Evolution of Transducin Alpha, Beta and Gamma Subunit Gene Families

Home , GNAT1, GNAT3, GNG11, GNG2, GNGT1, GNGT2

Evolution of transducin alpha, beta and gamma subunit gene families

David Lagman

Degree project in biology, Master of science (1 year), 2010 Examensarbete i biologi 30 hp till magisterexamen, 2010 Biology Education Centre, Uppsala University and Department of Neuroscience unit of Pharmacology Supervisors: Dan Larhammar and Görel Sundström Abstract

The genomes of modern vertebrates have expanded due to two rounds of genome duplication (2R) in the ancestor of the vertebrates, followed by a third genome duplication in the teleost fish ancestor (3R). Gene duplications can give rise to new functions (neo-functionalizations), similar and more specialized functions than the original copy (sub-functionalizations) or no function at all (due to subsequent loss of the duplicate).

In the vertebrate retina, all cell types probably arose early in vertebrate evolution. Duplications of the phototransduction genes may have lead the way for evolving new aspects of vision. As an example, the rods and cones use similar but different proteins in their signal transduction.

In this study, the focus lies on the guanine nucleotide-binding proteins (GN) involved in phototransduction: the transducins. Their function is to mediate the signal transduction from the photoreceptor proteins, the opsins, to the effector proteins, the phosphodiesterases. Transducins are heterotrimeric G-proteins made of three subunits: alpha, beta and gamma. The zebrafish genome has 15 members of the alpha subunit family (GNA), 7 members of the beta subunit family (GNB), and 14 members of the gamma subunit family (GNG). Out of these, two alpha genes are expressed in the retina: GNAT1 and GNAT2, closely related to a third member called GNAT3, involved in the taste pathways. The GNAT1 and GNAT2 genes seem to have diverged in one of the two rounds of whole genome duplication in early vertebrates. They share chromosomal regions with inhibitory GNA (GNAI) genes, and these seem to follow the same duplication pattern.

Phylogenetic analyses of the five members of the beta subunit family suggest pre-vertebrate duplication of one gene. One gene gave rise to the first branch, which contains the GNB1-4 genes. At least two of these are expressed in the retina. The other pre-vertebrate gene is distantly related to GNB1-4 and has just one member, GNB5. The gene giving rise to the GNB1-4 genes duplicated in the vertebrate ancestor after the split from urochordates, probably in the two rounds of genome duplication. GNB1 and GNB3 are expressed in the retina. GNB3 shows a high evolutionary rate and underwent an extra duplication in teleosts, giving rise to GNB3a and GNB3b. Any differences between these in function or expression pattern have yet to be investigated.

The gamma subunit family consists of four branches that already existed before the vertebrate genome duplications. Many genes in these groups were further duplicated in the early vertebrate and teleost genome duplications. The GNGT1 and GNGT2 have been reported to be expressed in retinal photoreceptor cells. These two genes seem to have been duplicated in 2R.

The main aim of this project is to sort out the evolution, expression patterns and neo- or subfunctionalizations of the different phototransduction cascade genes using bioinformatic and molecular tools, starting with the transducins.

Introduction

Vision Photoreception, as a sense for guidance, is widely adopted in multicellular organisms. It is present in many forms and for many different uses. In some organisms photoreception is mainly for detecting possible changes in the environment by feeling differences in light intensities. Other organisms have evolved special organs for visualising the environment, eyes. Vertebrates possess a so-called single lens camera eye. The eye is made of conjunctiva, sclera, lens and neural retina (Fig. 1). The retina connects to the brain via the optic nerve. The neural retina is the photoreceptive part of the eye and is built up of several layers (Fig. 1), which are from the outside in: outer segment, outer nuclear layer, outer plexiform layer, inner nuclear layer, inner plexiform layer and ganglion cell layer. The outer segment contains the photoreceptor parts in which the photoreception for vision takes place. In the outer plexiform layer the photoreceptor cells connect to horizontal and bipolar cells, which have their cell bodies in the inner nuclear layer. The bipolar cells project down to the inner plexiform layer where they connect to amacrine cells and ganglion cells. Amacrine cell bodies are located in the inner nuclear layer while the ganglion cell bodies are located in the ganglion cell layer (Lamb 2009).

Figure 1: General structure of the vertebrate eye and neural retina. A) Schematic picture of the vertebrate eye structure. B) Schematic picture of the vertebrate neural retina with its cells. Illustration by David Lagman Photoreceptor cells The photoreceptor cells are specialized neuroepithelial cells. They are found in a variety of forms in the animal kingdom subdivided in two major types of photoreceptor cells. The oldest form of photoreceptors is called ciliary photoreceptor cell and is most abundant in today’s vertebrate eyes. The other type is the rhabdomeric photoreceptor present in many of the modern invertebrates. The common ancestor to both types of photoreceptors is believed to have been a ciliary photoreceptor cell. The rhabdomeric photoreceptor cell has its apical surface tilted 90° so that it points to the side. In the apical surface are the zonula adherens (ZA), the fly stalk and the rhabdomes. The ciliary photoreceptor cells consist of a cell body, ZA, inner segment (IS), a connecting cilium and the outer segment (OS). In the outer segment

2 of the ciliary photoreceptors there are several folded inner membranes on which the opsins and all the components of the phototransduction cascade are located (Lamb 2009).

Phototransduction cascade The phototransduction cascade in a ciliary photoreceptor (Fig. 2) consists of many different components crucial for the initiation, transmission and termination of signalling. The cascade starts at the opsin level. Opsins are seven-transmembrane G-protein coupled receptors (GPCR) with a prosthetic group consisting of a retinal molecule in an 11-cis-retinal conformation. Light induces a conformational change in the retinal molecule to all-trans- retinal, which in turn changes the conformation of the opsin to an activated state. The activated opsin binds the G-protein named transducin. Transducin is a heterotrimeric G- protein and consisting of GNA, GNB and GNG. Transducins are involved in both taste and vision pathways (Oldham and Hamm 2006). The G-proteins are a family of proteins that act in different signalling pathways of cells through similar intrinsic mechanisms. Common to all G-proteins is the binding of a G-nucleotide where the active GTP form undergoes an intrinsic GTP hydrolysis to GDP (Wettschureck and Offermanns 2005). GTP/GDP binds in the GNA subunit. GDP removal makes it possible for a new GTP to bind the G-protein. The exchange of GDP for GTP is done by a G-nucleotide exchange factor (GEF), which is often another protein. For G-proteins that act in GPCR pathways it is the activated GPCR that acts as a GEF (Wettschureck and Offermanns 2005). Upon activation, GNA leaves the GNB-GNG dimer (Wettschureck and Offermanns 2005). GNA then is free to activate the phosphodiesterase (PDE), which transforms cyclic guanine mono-phosphate (cGMP) to guanine mono phosphate (GMP). This closes the cGMP gated ion channel (CNG) due to the decreasing amounts of cGMP in the cytoplasm (Chen 2005). Closure of the CNG leads to decreased influx of ions and thus a hyperpolarization of the photoreceptor cell, which causes the cell to stop its release of neurotransmitter. The GNA, GNB and GNG subunits mainly expressed in the retina are; GNAT1 and GNAT2, GNB1 and GNB3 and GNGT1 and GNGT2 (Wettschureck and Offermanns 2005). Under dark conditions and to recover the normal state cGMP is produced from GMP by guanylyl cyclase (GC) present in the disc membrane of the photoreceptor cell.

Figure 2: A schematic picture of the phototransduction cascade and its components in a vertebrate photoreceptor cell. All components are shown within the same membrane as believed to be the case in the ancestor of rods and cones. In rods parts of the membrane have been internalized into intracellular discs harbouring some of the signal transduction components, for example rhodopsin. (Figure from Larhammar et al. 2009 used with permission from authors and Royal Society Publishing)

Transducin As previously mentioned transducin is a heterotrimeric G-protein and therefore encoded by three different genes. Each heterotrimer consists of one alpha, one beta and one gamma subunit (Watson et al. 1994; Birnbaumer 2007). The gene families containing these genes are of varying size, the largest and most diverge being the alpha subunit gene family followed by the gamma subunit gene family and the beta subunit gene family. Guanine nucleotide binding protein subunit alpha The alpha subunit gene family has fifteen members in the human genome, which can be subdivided into four different subfamilies (Wilkie et al. 1992). The subfamilies are the GNAS, GNAI, GNAQ and G12/13. Each of these four subfamilies has members expressed in invertebrates as well as vertebrates suggesting an origin before the common ancestors of vertebrates and invertebrates (Wilkie et al. 1992). The GNAS subfamily includes the GNAS and GNAolf; GNAI subfamily includes GNAI1-3, GNAZ, GNAOa, GNAOb and GNAT1-3; GNAQ subfamily includes GNAQ, GNA11, 14, 15 and 16; GNA12 includes GNA12 and GNA13 (Wilkie et al. 1992).

Members of the GNAS subfamily are stimulatory G proteins that activate adenylyl cyclase. This increases the levels of the intracellular second messenger cyclic adenosine mono phosphate (cAMP), which then acts on different signalling pathways in the cells. An example of a ligand that induces signalling through GNAS is growth hormone releasing hormone (GHRH), which binds to a cell surface GPCR, the GHRH receptor (GHRHR), that in turn activates GNAS (Lania and Spada 2009). Serotonin (5-HT) also induces GNAS signalling when it binds to the GPCRs 5-HT4(b) and 5-HT7(a) which in turn couples to GNAS to up- regulate intracellular cAMP (Norum et al. 2003). The GNAI subfamily of alpha subunits has received its name due to its inhibitory effects. The members that share the family name are the GNAI1-3 proteins and they are most closely related to GNAT1-3. These two are located close to one another on the same chromosome (Larhammar et al. 2009). Members of GNAI interact with various effectors such as adenylyl cyclase and PI3 kinase. The GNAT genes of this subfamily act on the gamma subunit of phosphodiesterase 6 (PDE6) except for GNAT3 or gustducin, which acts on cAMP-sprcific Ca/CaM stimulated PDE1A (Birnbaumer 2007). GNAQ subfamily members act on for example phospholipase Cβ1 and Burton’s tyrosine kinase (Btk) (Birnbaumer 2007) while GNA12 and GNA13 subfamily members mediate the signal of growth factors acting on cell surface receptors, migration of cells and actin turnover in various processes in the cells (Shan et al. 2006; Wang et al. 2006). Guanine nucleotide binding protein subunit beta The G-protein beta subunit gene family have five members (GNB1-5) (Watson et al. 1994) in vertebrates with additional duplicates in teleosts. The GNB family belongs to a superfamily of proteins containing WD40 repeats, but other proteins in this large superfamily have not been shown to interact with the subunits of the heterotrimeric G protein (Watson et al. 1994). The GNB genes have a beta propeller structure that is built up by seven WD40 repeats (Cabrera- Vera 2003). The beta subunit gene family share very high sequence similarity, 80%-90%, between the GNB1-4 proteins. GNB5 is the most distantly related member of the family and shares only about 50% identity (Cabrera-Vera 2003). The GNB1-4 genes are expressed widely throughout an organism while GNB5 has been shown to be expressed only in the central nervous system (Yan et al. 1996).

4 Guanine nucleotide binding protein subunit gamma The GNB1-4 genes form a very tight complex with the last subunit member of the heterotrimeric G-protein, GNG. Also GNB5 have been shown to form complex with GNG but the affinity between GNB5 and GNG is lower (Wettschureck and Offermanns 2005). The GNG protein family is a large family with twelve members in the human genome (Wettschureck and Offermanns 2005), GNGT1, GNGT2, GNG2, GNG3, GNG4, GNG5, GNG7, GNG8, GNG10, GNG11, GNG12 and GNG13. The GNG genes encode short 68-70aa peptides. Studies on the interactions between the five GNB members and the various GNG subunits have revealed that GNB1 have its highest affinity towards GNGT1 and GNB3 have its highest affinity towards GNGT2 (Yan et al. 1996), this follows the notion that GNB1 and GNGT1 has been reported to be expressed exclusively in rods and GNB3 and GNGT2 exclusively in cones (Yan et al. 1996; Larhammar et al. 2009; Ritchey et al. 2010).

Whole Genome Duplication In the genomes of vertebrates one can see remnants of past duplication events in a common vertebrate ancestor. Susumu Ohno first proposed the theory of evolution by gene and genome duplications in the vertebrate lineage in the 1970s. He pointed out that for rapid evolution to take place a lot of new genomic raw material has to be generated in a short time (Panopoulou and Poustka 2005). Duplicating an organism’s genome can do this, resulting in new gene copies with relaxed selection pressure. Two whole genome duplications is believed to have occurred in a vertebrate ancestor and a third duplication in the teleost fish ancestor, named 1R, 2R and 3R respectively (first round 1R, second round 2R and third round 3R) (Dehal and Boore 2005; Sato and Nishida 2010).

The Hox gene clusters are clusters of genes involved in the morphological patterning of all bilaterians (Mallo et al. 2010). Studies of these genes suggested that the common ancestor of vertebrates underwent two rounds of whole genome duplications (Ohno 1999). This conclusion was based on that only one Hox gene cluster is present in most invertebrates compared to four in tetrapods (HoxA, HoxB, HoxC and HoxD) and seven to eight in teleost fish, as predicted by the 2R-3R hypothesis (Santini et al. 2009; Garcia-Fernàndez and Holland 1994; Chambers et al. 2009). The cephalochordate amphioxus (Branchiostoma floridae) has the same Hox gene cluster organization as vertebrates but as with invertebrates they only have one copy of the cluster (Garcia-Fernàndez and Holland 1994), this indicates that 1R and 2R occurred after the split from cephalochordates. The agnathans (jawless vertebrates), hagfish and lampreys, which are the closest extant relatives to the gnathostomes (jawed vertebrates) are a group of vertebrates to look at to help find the time point of the duplication events. The agnathans have at least three Hox gene clusters in their genome (Sharman and Holland 1998). This suggests a subsequent loss of duplicate in the agnathan lineage after two rounds of genome duplications, or it could be that the second round of duplication occurred after the divergence of agnathans and that the Hox gene cluster in agnathans have duplicated independently (Sharman and Holland 1998). More recent studies suggest the latter, that the Hox gene clusters have been duplicated independently in the lineages of gnathostomes and agnathans suggesting two Hox gene cluster in their common ancestor (Fried et al. 2003; Panopoulou and Poustka 2005). Incidentally the occurrences of four Hox gene clusters coincide with the appearance of the first jawed vertebrates (Ohno 1999) and this may have lead the way for the formation of a jaw. The sequencing of the elephant shark (Callorhinchus milii) genome revealed a set of four Hox gene clusters in cartilaginous fishes, which is an basal branch of the vertebrate lineage, further suggesting that the 2R events occurred before the emergence of jawed vertebrates (Venkatesh et al. 2007). These studies give a plausible

5 timeframe of when the two rounds of duplications occurred and would put the 1R just before and 2R after the agnathan/gnathostome split and an example of that new gene copies can give rise to new functions (Fig. 3).

Figure 3: Suggested time points of the major whole genome duplications in the vertebrate lineage. If the first two events occurred before and after the agnathan split from the other vertebrates is still debated. Illustration by David Lagman after (Panopoulou and Poustka 2005).

The four copies of the Hox gene clusters is just one example of two major duplication events and many other genes in the genomes of vertebrates show the same pattern of duplications like the neuropeptide Y (NPY) system (Larsson et al. 2008; Sundström et al. 2008a), the opioid system (Dreborg et al. 2008; Sundström et al. 2010), major histocompatibility complex (MHC) and fibroblast growth factor receptor (FGFR) genes (Panopoulou and Poustka 2005). Also extensive analyses using whole genome data from several species supports the 2R-3R hypothesis (Dehal and Boore 2005; Nakatani et al. 2007; Kasahara et al. 2007).

The mechanisms of tetraploidization of a genome can be varied. Often it is believed to be the result of autopolyploidy or allopolyploidy. Autopolyploidy is when duplication of the genome is taking place in one species due to problems during for example meiosis, which results in four copies of each allele other than the normal two (Larhammar and Risinger 1994; Spring 1997; Wolfe 2001). In allopolyploidy the genome is doubled due to a hybridization of two distinct species that may lead to a doubled genome when the chromosome count is different between the species involved (Larhammar and Risinger 1994; Spring 1997).

Studies of the genomes of vertebrates make it clear that they are of different sizes but the greatest variations in sequence length have been shown to mostly be in non-coding DNA. The genomes of human and fugu pufferfish, which differs greatly in overall size, contain about the same amount of coding genes (Ohno 1999). The 2R hypothesis proposes that invertebrate genes shall have four counterparts in vertebrates (i.e. orthologs), if no subsequent gene losses have occurred (Fig. 4)(Panopoulou and Poustka 2005). This is not the case, revealed as more and more genomes are sequenced. When the human genome project was finished the human genome was estimated to have around 25 000 genes which is not much more than the estimated 20 000 genes of invertebrates and it implies a huge loss of duplicated genes in vertebrates (Panopoulou and Poustka 2005). The standard response to genome duplication in a cell is to repair it, therefore the gene duplicates are often lost fast due to several mechanisms

6 such as deletions or formation of pseudo genes (Sankoff et al. 2010). Studies have shown that the average lifespan of a duplicate gene is about 4 million years, which may suggests that not all original duplicates are still around (Lynch and Conery 2003). A fraction of duplicated genes will be preserved through different mechanisms. New copies can maintain a similar function as the original gene (originalization) but also evolve a completely different function (neofunctionalization). In some cases the duplicated genes will share function of the ancestral gene (subfunctionalization). Neo- and subfunctionalized genes can be preserved for a long time, explaining the retention of certain duplicates, due to the selection working on such genes (Lynch and Conery 2003). It is believed that genome duplications can be correlated with species radiations (Van de Peer et al. 2009). The 3R event is one example that could be one of the major factors involved in the extensive radiation of the teleost lineage (Van de Peer et al. 2009; Santini et al. 2009).

Ancestral chromosome

Figure 4: The first two whole genome duplication events pictured by a single chromosome duplicating. Crossed over boxes represent gene duplicate losses and blue arrows indicate whole genome duplication events. Illustration by David Lagman. Whole genome duplications is today most common in plants where many species is polyploid i.e. have several copies of each chromosome (Van de Peer et al. 2009). In vertebrates, however, it is not as clear due to that most of today’s vertebrates are diploid i.e. have two copies of each chromosome (Van de Peer et al. 2009) often the result of a regression towards a diploid state after duplication. This is believed to happen because diversification of gene copies and their chromsomes over time makes them less similar to the other in the pair (Wolfe 2001). Examples of extant tetraploid vertebrates are the African clawed frog Xenopus laevis and common carp Cyprinus carpio (Larhammar and Risinger 1994).

Aims This degree project is a part of a more extensive project with the aim to sort out the evolution, expression patterns and possibly neo- or subfunctionalizations of the different components of the phototransduction cascade using bioinformatic tools and in situ hybridizations. The aim of this degree project is to sort out the evolution of the transducin alpha beta and gamma subunit genes using mainly bioinformatic tools but also some in situ hybridization.

7 Material and Methods

Zebrafish as a model In this study the experimental procedures on retinas have been performed on zebrafish (Danio rerio) retinas. Zebrafish is a good model animal due to its short generation time, small size and easy care and breeding. Due to its popularity as a model animal the genome of zebrafish is well studied and its genome is sequenced and assembled at 6,5 - 7x coverage (http://www.ensembl.org/Multi/blastview). Another reason for using zebrafish is that it is a teleost and thus may have more copies of photoransduction cascade component genes. This gives a possibility to see if genome duplications in the aspect of vision have given rise to neo- functionalizations in 3R copies.

Bioinformatic methods Peptide sequences of the transducin subunit families of different vertebrate species were collected from the Ensembl genome database (release 57, march 2010, http://www.ensembl.org/index.html) through their export FASTA file format function. If sequences were not annotated in Ensembl a known peptide sequence from closely related species was aligned to the deposited cDNA clones or the whole genome of the species of interest using BLAST (Basic Local Alignment Search Tool, http://blast.ncbi.nlm.nih.gov/Blast.cgi was used for cDNA clones and http://www.ensembl.org/Danio_rerio/blastview for the genomic blast) with the method tblastn. Species included in the study To give the broad picture of the evolution of the selected gene families, sequences from several extant vertebrate lineages were retrieved and analyzed. Grey short-tailed opossum (Monodelphis domestica), mouse (Mus musculus) and human (Homo sapiens) sequences were representing mammals and chicken (Gallus gallus) from birds. From the fish lineage a cartilaginous fish, the elephant shark (Callorhinchus milii), and four teleost species; zebrafish (Danio rerio), Medaka (Oryzias latipes), green spotten pufferfish (Tetraodon nigroviridis), three-spined stickleback (Gasterosteus aculeatus), was used. Sequences from interesting species in an evolutionary perspective, like the cyclostome sea lamprey (Petromyzon marinus), due to their early branching from other vertebrates was used as well. As representatives from species diverging before the 2R, sea squirts (Ciona intestinalis and Ciona savignyi) and amphioxus (Brachiostoma floridae) were used from the chordate branch and fruit fly (Drosophila melanogaster) and purple sea urchin (Strongylocentrotus purpuratus) were used from the non-chordate invertebrates.

Analysis of conserved synteny Conserved synteny was analyzed by retrieving of lists with gene family id, position and protein family description of genes located within a region of 5Mb upstream and 5Mb downstream of the GNA and GNB genes. This was done using Ensembl’s BioMart function: in chicken, human and zebrafish. For the GNA family, human GNA genes were used and protein families that had representatives on at least two human chromosomes were analyzed. Families that had representatives on at least two chicken chromosomes and on at least two chromosomes in human and zebrafish were used in the analysis regarding the GNB family.

The protein sequences of the family members of the neighbouring gene families were retrieved and aligned for a Neighbour-Joining (NJ) phylogenetic tree construction. Trees were

8 manually inspected to see if they seemed to have expanded during the two rounds of genome duplications using relative dating, as seem to be the case with the GNB and GNAI gene families. Phylogenetic analyses of gene families Retrieved sequences were aligned using ClustalW Multiple Sequence Alignment and manually edited with Jalview 2.5 version 10.0 (Waterhouse et al. 2009). Sequences were edited by taking into consideration of conserved stretches of sequences, and conserved domains of the proteins, like the beta propeller of the GNB genes. From the alignments Neighbor-Joining trees were calculated using ClustalX 2.0.12 (Larkin et al. 2007) with bootstrap-iterations set to 1000 using other settings as standard. Trees were visualized using FigTree v1.3.1. available online at http://tree.bio.ed.ac.uk/software/figtree/.

To test if the same result would be obtained using other methods for calculating phylogenetic trees, the alignments GNA and GNB were saved in PHYLIP format using ClustalX. The PHYLIP file was used to calculate the best amino acid substitution model using ProtTest 2.4 (Abascal et al. 2005) available free on http://darwin.uvigo.es/software/prottest.html. The PHYLIP file was then uploaded on the PhyML 3.0 (Guindon and Gascuel 2003) web server (http://atgc.lirmm.fr/phyml/) to calculate a Maximum-Likelihood tree for the alignments using the amino acid substitution model suggested by ProtTest. The settings used were, JTT as substitution model for the GNA alignments and LG for the GNB alignments. JTT and LG are two different models used to calculate the substitution of amino acids. Equilibrium frequencies were set to “empirical”, proportion of invariable sites was set to “estimated” and 0,0. Eight substitution rate categories were used and gamma shape parameter was set to “estimated”. SPR was used for tree improvement. The remaining settings were used as standard in the program. Bootstrap was used as branch support instead of aLTR and 100 bootstrap iterations was used. Hundred iterations was used because of 1000 would have increased the calculation time too much even though 1000 bootstrap-iterations was used when building the N-J trees.

Molecular methods Tissue preparation Adult zebrafish were anaesthetized in water containing benzocaine and sacrificed by removing the head from the body. The lower jaw and gill covers were removed and the heads were placed in 4% paraformaldehyde for 6-7 hours for fixation. Then washed in phosphate buffered saline (PBS) overnight to remove the fixative, placed in 10% sucrose solution for 30 minutes followed by 30% sucrose solution until the head sank to the bottom of the tube, indicating saturation in the tissue. Subsequently the head was placed in a mould, covered with Tissue-Tek® O.C.T (Sakura Finetek, Alphen aan den Rijn, The Netherlands) and frozen.

The heads were sectioned in 12-20 µm thick slices in a cryostat and placed on microscope slides. After sectioning the slides were left at room temperature for two hours to let the sections stick to the glass slide properly. Then they were stored at -80°C until use.

Probe design A ∼400bp part of the 3’ untranslated region (3’UTR) in the GNAT, GNB and GNGT genes was used to create ribo-probes for in situ hybridization on retinal sections. The 3’UTR was

9 used instead of the protein-coding region due to the high sequence similarity between the different protein family members, it is a measure to prevent cross hybridizations. For the GNGT2 gene however a 213bp part of the last exon and the 3’UTR was used instead because of the short 3’UTR in this gene. The sequences for the probes were amplified from genomic DNA except for GNGT2; in this case the probe sequence was amplified from complementary DNA (cDNA) instead.

RNA extraction cDNA needed for amplification of GNGT2 was synthesized from mRNA collected from zebrafish eye. RNA was extracted using Qiagen RNeasy® Mini kit (Qiagen AB, Sollentuna, Sweden) following the provided protocol. Eyes of zebrafish were placed in a tube containing RNAlater (100 µl/10 mg tissue). RNAlater was removed from the sample and 350 µl RLT buffer containing 1% beta-mercaptoethanol (14.3M, βME, for inhibition of ribo-nucleases) was added per tube. The samples were homogenized in a sonicator to disrupt cells. Samples were centrifuged for 3 minutes at maximum speed. The supernatants were transferred to a new tube and pellets were discarded. 350 µl of EtOH 70% per tube with supernatants was added. 700 µl of the solution was then added to a 2 ml spin column and centrifuged for 15 seconds at 8000 x g, flow-through was discarded. 700 µl of RW1 buffer was then added to the column and it was centrifuged again at 15 seconds and 8000 x g, flow through discarded. The column was then placed in a new tube and 500 µl of RPE was added to the column and centrifuged for 15 seconds at 8000 x g, flow-through was discarded. This step was repeated once more. At last the RNA was eluted from the column into a new tube by adding 50 µl of water to the column and then spin it down for 1 minute at 8000 x g. The amount and quality was then measured with a Nanodrop® ND-1000 spectrophotometer (NanoDrop products, 3411 Silverside Rd, Wilmington, DE 19810, USA).

PCR – Polymerase Chain Reaction The 3’UTR sequences were amplified with the designed primers (table 1) using these settings; initial denaturation 5 min 95°C, denaturation 30s 94°C, annealing 30s at different temperatures for each primer pair see table 1, elongation 1 min 72°C, 3’ extension 7 min 72°C and then down to 4°C.

Table 1: Primer pairs used and annealing temperature used in the amplification of 3’UTR regions.

Gene Forward 5'-3' Reverse 3'-5' Temperature (°C) gnat1 TGGCTGAATCAACAAAAC TCATCCACCTCACATAGACA 60 gnat2 GCCCCATCCCCACCTAA ATTGCGATCTGATTTCCCACTA 58 gnb1 GTGTGACCCTGTAAGAGAAAAC TCACAGGAGGGCGCATAAACATT 52 gnb3a TCAAAGAAATCACGCAATAACAGA GGCCCGAATAAGCAGAAGAA 62 gnb3b CTCCGGAAGACTGGCTGTT CTGTCTGGCATGTAAAAGT 58 gngt1 GACAGAAAATCCCCCAACAT TGAACAGCTAAATTACTCCACCAT 62 gngt2 AGCCTGTCTCTAAAACTG GTCTTCATGTACTAAAACTAA 57

PCR products were visualized on a 1% agarose gel with SYBR®safe (0,5X TBE buffer, 90V and 500 mA for 50 minutes) to determine if a region of correct size had been amplified.

10 Cloning PCR products were inserted into a pCR®II-TOPO® TA vector (Invitrogen, Carlsbad, CA) according to provided protocol. It is a linearised vector containing single 3’-thymidine overhangs, which are necessary to bind the PCR products 3’-adenine overhangs. Topoisomerase I is covalently bound to the vector and ligates the PCR product into the vector. The vector is constructed in such a way that the insert is placed inside the lacZ open reading frame. This region codes for the enzyme β-galactosidase. It cleaves the X-gal present on the agar plate into galactose and 5-bromo-4-chloro-3-hydroxyindole. The latter is then oxidized to 5,5'-dibromo-4,4'-dichloro-indigo, which colors the bacterial colonies blue. If the insert is successfully incorporated into the vector the colonies will not turn blue but stay white because of their inability to produce β-galactosidase. Non-transfected bacteria cannot survive on the plate because they are not ampicilin resistant. Ampicillin resistance gene is provided in the vector. This makes it possible to screen colonies containing the vector with insert for analysis.

The ligation of the vector and product was done by adding three units of PCR product, one unit of salt solution, one unit of water and one unit of pCR®II-TOPO® TA vector to a tube. The solution was mixed and incubated for five minutes at room temperature. The reaction mixture was then placed on ice until transformation into chemically competent TOP10 (Invitrogen, Carlsbad, CA) Escherichia coli cells, provided with the kit.

Transformation of vectors into chemically competent cells Two micro liters from each cloning reaction were added to one vial of One Shot® Chemically component TOP10 Escherichia coli bacteria. The cells were gently mixed with the vector and incubated on ice for 30 minutes. Following incubation, the cells were heat-chocked by incubation at 42°C for 30 seconds, followed by cooling on ice. S.O.C. medium was later added to the vials and they were incubated once more for 1 hour in a horizontal shaking incubator at 200 rpm and 37°C. After the incubation the cells were spread out on agar plates, containing 50 µg/ml ampicilin and 40 mg/ml X-gal. The plates were placed in 37°C over night. The following day, white and light blue colonies were collected and placed in glass tubes containing LB medium with 50 µg/ml ampicilin. The glass tubes were incubated in the shaking incubator at 37°C overnight. Sequencing of vectors Vectors were purified using Plasmid minikit I (Omega BIO-TEK, Beaver Ridge Circle Norcross, GA 30071, USA) following the protocol provided. It is a column-based kit where you first lyses the cells and remove proteins and then bind the plasmids to a spin- column. Then follows several washing steps with wash buffer. Finally the vectors were eluted ® in 50 µl dH2O and concentration and purity was measured using a Nanodrop spectrophotometer.

100 ng of the vector elute were transferred into tubes to a final volume of 15 µl. To each tube either M13 forward or M13 reverse primer were added. These were provided with the cloning kit (table 2).

Table 2: Sequencing primer sequences.

Primer Sequence M13 forward 5'-3' GTAAAACGACGGCCAG M13 reverse 5'-3' CAGGAAACAGCTATGAC

The tubes with vector and primers were sent to a company for sequencing. The sequencing results were received by email and analyzed for correct incorporation of PCR product into the vector.

Results

Bioinformatic results Guanine nucleotide binding protein subunit alpha The GNAI genes are represented by five genes in zebrafish and three-spined stickleback, four genes in medaka and three in green spotted pufferfish. All tetrapods in the study have three GNAI genes. Tetrapods have three GNAT genes, GNAT1-3, while teleost fish seem to have lost one and have two, GNAT1-2. Two genes were found to have been cloned in sea lamprey (Petromyzon marinus) and two genes in this family could be indentified in both sea squirts and amphioxus and one could be found in fruit fly (Fig. 5 and 6).

Figure 5: NJ tree of the GNAI and GNAT genes. Numbers after gene name represent amino acid sequence length. Galpha Z and Galpa O have been used as outgroups since they are the closest relatives in the superfamily. Hsa = Homo sapiens, Mmu = Mus musculus, Mdo = Monodelphis domestica, Gga = Gallus gallus, Dre = Danio rerio, Tni = Tetraodon nigroviridis, Gac = Gasterosteus aculeatus, Ola = Oryzias latipes, Pma = Petromyzon marinus, Dme = Drosophila melanogaster, Cioin = Ciona intestinalis, Bfl = Branchiostoma floridae.

Figure 6: Maximum-Likelihood phylogenetic tree of the transducin alpha subunits and their closest relatives, G protein alpha inhibitory subunits. Galpha Z and Galpa O have been used as outgroups since they are the closest relatives in the superfamily. Branches with lower than 50 percent bootstrap support have been collapsed. Hsa = Homo sapiens, Mmu = Mus musculus, Mdo = Monodelphis domestica, Gga = Gallus gallus, Dre = Danio rerio, Tni = Tetraodon nigroviridis, Gac = Gasterosteus aculeatus, Ola = Oryzias latipes, Dme = Drosophila melanogaster, Cioin = Ciona intestinalis, Bfl = Branchiostoma floridae.

14 Evolution of neighbouring gene families of GNA Twelve gene families were identified as neighbours to GNAI and GNAT according to the search criteria and all but one seem to have expanded during 2R and later some of them in 3R (Fig. 7). The families identified are; CELSR, RHO, SEMA3, PTPN, PLASM (plasminogen precursor), CACNA2D, MAGI, PHTF, RSBN, RBM, SLC6A and PPM. The SLC6A gene family seem to be old and does not seem to have been duplicated in 2R and therefore was excluded from this study. The phylogenetic trees of the following gene families are presented in the appendix.

Figure 7: GNAT genes and their neighbours. Red box mark GNAI and GNAT genes. Single genes are located individually on different scaffolds or by itself on a chromosome. A) human chromosomes, B) medaka and C) zebrafish.

Ras homolog, ABC subfamily (RHO) RHOs are ras-like GTPases (like the alpha subunit of heterotrimeric G-proteins) that are molecular switches amplifying external signals. They play roles in for example the dynamics of the actin cytoskeleton (Boureux et al. 2007). The proteins in the RHO ABC subfamily are highly conserved; urochordate and mammalian sequences are very similar. The high sequence similarity makes it very hard to get a good phylogenetic signal and thus no tree is presented of this family. Therefore the chromosomal positions are more important to deduce their evolutionary history. In human and chicken there are three RHO genes (RHOA, RHOB and RHOC) and in teleosts there are more copies suggesting possible 3R duplicates.

Putative Homeodomain Transcription Factor (PHTF) The gene family encodes possible transcription factors that contain a homeodomain transcriptional regulator, it is a 60aa long sequence that recognizes specific DNA sequences to initiate and control transcription of certain genes (Manuel et al. 2000). The PHTF gene family have two copies in all vertebrates studied, which suggests an expansion in 2R and no further expansion in 3R. (Fig. 14)

Round Spermatid Basic 1 (RSBN) RSBN is a homeobox like protein belived to be involved in round spermatid maturation arrest (Takahashi et al. 2004). Human and chicken carry two copies of RSBN in their genomes while teleosts have three copies. This suggests a 2R expansion with subsequent loss of two copies and then a 3R expansion in teleosts of the RSBN1L gene. (Fig. 15)

RNA Binding Motif (RBM) RBM is a family of proteins that belong to the Spen superfamily of proteins, they bind to specific RNA sequences to repress many signalling pathways (Hiriart et al. 2005). The RBM gene family follow the same pattern as RSBN; human and chicken carry two genes RBM15 and RBM15B. Teleosts carry the same genes but do also carry a putative 3R copy of RBM15. (Fig. 16)

Semaphorin precursor (SEMA3) The SEMA3 peptides are involved in axonal guidance during nervous system development (Haupt et al. 2010). The SEMA3 family is a large family where the ancestor to all extant gnathostomes seems to have had sixteen members in its genome as a result of the 2R event. In today’s vertebrates eight of the members seem to have been lost so that the ancestor of vertebrates in the study had eight members of the family in its genome. Humans now carry six SEMA3 genes and chicken eight, in teleosts it varies a bit more. This teleost variation could possibly be attributed to genomic rearrangements and local duplications. In teleosts some of the SEMA3 genes seem to have been duplicated in the 3R event. (Fig. 17)

Protein Phosphatase Mg2+/Mn2+ dependent (PPM) PPM proteins are serine/threonine phosphatases that are monomeric and metal ion dependent, in this case by Mg2+ or Mn2+ (Sun et al. 2009). The PPM family of genes have three members in tetrapods and three members in teleosts, but all the genes are not orthologous. Tetrapods have three of the original genes that probably arose during 2R, teleosts seem to have lost one of these genes but seem to have a 3R duplicate of one of the two original genes on the other hand. Tetrapods have PPM1M, PPM1J and PPM1H while teleosts have PPM1J and two PPM1H genes. (Fig. 18)

Membrane Associated Guanylate Kinase, WW and PDZ domain containing (MAGI) The MAGI gene family consists of synaptic scaffolding proteins that interact with the other proteins of the postsynaptic density (PSD) (Yamagata and Sanes 2010). The MAGI gene family have three members in human located on the three GNAT and GNAI bearing chromosomes, chicken does also have three MAGI genes. Teleost fish have four different MAGI genes MAGI1-3 and MAGIX. The MAGI 1-3 genes seem all to have been duplicated in 3R as well. The MAGI gene family thus seem to have followed a 2R and later in teleosts 3R duplication pattern. (Fig. 19)

Cadherin, EGF LAG Seven-pass G-type Receptor (CELSR) The members of the CELSR gene family are cadherins mediating the contact between neuronal cells during their migration in development and thus guiding them to the correct spot in the nervous system (Qu et al. 2010). The CELSR gene family have three members in humans, CELSR1-3, and four in zebrafish, CELSR1a, CELSR1b and CELSR2-3. This suggests an expansion in 2R and later a possible expansion of CELSR1b in 3R, but of the teleosts studied only zebrafish has these two copies in their genome. Chicken has only one CELSR gene suggesting a loss of all but flamingo 1, as the copy is called. (Fig. 20)

Protein Tyrosine Phosphatases Non-receptor type (PTPN) This is a family of genes regulate sgnaltransduction pathways by dephosophorylating tyrosine residues in proteins involved in various signalling pathways in the cell (Gandhi et al. 2005). The evolutionary history of the PTPN gene family is not as clear as the other gene families studied. Two major possibilities are considered, the first is that the family expanded during 2R, which resulted in today’s three mammalian copies. The second possibility is that there were two original genes and that one of them was duplicated during 2R. The latter scenario is supported by the placement of the sea squirt and C. elegans orthologs, which separates PTPN22 and PTPN12 from PTPN18. This is the reason for presenting the family tree as unrooted. (Fig. 21)

Voltage dependent calcium channel subunit alpha-2/delta (CACNA2D) Is the family of the alpha-2/delta subunit in the voltage dependant calcium channel (L-type calcium channel, LTCC)(Burashnikov et al. 2010). The CACNA2D family divides itself into two major branches separated by orthologs in invertebrates. Both of these two branches appear to have expanded in 2R and yielded two human genes on each branch i.e. four copies in total. The number of genes varies in teleost fish. One of the genes CACNA2D3 seem to have been duplicated in 3R. (Fig. 22)

Plasminogen precursor (PLASM) Plasminogen is a zymogen (enzyme precursor) involved in dissolving blood cloths (Forsgren et al. 1987). Four genes represent this protein family in human, three in opossum and chicken and around four in teleost fish. In sea squirts one can find three genes in this family, however the protein sequences are very short and thus increases the insecurity of their relation to each other. The sea squirt genes are placed on different contigs, which could mean that they are parts of the same gene. There are two major possibilities on the evolution of this protein family. The first is that the family expanded in 2R with a loss of one gene, and then one of the genes (HGF) was duplicated in 3R. The other possibility is an original set of two genes in the vertebrate ancestor of whom one was duplicated in 2R and later 3R. (Fig. 23)

Guanine nucleotide binding protein subunit beta In the GNB subunit gene family five members were identified in mammals and birds, eight in zebrafish, six in three-spined stickleback and green spotted pufferfish, five in medaka and one in elephant shark. In the invertebrates studied one gene was found in sea squirts, amphioxus, purple sea urchin and fruit fly (Fig. 8 and 9).

Figure 8: Neighbor-joining tree of all GNB genes. GNB5 have been used as outgroup as it is the closest relative of GNB1-4. Hsa = Homo sapiens, Mmu = Mus musculus, Mdo = Monodelphis domestica, Gga = Gallus gallus, Dre = Danio rerio, Tni = Tetraodon nigroviridis, Gac = Gasterosteus aculeatus, Ola = Oryzias latipes, Cmi = Callorhinchus milii, Dme = Drosophila melanogaster, Csa = Ciona savignyi, Cin = Ciona intestinalis, Bfl = Branchiostoma floridae, Spu = Strongylocentrotus purpuratus.

Figure 9: Maximum-likelihood phylogenetic tree of the GNB genes. GNB5 have been used as outgroup as it is the closest relative of GNB1-4. Branches with lower than 50 percent bootstrap support have been collapsed. Hsa = Homo sapiens, Mmu = Mus musculus, Mdo = Monodelphis domestica, Gga = Gallus gallus, Dre = Danio rerio, Tni = Tetraodon nigroviridis, Gac = Gasterosteus aculeatus, Ola = Oryzias latipes, Cmi = Callorhinchus milii, Dme = Drosophila melanogaster, Csa = Ciona savignyi, Cin = Ciona intestinalis, Bfl = Branchiostoma floridae, Spu = Strongylocentrotus purpuratus.

Evolution of neighbouring gene families of GNB Seven gene families were identified as neighbouring gene families to GNB according to the search criteria mentioned in materials an methods; SCNN, IFFO, CHD, DVL, MFN, PEX and USP (figure 9). All but SCNN (Fig. 30) and PEX (Fig. 29) seem to have expanded during the two rounds of whole genome duplications. SCNN seems to have expanded after the tetrapod- teleost split due to its presence only in tetrapod genomes. PEX is a gene family present on

20 some of the GNB-bearing chromosomes but its phylogeny suggests an old pair that has not expanded during 2R, mostly due to the orthologs in invertebrates that split PEX5 and PEX5L from each other. The phylogenetic trees of the following gene families are presented in appendix.

Figure 10: GNB genes and their neighbours on GNB bearing chromosomes. Red box mark GNB1-4 genes. A) human chromosomes, B) chicken and C) zebrafish.

21 Chromodomain Helicase DNA binding protein 3-5 (CHD) The CHD3-5 gene subfamily are involved in chromatin remodelling during various cell processes such as recombination and transcription (Marfella and Imbalzano 2007). The family has three members in human, two in chicken and four in medaka. The phylogenetic tree of the gene family suggests expansion during 2R and later 3R (one of the members namely CHD4 seem to have been duplicated in 3R). The zebrafish CHD4 seem to have been duplicated one more time and has a copy located on chromosome 15. If this copy is non-functional or not is not known as an inversion of half the gene seem to have occurred and thus could have rendered it non-functional. (Fig. 24)

Ubiquitin Specific Peptidase (USP) The USP5 and USP13 genes in the USP gene family hydrolyzes isopeptide bonds between ubiquitin molecules in a larger unanchored polyubiquitin molecule and thus disassembles unused polyubiquitins (Reyes-Turcu et al. 2008). The family follows a 2R duplication pattern with two copies present in all vertebrate genomes studied. In some genomes there seem to have occurred some local duplications as can be seen in zebrafish for USP13 and green spotted pufferfish with USP5. Due to that it is not the same gene subjected to local duplication it does not seem to be related events and they probably duplicated in the two lineages independently. In the beginning it was probably an ancestral copy of USP that was duplicated in 2R and two of the 2R copies were lost and that leaves it with today’s two copies. (Fig. 25)

Dishevelled (DVL) The DVL genes have been shown to interact with several different proteins to regulate, organize and amplify intracellular signals (Wharton 2003). The family have three copies in human, two in chicken and between four and five in teleosts; five members in zebrafish and four in the other three species included in the study. The phylogenetic tree suggests an expansion of the family during 2R followed by a duplication of DVL3 in teleosts in 3R. (Fig. 26)

Intermediate Filament Family Orphan (IFFO) Intermediate filaments are important components of the cells skeleton and nuclear envelope of eukaryotic cells (Steinert and Roop 1988). The IFFO gene subfamily is present in two copies in human and chicken. Teleosts have a varying amount of IFFO genes in their genomes (Appendix). Zebrafish have four copies located on four different chromosomes, namely 16, 19, 11 and 23, tetraodon have three IFFO genes located on two chromosomes suggesting a local duplicate of IFFO2. In medaka there are three IFFO genes present on three chromosomes; 1, 16 and 11. The zebrafish IFFO located on chromosome 19 and the medaka IFFO located on chromosome 16 share chromosome with an GNB3a each. These IFFO are called IFFO1 and can in both species also be found on the same chromosome as GNB3b, zebrafish 19 and medaka 11. This suggests a 3R duplication of IFFO1 in the teleosts according to chromososmal posistions but also if one look at the NJ tree of IFFO. (Fig. 27)

Mitofusin (MFN) Mitofusins are involved in fusion of mitochondria and are located on their outer membrane (Santel and Fuller 2001; Gegg et al. 2010). The MFN gene family have two copies in human and chicken, and three copies in all fish but tetraodon, which have two copies. The family thus seem to have expanded during 2R then lost two of the original copies. The presence of an extra copy in zebrafish, medaka and three spined stickleback suggests an extra duplication of MFN1 in 3R. (Fig. 28)

Guanine nucleotide binding protein subunit gamma Twelve members of the GNG gene family were identified in mammals, eleven in birds and twelve in zebrafish. In the invertebrates two GNG genes could be identified in sea squirts, three in amphioxus and two in purple sea urchin. However the amino acid sequences are too short (68-70aa) to make a reliable phylogenetic tree, therefore the chromosomal positions was also analyzed.

The GNG genes cluster into four branches according to their chromosomal positions marked with a separate colour for each branch (figure 10).

Figure 11: N-J tree of the GNG alignments showing the four major branches within the GNG family. The GNGT1, GNG11 and GNGT2 cluster together in one branch. GNGT1 and GNGT2 is the two involved in the signal transduction cascade in the eye. The other three branches contain genes involved in other intracellular signal transduction cascades. The different colour of the branches represents the four major groups. Hsa = Homo sapiens, Mmu = Mus musculus, Mdo = Monodelphis domestica, Gga = Gallus gallus, Dre = Danio rerio, Tni = Tetraodon nigroviridis, Gac = Gasterosteus aculeatus, Ola = Oryzias latipes, Elu = Esox lucius, Ciona = Ciona intestinalis, Bfl = Branchiostoma floridae, Spu = Strongylocentrotus purpuratus.

23 Molecular results The 3’UTR of GNA, GNB and GNG genes were successfully cloned into the vectors and sequenced. This region was used because of the high sequence similarity of the coding region between the subunit genes within each family. All purified vectors contained the correct insert. An in situ hybridization had been finished at the time of writing this report. The probe used in this experiment was the GNAT1 3’UTR probe and it shows an expression in cells of the outer nuclear layer, inner nuclear layer and some cells at the surface of the retina (figure 11). This suggests expression of GNAT1 in photoreceptors but as only one probe is used we cannot tell whether it is expressed in rods or cones or both.

ONL

INL

Figure 12: in situ hybridization using GNAT1 3'utr riboprobe. Showing expression of GNAT1 in the outer nuclear layer (ONL) and inner nuclear layer (INL)

Discussion

Evolution The three GNAT and three GNAI genes seem to have expanded before the emergence of vertebrates. In the NJ tree (Fig. 5) of the GNAI and GNAT gene family one can see that they are separated by putative orthologs in invertebrates (sea squirts and amphioxus) suggesting an ancient duplication that lead to the vertebrate ancestral pair. Thus the GNAT and GNAI genes were likely present in the vertebrate ancestor (Fig. 5). Teleosts, such as zebrafish, have duplicate GNAI2 genes, GNAI2 and GNAI2L. These copies are located on different chromosomes and seem to be the result of the 3R duplication. No 3R copies of the GNAT genes have been retained. Two genes in the family have been cloned in sea lamprey, GNATS and GNATL. These cluster with GNAT1 in the NJ tree (Fig. 5). The topology of the NJ tree is supported by the maximum likelihood (ML) analysis of the same gene family in that it shows two clear clusters: GNAI-GNAI2-GNAI3 and GNAT1-GNAT2-GNAT3 (Fig. 6). However there is not bootstrap support within each cluster to resolve the relationships between the genes, except to suggest the duplication of an ancestral gene that lead to the formation of GNAI3 and GNAI1. In this case the chromosomal locations of the genes in question could help resolve the evolution of the gene family. The GNAT genes are located on three different chromosomes and next to each one of the three copies there is a GNAI located. This suggests that an ancestral pair of GNA genes duplicated during 2R as mentioned above to give eight copies. Later one of the 2R copies of both genes was lost and today’s six copies were retained. Then one of the GNAT genes, namely GNAT3, was lost in the teleost fish lineage. The teleost genes named GNAT3, as one can see in the phylogenetic trees (Fig. 5 and 6), cluster with the zebrafish and tetrapod GNAT2 genes, thus I propose a renaming of these to

24 GNAT2. All neighbouring gene families studied seem to have expanded in 2R and show the same duplication pattern as the GNAT and GNAI genes, which support this scenario. In tetrapods these chromosomal regions show conserved synteny (Fig. 7). However in teleost fishes the gene family members are spread out on several chromosomes suggesting extensive chromosomal rearrangement in this region in the teleost lineage (Fig. 7).

The sequence alignments and phylogenetic analyses of the beta subunits suggest two ancestral genes before the emergence of vertebrates, out of which one subsequently quadrupled in 1R and 2R and duplicated in 3R. This resulted in five genes in humans and eight genes in zebrafish, for example. GNB1 has undergone local duplication in zebrafish giving GNB1 and GNB1L. The chromosome locations of these genes support this scenario. As visible from the NJ tree (Fig. 8), GNB5 have two putative orthologs in sea squirts and fruit fly suggest an origin before the protostome-deuterostome split. The GNB1-4 genes are more closely related to one another and seem to share putative orthologs in several invertebrates suggesting 2R expansion. However in phylogenetic analyses including sea squirts, purple sea urchin and amphioxus putative orthologs for GNB, the GNB3 genes place themselves before the split between vertebrates and invertebrates (Fig. 8). This may be explained by the relatively rapid evolutionary rate that the GNB3 genes have been subjected to as seen in figure 5 where branch length represents evolutionary distance. An alternative scenario is that they diverged before the emergence of vertebrates. The ML tree displays a similar picture but there is not enough bootstrap support to resolve the orthology relationships to the putative invertebrate orthologs of GNB1-4 (Fig. 9). To resolve this one must look at the chromosomal positions of the GNB1-4 genes. Analysis of the chromosomal positions and phylogenies of neighbouring gene families to the GNB subunits proposes a common origin of the GNB1-4 genes and that they have expanded in 2R. All the studied neighbouring gene families follow the same duplication pattern as GNB1-4 and in tetrapods the chromosomal regions seem to show conserved synteny (Fig. 10). Neighbouring gene families have members on all GNB bearing chromosomes. This is in line with what Larhammar et al. (2009) propose as well, and thus the GNB1-4 genes seem to originate from the same ancestral chromosome (Larhammar et al. 2009). The GNB5 genes seem to have a pre-vertebrate origin. This supports the hypothesis of an ancestral vertebrate set of two GNB genes, out of which GNB1-4 diverged in the two early vertebrate duplication events, and later in 3R in teleosts.

The GNG subunit is made up of on average 70 amino acids. This does not provide enough information in the sequence alignment to provide reliable phylogenetic signal. Thus it is not possible to draw good conclusions on the interrelationships between the different family members from a phylogenetic analysis. A crude classification into different groups is however possible (Fig. 11). The family members suggested to be expressed in the retina (GNGT1 and GNGT2) cluster together in the tree, which suggests that they are close relatives. This cluster also includes the GNG11 gene. This gene is believed to have arisen in mammals as a local duplication of the GNGT1 gene (Larhammar et al. 2009). One chicken gene clusters with the mammalian GNG11 genes. This could either mean that the GNG11 did not arise in a mammalian ancestor but actually arose before the emergence of amniotes. Another explanation could be that due to the short length of the sequence small amino acid substitutions have made this GNGT1 sequence more similar to GNG11 than the other GNGT1. In the group with GNG7 and GNG12 it is possible to identify two representatives of one gene, in zebrafish and northern pike. This gene is called GNG12L and could be an example of one 3R duplicate that has been lost in most teleosts but has been retained in zebrafish and northern pike. This is supported by the fact that GNG12 and GNG12L in zebrafish are located on different chromosomes.

Analyzing the chromosome positions of the gamma subunits shed more light on the origins. It appears that the subunits originate from four separate branches present before the emergence of vertebrates. The first cluster contains the GNG2, 3, 4 and 8, located in regions on chromosomes 14, 11, 1 and 19. These chromosome regions seem to originate from the same ancestral chromosome. The reconstruction of linkage between the amphioxus and human genomes supports this (Putnam et al. 2008). The bioinformatic reconstruction of the vertebrate ancestral karyotype does as well (Nakatani et al. 2007). The next cluster contains GNG5, 7, 10 and 12, located in regions on human chromosomes 1, 19, 9 and 1 that seem to originate from the same ancestral linkage group as well. GNG13 genes form a cluster and also seem to originate from a common ancestral linkage group. The last cluster of gamma subunits contains GNGT1, GNGT2 and GNG11, members involved in the visual pathways. The GNGT1 and GNGT2 genes are located in the same chromosomal regions as the Hox gene clusters. These chromosomes have previously been reported to have duplicated in 2R (Sundström et al. 2008b). This division of the family into four separate branches from four different ancestral vertebrate linkage groups suggest an old protein family with at least four original members that have later been duplicated in 2R. Some genes in the different branches of the family seem to have been duplicated in 3R, but not the GNGT genes that are involved in the phototransduction cascade.

Expression The expression studies of the different subunits in the retina are still ongoing at the time of writing this report and promise to produce interesting results. Previous studies in the field have been done using mostly immunohistochemistry. Nelson et al. (2008) however used in situ hybridizations on zebrafish retinas and showed a co-expression of rod opsin marker and GNAT1, which implies that rods use GNAT1 as their alpha subunit (Nelson et al. 2008). They also looked at a marker for cones (rx1) and GNAT2, which showed co-expression, suggesting GNAT2 as the cone alpha subunit (Nelson et al. 2008). Expression analysis of the alpha subunit in lampreys has also been done. Lampreys, which belong to the agnathans, diverged early in vertebrate evolution, which makes it of special interest to study which GNAT they use in their photoreceptors. The phylogenetic analyses of GNAT subunits place the putative lamprey orthologs at the base of the vertebrate branch of the GNAT1 subunit (figure 4). This would suggest that both GNAT subunits present in lampreys are GNAT1 orthologs and that a GNAT2 ortholog may have been lost. Lampreys possess two types of photoreceptors, the long and short photoreceptors. The specific identity of short and long photoreceptors in lamprey has long been debated (Walls 1935; Dickson and Graves 1979). Recent data suggest that long photoreceptors are cones and short photoreceptors are rod photoreceptors with several cone-like features (Govardovskii and Lychakov 1984; Muradov et al. 2008). The view that short photoreceptors are rods is supported by the expression of GNATS, which clusters with the rod transducin GNAT1 in the phylogenetic tree (figure 4), and that they express rhodopsin (Muradov et al. 2008). However long photoreceptors express long wavelength sensitive opsins (LWS) and appear in other ways to be cones, but also express GNATL, which diverges basally on the GNAT1 branch (figure 4) (Muradov et al. 2008). The GNATL expression in LWS expressing long photoreceptors suggest that GNATL is more of a cone GNAT even thought it is not in the GNAT2 cluster. This suggests independent evolution of the two genes in the lineage leading to lampreys. To further study this GNATS and GNATL have to be included in a ML analysis, which was not finished at the writing of this report.

26 Using immunohistochemostry on cryosections from macaque retina, Peng et al. (1992) suggested that GNB1 is expressed in rods and GNB3 in cones. They also suggest expression of GNGT1 in rods and GNGT2 in cones by using the same method. However, another study suggests co-expression of GNB1 and GNB2 in both rods and cones in chicken, guinea pig (Cavia porcellus), goldfish (Crassius carassius auratus) and frog (Xenopus (Silurana) tropicalis) retinas (Ritchey et al. 2010) even thought they mention that the antibody may lack specificity. The sequence similarity between the members in the GNAT1-3 family and the members in the GNB1-4 family is very high and an antibody against one member may crossreact to another. Chen et al. (2007) shed more light on the tissue specificity of GNGT1. They used in situ hybridizations on GNGT1 and rhodopsin and found co-expression in the rods supporting the results of Peng et al. (1992). Studies have shown that GNGT1 has to be used in the GNA-GNB-GNG-complex in order to achieve binding to the rhodopsin, lending further support to the use of GNGT1 in rods (Kisselev and Gautam 1993). A study on bovine retinas supports the theory that GNGT2 and GNB3 are used in cones by purifying the G-beta gamma complex from the retina using a separation technique and immunohistochemistry on retinal sections (Ong et al. 1995).

Conclusions Phylogenies of the transducin subunits, their chromosomal positions and the phylogenies of their neighbouring gene families support the hypothesis that transducin components expanded during the whole genome duplication events in the vertebrate lineage (Fig. 13). GNAT1, GNAT2 and GNAT3 together with their neighbours GNAI1, GNAI2 and GNAI3 seem to have undergone duplications through the 2R event, with the subsequent loss of one GNAT and GNAI duplicate before the actinopterygian-sarcopterygian split. GNAT3 was subsequently lost in the teleost lineage. GNB1-4 seems to have originated from one of two ancestral GNB genes. The GNB1-4 genes expanded in 2R, followed by a 3R duplication of GNB3, a possible 3R duplication of GNB4 (seen only in zebrafish) and a local duplication of GNB1 in zebrafish. GNGT1 and GNGT2 seem to be the result of 2R, based on their chromosomal position on Hox bearing chromosomes.

Figure 13: Deduced evolutionary history of the transducin subunit genes after the invertebrate-vertebrate split. The mouse represents mammals and zebrafish teleosts. A) GNAT, B) GNB and C) GNGT.

This implies that if the expression data available on subunit distribution in the retina is correct the expansion of these gene families have contributed with genetic raw material for the evolution of complex vision in modern vertebrates. The next step is to test this by performing in situ hybridization experiments on zebrafish retinas using specific probes targeting each of the different subunit mRNAs.

Acknowledgements First I would like to thank Dan Larhammar for giving me this opportunity to start on this very interesting project. Thanks go to Christina, Chus, Daniel and Görel for answering all of my many questions and helping me whenever I didn’t know what to do. I would also like to thank all the other people in the lab for good company during lunch and fika.

References

Abascal F, Zardoya R, and Posada D. 2005. ProtTest: selection of best-fit models of protein evolution. Bioinformatics (Oxford, England). 21: 2104-2105. doi:10.1093/bioinformatics/bti263. Birnbaumer L. 2007. Expansion of signal transduction by G proteins. The second 15 years or so: from 3 to 16 alpha subunits plus betagamma dimers. Biochimica et biophysica acta. 1768: 772-793. doi:10.1016/j.bbamem.2006.12.002. Boureux A, Vignal E, Faure S, and Fort P. 2007. Evolution of the Rho family of ras-like GTPases in eukaryotes. Molecular biology and evolution. 24: 203-216. doi:10.1093/molbev/msl145. Burashnikov E, Pfeiffer R, Barajas-Martinez H, Delpón E, Hu D, Desai M, Borggrefe M, Häissaguerre M, Kanter R, Pollevick GD, Guerchicoff A, Laiño R, Marieb M, Nademanee K, Nam GB, Robles R, Schimpf R, Stapleton DH, Viskin S, Winters S, Wolpert C, Zimmern S, Veltmann C, Antzelevitch C. 2010. Mutations in the Cardiac L- type Calcium Channel Associated with Inherited J Wave Syndromes and Sudden Cardiac Death. Heart Rhythm. doi:10.1016/j.hrthm.2010.08.026. Cabrera-Vera TM, Vanhauwe J, Thomas TO, Medkova M, Preininger A, Mazzoni MR and Hamm HE. 2003. Insights into G Protein Structure, Function, and Regulation. Endocrine Reviews. 24: 765-781. doi:10.1210/er.2000-0026. Chambers KE, McDaniell R, Raincrow JD, Deshmukh M, Stadler PF, and Chiu C. 2009. Hox cluster duplication in the basal teleost Hiodon alosoides (Osteoglossomorpha). Theory in biosciences = Theorie in den Biowissenschaften. 128: 109-120. doi:10.1007/s12064-009- 0056-1. Chen CK. 2005. The vertebrate phototransduction cascade: amplification and termination mechanisms. Reviews of Physiology, Biochemistry and Pharmacology. 154: 101-121. doi:10.1007/s10254-005-0004-5. Chen H, Leung T, Giger KE, Stauver AM, Humbert JE, Sinha S, Horstick EJ, Hansen CA, and Robishaw JD. 2007. Expression of the G protein T1 subunit during zebraWsh development. Gene. 7: 574-583. doi:10.1016/j.modgep.2007.01.003. Dehal P, and Boore JL. 2005. Two Rounds of Whole Genome Duplication in the Ancestral Vertebrate. PLOS Biology. 3: e314. doi:10.1371/journal.pbio.0030314. Dickson DH, and Graves DA. 1979. Fine structure of the lamprey photoreceptors and retinal pigment epithelium (Petromyzon marinus L.). Experimental eye research. 29: 45-60. Dreborg S, Sundström G, Larsson TA, and Larhammar D. 2008. Evolution of vertebrate opioid receptors. Proceedings of the National Academy of Sciences of the United States of America. 105: 15487-15492. doi:10.1073/pnas.0805590105. Forsgren M, Råden B, Israelsson M, Larsson K, and Hedén LO. 1987. Molecular cloning and characterization of a full-length cDNA clone for human plasminogen. FEBS letters. 213: 254-260. Fried C, Prohaska SJ, and Stadler PF. 2003. Independent Hox-cluster duplications in lampreys. Journal of experimental zoology. Part B, Molecular and developmental evolution. 299: 18-25. doi:10.1002/jez.b.37. Gandhi TKB, Chandran S, Peri S, Saravana R, Amanchy, Keshava Prasad TS, and Pandey A. 2005. A bioinformatics analysis of protein tyrosine phosphatases in humans. DNA research. 12: 79-89. doi:10.1093/dnares/12.2.79. Garcia-Fernàndez J, and Holland PWH. 1994. Archetypal organization of the amphioxus Hox gene cluster. Nature. 370: 563-566. doi:10.1038/370563a0.

30 Gegg ME, Cooper JM, Chau K-Y, Rojo M, Schapira AHV, and Taanman J-W. 2010. Mitofusin-1 and Mitofusin-2 are ubiquitinated in a PINK1/parkin dependent manner upon induction of mitophagy. Human molecular genetics. doi:10.1093/hmg/ddq419. Govardovskii VI, and Lychakov DV. 1984. Visual cells and visual pigments of the lamprey,Lampetra fluviatilis. Journal of Comparative Physiology A. 154: 279-286. doi:10.1007/BF00604994. Guindon S, and Gascuel O. 2003. A Simple, Fast, and Accurate Algorithm to Estimate Large Phylogenies by Maximum Likelihood. Systematic Biology. 52: 696-704. doi:10.1080/10635150390235520. Haupt C, Kloos K, Faus-Kessler T, and Huber AB. 2010. Semaphorin 3A-Neuropilin-1 signaling regulates peripheral axon fasciculation and pathfinding but not developmental cell death patterns. The European journal of neuroscience. 31: 1164-1172. doi:10.1111/j.1460-9568.2010.07154.x. Hiriart E, Gruffat H, Buisson M, Mikaelian I, Keppler S, Meresse P, Mercher T, Bernard OA, Sergeant A, and Manet E. 2005. Interaction of the Epstein-Barr virus mRNA export factor EB2 with human Spen proteins SHARP, OTT1, and a novel member of the family, OTT3, links Spen proteins with splicing regulation and mRNA export. The Journal of biological chemistry. 280: 36935-36945. doi:10.1074/jbc.M501725200. Kasahara M, Naruse K, Sasaki S, Nakatani Y, Qu W, Ahsan B, Yamada T, Nagayasu Y, Doi K, Kasai Y, Jindo T, Kobayashi D, Shimada A, Toyoda A, Kuroki Y, Fujiyama A, Sasaki T, Shimizu A, Asakawa S, Shimizu N, Hashimoto S-I, Yang J, Lee Y, Matsushima K, Sugano S, Sakaizumi M, Narita T, Ohishi K, Haga S, Ohta F, Nomoto H, Nogata K, Morishita T, Endo T, Shin-I T, Takeda H, Morishita S, and Kohara Y. 2007. The medaka draft genome and insights into vertebrate genome evolution. Nature. 447: 714-719. doi:10.1038/nature05846. Kisselev O, and Gautam N. 1993. Specific interaction with rhodopsin is dependent on the gamma subunit type in a G protein. The Journal of biological chemistry. 268: 24519- 24522. Lamb TD. 2009. Evolution of vertebrate retinal photoreception. Philosophical transactions of the Royal Society of London. Series B, Biological sciences. 364: 2911-2924. doi:10.1098/rstb.2009.0102. Lania A, and Spada A. 2009. G-protein and signalling in pituitary tumours. Hormone research. 71: 95-100. doi:10.1159/000192446. Larhammar D, and Risinger C. 1994. Molecular genetic aspects of tetraploidy in the common carp Cyprinus carpio. Molecular phylogenetics and evolution. 3:59-68. doi:10.1006/mpev.1994.1007. Larhammar D, Nordström K, and Larsson TA. 2009. Evolution of vertebrate rod and cone phototransduction genes. Philosophical transactions of the Royal Society of London. Series B, Biological sciences. 364: 2867-2880. doi:10.1098/rstb.2009.0077. Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R, Thompson JD, Gibson TJ, and Higgins DG. 2007. Clustal W and Clustal X version 2.0. Bioinformatics (Oxford, England). 23: 2947-2948. doi:10.1093/bioinformatics/btm404. Larsson TA, Olsson F, Sundstrom G, Lundin L-G, Brenner S, Venkatesh B, and Larhammar D. 2008. Early vertebrate chromosome duplications and the evolution of the neuropeptide Y receptor gene regions. BMC evolutionary biology. 8. doi:10.1186/1471- 2148-8-184. Lynch M, and Conery JS. 2003. The evolutionary demography of duplicate genes. Journal of structural and functional genomics. 3: 35-44.

31 Mallo M, Wellik DM, and Deschamps J. 2010. Hox genes and regional patterning of the vertebrate body plan. Developmental biology. 344: 7-15. doi:10.1016/j.ydbio.2010.04.024. Manuel A, Beaupain D, Romeo PH, and Raich N. 2000. Molecular Characterization of a Novel Gene Family (PHTF ) Conserved from Drosophila to Mammals. Genomics. 64: 216–220. doi:10.1006/gen. Marfella CGA, and Imbalzano AN. 2007. The Chd family of chromatin remodelers. Mutation research. 618: 30-40. doi:10.1016/j.mrfmmm.2006.07.012. Muradov H, Kerov V, Boyd KK, and Artemyev NO. 2008. Unique transducins expressed in long and short photoreceptors of lamprey Petromyzon marinus. Vision research. 48: 2302-2308. doi:10.1016/j.visres.2008.07.006. Nakatani Y, Takeda H, Kohara Y, and Morishita S. 2007. Reconstruction of the vertebrate ancestral genome reveals dynamic genome reorganization in early vertebrates. Genome research. 17: 1254-1265. doi:10.1101/gr.6316407. Nelson SM, Frey RA, Wardwell SL, and Stenkamp DL. 2008. The developmental sequence of gene expression within the rod photoreceptor lineage in embryonic zebrafish. Developmental dynamics. 237: 2903-2917. doi:10.1002/dvdy.21721. Norum JH, Hart K, and Levy FO. 2003. Ras-dependent ERK activation by the human G(s)- coupled serotonin receptors 5-HT4(b) and 5-HT7(a). The Journal of biological chemistry. 278: 3098-3104. doi:10.1074/jbc.M206237200. Ohno S. 1999. Gene duplication and the uniqueness of vertebrate genomes circa 1970-1999. Seminars in cell & developmental biology. 10: 517-522. doi:10.1006/scdb.1999.0332. Oldham WM, and Hamm HE. 2006. Structural basis of function in heterotrimeric G proteins. Quarterly Reviews of Biophysics. 39: 117-166. Ong OC, Yamane HK, Phan KB, Fong HKW, Bok D, Lee RH, and Fung BKK. 1995. Molecular cloning and characterization of the G protein γ subunit of cone photoreceptors. Journal of Biological Chemistry. 270:8495-8500 Panopoulou G, and Poustka AJ. 2005. Timing and mechanism of ancient vertebrate genome duplications -- the adventure of a hypothesis. Trends in genetics : TIG. 21: 559-567. doi:10.1016/j.tig.2005.08.004. Peng YW, Robishaw JD, Levine MA, and Yau KW. 1992. Retinal rods and cones have distinct G protein beta and gamma subunits. Proceedings of the National Academy of Sciences of the United States of America. 89: 10882-10886. Putnam NH, Butts T, Ferrier DEK, Furlong RF, Hellsten U, Kawashima T, Robinson-Rechavi M, Shoguchi E, Terry A, Yu J-K, Benito-Gutiérrez E, Dubchak I, Garcia-Fernàndez J, Gibson-Brown JJ, Grigoriev IV, Horton AC, de Jong PJ, Jurka J, Kapitonov VV, Kohara Y, Kuroki Y, Lindquist E, Lucas S, Osoegawa K, Pennacchio LA, Salamov AA, Satou Y, Sauka-Spengler T, Schmutz J, Shin-I T, Toyoda A, Bronner-Fraser M, Fujiyama A, Holland LZ, Holland PWH, Satoh N, and Rokhsar DS. 2008. The amphioxus genome and the evolution of the chordate karyotype. Nature. 453: 1064-1071. doi:10.1038/nature06967. Qu Y, Glasco DM, Zhou L, Sawant A, Ravni A, Fritzsch B, Damrau C, Murdoch JN, Evans S, Pfaff SL, Formstone C, Goffinet AM, Chandrasekhar A, and Tissir F. 2010. Atypical cadherins Celsr1-3 differentially regulate migration of facial branchiomotor neurons in mice. The Journal of neuroscience : the official journal of the Society for Neuroscience 30: 9392-9401. doi:10.1523/JNEUROSCI.0124-10.2010. Reyes-Turcu FE, Shanks JR, Komander D, and Wilkinson KD. 2008. Recognition of polyubiquitin isoforms by the multiple ubiquitin binding modules of isopeptidase T. The Journal of biological chemistry 283:19581-19592. doi:10.1074/jbc.M800947200.

32 Ritchey ER, Bongini RE, Code KA, Zelinka C, Petersen-Jones S, and Fischer AJ. 2010. The pattern of expression of guanine nucleotide-binding protein beta3 (GNB3) in the retina is conserved across vertebrate species. Neuroscience. 169:1376-1391. doi:10.1016/j.neuroscience.2010.05.081. Sankoff D, Zheng C, and Zhu Q. 2010. The collapse of gene complement following whole genome duplication. BMC Genomics. 11. doi:10.1186/1471-2164-11-313. Santel A, and Fuller MT. 2001. Control of mitochondrial morphology by a human mitofusin. Journal of cell science. 114: 867-874. Santini F, Harmon LJ, Carnevale G, and Alfaro ME. 2009. Did genome duplication drive the origin of teleosts? A comparative study of diversification in ray-finned fishes. BMC evolutionary biology. 9. doi:10.1186/1471-2148-9-194. Sato Y, and Nishida M. 2010. Teleost fish with specific genome duplication as unique models of vertebrate evolution. Environmental Biology of Fishes. 88: 169-188. doi:10.1007/s10641-010-9628-7. Shan D, Chen L, Wang D, Tan Y-C, Gu JL, and Huang XY. 2006. The G protein G alpha(13) is required for growth factor-induced cell migration. Developmental cell. 10: 707-718. doi:10.1016/j.devcel.2006.03.014. http://www.ncbi.nlm.nih.gov/pubmed/16740474. Sharman AC, and Holland PWH. 1998. Estimation of Hox gene cluster number in lampreys. Journal of Developmental Biology. 42: 617-620. Spring J. 1997. Vertebrate evolution by interspecific hybridisation – are we polyploid? FEBS letters. 400: 2–8. Steinert PM, and Roop DR. 1988. Molecular and cellular biology of intermediate filaments. Annual review of biochemistry. 57: 593–625. Sun W, Yu Y, Dotti G, Shen T, Tan X, Savoldo B, Pass AK, Chu M, Zhang D, Lu X, Fu S, Lin X, and Yang J. 2009. PPM1A and PPM1B act as IKKbeta phosphatases to terminate TNFalpha-induced IKKbeta-NF-kappaB activation. Cellular signalling. 21: 95-102. doi:10.1016/j.cellsig.2008.09.012. Sundström G, Dreborg S, and Larhammar D. 2010. Concomitant Duplications of Opioid Peptide and Receptor Genes before the Origin of Jawed Vertebrates. PLoS ONE. 5: e10512. doi:10.1371/journal.pone.0010512. Sundström G, Larsson TA, Brenner S, Venkatesh B, and Larhammar D. 2008a. Evolution of the neuropeptide Y family: new genes by chromosome duplications in early vertebrates and in teleost fishes. General and comparative endocrinology. 155: 705-716. doi:10.1016/j.ygcen.2007.08.016. Sundström G, Larsson TA, and Larhammar D. 2008b. Phylogenetic and chromosomal analyses of multiple gene families syntenic with vertebrate Hox clusters. BMC evolutionary biology. 8. doi:10.1186/1471-2148-8-254. Takahashi T, Tanaka H, Iguchi N, Kitamura K, Chen Y, Maekawa M, Nishimura H, Ohta H, Miyagawa Y, Matsumiya K, Okuyama A, and Nishimune Y. 2004. Rosbin: a novel homeobox-like protein gene expressed exclusively in round spermatids. Biology of reproduction. 70: 1485-1492. doi:10.1095/biolreprod.103.026096. Van de Peer Y, Maere S, and Meyer A. 2009. The evolutionary significance of ancient genome duplications. Nature reviews. Genetics. 10: 725-32. doi:10.1038/nrg2600. Venkatesh B, Kirkness EF, Loh Y-H, Halpern AL, Lee AP, Johnson J, Dandona N, Viswanathan LD, Tay A, Venter JC, Strausberg RL, and Brenner S. 2007. Survey sequencing and comparative analysis of the elephant shark (Callorhinchus milii) genome. PLoS biology. 5: e101. doi:10.1371/journal.pbio.0050101. Walls GL. 1935. The Visual Cells of Lampreys. British Journal of Ophthalmology. 19: 129- 148. doi:10.1136/bjo.19.3.129.

33 Wang D, Tan Y-C, Kreitzer GE, Nakai Y, Shan D, Zheng Y, and Huang XY. 2006. G proteins G12 and G13 control the dynamic turnover of growth factor-induced dorsal ruffles. The Journal of biological chemistry. 281: 32660-32667. doi:10.1074/jbc.M604588200. Waterhouse AM, Procter JB, Martin DMA, Clamp M, and Barton GJ. 2009. Jalview Version 2--a multiple sequence alignment editor and analysis workbench. Bioinformatics (Oxford, England). 25: 1189-1191. doi:10.1093/bioinformatics/btp033. Watson AJ, Katz A, and Simon MI. 1994. A fifth member of the mammalian G-protein beta- subunit family. Expression in brain and activation of the beta 2 isotype of phospholipase C. The Journal of biological chemistry. 269: 22150-22156. Wettschureck N, and Offermanns S. 2005. Mammalian G Proteins and Their Cell Type Specific Functions. Physiological Reviews. 85: 1159 -1204. doi:10.1152/physrev.00003.2005. Wharton KA Jr. 2003. Runnin’ with the Dvl: Proteins That Associate with Dsh/Dvl and Their Significance to Wnt Signal Transduction. Developmental Biology. 253: 1-17. doi:10.1006/dbio.2002.0869. Wilkie TM, Gilbert DJ, Olsen AS, Chen XN, Amatruda T, Korenberg JR, Trask BJ, de Jong P, Reed RR, Simon MI, Jenkins NA, and Copeland NG. 1992. Evolution of the mammalian G protein alpha subunit multigene family. Nature genetics. 1: 85-91. doi:10.1038/ng0592-85. Wolfe KH. 2001. Yesterday’s polyploids and the mystery of diploidization. Nature reviews. Genetics 2: 333-41. doi:10.1038/35072009. Yamagata M, and Sanes JR. 2010. Synaptic localization and function of Sidekick recognition molecules require MAGI scaffolding proteins. The Journal of neuroscience : the official journal of the Society for Neuroscience 30: 3579-3588. doi:10.1523/JNEUROSCI.6319- 09.2010. Yan K, Kalyanaraman V, and Gautam N. 1996. Differential ability to form the G protein betagamma complex among members of the beta and gamma subunit families. The Journal of biological chemistry. 271: 7141-7146.

Appendix

Neighbouring gene families of GNAT and GNAI

Figure 14: N-J tree with all PHTF family members.

Figure 15: N-J tree including all RSBN gene family members.

Figure 16: N-J tree with all RBM family members.

Figure 17: NJ tree of all SEMA3 family members.

Figure 18: N-J tree with all PPM family members.

Figure 19: NJ tree of all the MAGI gene family members.

Figure 20: NJ tree of all CELSR gene family members.

Figure 21: NJ tree of all PTPN gene family members.

Figure 22: NJ tree of all CACNA2D family members.

Figure 15: NJ tree of all PLASMINOGEN gene family members.

44 Neighbouring gene families of GNB

Figure 24: NJ tree of all CHD family members.

Figure 25: NJ tree of all USP family members.

Figure 26: NJ tree of all DVL family members.

Figure 27: NJ tree of all IFFO family members.

Figure 28: NJ tree of all MFN gene family members.

Figure 29: NJ tree of all PEX family members.

Figure 30: NJ tree of all SCNN family members.