Biochemistry and Cell Biology
GNG11 (G protein γ subunit 11) suppresses cell growth with induction of reactive oxygen species and abnormal nuclear morphology in human SUSM 1 cells
Journal: Biochemistry and Cell Biology
Manuscript ID bcb-2016-0248.R1
Manuscript Type: Article
Date Submitted by the Author: 02-Mar-2017
Complete List of Authors: Takauji, Yuki; Yokohama City University Kudo, Ikuru; Yokohama City University En, Atsuki; DraftYokohama City University Matsuo, Ryo; Yokohama City University Hossain, Mohammad; Primeasia University Nakabayashi, Kazuhiko; National Center for Child Health and Development Miki, Kensuke; Yokohama City University Fujii, Michihiko; Yokohama City University Ayusawa, Dai; Yokohama City University
Please Select from this Special N/A Issues list if applicable:
GNG11, cellular senescence, cellular immortalization, nuclear shape, Keyword: reactive oxygen species
https://mc06.manuscriptcentral.com/bcb-pubs Page 1 of 33 Biochemistry and Cell Biology
1 GNG11 (G-protein γ subunit 11) suppresses cell growth with induction of reactive
2 oxygen species and abnormal nuclear morphology in human SUSM-1 cells
3
4 Yuki Takauji1,5, Ikuru Kudo1,5, Atsuki En1, Ryo Matsuo1, Mohammad Nazir Hossain3, Kazuhiko
5 Nakabayashi4, Kensuke Miki1,2, Michihiko Fujii1* and Dai Ayusawa1,2
6
7 1Graduate school of Nanobioscience, Yokohama City University, 22-2 Seto, Kanazawa-ku,
8 Yokohama, Kanagawa 236-0027, JapanDraft
9 2Ichiban Life Corporation, 1-1-7 Horai-cho, Naka-ku, Yokohama, Kanagawa 231-0048, Japan
10 3Department of Biochemistry, Primeasia University, 9 Banani C/A Banani, Dhaka 1213, Bangladesh
11 4Department of Maternal-Fetal Biology, National Center for Child Health and Development, Tokyo
12 157-8535, Japan
13 5Both authors contributed equally to this work.
14
15 *To whom correspondence should be addressed.
16 Michihiko Fujii, Tel&Fax: +81 45 787 2213; E mail address: mifuji@yokohama cu.ac.jp
17
1
https://mc06.manuscriptcentral.com/bcb-pubs Biochemistry and Cell Biology Page 2 of 33
1 Abstract
2 Enforced expression of GNG11, G protein γ subunit 11, induces cellular senescence in normal
3 human diploid fibroblasts. We here examined the effect of the expression of GNG11 on the growth of
4 immortalized human cell lines, and found that it suppressed the growth of SUSM 1 cells, but not of
5 HeLa cells. We then compared these two cell lines to understand the molecular basis for the action of
6 GNG11. We found that expression of GNG11 induced the generation of reactive oxygen species
7 (ROS) and abnormal nuclear morphology in SUSM 1 cells but not in HeLa cells. Increased ROS
8 generation by GNG11 would likely be causedDraft by the down regulation of the antioxidant enzymes in
9 SUSM 1 cells. We also found that SUSM 1 cells, even under normal culture conditions, showed
10 higher levels of ROS and higher incidence of abnormal nuclear morphology than HeLa cells, and
11 that abnormal nuclear morphology was relevant to the increased ROS generation in SUSM 1 cells.
12 Thus, SUSM 1 and HeLa cells showed differences in the regulation of ROS and nuclear morphology,
13 which might account for their different responses to the expression of GNG11. Then, SUSM 1 cells
14 may provide a unique system to study the regulatory relationship between ROS generation, nuclear
15 morphology, and G protein signaling.
16 Key words: GNG11; cellular senescence; cellular immortalization; nuclear shape; reactive oxygen
17 species;
18
2
https://mc06.manuscriptcentral.com/bcb-pubs Page 3 of 33 Biochemistry and Cell Biology
1 Introduction
2 Normal types of human somatic cell undergo terminal growth arrest after a limited number of
3 cell divisions in vitro, a phenomenon termed cellular senescence or replicative senescence (Hayflick
4 and Moorhead 1961). Cellular senescence can also be induced by various means such as reactive
5 oxygen species (ROS), DNA damages, cell cycle perturbations, chromatin destabilization, etc
6 (Michishita et al. 1999; Young and Smith 2000). Cells can escape from cellular senescence by
7 mutational events and acquire an ability to grow indefinitely. For instance, mutations in tumor
8 suppressor genes such as p53, RB, and INK4a/ARFDraft are well known to help cells escape from cellular
9 senescence. Then, immortalized cell lines have different genetic backgrounds, and the difference in
10 their genetic backgrounds would be causative for their distinct responses to various stimuli or
11 treatments.
12 We have shown that 5 bromodeoxyuridine (BrdU), an analogue of thymidine, effectively
13 induces cellular senescence in various types of cell (Michishita et al. 1999). BrdU is a thymidine
14 analogue and thus exerts its effects upon incorporation into genomic DNA in the place of thymidine.
15 Since BrdU decondenses heterochromatin through destabilization or disruption of nucleosome
16 positioning (Miki et al. 2008; Miki et al. 2010; Zakharov et al. 1974), dysregulation of
17 heterochromatin seems to be involved in the induction of cellular senescence. Heterochromatin is
18 tethered to the nuclear envelope and has roles in the organization of the nuclear envelope. To analyze
3
https://mc06.manuscriptcentral.com/bcb-pubs Biochemistry and Cell Biology Page 4 of 33
1 the molecular basis for the action of BrdU in cellular senescence, we screened for the genes
2 up regulated in BrdU induced senescent cells, and identified GNG11, γ subunit 11 of the
3 heterotrimeric G protein (Hossain et al. 2006; Suzuki et al. 2001). The heterotrimeric G proteins are
4 composed of the Gα, Gβ, and Gγ subunits, and the Gα and Gβγ subunits work synergistically or
5 independently to transduce signals upon receptor activation (Clapham and Neer 1997). Gβγ subunits
6 reside not only in the plasma membrane but also in endosomes, endoplasmic reticulum, the Golgi
7 apparatus, mitochondria, and nuclei (Khan et al. 2013). GNG11 (Gγ11) forms a complex with the Gβ1
8 subunit and shuttles between the plasmaDraft membrane and the Golgi apparatus (Cho et al. 2011; Saini
9 et al. 2010); however, the function of GNG11 has been largely unidentified.
10 We have previously shown that enforced expression of GNG11 suppresses the growth of
11 normal human diploid fibroblast TIG 7 cells (Hossain et al. 2006). We then examined whether
12 expression of GNG11 suppresses the growth of immortalized cell lines. For this, we employed
13 human immortal SUSM 1 and HeLa cells, and found that expression of GNG11 suppressed the
14 growth of SUSM 1 cells, but not of HeLa cells. We then compared SUSM 1 cells with HeLa cells to
15 understand the mechanisms for the growth suppressive effect of GNG11 in SUSM 1 cells, and found
16 that ROS and nuclear morphology were regulated differently in SUSM 1 cells than in HeLa cells,
17 and these differences may account for the different responses to the expression of GNG11 in
18 SUSM 1 cells and HeLa cells.
4
https://mc06.manuscriptcentral.com/bcb-pubs Page 5 of 33 Biochemistry and Cell Biology
1 Materials and Methods
2 Cell culture
3 Cervical tumor derived HeLa cells were obtained from the Japanese Collection of Research
4 Bioresources (JCRB). SUSM 1 cells were established from fetal human diploid fibroblast (AD387)
5 by repeated mutagen treatments and were kindly provided by Dr. Namba, M (Namba et al. 1993).
6 Cells were cultured in plastic dishes (Thermo Scientific, Nunc) containing Dulbecco's modified
7 Eagle's Medium (DMEM) (Nissui Seiyaku) supplemented with 5% fetal calf serum (Cell culture
8 bioscience) at 37°C in 5% CO2 and 95%Draft humidity as described previously (Michishita et al. 1999).
9 Paraquat (Sigma Aldrich) and BrdU (Wako) were added to the cells at the concentrations of 5 40
10 M and 50 M, respectively.
11
12 Colony formation assay
13 To determine the survival of cells, appropriate numbers of cells (1 x 103 1 x 104) were plated
14 on 30 or 60 mm dishes, and allowed to grow for 1 2 weeks. To observe colony formation, cells
15 were fixed with methanol and stained with Coomassie Brilliant Blue (CBB, Bio Rad), and subjected
16 to photography.
17
18 Plasmids
5
https://mc06.manuscriptcentral.com/bcb-pubs Biochemistry and Cell Biology Page 6 of 33
1 The plasmid encoding YFP tagged GNG11 was kindly provided by Dr. Gautam (Washington
2 University school of Medicine) (Cho et al. 2011; Saini et al. 2010). Construction of the plasmid that
3 expresses GNG11 or GFP from the human cytomegalovirus promoter was previously described
4 (Hossain et al. 2006).
5
6 DNA transfection
7 Plasmids (10 g) were introduced into cells (106 cells) by electroporation with a
8 high efficiency electroporator (type NEPA21,Draft Nepa Gene), and appropriate numbers of the cells
9 (1×103 106 cells) were seeded on dishes or cover slips for further analyses.
10
11 Senescence-associated ß-Galactosidase assay
12 Cells were fixed in 2% formaldehyde/ 0.2% glutaraldehyde at room temperature for 5 min, and
13 incubated at 37˚C with a fresh staining solution [1 mg/ml of 5 bromo 4 chloro 3 indolyl
14 ß D galactoside, 40 mM citric acid sodium phosphate (pH 6.0), 5 mM potassium ferricyanide, 5 mM
15 potassium ferrocyanide, 150 mM NaCl, and 2 mM MgC12] as previously described (Michishita et al.
16 1999).
17
18 Assay of ROS
6
https://mc06.manuscriptcentral.com/bcb-pubs Page 7 of 33 Biochemistry and Cell Biology
1 The cells were washed twice with PBS (phosphate buffered saline), and incubated in serum
2 free medium supplemented with 5 M of a ROS sensitive fluorescence probe,
3 2’7’ dichloro fluorescein diacetate (H2DCFDA, Molecular probes) for 30 min at 37˚C in dark. Then,
4 cells were washed twice with PBS, and the fluorescence signals were photographed with a
5 fluorescence microscope (IX 70, Olympus) equipped with a standard filter set for fluorescein.
6
7 Immunofluorescence analysis
8 Cells grown on a cover slip were fixedDraft with 100% methanol for 15 min at 20˚C, washed three
9 times with PBS, and incubated with 1% bovine serum albumin in PBS at room temperature for 1 h.
10 After washing with PBS, the primary antibody against GFP (Bio Vision) was mounted on a cover
11 slip for 18 h. The cells were washed three times with PBS, and incubated with an alexa
12 568 conjugated secondary antibody (Molecular Probes) for 3 h. Finally, the cells were washed three
13 times with PBS, incubated with DAPI (4',6 diamidino 2 phenylindole) for 30 min, and mounted
14 with an anti fading reagent (Molecular probes). Immunofluorescence images were obtained by
15 fluorescence microscopy (BZ 9000, Keyence).
16
17 Quantitative real time RT-PCR
7
https://mc06.manuscriptcentral.com/bcb-pubs Biochemistry and Cell Biology Page 8 of 33
1 Total RNA samples were prepared from cells with an RNA extraction kit (Isogen, Nippon
2 Gene). RNA was converted to cDNA by a reverse transcriptase (PrimeScript 1st strand cDNA
3 synthesis kit, Takara), and transcripts were quantified by quantitative real time PCR with a kit
4 (QuantiFast SYBR green PCR kit, Qiagen) on a StepOnePlus Real Time PCR System (Applied
5 Biosystems) according to the manufacturer’s protocol. The primers used were as follows:
6 5’ GAAGGTGTGGGGAAGCATTA 3’ and 5’ ACATTGCCCAAGTCTCCAAC 3’ for SOD1;
7 5’ CGTCACCGAGGAGAAGTACC 3’ and 5’ CTGATTTGGACAAGCAGCAA 3’ for SOD2;
8 5’ CGTGCTGAATGAGGAACAGA 3’Draft and 5’ AGTCAGGGTGGACCTCAGTG 3’ for catalase;
9 5’ CCAAGCTCATCACCTGGTCT 3’ and 5’ TCGATGTCAATGGTCTGGAA 3’ for GPX1;
10 5’ TGCAACCAATTTGGACATCAG 3’ and 5’ AGACAGGATGCTCGTTCTGC 3’ for GPX2;
11 5’ AGAGATCAAAGAGTTCGCCGC 3’ and 5’ TCTTCATCCACTTCCACAGCG 3’ for GPX4;
12 5’ CCACTGTAGGCGCCCTAAGTT 3’ and 5’ ATGACCGGTGCAAGGATCC 3’ for NOX1;
13 5’ GCCCAAAGGTGTCCAAGCT 3’ and 5’ TCCCCAACGATGCGGATAT 3’ for NOX2;
14 5’ CCTTCTGTAGAGACCGCTATGCA 3’ and 5’ GACCACAGGGCCTAAAATCCA 3’ for
15 NOX3; 5’ CTCAGCGGAATCAATCAGCTGTG 3’ and
16 5’ AGAGGAACACGACAATCAGCCTTAG 3’ for NOX4;
17 5’ CAGGCACCAGAAAAGAAAGCAT 3’ and 5’ TGTTGATCCAGATAAAGTCCACCTT 3’ for
18 NOX5; 5’ AGCTGCTTGGACCCAGTCTC 3’ and 5’ GCCTTTTCTCAAGTCCCTGC 3’ for
8
https://mc06.manuscriptcentral.com/bcb-pubs Page 9 of 33 Biochemistry and Cell Biology
1 GNG11; 5’ GAAGGTGAAGGTCGGAGTCAA 3’ and 5’ GACAAGCTTCCCGTTCTCAG 3’ for
2 GAPDH (Ahmad et al. 2013; Juhasz et al. 2009; Lei et al. 2016). Results were normalizes with the
3 expression of GAPDH.
4
Draft
9
https://mc06.manuscriptcentral.com/bcb-pubs Biochemistry and Cell Biology Page 10 of 33
1 Results
2 Growth suppression by expression of GNG11 in SUSM-1 cells
3 We examined whether enforced expression of GNG11 suppresses the growth of immortalized
4 human cell lines. For this, we employed SUSM 1 cells and HeLa cells. We transfected these cells
5 with the GNG11 expressing vector or an empty vector (Hossain et al. 2006), and subsequently
6 cultured them with G418 to select the cells that stably expressed GNG11. SUSM 1 cells formed
7 much less colonies when transfected with the GNG11 expressing vector than when transfected with
8 an empty vector (Fig. 1A). By contrast, DraftHeLa cells showed similar colony formation when
9 transfected with the GNG11 expressing vector or an empty vector (Fig. 1A). Thus, expression of
10 GNG11 effectively suppressed the growth of SUSM 1 cells, but not of HeLa cells. Importantly,
11 SUSM 1 cells transfected with the GNG11 expression vector were stained with
12 senescence associated ß galactosidase (Fig.1 B), which observation suggested the possibility that
13 enforced expression of GNG11 induced cellular senescence in SUSM 1 cells. We also found that
14 GNG11 was endogenously expressed at detectable levels in both SUSM 1 and HeLa cells, but its
15 expression level was lower in SUSM 1 cells than in HeLa cells (Fig. 1C).
16
17 Abnormal nuclear morphology in SUSM-1 cells
18 To explore the mechanisms for the growth suppressive effect of GNG11 in SUSM 1 cells, we
10
https://mc06.manuscriptcentral.com/bcb-pubs Page 11 of 33 Biochemistry and Cell Biology
1 examined the subcellular localization of GNG11 in SUSM 1 and HeLa cells. We expressed the
2 YFP fused GNG11 protein (YFP GNG11) in cells (Cho et al. 2011; Saini et al. 2010); however, YFP
3 fluorescence signals were found to be too weak to precisely determine the localization of GNG11 in
4 both SUSM 1 and HeLa cells, though GFP alone was efficiently expressed in both cell lines
5 (Supplementary Fig. 1). We then enhanced the signals by indirect immunofluorescence with an
6 antibody against YFP/GFP. The YFP GNG11 protein was observed in the nuclei and at the
7 perinuclear regions in both SUSM 1 and HeLa cells, and thus SUSM 1 and HeLa cells did not
8 appear to show differences in the subcellularDraft localization of GNG11 (Fig. 2A). However, we
9 unexpectedly found that expression of GNG11 significantly increased the cells with abnormal
10 nuclear morphology, which was revealed by staining the nuclei with DAPI, in SUSM 1 cells (Fig.
11 2A, B). Interestingly, the YFP GNG11 signals frequently accumulated in the bending regions of the
12 nuclei (Fig. 2A). Abnormal nuclear morphology in SUSM 1 cells was also confirmed by staining the
13 nuclear envelope with an antibody against lamin B receptor (LBR) (Fig. 2C). Additionally, we found
14 that considerable numbers of SUSM 1 cells showed abnormal nuclear morphology even under
15 normal culture conditions (Fig. 2B, 5D). However, by contrast, HeLa cells showed almost normal
16 nuclear morphology when GNG11 was expressed or not (Fig. 2A). Thereby, expression of GNG11
17 increased the cells with abnormal nuclear morphology in SUSM 1 cells, but not in HeLa cells.
18
11
https://mc06.manuscriptcentral.com/bcb-pubs Biochemistry and Cell Biology Page 12 of 33
1 Increased ROS generation by GNG11 in SUSM-1 cells
2 We next examined the generation of ROS in SUSM 1 and HeLa cells by staining the cells with
3 a ROS sensitive fluorescent probe, H2DCFDA, because ROS are frequently involved in the
4 regulation of cell growth. We found that expression of GNG11 clearly induced ROS generation in
5 SUSM 1 cells, but not in HeLa cells, and further that SUSM 1 cells showed higher basal levels of
6 ROS than HeLa cells under normal culture conditions (Fig. 3A, B). Thus, SUSM 1 cells showed a
7 clear induction of ROS by GNG11 as well as high basal levels of ROS, whereas HeLa cells showed
8 no detectable induction of ROS by GNG11Draft as well as low basal levels of ROS. This observation
9 suggested that ROS were regulated differently in SUSM 1 cells than in HeLa cells. We then
10 examined the sensitivity to oxidative stress in SUSM 1 and HeLa cells by culturing them in medium
11 supplemented with paraquat, which generates superoxide anions in cells. SUSM 1 cells were more
12 sensitive to paraquat than HeLa cells (Fig. 3C), and thus SUSM 1 cells would be more susceptible to
13 the growth defect due to oxidative stress than HeLa cells. Since the growth suppressive effect of
14 paraquat was diminished by simultaneous addition of an antioxidant, N acetyl L cysteine, in
15 SUSM 1 and HeLa cells, ROS were causally involved in the growth suppression by paraquat in
16 these cells (Fig. 3D). Then, ROS were regulated differently in SUSM 1 cells than in HeLa cells, and
17 GNG11-induced growth suppression in SUSM 1 cells may be at least partly explained by the
18 increased generation of ROS by GNG11.
12
https://mc06.manuscriptcentral.com/bcb-pubs Page 13 of 33 Biochemistry and Cell Biology
1
2 Expression of antioxidant and pro-oxidant enzymes in SUSM-1 and HeLa cells
3 To understand the mechanisms for the increased generation of ROS by GNG11 in SUSM 1
4 cells, we analyzed the expression of the enzymes that scavenge or produce ROS: i.e., superoxide
5 dismutase (SOD), catalase, glutathione peroxidase (GPX), and NADPH oxidase (NOX). NOX
6 produces ROS but the others scavenge ROS. Of these, we examined the expression of the
7 intracellular enzymes such as SOD1, SOD2, catalase, GPX1, GPX2, GPX4, and NOX1-5, and found
8 that GNG11 significantly down regulatedDraft the expression of SOD1, SOD2, catalase, and NOX5 but
9 not of GPX1, GPX4, and NOX4 in SUSM 1 cells (Fig. 4). The expression of GPX2 and NOX1-3 was
10 not detected in SUSM 1 cells (data not shown). Further, we also compared the expression of these
11 enzymes between SUSM 1 cells and HeLa cells. We found that expression of SOD1, catalase, GPX2
12 and NOX5 was significantly lower in SUSM 1 cells, but that of NOX4 was higher in SUSM 1 cells,
13 than in HeLa cells (Fig. 4). The expression of NOX1-4 was not detected in HeLa cells (data not
14 shown). Thereby, decreased expression of the antioxidant genes appeared to be involved in the
15 increased ROS generation in SUSM 1 cells upon expression of GNG11 and the increased basal
16 levels of ROS in SUSM 1 cells as compared with those of HeLa cells under normal culture
17 conditions, though the roles of the NOX genes in ROS generation remain elusive.
18
13
https://mc06.manuscriptcentral.com/bcb-pubs Biochemistry and Cell Biology Page 14 of 33
1 Regulatory interplay between ROS generation and nuclear morphology in SUSM-1 cells
2 To examine the relationship between increased ROS generation and abnormal nuclear
3 morphology in SUSM 1 cells, we treated SUSM 1 cells with paraquat and examined their nuclear
4 shapes. We then found that paraquat significantly increased the cells with abnormal nuclear
5 morphology in SUSM 1 cells (Fig. 5A, D). This observation indicated that ROS, at least partly,
6 regulated the nuclear shapes in SUSM 1 cells, and thus suggested that expression of GNG11
7 increased the cells with abnormal nuclear morphology by up regulating ROS generation in SUSM 1
8 cells. Interestingly, we also found that SUSM 1Draft cells, when treated with BrdU, showed ameliorated
9 nuclear morphology and decreased basal levels of ROS (Fig. 5B, C, D). BrdU might affect the
10 nuclear envelope organization because BrdU is an agent that decondenses heterochromatin which
11 interacts with nuclear envelope proteins (Zakharov et al. 1974). Collectively, these findings
12 suggested that increased ROS generation might couple with abnormal nuclear morphology in
13 SUSM 1 cells. However, in HeLa cells, ROS alone were not sufficient to induce abnormal nuclear
14 morphology (Fig. 5A). Thus, nuclear envelope organization as well as ROS generation was regulated
15 differently in SUSM 1 cells than in HeLa cells.
16
14
https://mc06.manuscriptcentral.com/bcb-pubs Page 15 of 33 Biochemistry and Cell Biology
1 Discussion
2 In this study, we showed that enforced expression of GNG11 suppressed the growth of
3 SUSM 1 cells, but not of HeLa cells. Since different responses to the expression of GNG11 in
4 SUSM 1 and HeLa cells would be caused by their different genetic backgrounds, we compared these
5 two cell lines to understand the molecular mechanisms for the growth suppressive effect of GNG11
6 in SUSM 1 cells. We then found that SUSM 1 cells showed a clear induction of ROS by GNG11 as
7 well as high basal levels of ROS, whereas HeLa cells showed no detectable induction of ROS by
8 GNG11 as well as low basal levels of ROS.Draft Since ROS impair cellular functions, increased ROS
9 seemed to be involved in the growth suppression by GNG11 in SUSM 1 cells. Given that GNG11
10 encodes a member of the γ subunit family of the heterotrimeric G proteins, GNG11 would likely
11 participate in the regulation of the reactions that erase or produce ROS, rather than GNG11 directly
12 catalyzes the reactions that produce ROS. Indeed, we showed that GNG11 down regulated the
13 expression of the antioxidant enzymes in SUSM 1 cells, though its regulatory mechanisms are
14 currently unidentified. The activity of transcription factors that regulate the expression of these
15 antioxidant genes might be regulated differently in SUSM 1 cells than in HeLa cells.
16 We also found that GNG11 or paraquat induced abnormal nuclear morphology in SUSM 1
17 cells. Then, ROS induced by GNG11 or paraquat would have a role in the induction of abnormal
18 nuclear morphology in SUSM 1 cells. Abnormal nuclear morphology was also observed in a portion
15
https://mc06.manuscriptcentral.com/bcb-pubs Biochemistry and Cell Biology Page 16 of 33
1 of SUSM 1 cells cultured under normal culture conditions, and this phenomenon would be probably
2 linked with high basal levels of ROS in SUSM 1 cells. Additionally, we showed that BrdU
3 ameliorated nuclear shapes with decreased basal levels of ROS. Thereby, these observations
4 suggested a regulatory interplay between ROS generation and nuclear envelope organization in
5 SUSM 1 cells. Consistent with this, it is well known that the Hutchinson Gilford progeria syndrome
6 (HGPS) patient cells, which have a defective nuclear lamina due to a mutation in lamin A/C, show
7 not only aberrant nuclear morphology but also increased levels of ROS and an increased sensitivity
8 to ROS (De Sandre Giovannoli et al. 2003;Draft Eriksson et al. 2003; Richards et al. 2011; Viteri et al.
9 2010). Recent findings indicate that the defective nuclear lamina in HGPS cells impairs the NRF2
10 function through sequestration of NRF2 at the nuclear periphery and intracellular aggregates, and
11 consequently increases chronic oxidative stress (Kubben et al. 2016). This finding indicates the
12 crucial roles of the nuclear envelope organization in the regulation of oxidative stress because NRF2
13 encodes a transcription factor that plays a central role in the response to oxidative stress by inducing
14 many detoxification/antioxidant enzymes (Itoh et al. 1997). Further, increased generation of ROS
15 due to the defects in the nuclear lamina, in turn, impairs lamin A/C through oxidation of its tail
16 domain (Pekovic et al. 2011). Thus, ROS induced by the defective nuclear lamina amplify the
17 defects in nuclear lamina in a positive feedback loop manner. Then, it would be interesting to
18 speculate such a regulatory interplay between ROS and nuclear envelope proteins might be observed
16
https://mc06.manuscriptcentral.com/bcb-pubs Page 17 of 33 Biochemistry and Cell Biology
1 in SUSM 1, though it is unclear at present whether increased generation of ROS is a cause or
2 consequence of abnormal nuclear organization in SUSM 1 cells. However, ROS alone did not seem
3 to be sufficient to alter nuclear shapes because paraquat hardly affected nuclear shapes in HeLa cells;
4 thus, we prefer the possibility that altered nuclear envelope organization might cause increased
5 generation of ROS that consequently leads to an increased sensitivity to ROS in SUSM 1 cells.
6 Then, it is possible to speculate that SUSM 1 cells would have altered nuclear envelope
7 organization. In addition, we showed that heterochromatin would also be involved in the regulation
8 of nuclear shapes because abnormal nuclearDraft shapes in SUSM 1 cells were ameliorated by BrdU,
9 which decondenses heterochromatin (Zakharov et al. 1974). Given that heterochromatin interacts
10 with the nuclear envelope proteins, abnormal nuclear shapes might be caused by abnormal
11 interaction between the nuclear envelope and heterochromatin in SUSM 1 cells. If so, BrdU might
12 ameliorate the nuclear shapes by unraveling the abnormal interaction between the nuclear envelope
13 and heterochromatin, and consequently down regulate the increased basal levels of ROS in SUSM 1
14 cells. However, we found that, even though BrdU down regulated the increased basal levels of ROS
15 in SUSM 1 cells, the ROS levels in BrdU treated SUSM 1 cells seemed to be higher than those in
16 HeLa cells under normal culture conditions. This may be due to that BrdU treated SUSM 1 cells
17 entered cellular senescence, in which increased ROS generation is frequently observed (Chen et al.
18 1995; Lee et al. 1999; Lee et al. 2002; Takauji et al. 2016).
17
https://mc06.manuscriptcentral.com/bcb-pubs Biochemistry and Cell Biology Page 18 of 33
1 To date, human immortalized cell lines are classified into, at least, four genetic
2 complementation groups (A D) by examining the immortal phenotype of the cell cell hybrids
3 constructed with a cell cell fusion technique (Ning et al. 1991). This finding indicates that a limited
4 number of genes are involved in cellular immortalization. We have previously demonstrated that
5 introduction of human chromosome 7 by microcell mediate chromosome transfer suppresses cell
6 growth in SUSM 1 cells which belong to the complementation group D, but not in HT1080, HeLa,
7 and TE85 cells, which belong to the other complementation groups (Ogata et al. 1993; Ogata et al.
8 1995). This indicates that a gene(s) that Draftlocates on chromosome 7 suppresses the growth of SUSM 1
9 cells. Since GNG11 locates on chromosome 7, it would be intriguing to speculate that GNG11 plays
10 a role in the growth suppression by introduction of chromosome 7 in SUSM 1 cells.
11 In summary, we have shown that GNG11 suppressed cell growth with induction of ROS and
12 abnormal nuclear morphology in SUSM 1 cells. Our findings suggested a regulatory interplay
13 between ROS generation and nuclear envelope organization in SUSM 1 cells, and thus, SUSM 1
14 cells may provide a unique system to study the relationship between ROS generation, nuclear
15 envelope organization, and G protein signaling.
16
17 Acknowledgment
18 We thank Dr. Gautam, N. for providing us with the plasmid that encodes YFP-GNG11. This work
18
https://mc06.manuscriptcentral.com/bcb-pubs Page 19 of 33 Biochemistry and Cell Biology
1 was supported in part by a grant in aid for Scientific Research from the Ministry of Education,
2 Science and Culture of Japan.
3
Draft
19
https://mc06.manuscriptcentral.com/bcb-pubs Biochemistry and Cell Biology Page 20 of 33
1 References
2 Ahmad, T.A., Jubri, Z., Rajab, N.F., Rahim, K.A., Yusof, Y.A., and Makpol, S. 2013. Gelam honey
3 protects against gamma irradiation damage to antioxidant enzymes in human diploid fibroblasts.
4 Molecules 18(2): 2200 2211. doi: 10.3390/molecules18022200.
5 Chen, Q., Fischer, A., Reagan, J.D., Yan, L.J., and Ames, B.N. 1995. Oxidative DNA damage and
6 senescence of human diploid fibroblast cells. Proceedings of the National Academy of Sciences of
7 the United States of America 92(10): 4337 4341.
8 Cho, J.H., Saini, D.K., Karunarathne, W.K.,Draft Kalyanaraman, V., and Gautam, N. 2011. Alteration of
9 Golgi structure in senescent cells and its regulation by a G protein gamma subunit. Cellular
10 signalling 23(5): 785 793. doi: 10.1016/j.cellsig.2011.01.001.
11 Clapham, D.E., and Neer, E.J. 1997. G protein beta gamma subunits. Annu Rev Pharmacol Toxicol
12 37: 167 203. doi: 10.1146/annurev.pharmtox.37.1.167.
13 De Sandre Giovannoli, A., Bernard, R., Cau, P., Navarro, C., Amiel, J., Boccaccio, I., Lyonnet, S.,
14 Stewart, C.L., Munnich, A., Le Merrer, M., and Levy, N. 2003. Lamin a truncation in
15 Hutchinson Gilford progeria. Science 300(5628): 2055. doi: 10.1126/science.1084125.
16 Eriksson, M., Brown, W.T., Gordon, L.B., Glynn, M.W., Singer, J., Scott, L., Erdos, M.R., Robbins,
17 C.M., Moses, T.Y., Berglund, P., Dutra, A., Pak, E., Durkin, S., Csoka, A.B., Boehnke, M., Glover,
18 T.W., and Collins, F.S. 2003. Recurrent de novo point mutations in lamin A cause
20
https://mc06.manuscriptcentral.com/bcb-pubs Page 21 of 33 Biochemistry and Cell Biology
1 Hutchinson Gilford progeria syndrome. Nature 423(6937): 293 298. doi: 10.1038/nature01629.
2 Hayflick, L., and Moorhead, P.S. 1961. The serial cultivation of human diploid cell strains.
3 Experimental cell research 25: 585 621.
4 Hossain, M.N., Sakemura, R., Fujii, M., and Ayusawa, D. 2006. G protein gamma subunit GNG11
5 strongly regulates cellular senescence. Biochemical and biophysical research communications
6 351(3): 645 650. doi: S0006 291X(06)02329 1 [pii]
7 10.1016/j.bbrc.2006.10.112.
8 Itoh, K., Chiba, T., Takahashi, S., Ishii, T.,Draft Igarashi, K., Katoh, Y., Oyake, T., Hayashi, N., Satoh, K.,
9 Hatayama, I., Yamamoto, M., and Nabeshima, Y. 1997. An Nrf2/small Maf heterodimer mediates the
10 induction of phase II detoxifying enzyme genes through antioxidant response elements. Biochemical
11 and biophysical research communications 236(2): 313 322.
12 Juhasz, A., Ge, Y., Markel, S., Chiu, A., Matsumoto, L., van Balgooy, J., Roy, K., and Doroshow, J.H.
13 2009. Expression of NADPH oxidase homologues and accessory genes in human cancer cell lines,
14 tumours and adjacent normal tissues. Free radical research 43(6): 523 532. doi:
15 10.1080/10715760902918683.
16 Khan, S.M., Sleno, R., Gora, S., Zylbergold, P., Laverdure, J.P., Labbe, J.C., Miller, G.J., and Hebert,
17 T.E. 2013. The expanding roles of Gbetagamma subunits in G protein coupled receptor signaling
18 and drug action. Pharmacological reviews 65(2): 545 577. doi: 10.1124/pr.111.005603.
21
https://mc06.manuscriptcentral.com/bcb-pubs Biochemistry and Cell Biology Page 22 of 33
1 Kubben, N., Zhang, W., Wang, L., Voss, T.C., Yang, J., Qu, J., Liu, G.H., and Misteli, T. 2016.
2 Repression of the Antioxidant NRF2 Pathway in Premature Aging. Cell 165(6): 1361 1374. doi:
3 10.1016/j.cell.2016.05.017.
4 Lee, A.C., Fenster, B.E., Ito, H., Takeda, K., Bae, N.S., Hirai, T., Yu, Z.X., Ferrans, V.J., Howard,
5 B.H., and Finkel, T. 1999. Ras proteins induce senescence by altering the intracellular levels of
6 reactive oxygen species. The Journal of biological chemistry 274(12): 7936 7940.
7 Lee, H.C., Yin, P.H., Chi, C.W., and Wei, Y.H. 2002. Increase in mitochondrial mass in human
8 fibroblasts under oxidative stress and duringDraft replicative cell senescence. Journal of biomedical
9 science 9(6 Pt 1): 517 526.
10 Lei, Z., Tian, D., Zhang, C., Zhao, S., and Su, M. 2016. Clinicopathological and prognostic
11 significance of GPX2 protein expression in esophageal squamous cell carcinoma. BMC cancer 16:
12 410. doi: 10.1186/s12885 016 2462 3.
13 Michishita, E., Nakabayashi, K., Suzuki, T., Kaul, S.C., Ogino, H., Fujii, M., Mitsui, Y., and
14 Ayusawa, D. 1999. 5 Bromodeoxyuridine induces senescence like phenomena in mammalian cells
15 regardless of cell type or species. J Biochem 126(6): 1052 1059.
16 Miki, K., Shimizu, M., Fujii, M., Hossain, M.N., and Ayusawa, D. 2008. 5 Bromouracil disrupts
17 nucleosome positioning by inducing A form like DNA conformation in yeast cells. Biochemical and
18 biophysical research communications 368(3): 662 669. doi: 10.1016/j.bbrc.2008.01.149.
22
https://mc06.manuscriptcentral.com/bcb-pubs Page 23 of 33 Biochemistry and Cell Biology
1 Miki, K., Shimizu, M., Fujii, M., Takayama, S., Hossain, M.N., and Ayusawa, D. 2010.
2 5 bromodeoxyuridine induces transcription of repressed genes with disruption of nucleosome
3 positioning. The FEBS journal 277(21): 4539 4548. doi: 10.1111/j.1742 4658.2010.07868.x.
4 Namba, M., Iijima, M., Kondo, T., Jahan, I., and Mihara, K. 1993. Immortalization of normal human
5 cells is a multistep process and a rate limiting step of neoplastic transformation of the cells. Human
6 cell 6(4): 253 259.
7 Ning, Y., Weber, J.L., Killary, A.M., Ledbetter, D.H., Smith, J.R., and Pereira Smith, O.M. 1991.
8 Genetic analysis of indefinite division inDraft human cells: Evidence for a cell senescence related gene(s)
9 on human chromosome 4. Proc Natl Acad Sci USA 88:5635 5639, 1991 . Proc Natl Acad Sci USA
10 88: 5635 5639.
11 Ogata, T., Ayusawa, D., Namba, M., Takahashi, E., Oshimura, M., and Oishi, M. 1993. Chromosome
12 7 suppresses indefinite division of non tumorigenic immortalized human fibroblast cell lines
13 KMST 6 and SUSM 1. Mol Cell Biol 13: 6036 6043.
14 Ogata, T., Oshimura, M., Namba, M., Fujii, M., Oishi, M., and Ayusawa, D. 1995. Genetic
15 complementation of the immortal phenotype in group D cell lines by introduction of chromosome 7.
16 Jpn J Cancer Res 86: 35 40.
17 Pekovic, V., Gibbs Seymour, I., Markiewicz, E., Alzoghaibi, F., Benham, A.M., Edwards, R.,
18 Wenhert, M., von Zglinicki, T., and Hutchison, C.J. 2011. Conserved cysteine residues in the
23
https://mc06.manuscriptcentral.com/bcb-pubs Biochemistry and Cell Biology Page 24 of 33
1 mammalian lamin A tail are essential for cellular responses to ROS generation. Aging cell 10(6):
2 1067 1079. doi: 10.1111/j.1474 9726.2011.00750.x.
3 Richards, S.A., Muter, J., Ritchie, P., Lattanzi, G., and Hutchison, C.J. 2011. The accumulation of
4 un repairable DNA damage in laminopathy progeria fibroblasts is caused by ROS generation and is
5 prevented by treatment with N acetyl cysteine. Human molecular genetics 20(20): 3997 4004. doi:
6 10.1093/hmg/ddr327.
7 Saini, D.K., Karunarathne, W.K., Angaswamy, N., Saini, D., Cho, J.H., Kalyanaraman, V., and
8 Gautam, N. 2010. Regulation of Golgi structureDraft and secretion by receptor induced G protein
9 betagamma complex translocation. Proceedings of the National Academy of Sciences of the United
10 States of America 107(25): 11417 11422. doi: 10.1073/pnas.1003042107.
11 Suzuki, T., Minagawa, S., Michishita, E., Ogino, H., Fujii, M., Mitsui, Y., and Ayusawa, D. 2001.
12 Induction of senescence associated genes by 5 bromodeoxyuridine in HeLa cells. Experimental
13 gerontology 36(3): 465 474.
14 Takauji, Y., En, A., Miki, K., Ayusawa, D., and Fujii, M. 2016. Combinatorial effects of continuous
15 protein synthesis, ERK signaling, and reactive oxygen species on induction of cellular senescence.
16 Experimental cell research 345(2): 239 246. doi: 10.1016/j.yexcr.2016.06.011.
17 Viteri, G., Chung, Y.W., and Stadtman, E.R. 2010. Effect of progerin on the accumulation of
18 oxidized proteins in fibroblasts from Hutchinson Gilford progeria patients. Mechanisms of ageing
24
https://mc06.manuscriptcentral.com/bcb-pubs Page 25 of 33 Biochemistry and Cell Biology
1 and development 131(1): 2 8. doi: 10.1016/j.mad.2009.11.006.
2 Young, J., and Smith, J.R. 2000. Epigenetic aspects of cellular senescence. Experimental
3 gerontology 35(1): 23 32. doi: S0531 5565(99)00076 5 [pii].
4 Zakharov, A.F., Baranovskaya, L.I., Ibraimov, A.I., Benjusch, V.A., Demintseva, V.S., and
5 Oblapenko, N.G. 1974. Differential spiralization along mammalian mitotic chromosomes. II.
6 5 bromodeoxyuridine and 5 bromodeoxycytidine revealed differentiation in human chromosomes.
7 Chromosoma 44(4): 343 359.
8 Draft
9
10
25
https://mc06.manuscriptcentral.com/bcb-pubs Biochemistry and Cell Biology Page 26 of 33
1 Figure legends
2 Fig. 1. Growth suppression by expression of GNG11 in SUSM 1 cells
3 A, SUSM 1 and HeLa cells were transfected with the GNG11 expressing vector or an empty vector
4 and allowed to form colonies in the presence of G418 (200 400 g/ml) for 2 weeks. Cells were
5 subjected to photography and stained with CBB.
6 B, SUSM 1 cells transfected with the GNG11 expressing vector or an empty vector were stained
7 with senescence associated ß galactosidase.
8 C, Expression level of endogenous GNG11Draft was determined by quantitative RT PCR in SUSM 1 and
9 HeLa cells, and is expressed as a value relative to that of SUSM 1 cells. An error bar indicates S.D.
10
11 Fig. 2. Subcellular localization of GNG11 and nuclear morphology in SUSM 1 and HeLa cells upon
12 expression of GNG11
13 A, SUSM 1 and HeLa cells were transfected with the vectors expressing YFP-GNG11 or GFP
14 (control), and probed with an anti GFP antibody. Nuclei were stained with DAPI. Arrowheads
15 indicate abnormal nuclei, and arrows indicate the accumulated YFP GNG11 signals at the bending
16 regions of the nuclei.
17 B, The percentage of the cells with abnormal nuclear morphology (A) was determined.
18 Approximately 50 nuclei of the YFP/GFP positive cells were examined (n=3). An error bar indicates
26
https://mc06.manuscriptcentral.com/bcb-pubs Page 27 of 33 Biochemistry and Cell Biology
1 S.D., and an asterisk indicates statistical significance (P< 0.05).
2 C, SUSM 1 cells were stained for the nuclear envelope with an antibody against a nuclear envelope
3 protein, lamin B receptor (LBR).
4
5 Fig. 3. Regulation of ROS in SUSM 1 and HeLa cells
6 A, SUSM 1 and HeLa cells were transfected with the GNG11 expressing vector or an empty vector,
7 and generation of ROS was determined by culturing these cells with a ROS sensitive fluorescent
8 probe, H2DCFDA. Draft
9 B, Basal levels of ROS were determined by culturing SUSM 1 and HeLa cells with H2DCFDA.
10 C, SUSM 1 and HeLa cells were cultured with paraquat (5 M) for 1 week, and stained with CBB.
11 D, SUSM 1 and HeLa cells were cultured with paraquat (5 M for SUSM 1 cells and 10 M for
12 HeLa cells) in the presence or absence of 0.5 mM of N acetyl L cysteine (NAC) for 1 week, and
13 stained with CBB.
14
15 Fig. 4. Expression of ROS scavenging and ROS producing enzymes
16 Expression levels of ROS scavenging and ROS producing enzymes were determined by quantitative
17 RT PCR in SUSM 1 cells transfected with the GNG11 expressing vector (grey bars) or an empty
18 vector (white bars), and in HeLa transfected with an empty vector (black bars). The expression level
27
https://mc06.manuscriptcentral.com/bcb-pubs Biochemistry and Cell Biology Page 28 of 33
1 is expressed as a value relative to that of SUSM 1 cells transfected with an empty vector. An error
2 bar indicates S.D.
3
4 Fig. 5. Regulatory interplay between ROS generation and nuclear envelope organization
5 A, SUSM 1 and HeLa cells were treated with paraquat (40 M) for 3 days and stained with DAPI.
6 Arrowheads and squares indicate abnormal nuclei and slightly abnormal nuclei, respectively.
7 B, C, SUSM 1 and HeLa cells were treated with BrdU (50 M) for 3 days and stained with
8 H2DCFDA (B) or DAPI (C). ArrowheadsDraft and squares indicate abnormal nuclei and slightly
9 abnormal nuclei, respectively.
10 D, The percentage of the cells with abnormal and slightly abnormal nuclear morphology in SUSM 1
11 cells (A and C) was determined (> 100 cells, n=3). Error bars indicates S.D., and asterisks indicate
12 statistical significance (P< 0.05).
13
14 Supplementary figure 1. Transfection of SUSM 1 and HeLa cells with a GFP expressing vector.
15 SUSM 1 and HeLa cells were transfected with a GFP expression vector and GFP fluorescence was
16 photographed.
17
28
https://mc06.manuscriptcentral.com/bcb-pubs Page 29 of 33 Biochemistry and Cell Biology
Draft
https://mc06.manuscriptcentral.com/bcb-pubs Biochemistry and Cell Biology Page 30 of 33
Draft
https://mc06.manuscriptcentral.com/bcb-pubs Page 31 of 33 Biochemistry and Cell Biology
Draft
https://mc06.manuscriptcentral.com/bcb-pubs Biochemistry and Cell Biology Page 32 of 33
Draft
https://mc06.manuscriptcentral.com/bcb-pubs Page 33 of 33 Biochemistry and Cell Biology
Draft
https://mc06.manuscriptcentral.com/bcb-pubs