Mitochondrial Calcium Deregulation in the Mechanism of Beta-Amyloid and Tau Pathology
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
IHC Test Menu
Immunohistochemistry Test Menu A Alpha fetoprotein [I AFP] CD99 Ewings sarcoma PNET [I CD99] Anaplastic lymphoma kinase -1 [I ALK] CD103 Integrin alpha E [I CD103] Androgen receptor [I ANDRO]* CD117 C-Kit, myeloid, mast cells, GIST [I CD117] Annexin A1, hairy cell, B cell lymphoma [I ANXA1] CD138 plasma cells, subset epithelial cells [I CD138] Anti-Arginase-1 [I ARGINASE] CD163 histiocytes [I CD163] CDK4 cyclin-depdendent kinase-4, clone DCS-31 [I CDK4] B CDX2 colorectal carcinoma [I CDX2] BCL2 follicular lymphoma, apoptosis inhibiting protein [I BCL2] Chromogranin A [I CHROGRAN] BCL6 follicle center B-cell [I BCL6] CMYC C-MYC oncoprotein [I CMYC] BER EP4 Epithelial antigen [I BER EP4] Collagen IV, basement membrane protein [I CLLGIV] BRAF [I V600E] Cyclin D1/PRAD1 mantle cell lymphoma [I CYCLIN] Cytokeratin 5/6, squamous, mesothelial [I CK5/6] C Cytokeratin 7, 54kD [I CK7] CA 19-9 pancreas, liver, ovary, lung tumors [I CA19 9] Cytokeratin 7/8 CAM5.2 [I CAM 5.2] CA 125 epitheliod malignancies ovary, breast [I CA125] Cytokeratin 8, 35BH11 [I CK8] Calcitonin [I CALCT] Cytokeratin 8/18, adenocarcinoma [I CK8/18] Caldesmon, smooth muscle [I CALDSM] Cytokeratin 19 [I CK19] Calretinin; Calcium binding protein [I CALRT] Cytokeratin 20 [I CK20] CAM 5.2 Cytokeratin 7/Cytokeratin 8 [I CAM 5.2] Cytokeratin cocktail, PAN (AE1/AE3) [I AE1/AE3] Carcinoembryonic antigen (CEA) [I CEA] Cytokeratin high molecular weight; 34BE12 [I CK HMW] Cathepsin D, breast carcinoma [I CATHD] Cytomegalovirus [I CMV] CD1a cortical thymocyctes, Langerhans cells [I CD1a] -
Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase -
This Electronic Thesis Or Dissertation Has Been Downloaded from Explore Bristol Research
This electronic thesis or dissertation has been downloaded from Explore Bristol Research, http://research-information.bristol.ac.uk Author: Al Ahdal, Hadil Title: Investigating the role of miR-21 in adult neurogenesis General rights Access to the thesis is subject to the Creative Commons Attribution - NonCommercial-No Derivatives 4.0 International Public License. A copy of this may be found at https://creativecommons.org/licenses/by-nc-nd/4.0/legalcode This license sets out your rights and the restrictions that apply to your access to the thesis so it is important you read this before proceeding. Take down policy Some pages of this thesis may have been removed for copyright restrictions prior to having it been deposited in Explore Bristol Research. However, if you have discovered material within the thesis that you consider to be unlawful e.g. breaches of copyright (either yours or that of a third party) or any other law, including but not limited to those relating to patent, trademark, confidentiality, data protection, obscenity, defamation, libel, then please contact [email protected] and include the following information in your message: •Your contact details •Bibliographic details for the item, including a URL •An outline nature of the complaint Your claim will be investigated and, where appropriate, the item in question will be removed from public view as soon as possible. Investigating the role of miR-21 in adult neurogenesis Hadil Mohammad Al Ahdal Faculty of Health Sciences Bristol Medical School A dissertation submitted to the University of Bristol in accordance with the requirements for award of the degree of Doctor of Philosophy in the Faculty of Health Sciences, Bristol Medical School 64,598 words Abstract MicroRNAs (miRNAs) are a class of small non-coding RNAs that act as post- transcriptional regulators and play important roles in neurodegenerative diseases and brain disorders (Nelson et al. -
Immunohistochemistry Stain Offerings
immunohistochemistry stain offerings TRUSTED PATHOLOGISTS. INVALUABLE ANSWERS.™ MARCHMAY 20172021 www.aruplab.com/ap-ihcaruplab.com/ap-ihc InformationInformation in this brochurein this brochure is current is current as of as May of March 2021. 2017. All content All content is subject is subject to tochange. change. Please contactPlease ARUPcontact ClientARUP Services Client Services at 800-522-2787 at (800) 522-2787 with any with questions any questions or concerns.or concerns. ARUP LABORATORIES As a nonprofit, academic institution of the University of Utah and its Department We believe in of Pathology, ARUP believes in collaborating, sharing and contributing to laboratory science in ways that benefit our clients and their patients. collaborating, Our test menu is one of the broadest in the industry, encompassing more sharing and than 3,000 tests, including highly specialized and esoteric assays. We offer comprehensive testing in the areas of genetics, molecular oncology, pediatrics, contributing pain management, and more. to laboratory ARUP’s clients include many of the nation’s university teaching hospitals and children’s hospitals, as well as multihospital groups, major commercial science in ways laboratories, and group purchasing organizations. We believe that healthcare should be delivered as close to the patient as possible, which is why we support that provide our clients’ efforts to be the principal healthcare provider in the communities they serve by offering highly complex assays and accompanying consultative support. the best value Offering analytics, consulting, and decision support services, ARUP provides for the patient. clients with the utilization management tools necessary to prosper in this time of value-based care. -
Calbindin-D28k and Its Role in Apoptosis: Inhibition of Caspase-3 Activity and Interaction with Pro-Caspase-3 Investigated by In-Situ FRET Microscopy
Dissertation Aus dem Physiologischen Institut Lehrstuhl: Physiologie – Zelluläre Physiologie (Biomedizinisches Zentrum München) der Ludwig-Maximilians-Universität München Vorstand: Prof. Dr. Claudia Veigel Calbindin-D28k and its role in apoptosis: Inhibition of Caspase-3 activity and interaction with Pro-Caspase-3 investigated by in-situ FRET microscopy. Dissertation zum Erwerb des Doktorgrades der Medizin an der Medizinischen Fakultät der Ludwig-Maximilians-Universität zu München vorgelegt von Johannes Lohmeier aus Bong Town, Liberia 2018 Mit Genehmigung der Medizinischen Fakultät der Universität München Berichterstatter: Prof. Dr. Michael Meyer Prof. Dr. Alexander Faussner Mitberichterstatter: Prof. Dr. Nikolaus Plesnila Prof. Dr. Dr. Bernd Sutor Dekan: Prof. Dr. med. dent. Reinhard Hickel Tag der mündlichen Prüfung: 14.06.2018 Eidesstattliche Versicherung Lohmeier, Johannes Name, Vorname Ich erkläre hiermit an Eides statt, dass ich die vorliegende Dissertation mit dem Thema Calbindin-D28k and its role in apoptosis: Inhibition of Caspase-3 activity and interaction with Pro-Caspase-3 investigated by in-situ FRET microscopy. selbständig verfasst, mich außer der angegebenen keiner weiteren Hilfsmittel bedient und alle Erkenntnisse, die aus dem Schrifttum ganz oder annähernd übernommen sind, als solche kenntlich gemacht und nach ihrer Herkunft unter Bezeichnung der Fundstelle einzeln nachgewiesen habe. Ich erkläre des Weiteren, dass die hier vorgelegte Dissertation nicht in gleicher oder in ähnlicher Form bei einer anderen Stelle zur Erlangung -
Figure S1. HAEC ROS Production and ML090 NOX5-Inhibition
Figure S1. HAEC ROS production and ML090 NOX5-inhibition. (a) Extracellular H2O2 production in HAEC treated with ML090 at different concentrations and 24 h after being infected with GFP and NOX5-β adenoviruses (MOI 100). **p< 0.01, and ****p< 0.0001 vs control NOX5-β-infected cells (ML090, 0 nM). Results expressed as mean ± SEM. Fold increase vs GFP-infected cells with 0 nM of ML090. n= 6. (b) NOX5-β overexpression and DHE oxidation in HAEC. Representative images from three experiments are shown. Intracellular superoxide anion production of HAEC 24 h after infection with GFP and NOX5-β adenoviruses at different MOIs treated or not with ML090 (10 nM). MOI: Multiplicity of infection. Figure S2. Ontology analysis of HAEC infected with NOX5-β. Ontology analysis shows that the response to unfolded protein is the most relevant. Figure S3. UPR mRNA expression in heart of infarcted transgenic mice. n= 12-13. Results expressed as mean ± SEM. Table S1: Altered gene expression due to NOX5-β expression at 12 h (bold, highlighted in yellow). N12hvsG12h N18hvsG18h N24hvsG24h GeneName GeneDescription TranscriptID logFC p-value logFC p-value logFC p-value family with sequence similarity NM_052966 1.45 1.20E-17 2.44 3.27E-19 2.96 6.24E-21 FAM129A 129. member A DnaJ (Hsp40) homolog. NM_001130182 2.19 9.83E-20 2.94 2.90E-19 3.01 1.68E-19 DNAJA4 subfamily A. member 4 phorbol-12-myristate-13-acetate- NM_021127 0.93 1.84E-12 2.41 1.32E-17 2.69 1.43E-18 PMAIP1 induced protein 1 E2F7 E2F transcription factor 7 NM_203394 0.71 8.35E-11 2.20 2.21E-17 2.48 1.84E-18 DnaJ (Hsp40) homolog. -
Chemical Agent and Antibodies B-Raf Inhibitor RAF265
Supplemental Materials and Methods: Chemical agent and antibodies B-Raf inhibitor RAF265 [5-(2-(5-(trifluromethyl)-1H-imidazol-2-yl)pyridin-4-yloxy)-N-(4-trifluoromethyl)phenyl-1-methyl-1H-benzp{D, }imidazol-2- amine] was kindly provided by Novartis Pharma AG and dissolved in solvent ethanol:propylene glycol:2.5% tween-80 (percentage 6:23:71) for oral delivery to mice by gavage. Antibodies to phospho-ERK1/2 Thr202/Tyr204(4370), phosphoMEK1/2(2338 and 9121)), phospho-cyclin D1(3300), cyclin D1 (2978), PLK1 (4513) BIM (2933), BAX (2772), BCL2 (2876) were from Cell Signaling Technology. Additional antibodies for phospho-ERK1,2 detection for western blot were from Promega (V803A), and Santa Cruz (E-Y, SC7383). Total ERK antibody for western blot analysis was K-23 from Santa Cruz (SC-94). Ki67 antibody (ab833) was from ABCAM, Mcl1 antibody (559027) was from BD Biosciences, Factor VIII antibody was from Dako (A082), CD31 antibody was from Dianova, (DIA310), and Cot antibody was from Santa Cruz Biotechnology (sc-373677). For the cyclin D1 second antibody staining was with an Alexa Fluor 568 donkey anti-rabbit IgG (Invitrogen, A10042) (1:200 dilution). The pMEK1 fluorescence was developed using the Alexa Fluor 488 chicken anti-rabbit IgG second antibody (1:200 dilution).TUNEL staining kits were from Promega (G2350). Mouse Implant Studies: Biopsy tissues were delivered to research laboratory in ice-cold Dulbecco's Modified Eagle Medium (DMEM) buffer solution. As the tissue mass available from each biopsy was limited, we first passaged the biopsy tissue in Balb/c nu/Foxn1 athymic nude mice (6-8 weeks of age and weighing 22-25g, purchased from Harlan Sprague Dawley, USA) to increase the volume of tumor for further implantation. -
Supplementary Material Computational Prediction of SARS
Supplementary_Material Computational prediction of SARS-CoV-2 encoded miRNAs and their putative host targets Sheet_1 List of potential stem-loop structures in SARS-CoV-2 genome as predicted by VMir. Rank Name Start Apex Size Score Window Count (Absolute) Direct Orientation 1 MD13 2801 2864 125 243.8 61 2 MD62 11234 11286 101 211.4 49 4 MD136 27666 27721 104 205.6 119 5 MD108 21131 21184 110 204.7 210 9 MD132 26743 26801 119 188.9 252 19 MD56 9797 9858 128 179.1 59 26 MD139 28196 28233 72 170.4 133 28 MD16 2934 2974 76 169.9 71 43 MD103 20002 20042 80 159.3 403 46 MD6 1489 1531 86 156.7 171 51 MD17 2981 3047 131 152.8 38 87 MD4 651 692 75 140.3 46 95 MD7 1810 1872 121 137.4 58 116 MD140 28217 28252 72 133.8 62 122 MD55 9712 9758 96 132.5 49 135 MD70 13171 13219 93 130.2 131 164 MD95 18782 18820 79 124.7 184 173 MD121 24086 24135 99 123.1 45 176 MD96 19046 19086 75 123.1 179 196 MD19 3197 3236 76 120.4 49 200 MD86 17048 17083 73 119.8 428 223 MD75 14534 14600 137 117 51 228 MD50 8824 8870 94 115.8 79 234 MD129 25598 25642 89 115.6 354 Reverse Orientation 6 MR61 19088 19132 88 197.8 271 10 MR72 23563 23636 148 188.8 286 11 MR11 3775 3844 136 185.1 116 12 MR94 29532 29582 94 184.6 271 15 MR43 14973 15028 109 183.9 226 27 MR14 4160 4206 89 170 241 34 MR35 11734 11792 111 164.2 37 52 MR5 1603 1652 89 152.7 118 53 MR57 18089 18132 101 152.7 139 94 MR8 2804 2864 122 137.4 38 107 MR58 18474 18508 72 134.9 237 117 MR16 4506 4540 72 133.8 311 120 MR34 10010 10048 82 132.7 245 133 MR7 2534 2578 90 130.4 75 146 MR79 24766 24808 75 127.9 59 150 MR65 21528 21576 99 127.4 83 180 MR60 19016 19049 70 122.5 72 187 MR51 16450 16482 75 121 363 190 MR80 25687 25734 96 120.6 75 198 MR64 21507 21544 70 120.3 35 206 MR41 14500 14542 84 119.2 94 218 MR84 26840 26894 108 117.6 94 Sheet_2 List of stable stem-loop structures based on MFE. -
Impact of Actin Filament Stabilization on Adult Hippocampal and Olfactory Bulb Neurogenesis
The Journal of Neuroscience, March 3, 2010 • 30(9):3419–3431 • 3419 Development/Plasticity/Repair Impact of Actin Filament Stabilization on Adult Hippocampal and Olfactory Bulb Neurogenesis Golo Kronenberg,1,2,5* Karen Gertz,1,2* Tina Baldinger,1 Imke Kirste,5 Sarah Eckart,3 Ferah Yildirim,1 Shengbo Ji,1 Isabella Heuser,5 Helmut Schro¨ck,6 Heide Ho¨rtnagl,4 Reinhard Sohr,4 Pierre Chryso Djoufack,7 Rene´Ju¨ttner,8 Rainer Glass,8 Ingo Przesdzing,1 Jitender Kumar,8 Dorette Freyer,1 Rainer Hellweg,3 Helmut Kettenmann,8 Klaus Benno Fink,7 and Matthias Endres1,2 1Klinik und Poliklinik fu¨r Neurologie, 2Center for Stroke Research Berlin, 3Klinik fu¨r Psychiatrie und Psychotherapie, and 4Institut fu¨r Pharmakologie und Toxikologie, Charite´-Universita¨tsmedizin Berlin, D-10117 Berlin, Germany, 5Klinik und Hochschulambulanz fu¨r Psychiatrie und Psychotherapie, Charite´- Universita¨tsmedizin Berlin, D-14050 Berlin, Germany, 6Institut fu¨r Neurophysiologie, Medizinische Fakulta¨t Mannheim, Universita¨t Heidelberg, D-68167 Mannheim, Germany, 7Institut fu¨r Pharmakologie und Toxikologie, Universita¨t Bonn, D-53113 Bonn, Germany, and 8Max Delbru¨ck Center for Molecular Medicine, D-13092 Berlin, Germany Rearrangement of the actin cytoskeleton is essential for dynamic cellular processes. Decreased actin turnover and rigidity of cytoskeletal structures have been associated with aging and cell death. Gelsolin is a Ca 2ϩ-activated actin-severing protein that is widely expressed throughout the adult mammalian brain. Here, we used gelsolin-deficient (Gsn Ϫ/Ϫ) mice as a model system for actin filament stabiliza- tion. In Gsn Ϫ/Ϫ mice, emigration of newly generated cells from the subventricular zone into the olfactory bulb was slowed. -
Strand Breaks for P53 Exon 6 and 8 Among Different Time Course of Folate Depletion Or Repletion in the Rectosigmoid Mucosa
SUPPLEMENTAL FIGURE COLON p53 EXONIC STRAND BREAKS DURING FOLATE DEPLETION-REPLETION INTERVENTION Supplemental Figure Legend Strand breaks for p53 exon 6 and 8 among different time course of folate depletion or repletion in the rectosigmoid mucosa. The input of DNA was controlled by GAPDH. The data is shown as ΔCt after normalized to GAPDH. The higher ΔCt the more strand breaks. The P value is shown in the figure. SUPPLEMENT S1 Genes that were significantly UPREGULATED after folate intervention (by unadjusted paired t-test), list is sorted by P value Gene Symbol Nucleotide P VALUE Description OLFM4 NM_006418 0.0000 Homo sapiens differentially expressed in hematopoietic lineages (GW112) mRNA. FMR1NB NM_152578 0.0000 Homo sapiens hypothetical protein FLJ25736 (FLJ25736) mRNA. IFI6 NM_002038 0.0001 Homo sapiens interferon alpha-inducible protein (clone IFI-6-16) (G1P3) transcript variant 1 mRNA. Homo sapiens UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15 GALNTL5 NM_145292 0.0001 (GALNT15) mRNA. STIM2 NM_020860 0.0001 Homo sapiens stromal interaction molecule 2 (STIM2) mRNA. ZNF645 NM_152577 0.0002 Homo sapiens hypothetical protein FLJ25735 (FLJ25735) mRNA. ATP12A NM_001676 0.0002 Homo sapiens ATPase H+/K+ transporting nongastric alpha polypeptide (ATP12A) mRNA. U1SNRNPBP NM_007020 0.0003 Homo sapiens U1-snRNP binding protein homolog (U1SNRNPBP) transcript variant 1 mRNA. RNF125 NM_017831 0.0004 Homo sapiens ring finger protein 125 (RNF125) mRNA. FMNL1 NM_005892 0.0004 Homo sapiens formin-like (FMNL) mRNA. ISG15 NM_005101 0.0005 Homo sapiens interferon alpha-inducible protein (clone IFI-15K) (G1P2) mRNA. SLC6A14 NM_007231 0.0005 Homo sapiens solute carrier family 6 (neurotransmitter transporter) member 14 (SLC6A14) mRNA.