Genomic Structure and Genetic Mapping of the Human Neutral Cysteine Protease Bleomycin Hydrolase'

(CANCER RESEARCH57. 4191â€”4195,October1, 1997] Advances in Brief

Susana E. Montoya, Robert E. Ferrell, and John S. Lazo2

Departments ofHuman Genetics [S. E. M., R. E. F.J and Pharmacology [J. S. LI, University of Pittsburgh, Pittsburgh. Pennsylvania 1526/

Abstract reported to bind DNA and to act as a repressor of the Gal4 regulatory system (10). Thus, BH, which has been conserved during evolution, is Bleomycin hydrolase (BH) is the only known eukaryotic enzyme that likely to have important physiological functions in human cells in inactivates the widely used antineoplastic agent bleomycin (BLM) and is a cluding its key role in drug metabolism. We now report the genetic primary candidate gene for protection against lethal BLM-induced pul monary fibrosis and for BLM resistance in tumors. Human B!! was found mapping of the human BH gene and its overall genomic organization, to exist as a single gene that was mapped to chromosome 17 using National which corroborates membership in the cysteine protease superfamily. Institute of General Medical Sciences human/rodent hybrid mapping panels and localized to 17q11.1â€”11.2 by linkage analysis using the Centre Materials and Methods d'Etude du Polymorphisme Humain reference database. The human BH gene consisted of 11 exons ranging in size from 69â€”198bpseparated by Characterization of Human BH Genomic Structure. Amplification introns ofapproximately 1kb, reflectingthe archetypal genomicstructure primers (Fig. 1) from adjacent exons were designed using the human cDNA of the cysteine protease family. A polymorphic site was identified in the sequence (8) and intron-exon boundary data from the 5' end of the mouse BH eleventh exon at bp 1450 encodIng either valine or Isoleucine. These gene.4 Intronic regions were amplified from human genomic DNA using fmdings provide essential tools requlred to define the role of RH in long-distance PCR (Elongase; Life Technologies, Inc., Gaithersburg, MD) and BLM-induced pulmonary fibrosis and BLM resistance in tumors. sized on ethidium bromide-stained 1% agarose gel with a 1-kb ladder molec ular size marker (Life Technologies, Inc.). Confirmation of the identity of the Introduction PCR products and determination of intron-exon boundaries were performed by dye-labeled terminator direct cycle sequencing of the PCR products (1 I ) using BLM3 is an essential component of combination chemotherapy the DNA sequencing kit (Applied Biosystems, Foster, CA). Sequencing prod regimens (1, 2). Despite the importance of BLM for curative thera ucts were analyzed on an ABI Prism 377 automatic DNA sequencer (Applied pies, low doses of BLM induce pulmonary toxicity in approximately Biosystems) and assembled using sequencer v.3.0 (Gene Codes Corp., Ann 3â€”5%of patients, and cumulative doses greater than 450 mg induce Arbor, MI). The intron-exon boundary between intron 6 and exon 6 was potentially lethal pulmonary toxicity in up to 10% of patients (1). The determined from the homologous region of the cloned mouse gene.4 molecular basis for this untoward effect is not established, and accu Chromosomal Mapping of the Human BH Gene. Preliminary localiza rate methods to screen patients for sensitivity before treatment are tion of the human BH gene was obtained using PCR-based analysis of NIGMS unavailable. Recent studies indicate a genetic basis for susceptibility monoclonal hybrid mapping panel 2 (Coriell Institute for Medical Research, Camden, NJ) with primers BHB11 and BHB12 described in Fig. 1. Amplifi to BLM-induced pulmonary fibrosis (3). BH is the only known cation was performed in a DNA thermal cycler 480 (Perkin-Elmer Corp., eukaryotic enzyme that can inactivate BLM (1), and there is consid Foster City, CA) in a final volume of 25 @lcontaining 500 ng of genomic erable evidence that BH can protect pulmonary tissue from BLM DNA, 0.5 unit of Taq polymerase (Life Technologies, Inc.), I.5 mMMgCI2, induced lung injury (1, 4). Deletion of BH in yeast cells results in 200 @.LMeachdeoxynucleotide triphosphate, 240 flM each primer, and 7% increased sensitivity to BLM (5), and expression of yeast BH in DMSO. Thermal cycling comprised 30 cycles of 1-mm denaturation at 94Â°C, mammalian cells results in resistance to BLM (6). Mammalian BH has 30-s annealing at 58Â°C,and 1-mm extension at 72Â°C.Results from monoclonal been purified to homogeneity, and its substrate specificity, inhibitor hybrid mapping panel 2 were confirmed by analysis of NIOMS human/rodent sensitivity, and deduced catalytic domains suggest its membership in hybrid mapping panel I (Coriell Institute for Medical Research). Panel I was the cysteine protease superfamily that includes the calpains, cathep probed with the BHB11IBHBI2 primer pair as well as a second primer pair sins, and the prototype, papain (7). Human BH cDNA encodes a comprised of BHB11 and BHCI2 using long-distance PCR (Elongase; Life 455-amino acid polypeptide that is highly conserved among species Technologies, Inc.). Regional localization of the BH gene was performed using the NIGMS chromosome 17 regional mapping panel (Coriell Institute for with 40% identity to the yeast BH homologue Gal6 (8). Human BH is Medical Research). expressed in many tissues with elevated expression levels found in the Genetic Mapping of Human BH. Based on the report of a possible testis, skeletal muscle, and pancreas and low expression levels seen in polymorphism at bp 1450 (8), exon 1 1 was amplified for SSCP analysis using the colon and peripheral blood leukocytes (8). Based on crystal primers BHZ11 and BHZI2 (Fig. 1) with the same reaction conditions as structure analysis, yeast BH is characterized as a homohexamer that described for primers BHB1 1 and BHB12. The PCR products were screened resembles a 205 proteasome with a prominent central channel housing by a modified SSCP analysis (12) using 4â€”20%Tris-borateEDTA precast gels the conserved cysteine protease active sites (9). Yeast BH is also (Novex, San Diego, CA) run on a vertical electrophoresis unit (Mighty Small II Vertical Electrophoresis Unit; Hoefer, San Francisco, CA) for 2.5 h with at

Received 7/24/97; accepted 8/14/97. 20 mA witha temperaturegradientof â€”7Â°Câ€”20Â°C(ProgrammableTempera The costs of publication of this article were defrayed in part by the payment of page ture Controller; Polyscience, Niles, IL). Gels were visualized by staining with charges. This article must therefore be hereby marked advertisement in accordance with SYBR Green II (Molecular Probes, Eugene, OR) for 20 mm followed by 18 U.S.C. Section 1734 solely to indicate this fact. inspection using the still video imaging system (Eagle Eye II; Stratagene, La I Supported in part by NIH Grant CA43917 and the Fiske Drug Discovery Fund. Jolla, CA). Confirmation of the A14500 polymorphism and genotyping was 2 To whom requests for reprints should be addressed, at Department of Pharmacology. E-1340 Biomedical Science Tower, University of Pittsburgh, Pittsburgh, PA 15261. performed by direct cycle sequencing of the PCR products. The human BH 3 The abbreviations used are: BLM, bleomycin; BH, bleomycin hydrolase; SSCP, gene was genetically mapped by linkage analysis using the 10 informative single-strand conformational polymorphism; MOMS, National Institute of General Mcd ical Sciences; ABI, Applied Biosystems Incorporated; CHLC, Cooperative Human Link age Center; LOD, log of odds; CEPH, Centre d'Etude du Polymorphisme Humain. 4 T. P. G. Calmels, D. R. Schwartz, and J. S. Lazo, unpublished observations. 4191

GGCGCCATGAGCAGCTCGG . cctgtttggtctcccaacagGACTGAATI@CGGAGAA BHAII(+.I) BHBII(+,2) GGTAGCFGCFCTGATACAGAAA@TGAATTCCGACCCCCAGTTCGTACTTG

CCCAGAATGTCGGGACCACCCACGACCTGCTGGACATCTGTCTGAAGCG

GGCCACGGTGCAGCGCGCGCAGCATGTGTTCCAGCACGCCGTGCCCCAG

GAGGGCAAGCCAATCACCAACCAGAAGAGCTCAGgtgtgggctgccacttctcc gat SHBI2(-. 1) gtgctttcttgUtcaGGCGATGCTGGATCTITrCTrGTcTGAATGrrATGAGGCTF BHCtI(+.3) CCATTCATGAAAAAGTrAAATATTGAAGAA1TrGAGTrrAGCCAATC@TA BHCI2(-, 2)

QQlGmTTTTGGGACAAGgtatgggacagatctggcaa taacffictttactctttagGTl'GAAC

GCTGTTATTTCTfCTTGAGTGCTrTTGTGGACACAGCCCAGAGAAAGGAG B}tDII(+.4) CCTGAGGATGGGAGGCTGGTGCAGTI'iriGCI'TATGAACCCTGCAAATG BHDI2(-. 3) ATGGTGGCCAATGGGATATGC1Â°I'GTFAATATFGTTGgtaaaagftctttctttaat tag

aatttgttItcttttagAAAAATATGGTGTTATCCCTAAGAAATGCTfCCCTGAATCTT BHEII(+. 5) 514E12(-. 4) AIAQAACAGAGGCAACCAGAAGGATGAATGATATFCTGAATCACAAGgtaC

aatatatgaagcaggg tgaataagmctgtcatagATGAGAGAATTCTGTATACGACTGCGA

ACCTGGTACACAGTGGAGCA4CGAAAGGAGAAATCrCGGCCACACAGGA BHFI2(-. 5) CGTCATGATGGAGGAG ATATrCCGAGTGGTGTGCATCTGTTTGGGTAA BHGII(+.6) Fig. 1. Intron-exon boundaries of the human BH gene. Exons are I@ACCAGAGACATTCACCTGGGAATATCGAGACAAAGATAAAAA1Â°FATC indicated in bold uppercase letters. Fully conserved consensus sequences next to the primer name indicates forward (+) or reverse (â€”)primer. Primer pairing is indicated by a number in parentheses next to primer CCACTCTTCAATATGGAAGATAAGgttgggaatggcactgga tacttaacaatgtggctgtagt name, e.g.. BHAI l(+ ,l) and BHB12(â€”1)form primer pair I. acttagcttgtaggcagagatgatgagcttgatggaaacatgaacctagaggagagctgtgtgttgcttgacattcctggttttgt

gccctaattaatgtgUcttgatcftgatagATTTGTTTAGTGAATGACCCTAGGCCCCAGCAC

AAGTACAACAAACrflACACAGTGGAATAcTTAAGCAATATGGTrGGTGG BHHI2(-. 6) GAGAAAAACTCTATACAACAACCAGCCCArfGAcrrCcrG@t@GATGG BHH1I(+. 7) TTGCTGCCTCCATCAAAGATGGAGAGgttggtaftgtttctgtattttgcacauggggttaaaacatct

tttacttctttggtataataggaaaatggggtttatgttgacutcttcctctttcttctgtttctagGCTGTGTGQmG

GcTGTGATGTTGGAAAACACTTCAATAGCA@tG@TGG@cc'rCGTGACATG BH212(-, 7) AATCTgtgattgcaggaaatttaaa.....TACTATCATTCTTTTTACAGCTATGACcAT@A

GTTAGTGTTTGGTGTCTCCrTGAAGAACATGAATA@4GCGGAGAGGCTG BHII2(-. 7) A@TTTTGGTGAGTCACTTATGACCCACGCCATGACmCACTGCTGTCTC

AGAGAAGGTGATCAGGATGGTGCTTTCACAAAATGGAGAGTGGAG@4TT

CATGGGGTGAAGACCATGGCCACAAAGGTTACCTGTGCATGACAGATGA

GTGGrrCTCTGAGTATGTCTACGAGTGGTGGTGGACAG@GCATGTCC BHZII(+, 8) CTGAAGAGGTGCTAGCTGTGTTAGAGCAGGAACCCATTATCCTGCCAGC

ATGGGACCCCATGGGAGCmGGCTGAGTGAGTGATACTGCCcTCCAGC

TCTTTCCTCCTTCCATGGAACCTGACGTAccrGc@&@cACAGATCCA@ B}4Z12(., 8)

4192

Human Bleomycin Hydrolase

198 110142899315615968Iâ€”u-I--I U1.20.11.21478611511986144117129-I

Fig. 2. Genomic structure of human BH and 0.4 2.0 1.4 0.7 1.3 representative members of the cysteine protease family. Exons are indicated as boxes; exon size is indicated in bp above the figure. Introns are drawn to scale. Intronic distances are indicated below the figure in kb. A, genomic structure of human BH. The size of introns 6 and 10 has not been deter B mined. Exon 1 contains 13 bp of coding sequence, and exons 10 and 11 together contain 337 bp of coding sequence. B, genomic structures of related members of the cysteine protease family. Mouse cathepsin B and human cathepsin genomic struc Mouse Cathepsin B tures were from Refs. 15 and 21, respectively. 112 901U...IRIUâ€¢ â€”

4,7 0.6 0.5 0.8 1.5 0.2 0.8 2.6 0.5

Human Cathepsin L 278 136 123147225 163 118 385 U 1.0 0.3 0.1 0.2 0.7 0.6 0.5

CEPHfamilies (12, 66, 104, 1331, 1332, 1333, 1344, 1346, 1347, and 1377) allele based on 35 CEPH family grandparents. Two-point linkage that were genotyped for the exon 11polymorphism by SSCP. Determination of analysis of the human BH gene with 50 chromosome 17 markers from the most likely map position was performed using CR1-MAP (13) with 50 the ABI/CHLC/CEPH vO.8 integrated sex-averaged map resulted in a chromosome 17 markers from the ABI/CHLC/CEPH vO.8 integrated sex LOD score of4.96 at U= 0.14 with Dl7s975 and a LOD score of 4.45 averaged map. at 0 = 0.15 with Dl7sl299. Multipoint analysis yielded the best-order Results map (1000:1 odds) shown in Fig. 5. Restriction endonuclease finger printing was used to try to localize other polymorphic regions in the Genomic Structure of the Human BH Gene. Eleven exons have human RH gene, but to date, none have been detected (data not been identified encoding human BH using long-distance PCR. The shown). exons ranged in size from 69â€”198bp, and intervening introns aver aged 1 kb but ranged in size from 0.1â€”2.0kb.The OC content of the Discussion exons ranged from 36% in exon 3 to 59% in exon 2. The human BH gene spanned approximately 10 kb (Fig. Vt); introns 6 and 10 were The human BH genomic structure and chromosomal localization resistant to PCR amplification, perhaps due to large size or secondary have been determined. The human BH genomic structure was remark structure in the region. The conserved catalytic cysteine (Cys73) was ably similar to that of other related members of the cysteine protease contained in exon 3. Comparisons of the genomic structure of human papain superfamily, which includes at least 12 other unique mamma BH with other members of the cysteine protease papain superfamily han cysteine proteases (14). Among the papain superfamily, the revealed a conserved architecture comprising small 100â€”200-kbcx lysosomal cathepsins, cytoplasmic calpains, and BHs are found to ons separated by introns of approximately 0.5â€”Ikb (Fig. 2B). share conserved active site residues and are believed to be derived Mapping of the Human BH Gene. PCR-basedanalysis of from an ancestral protease that has evolved through gene duplication NIOMS human/rodent hybrid mapping panel 2 resulted in localization (14). Our results corroborate this suggestion. Of the related cysteine of the human BH gene to chromosome 17 (data not shown). PCR proteases, cathepsin H displays in vitro peptidase action similar to BH analysis of NIOMS human/rodent hybrid mapping panel 1 confirmed in vitro (7) but does not share any remarkable amino acid sequence the chromosomal assignment (data not shown). Analysis of the homology with human BH other than in the catalytic regions. In MOMS chromosome 17 regional mapping panel localized the human general, the genomic structures that have been characterized among BH gene to the region of l7pll.lâ€”l7qll.2 (Fig. 3). members of the cysteine protease family show no obvious correspond Genetic Mapping of the Human BH Gene. An A14500 poly ence between exon divisions and structural or functional units (15); morphic site suggested previously from human BH cDNA (8) was however, an intron-exon junction frequently has been noted near the confirmed in exon 11, leading to a protein with either VaP@3or Ileâ€•@'3.active site cysteine (16). Qian et al. (15) hypothesize that the ancestral The two variants were clearly discernible by SSCP analysis (Fig. 4). cysteine protease gene has undergone exon shifting during the evo The allele frequencies were 0.61 for the A allele and 0.39 for the G lutionary process. Consistent with this notion, the active site cysteine 4193

D17s1843 A 4.2 13.3 D17s925 13.2 2.1 13.1 p 12U D17s975 11.2 3.8 11.1 D17s798 11.1 11.2 3.6 12 a 21.1 hBH 21.2 2.9 21.31 21.32 D17s1293 21.33 1.1 1'I 22 U D17s1842 @I 23.1 1.1 23.2 a D17s927 23.3 24.1 a 1.3 24.324.2a D17s1867 25.1 25.2 Fig. 5. Chromosome 17 best-order map (1000:1 odds). Map distances noted in 25.3 Kosambi cM. Second best-order map (4.9X less likely) places human BH between D17s975 and Dl7s798.

17 O@COLOCDLOOO) LO(O(O@(OLO@ OC@JCsJO 00000 in human BH occurred in exon 3 six bp upstream from the intron-exon @- 1@ @- Â¶@ 1@ , @- , junction, perhaps revealing a preserved exon structure encompassing

5- a highly conserved catalytic region of the papain superfamily. The B V 5- V polymorphism found in exon 11 confirmed that noted by BrÃ¶mmeet a!. (8) during the sequencing of the human BH cDNA. Due to the C\O@tr8OC\ conserved substitution of a valine for an isoleucine, BrOmme et a!. (8) o@ooo@o,,@ 0C@lr@1O00000 argue that the polymorphism is likely not to have any functional â€” â€” â€” â€” â€” â€” â€” â€” â€” â€” consequence. The human RH gene was mapped to chromosome I7 by several complimentary methods. Human BH seemed to be a single-copy gene, based on all data from mapping and genomic structural analysis.

- Related cysteine protease genes are similarly found as single-copy 2 kb - - â€” genes without any apparent clustering on individual chromosomes. The best-order map location for human BH derived from genetic mapping using the CEPH database was in agreement with localization of the human BH gene using NIGMS human rodent hybrid mapping panels. The best-order map places human BH between markers D17s798 and Dl7sl293. Dl7sl45, which lies 1 cM from Dl7s798, has been localized to l7qll.lâ€”l7ql 1.2 (17), consistent with our Fig. 3. NIGMS chromosome 17 regional mapping panel. A, ideogram of the regional positioning using the chromosome 17 regional mapping panel. LOD mapping panel with deletion hybrids (courtesy of Dr. J. Beck. Coriell Institute for Medical Research). B, PCR analysis of the chromosome 17regional mapping panel. The panel was scores for markers in the l2.2-Kosambi cM region between Dl7s975 probed with primers BHBI I and BHCI2, which yielded a 2-kb amplicon from human and D17sl299 (ABI/CHLC/CEPH vO.8 integrated sex-averaged map) genomic DNA. PCR products were analyzed on an ethidium bromide-stained 1% agarose were uninformative in the two-point linkage analysis due to the lack gel. of informative meiosis. The localization of human BH on chromosome 17 implies that the mouse homologue should be situated on mouse chromosome 11, due @ (@ L@ (.@ (@ (@ (@ (@ c@ to thehighdegreeofsyntenybetweenthetwospecies(18).Interest @ :;@ :;;@:;@:@ ::@:@ :@ ingly,recentlinkagestudieswithinbredmurinestrainsthatdisplay differential BLM sensitivity suggest a locus that is linked to sensitiv ity to BLM-induced pulmonary fibrosis at Dl lMit35 (3)@5Dl lMit35 is near to the mouse gene CRYBA (19); CRYBAJ, the human homo logue, maps to l7ql 1.2â€”17q12(20). The genomic structure data and chromosomal mapping of BH provide a valuable resource for additional studies on the role of human 6. BH in the etiology of BLM-induced pulmonary fibrosis and BLM therapy resistance. Moreover, the genomic architecture of human BH supports the role of this enzyme as a member of the diverse cysteine protease family.

Acknowledgments Fig. 4. SSCP genotyping of the A14500 polymorphism of human BH in CEPH families. SSCP analysis of the 160-bp PCR amplicon of primers BHZI I and BHZ12 was We thank Pam St. Jean for assistance with the linkage analysis, Dieter performed as described in â€œMaterialsandMethods.â€•ASYBR Green 11-stained4-20% polyacrylamide gel was loaded with samples from the following CEPH family members: BrÃ¶mmeforhuman BH cDNA, Dr. Jean Beck for assistance with the chro 6608, 6609, 6610, 6611, 6612, 10401, 10402, 10403, and 10404. Genotype is indicated mosome 17 ideogram, and Donald Schwartz and Thierry P. G. Calmels for above each lane (A/A, A1G. or GIG).

5 C. Haston and E. Travis, personal communication. 4194

Downloaded from cancerres.aacrjournals.org on September 30, 2021. © 1997 American Association for Cancer Research. BH GENE providing the initial mouse genomic sequence. We also appreciate the thought 12. Orita, M., Suzuki, Y., Sikiya, T., and Hayashi, K. Rapid and sensitive detection of ful comments of I. Lefterov and G. Homanics concerning this manuscript. point mutations and DNA polymorphisms using the polymerase chain reaction. Genomics, 5: 874â€”879,1989. 13. Lander, E. S., and Green, P. Construction of multilocus genetic linkage maps in References humans. Proc. NatI. Acad. Sci. USA, 84: 2363â€”2367, 1987. 1. Lazo, J., and Chabner, B. A. Bleomycin. In: B. A. Chabner and D. Longo (eds.), 14. Berti, P. J., and Storer, A. C. Alignmentlphylogeny of the papain superfamily of Cancer Chemotherapy and Biotherapy, 2nd ed., pp. 379â€”392.Philadelphia:Lippin cysteine proteases. J. Mol. Biol., 246: 273â€”282,1995. con-Raven Publishers, 1996. 15. Qian, F., Frankfater, A., Chan, S. J., and Steiner, D. F. The structure of the mouse 2. Loehner, P. J., Sr., Johnson, D., Elson, P., Einhom, H. L., and Trump, D. Importance cathepsin B gene and its putative promoter. DNA Cell Biol., /0: 159â€”168,1991. of bleomycin in favorable-prognosis disseminated germ cell tumors: an Eastern 16. Ishidoh, K., Kominami, E., Kawnuma, N., and Suzuki, K. Gene structure of rat Cooperative Oncology Group trial. J. Clin. Oncol., 13: 470â€”476,1995. cathepsin H. FEBS Lett., 253: 103â€”107,1989. 3. Haston, C., Amos, C., King, T., and Travis, E. Inheritance of susceptibility to 17. Chumakov, I. M., Rigault, P., Le Gall, I., Bellanne-Chantelot, C., Billault, A.. bleomycin-induced pulmonary fibrosis in the mouse. Cancer Res., 56: 2596â€”2601, Guillou, S., Soularue, P., Guasconi, 0., Poullier, E., Gros, I., Belova, M., Sambucy, 1996. J., Susini, L., Gervy, P., Gilbert, F., Beaufils, S., Bui, H., Massart, C., Dc Tand, M., 4. Law, J. S., and Humphreys, C. J. Lack of metabolism as the biochemical basis of Dukasz, F., Lecoulant, S., Ougen, P., Perrot, V., Saumier, M., Soravito, C., bleomycin-inducedpulmonary toxicity. Proc. Nat]. Aced. Sci. USA, 80: 3064-3068, Bahouayila, R., Cohen-Akenine, A., Barillot, E., Bertrand, S., Codani, J., Caterina, 1983. D., Georges, I., Lacroix, B., Lucotte, G., Sahbatou, M., Schmit, C., Sagouard, M., 5. Enenkel, C., and Wolf, D. H. BLH1 codes fora yeast thiol aminopeptidase, the equivalent Tubacher, E., Dib, C., Faure, S., Fizames, C., Gyapay, G., Millasseau, P., Nguyen, S., of mammalian bleomycin hydrolase. J. Biol. Chem., 268: 7036â€”7043,1993. Muselet, D., Vignal, A., Morissette, J., Menninger, J., Lieman, J., Desai, T., Banks. 6. Pci, Z., Calmels, T. P. G., Cruetz, C. E., and Sebti, S. M. Yeast cysteine proteinase A., Bray-Ward, P., Ward, D., Hudson, T., Gerety, S., Foote, S., Stein, L., Page, D. C., gene ycpl induces resistance to bleomycin in mammalian cells. Mol. Pharmacol., 48: Lander, E. S., Weissenbach, J., Le Paslier, D., and Cohen, D. A YAC contig map of 676â€”681, 1995. the human genome. Nature (Lond.), 377: 175â€”285,1995. 7. Sebti, S. M., DeLeon, J. C., and Lazo, J. S. Purification, characterization, and amino 18. Copeland, N. G., Jenkins, N. A., Gilbert, D. J., Eppig, J. T., Maltais, L. J., Miller, acid composition of rabbit pulmonary bleomycin hydrolase. Biochemistry, 26: 4213â€” J. C., Dietrich, W. F., Weaver, A., Lincoln, S. E., Steen, R. G., Stein, L. D., Nadeau, 4219,1987. J. H., and Lander, E. S. A genetic linkage map of the mouse: current applications and 8. BrÃ¶mme,D., Rossi, A. B., Smeekens, S. P., Anderson, D. C., and Payan, D. G. future prospects. Science (Washington DC), 262: 57â€”66,1993. Human bleomycin hydrolase: molecular cloning, sequencing, functional expression, 19. Kerscher, S., Church, R. L., Boyd, Y., and Lyon, M. Mapping of four mouse genes and enzymatic characterization. Biochemistry, 35: 6706â€”6714,1996. encoding eye lens-specific structural, gap junction, and integral membrane proteins: 9. Joshua-Tor, L., Xu, H. E., Johnston, S. A., and Rees, D. C. Crystal structure of a Cryba 1 (Crystallin f3 A3/Al), Crybb b2 (Crystallin @3B2),Gja8 (MP7O), and Lim2 conserved protease that binds DNA: the bleomycin hydrolase, Gal 6. Science (Wash (MPI9). Genomics, 29: 445â€”450, 1995. ington DC), 269: 945â€”950,1995. 20. Sparkes, R. S., Mohandas, T., Heinzmann, C., Gorin, M. B., Zollman, S., and 10. Xu, H. E., and Johnston, S. A. Yeast bleomycin hydrolase is a DNA-binding cysteine Horwitz, J. Assignment of human @3-crystallingene to l7cen-q23. Hum. Genet., 74: protease.J.Biol.Chem., 269: 21177â€”21183,1994. 133â€”136,1986. I 1. McCombie, W. R., Heiner, C., Kelley, J. M., Fitzgerald, M. G., and Gocayne, J. D. 21. Chauhan, S. S., Popescu, N. C., Ray, D., Fleischmann, R., Gottesman, M. M., and Rapid and reliable fluorescent cycle sequencing of double stranded templates. DNA Troen, B. R. Cloning, genomic organization, and chromosomal localization of human Seq., 2: 289â€”296,1992. cathepsin L. J. Biol. Chem., 268: 1039â€”1045, 1993.

4195

Downloaded from cancerres.aacrjournals.org on September 30, 2021. © 1997 American Association for Cancer Research. Genomic Structure and Genetic Mapping of the Human Neutral Cysteine Protease Bleomycin Hydrolase

Susana E. Montoya, Robert E. Ferrell and John S. Lazo

Cancer Res 1997;57:4191-4195.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/57/19/4191

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/57/19/4191. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.