sporadic cases of transmission of genotypes from other geographi-

between therapeutic injections and high prevalence of hepatitis C infection at

cal regions in which the endemicity of these genotypes is higher. Haﬁzabad. Epidemiol Infect 1997;119:349–56.

H. Aziz et al. / International Journal of Infectious Diseases 17 (2013) e247–e253 e253

8. Pasha. Infection with HCV in families of hepatitis C positive patients living 19. Attaullah S, Khan S, Ali I. Hepatitis C virus genotypes in Pakistan: a systemic

together. Paper presented at the Second Annual Symposium of Aga Khan review. Virol J 2011;8:433.

University, October 1995. Karachi: The Doctors Fortnightly; 1997. 20. Idrees M, Riazuddin S. Frequency distribution of hepatitis C virus genotypes in

9. Ministry of Health. National Hepatitis Control Programme. Islamabad: Govern- different geographical regions of Pakistan and their possible routes of trans-

ment of Pakistan; 2006. mission. BMC Infect Dis 2008;8:69.

10. Tanaka T, Kato N, Nakagawa M, Ootsuyama Y, Cho MJ, Nakazawa T, et al. 21. Zuberi SJ, Arif A. Serotyping of hepatitis C in Pakistan. J Pak Med Assoc

Molecular cloning of hepatitis C virus genome from a single Japanese carrier: 2002;52:218–9.

sequence variation within the same individual and among infected individuals. 22. Das BR, Kundu B, Khandapkar R, Sahni S. Geographical distribution of hepatitis

Virus Res 1992;23:39–53. C virus genotypes in India. Indian J Pathol Microbiol 2002;45:323–8.

11. Okamoto H, Kojima M, Okada S, Yoshizawa H, Iizuka H, Tanaka T, et al. Genetic 23. Tokita H, Shrestha SM, Okamoto H, Sakamoto M, Horikita M, Iizuka H, et al.

drift of hepatitis C virus during an 8.2-year infection in a chimpanzee: vari- Hepatitis C virus variants from Nepal with novel genotypes and their classiﬁ-

ability and stability. Virology 1992;190:894–9. cation into the third major group. J Gen Virol 1994;75:931–6.

12. Zein NN, Rakela J, Krawitt EL, Reddy KR, Tominaga T, Persing DH. Hepatitis C 24. Narahari S, Juwle A, Basak S, Saranath D. Prevalence and geographic distribution

virus genotypes in the United States: epidemiology, pathogenicity, and re- of hepatitis C virus genotypes in Indian patient cohort. Infect Genet Evol

sponse to interferon therapy. Ann Intern Med 1996;125:634–9. 2009;9:643–5.

13. Takada NS, Takase S, Takada A. Differences in the hepatitis C virus genotypes in 25. Shah HA, Jafri WS, Malik I, Prescott L, Simmonds P. Hepatitis C virus (HCV)

different countries. J Hepatol 1993;17:277–83. genotypes and chronic liver disease in Pakistan. J Gastroenterol Hepatol

14. Tsubota A, Chayama K, Ikeda K, Yasuji A, Koida I, Saitoh S, et al. Factors 1997;12:758–61.

predictive of response to interferon-alpha therapy in hepatitis C virus infection. 26. Sarwar MT, Kausar H, Ijaz B, Ahmad W, Ansar M, Sumrin A, et al. NS4A protein as

Hepatology 1994;19:1088–94. a marker of HCV history suggests that different HCV genotypes originally

15. Ohno T, Mizokami M, Wu R, Saleh MG, Ohba K, Orito E, et al. New hepatitis C evolved from genotype 1b. Virol J 2011;8:317.

virus (HCV) genotyping system that allows for identiﬁcation of HCV genotypes 27. Zali MR, Mayumi M, Raouﬁ M, Nowroozi A. Hepatitis C virus genotypes in the

1a, 1b, 2a, 2b, 3a, 3b, 4, 5a, and 6a. J Clin Microbiol 1997;35:201–7. Islamic Republic of Iran: a preliminary study. East Mediterr Health J 2000;6: 372–7.

16. Saitou N, Nei M. The neighbor-joining method: a new method for reconstruct- 28. Butt S, Idrees M, Ur Rehman I, Akbar H, Shahid M, Afzal S, et al. Mixed genotype

ing phylogenetic trees. Mol Biol Evol 1987;4:406–25. infections with hepatitis C virus, Pakistan. Emerg Infect Dis 2011;17:1565–7.

17. Davis GL, Esteban-Mur R, Rustgi V, Hoefs J, Gordon SC, Trepo C, et al. Interferon 29. Oh JW, Ito T, Lai MC. Recombinant hepatitis C virus RNA dependent RNA

alfa-2b alone or in combination with ribavirin for the treatment of relapse of polymerase capable of copying the full-length viral RNA. J Virol

chronic hepatitis C. N Engl J Med 1998;339:1493–9. 1999;73:7694–702.

18. EASL International Consensus Conference on Hepatitis C. Paris, 26–28 February 30. Qin W, Yamashita T, Shirota Y, Lin Y, Wei W, Murakami S. Mutational analysis of

1999, Consensus Statement. European Association for the Study of the Liver. J the structure and function of hepatitis C virus RNA-dependent RNA polymerase.

Hepatol 1999;30:956–61. Hepatology 2001;33:728–37.