DOCSLIB.ORG

Genomic Structure and Genetic Mapping of the Human Neutral Cysteine Protease Bleomycin Hydrolase'

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Genomic Structure and Genetic Mapping of the Human Neutral Cysteine Protease Bleomycin Hydrolase' (CANCER RESEARCH57. 4191—4195,October1, 1997] Advances in Brief Genomic Structure and Genetic Mapping of the Human Neutral Cysteine Protease Bleomycin Hydrolase' Susana E. Montoya, Robert E. Ferrell, and John S. Lazo2 Departments ofHuman Genetics [S. E. M., R. E. F.J and Pharmacology [J. S. LI, University of Pittsburgh, Pittsburgh. Pennsylvania 1526/ Abstract reported to bind DNA and to act as a repressor of the Gal4 regulatory system (10). Thus, BH, which has been conserved during evolution, is Bleomycin hydrolase (BH) is the only known eukaryotic enzyme that likely to have important physiological functions in human cells in inactivates the widely used antineoplastic agent bleomycin (BLM) and is a cluding its key role in drug metabolism. We now report the genetic primary candidate gene for protection against lethal BLM-induced pul monary fibrosis and for BLM resistance in tumors. Human B!! was found mapping of the human BH gene and its overall genomic organization, to exist as a single gene that was mapped to chromosome 17 using National which corroborates membership in the cysteine protease superfamily. Institute of General Medical Sciences human/rodent hybrid mapping panels and localized to 17q11.1—11.2 by linkage analysis using the Centre Materials and Methods d'Etude du Polymorphisme Humain reference database. The human BH gene consisted of 11 exons ranging in size from 69—198bpseparated by Characterization of Human BH Genomic Structure. Amplification introns ofapproximately 1kb, reflectingthe archetypal genomicstructure primers (Fig. 1) from adjacent exons were designed using the human cDNA of the cysteine protease family. A polymorphic site was identified in the sequence (8) and intron-exon boundary data from the 5' end of the mouse BH eleventh exon at bp 1450 encodIng either valine or Isoleucine. These gene.4 Intronic regions were amplified from human genomic DNA using fmdings provide essential tools requlred to define the role of RH in long-distance PCR (Elongase; Life Technologies, Inc., Gaithersburg, MD) and BLM-induced pulmonary fibrosis and BLM resistance in tumors. sized on ethidium bromide-stained 1% agarose gel with a 1-kb ladder molec ular size marker (Life Technologies, Inc.). Confirmation of the identity of the Introduction PCR products and determination of intron-exon boundaries were performed by dye-labeled terminator direct cycle sequencing of the PCR products (1 I ) using BLM3 is an essential component of combination chemotherapy the DNA sequencing kit (Applied Biosystems, Foster, CA). Sequencing prod regimens (1, 2). Despite the importance of BLM for curative thera ucts were analyzed on an ABI Prism 377 automatic DNA sequencer (Applied pies, low doses of BLM induce pulmonary toxicity in approximately Biosystems) and assembled using sequencer v.3.0 (Gene Codes Corp., Ann 3—5%of patients, and cumulative doses greater than 450 mg induce Arbor, MI). The intron-exon boundary between intron 6 and exon 6 was potentially lethal pulmonary toxicity in up to 10% of patients (1). The determined from the homologous region of the cloned mouse gene.4 molecular basis for this untoward effect is not established, and accu Chromosomal Mapping of the Human BH Gene. Preliminary localiza rate methods to screen patients for sensitivity before treatment are tion of the human BH gene was obtained using PCR-based analysis of NIGMS unavailable. Recent studies indicate a genetic basis for susceptibility monoclonal hybrid mapping panel 2 (Coriell Institute for Medical Research, Camden, NJ) with primers BHB11 and BHB12 described in Fig. 1. Amplifi to BLM-induced pulmonary fibrosis (3). BH is the only known cation was performed in a DNA thermal cycler 480 (Perkin-Elmer Corp., eukaryotic enzyme that can inactivate BLM (1), and there is consid Foster City, CA) in a final volume of 25 @lcontaining 500 ng of genomic erable evidence that BH can protect pulmonary tissue from BLM DNA, 0.5 unit of Taq polymerase (Life Technologies, Inc.), I.5 mMMgCI2, induced lung injury (1, 4). Deletion of BH in yeast cells results in 200 @.LMeachdeoxynucleotide triphosphate, 240 flM each primer, and 7% increased sensitivity to BLM (5), and expression of yeast BH in DMSO. Thermal cycling comprised 30 cycles of 1-mm denaturation at 94°C, mammalian cells results in resistance to BLM (6). Mammalian BH has 30-s annealing at 58°C,and 1-mm extension at 72°C.Results from monoclonal been purified to homogeneity, and its substrate specificity, inhibitor hybrid mapping panel 2 were confirmed by analysis of NIOMS human/rodent sensitivity, and deduced catalytic domains suggest its membership in hybrid mapping panel I (Coriell Institute for Medical Research). Panel I was the cysteine protease superfamily that includes the calpains, cathep probed with the BHB11IBHBI2 primer pair as well as a second primer pair sins, and the prototype, papain (7). Human BH cDNA encodes a comprised of BHB11 and BHCI2 using long-distance PCR (Elongase; Life 455-amino acid polypeptide that is highly conserved among species Technologies, Inc.). Regional localization of the BH gene was performed using the NIGMS chromosome 17 regional mapping panel (Coriell Institute for with 40% identity to the yeast BH homologue Gal6 (8). Human BH is Medical Research). expressed in many tissues with elevated expression levels found in the Genetic Mapping of Human BH. Based on the report of a possible testis, skeletal muscle, and pancreas and low expression levels seen in polymorphism at bp 1450 (8), exon 1 1 was amplified for SSCP analysis using the colon and peripheral blood leukocytes (8). Based on crystal primers BHZ11 and BHZI2 (Fig. 1) with the same reaction conditions as structure analysis, yeast BH is characterized as a homohexamer that described for primers BHB1 1 and BHB12. The PCR products were screened resembles a 205 proteasome with a prominent central channel housing by a modified SSCP analysis (12) using 4—20%Tris-borateEDTA precast gels the conserved cysteine protease active sites (9). Yeast BH is also (Novex, San Diego, CA) run on a vertical electrophoresis unit (Mighty Small II Vertical Electrophoresis Unit; Hoefer, San Francisco, CA) for 2.5 h with at Received 7/24/97; accepted 8/14/97. 20 mA witha temperaturegradientof —7°C—20°C(ProgrammableTempera The costs of publication of this article were defrayed in part by the payment of page ture Controller; Polyscience, Niles, IL). Gels were visualized by staining with charges. This article must therefore be hereby marked advertisement in accordance with SYBR Green II (Molecular Probes, Eugene, OR) for 20 mm followed by 18 U.S.C. Section 1734 solely to indicate this fact. inspection using the still video imaging system (Eagle Eye II; Stratagene, La I Supported in part by NIH Grant CA43917 and the Fiske Drug Discovery Fund. Jolla, CA). Confirmation of the A14500 polymorphism and genotyping was 2 To whom requests for reprints should be addressed, at Department of Pharmacology. E-1340 Biomedical Science Tower, University of Pittsburgh, Pittsburgh, PA 15261. performed by direct cycle sequencing of the PCR products. The human BH 3 The abbreviations used are: BLM, bleomycin; BH, bleomycin hydrolase; SSCP, gene was genetically mapped by linkage analysis using the 10 informative single-strand conformational polymorphism; MOMS, National Institute of General Mcd ical Sciences; ABI, Applied Biosystems Incorporated; CHLC, Cooperative Human Link age Center; LOD, log of odds; CEPH, Centre d'Etude du Polymorphisme Humain. 4 T. P. G. Calmels, D. R. Schwartz, and J. S. Lazo, unpublished observations. 4191 Downloaded from cancerres.aacrjournals.org on September 30, 2021. © 1997 American Association for Cancer Research. BH GENE GGCGCCATGAGCAGCTCGG . cctgtttggtctcccaacagGACTGAATI@CGGAGAA BHAII(+.I) BHBII(+,2) GGTAGCFGCFCTGATACAGAAA@TGAATTCCGACCCCCAGTTCGTACTTG CCCAGAATGTCGGGACCACCCACGACCTGCTGGACATCTGTCTGAAGCG GGCCACGGTGCAGCGCGCGCAGCATGTGTTCCAGCACGCCGTGCCCCAG GAGGGCAAGCCAATCACCAACCAGAAGAGCTCAGgtgtgggctgccacttctcc gat SHBI2(-. 1) gtgctttcttgUtcaGGCGATGCTGGATCTITrCTrGTcTGAATGrrATGAGGCTF BHCtI(+.3) CCATTCATGAAAAAGTrAAATATTGAAGAA1TrGAGTrrAGCCAATC@TA BHCI2(-, 2) QQlGmTTTTGGGACAAGgtatgggacagatctggcaa taacffictttactctttagGTl'GAAC GCTGTTATTTCTfCTTGAGTGCTrTTGTGGACACAGCCCAGAGAAAGGAG B}tDII(+.4) CCTGAGGATGGGAGGCTGGTGCAGTI'iriGCI'TATGAACCCTGCAAATG BHDI2(-. 3) ATGGTGGCCAATGGGATATGC1°I'GTFAATATFGTTGgtaaaagftctttctttaat tag aatttgttItcttttagAAAAATATGGTGTTATCCCTAAGAAATGCTfCCCTGAATCTT BHEII(+. 5) 514E12(-. 4) AIAQAACAGAGGCAACCAGAAGGATGAATGATATFCTGAATCACAAGgtaC aatatatgaagcaggg tgaataagmctgtcatagATGAGAGAATTCTGTATACGACTGCGA ACCTGGTACACAGTGGAGCA4CGAAAGGAGAAATCrCGGCCACACAGGA BHFI2(-. 5) CGTCATGATGGAGGAG ATATrCCGAGTGGTGTGCATCTGTTTGGGTAA BHGII(+.6) Fig. 1. Intron-exon boundaries of the human BH gene. Exons are I@ACCAGAGACATTCACCTGGGAATATCGAGACAAAGATAAAAA1°FATC indicated in bold uppercase letters. Fully conserved consensus sequences next to the primer name indicates forward (+) or reverse (—)primer. Primer pairing is indicated by a number in parentheses next to primer CCACTCTTCAATATGGAAGATAAGgttgggaatggcactgga tacttaacaatgtggctgtagt name, e.g.. BHAI l(+ ,l) and BHB12(—1)form primer pair I. acttagcttgtaggcagagatgatgagcttgatggaaacatgaacctagaggagagctgtgtgttgcttgacattcctggttttgt gccctaattaatgtgUcttgatcftgatagATTTGTTTAGTGAATGACCCTAGGCCCCAGCAC AAGTACAACAAACrflACACAGTGGAATAcTTAAGCAATATGGTrGGTGG BHHI2(-. 6) GAGAAAAACTCTATACAACAACCAGCCCArfGAcrrCcrG@t@GATGG BHH1I(+. 7) TTGCTGCCTCCATCAAAGATGGAGAGgttggtaftgtttctgtattttgcacauggggttaaaacatct tttacttctttggtataataggaaaatggggtttatgttgacutcttcctctttcttctgtttctagGCTGTGTGQmG
Load more

Recommended publications
  • Curcumin Effect on Bleomycin-Induced Pulmonary Fibrosis in Mus Musculus
    JITV Vol. 20 No 2 Th. 2015: 148-157 Curcumin Effect on Bleomycin-Induced Pulmonary Fibrosis in Mus musculus Rahmi A1, Setiyono A2, Juniantito V2 1Graduate School of Animal Biomedical Science, Faculty of Veterinary Medicine, Bogor Agricultural University 2Division of Pathology, Department of Clinic, Reproduction and Pathology, Faculty of Veterinary Medicine, Bogor Agricultural University E-mail: [email protected]; [email protected] (received 31-03-2015; revised 29-05-2015; accepted 04-06-2015) ABSTRAK Rahmi A, Setiyono A, Juniantito V. 2015. Pengaruh kurkumin terhadap fibrosis paru-paru akibat aplikasi bleomisin pada Mus musculus. JITV 20(2): 148-157. DOI: http://dx.doi.org/10.14334/jitv.v20i2.1169 Kurkumin merupakan bahan aktif utama dari tanaman kunyit (Curcuma longa) diketahui memiliki aktivitas sebagai anti- oksidan dan anti-inflamasi. Bleomisin merupakan salah satu obat anti-kanker yang dapat menginduksi fibrosis paru-paru pada manusia dan hewan. Tujuan penelitian ini adalah untuk mengetahui efek biologis kurkumin pada fibrosis paru-paru yang diinduksi bleomisin pada mencit. Sebanyak 16 ekor mencit galur ddy dibagi dalam 4 kelompok perlakuan: (i) kontrol, 100 µl aquadest steril diinjeksikan secara SC, (ii) bleomisin (BLM), 100 µl bleomisin konsentrasi 1 mg/ml diinjeksikan secara SC, (iii) kurkumin (CMN), 100 µl aquadest steril diinjeksikan secara SC dan 100 mg/kg BB kurkumin dalam 0,5% carboxymethylcellulose (CMC) yang diinjeksikan secara IP, dan (iv) BLM+CMN, 100 µl bleomisin dengan konsentrasi 1 mg/ml diinjeksikan secara SC dan 100 mg/kg BB kurkumin dalam 0,5% CMC diinjeksikan secara IP. Semua perlakuan diberikan setiap hari selama 4 minggu. Organ paru-paru dikoleksi dalam 10% buffered neutral formalin (BNF).
    [Show full text]
  • (12) Patent Application Publication (10) Pub. No.: US 2014/0010901 A1 Hibino Et Al
    US 20140010901A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2014/0010901 A1 Hibino et al. (43) Pub. Date: Jan. 9, 2014 (54) BLEOMYCIN HYDROLASE PRODUCTION Publication Classification PROMOTOR (51) Int. Cl. A61E36/756 (2006.01) A63L/047 (2006.01) (75) Inventors: Toshihiko Hibino, Yokohama-shi (JP); A 6LX3/97 (2006.01) Shoko Yamada, Yokohama-shi (JP); A61E36/53 (2006.01) Hidekazu Fukushima, Yokohama-shi A61E36/23 (2006.01) (JP) (52) U.S. Cl. CPC ............... A61K 36/756 (2013.01); A61K 36/53 (2013.01); A61 K36/23 (2013.01); A61 K (73) Assignee: Shiseido Company, Ltd. 31/197 (2013.01); A61 K3I/047 (2013.01) USPC ........... 424/745; 424/769; 424/773; 424/777; (21) Appl. No.: 14/004,977 514/562; 514/738 (57) ABSTRACT (22) PCT Filed: Mar. 14, 2012 Provided is a novel bleomycin hydrolase production pro moter. (86). PCT No.: PCT/UP2012/056581 Provided is a bleomycin hydrolase production promoter, S371 (c)(1), natural moisturizing factor production promoter, and dry skin (2), (4) Date: Sep. 13, 2013 remedy, comprising as an active ingredient thereof one or a plurality of ingredients selected from the group consisting of (30) Foreign Application Priority Data chestnut rose extract, angelica root extract, cork tree bark extract, lamium album extract, rosemary extract, benzene Mar. 15, 2011 (JP) ................................. 2011-057126 sulfonyl GABA and erythritol. Patent Application Publication Jan. 9, 2014 Sheet 1 of 23 US 2014/0010901 A1 Fig.1 SPECIMEN 1 SPEC MEN 2 2 5 10 20 2 5 10 20 NUMBER OF TIMES OF TAPE STRIPPING Fig.2 SPECIMEN T N A M T, A: SUBJECTS NOT HAVING DRY SKIN N: SUBJECT HAVING SOMEWHAT DRY SKIN, MSUBJECT HAVING DRY SKN Patent Application Publication Jan.
    [Show full text]
  • In a Three-Dimensional Reconstructed Human Epidermis Filaggrin-2 Is Essential for Proper Cornification
    Citation: Cell Death and Disease (2015) 6, e1656; doi:10.1038/cddis.2015.29 OPEN & 2015 Macmillan Publishers Limited All rights reserved 2041-4889/15 www.nature.com/cddis In a three-dimensional reconstructed human epidermis filaggrin-2 is essential for proper cornification V Pendaries1,2,3, M Le Lamer1,2,3, L Cau1,2,3, B Hansmann4, J Malaisse5, S Kezic6, G Serre1,2,3 and M Simon*,1,2,3 Atopic dermatitis is a chronic inflammatory skin disease with defects in the epidermal barrier. In a cohort of African-American children, a FLG2 nonsense mutation has been associated with the disease. In the epidermis of European patients, the expression of filaggrin-2, the filaggrin-related protein encoded by FLG2, is decreased. To describe the function of filaggrin-2 and evaluate the impact of its deficiency, its expression was downregulated using lentivirus-mediated shRNA interference in a three-dimensional reconstructed human epidermis (RHE) model. This resulted in parakeratosis and a compact stratum corneum, presence of abnormal vesicles inside the corneocytes, increased pH and reduced amounts of free amino acids at the RHE surface, leading to increased sensitivity to UVB radiations. The expression of differentiation markers was slightly modified. However, we observed reduced proteolytic processing of corneodesmosin, hornerin and filaggrin in parallel with reduced amounts of caspase-14 and bleomycin hydrolase. Our data demonstrated that filaggrin-2 is important for a proper cornification and a functional stratum corneum. Its downregulation in atopic patients may be involved in the disease-associated epidermis impairment. Cell Death and Disease (2015) 6, e1656; doi:10.1038/cddis.2015.29; published online 19 February 2015 Atopic dermatitis (AD; OMIM #603165), also known as atopic homologous repeats and a S100-homologous N-terminal eczema, is a very common inflammatory skin disease.1,2 It is domain.
    [Show full text]
  • Biochemical Investigation of the Ubiquitin Carboxyl-Terminal Hydrolase Family" (2015)
    Purdue University Purdue e-Pubs Open Access Dissertations Theses and Dissertations Spring 2015 Biochemical investigation of the ubiquitin carboxyl- terminal hydrolase family Joseph Rashon Chaney Purdue University Follow this and additional works at: https://docs.lib.purdue.edu/open_access_dissertations Part of the Biochemistry Commons, Biophysics Commons, and the Molecular Biology Commons Recommended Citation Chaney, Joseph Rashon, "Biochemical investigation of the ubiquitin carboxyl-terminal hydrolase family" (2015). Open Access Dissertations. 430. https://docs.lib.purdue.edu/open_access_dissertations/430 This document has been made available through Purdue e-Pubs, a service of the Purdue University Libraries. Please contact [email protected] for additional information. *UDGXDWH6FKRRO)RUP 8SGDWHG PURDUE UNIVERSITY GRADUATE SCHOOL Thesis/Dissertation Acceptance 7KLVLVWRFHUWLI\WKDWWKHWKHVLVGLVVHUWDWLRQSUHSDUHG %\ Joseph Rashon Chaney (QWLWOHG BIOCHEMICAL INVESTIGATION OF THE UBIQUITIN CARBOXYL-TERMINAL HYDROLASE FAMILY Doctor of Philosophy )RUWKHGHJUHHRI ,VDSSURYHGE\WKHILQDOH[DPLQLQJFRPPLWWHH Chittaranjan Das Angeline Lyon Christine A. Hrycyna George M. Bodner To the best of my knowledge and as understood by the student in the Thesis/Dissertation Agreement, Publication Delay, and Certification/Disclaimer (Graduate School Form 32), this thesis/dissertation adheres to the provisions of Purdue University’s “Policy on Integrity in Research” and the use of copyrighted material. Chittaranjan Das $SSURYHGE\0DMRU3URIHVVRU V BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB $SSURYHGE\R. E. Wild 04/24/2015 +HDGRIWKH'HSDUWPHQW*UDGXDWH3URJUDP 'DWH BIOCHEMICAL INVESTIGATION OF THE UBIQUITIN CARBOXYL-TERMINAL HYDROLASE FAMILY Dissertation Submitted to the Faculty of Purdue University by Joseph Rashon Chaney In Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy May 2015 Purdue University West Lafayette, Indiana ii All of this I dedicate wife, Millicent, to my faithful and beautiful children, Josh and Caleb.
    [Show full text]
  • Families and Clans of Cysteine Peptidases
    Families and clans of eysteine peptidases Alan J. Barrett* and Neil D. Rawlings Peptidase Laboratory. Department of Immunology, The Babraham Institute, Cambridge CB2 4AT,, UK. Summary The known cysteine peptidases have been classified into 35 sequence families. We argue that these have arisen from at least five separate evolutionary origins, each of which is represented by a set of one or more modern-day families, termed a clan. Clan CA is the largest, containing the papain family, C1, and others with the Cys/His catalytic dyad. Clan CB (His/Cys dyad) contains enzymes from RNA viruses that are distantly related to chymotrypsin. The peptidases of clan CC are also from RNA viruses, but have papain-like Cys/His catalytic sites. Clans CD and CE contain only one family each, those of interleukin-ll3-converting enz3wne and adenovirus L3 proteinase, respectively. A few families cannot yet be assigned to clans. In view of the number of separate origins of enzymes of this type, one should be cautious in generalising about the catalytic mechanisms and other properties of cysteine peptidases as a whole. In contrast, it may be safer to gener- alise for enzymes within a single family or clan. Introduction Peptidases in which the thiol group of a cysteine residue serves as the nucleophile in catalysis are defined as cysteine peptidases. In all the cysteine peptidases discovered so far, the activity depends upon a catalytic dyad, the second member of which is a histidine residue acting as a general base. The majority of cysteine peptidases are endopeptidases, but some act additionally or exclusively as exopeptidases.
    [Show full text]
  • A Genomic Analysis of Rat Proteases and Protease Inhibitors
    A genomic analysis of rat proteases and protease inhibitors Xose S. Puente and Carlos López-Otín Departamento de Bioquímica y Biología Molecular, Facultad de Medicina, Instituto Universitario de Oncología, Universidad de Oviedo, 33006-Oviedo, Spain Send correspondence to: Carlos López-Otín Departamento de Bioquímica y Biología Molecular Facultad de Medicina, Universidad de Oviedo 33006 Oviedo-SPAIN Tel. 34-985-104201; Fax: 34-985-103564 E-mail: [email protected] Proteases perform fundamental roles in multiple biological processes and are associated with a growing number of pathological conditions that involve abnormal or deficient functions of these enzymes. The availability of the rat genome sequence has opened the possibility to perform a global analysis of the complete protease repertoire or degradome of this model organism. The rat degradome consists of at least 626 proteases and homologs, which are distributed into five catalytic classes: 24 aspartic, 160 cysteine, 192 metallo, 221 serine, and 29 threonine proteases. Overall, this distribution is similar to that of the mouse degradome, but significatively more complex than that corresponding to the human degradome composed of 561 proteases and homologs. This increased complexity of the rat protease complement mainly derives from the expansion of several gene families including placental cathepsins, testases, kallikreins and hematopoietic serine proteases, involved in reproductive or immunological functions. These protease families have also evolved differently in the rat and mouse genomes and may contribute to explain some functional differences between these two closely related species. Likewise, genomic analysis of rat protease inhibitors has shown some differences with the mouse protease inhibitor complement and the marked expansion of families of cysteine and serine protease inhibitors in rat and mouse with respect to human.
    [Show full text]
  • Knockdown of Filaggrin in a Three-Dimensional Reconstructed
    ORIGINAL ARTICLE Knockdown of Filaggrin in a Three-Dimensional Reconstructed Human Epidermis Impairs Keratinocyte Differentiation Vale´rie Pendaries1,2,3, Jeremy Malaisse4, Laurence Pellerin1,2,3, Marina Le Lamer1,2,3, Rachida Nachat1,2,3,8, Sanja Kezic5, Anne-Marie Schmitt6,CarlePaul1,2,3,7, Yves Poumay4, Guy Serre1,2,3 and Michel Simon1,2,3 Atopic dermatitis is a chronic inflammatory skin disorder characterized by defects in the epidermal barrier and keratinocyte differentiation. The expression of filaggrin, a protein thought to have a major role in the function of the epidermis, is downregulated. However, the impact of this deficiency on keratinocytes is not really known. This was investigated using lentivirus-mediated small-hairpin RNA interference in a three-dimensional recon- structed human epidermis (RHE) model, in the absence of other cell types than keratinocytes. Similar to what is known for atopic skin, the experimental filaggrin downregulation resulted in hypogranulosis, a disturbed corneocyte intracellular matrix, reduced amounts of natural moisturizing factor components, increased permeability and UV-B sensitivity of the RHE, and impaired keratinocyte differentiation at the messenger RNA and protein levels. In particular, the amounts of two filaggrin-related proteins and one protease involved in the degradation of filaggrin, bleomycin hydrolase, were lower. In addition, caspase-14 activation was reduced. These results demonstrate the importance of filaggrin for the stratum corneum properties/functions. They indicate that filaggrin downregulation in the epidermis of atopic patients, either acquired or innate, may be directly responsible for some of the disease-related alterations in the epidermal differentiation program and epidermal barrier function. Journal of Investigative Dermatology advance online publication, 10 July 2014; doi:10.1038/jid.2014.259 INTRODUCTION a secondary local epidermal barrier disruption.
    [Show full text]
  • Cold Adaptation in Antarctic Notothenioids
    International Journal of Molecular Sciences Article Cold Adaptation in Antarctic Notothenioids: Comparative Transcriptomics Reveals Novel Insights in the Peculiar Role of Gills and Highlights Signatures of Cobalamin Deficiency Federico Ansaloni 1,2 , Marco Gerdol 1,* , Valentina Torboli 1, Nicola Reinaldo Fornaini 1,3, Samuele Greco 1 , Piero Giulio Giulianini 1 , Maria Rosaria Coscia 4, Andrea Miccoli 5 , Gianfranco Santovito 6 , Francesco Buonocore 5 , Giuseppe Scapigliati 5,† and Alberto Pallavicini 1,7,8,† 1 Department of Life Sciences, University of Trieste, 34127 Trieste, Italy; [email protected] (F.A.); [email protected] (V.T.); [email protected] (N.R.F.); [email protected] (S.G.); [email protected] (P.G.G.); [email protected] (A.P.) 2 International School for Advanced Studies, 34136 Trieste, Italy 3 Department of Cell Biology, Charles University, 12800 Prague, Czech Republic 4 Institute of Biochemistry and Cell Biology, National Research Council of Italy, 80131 Naples, Italy; [email protected] 5 Department for Innovation in Biological, Agro-Food and Forest Systems, University of Tuscia, 01100 Viterbo, Italy; [email protected] (A.M.); [email protected] (F.B.); [email protected] (G.S.) 6 Department of Biology, University of Padua, 35131 Padua, Italy; [email protected] 7 Anton Dohrn Zoological Station, 80122 Naples, Italy 8 National Institute of Oceanography and Experimental Geophysics, 34010 Trieste, Italy * Correspondence: [email protected] Citation: Ansaloni, F.; Gerdol, M.; † These authors contributed equally to this work. Torboli, V.; Fornaini, N.R.; Greco, S.; Giulianini, P.G.; Coscia, M.R.; Miccoli, A.; Santovito, G.; Buonocore, F.; et al.
    [Show full text]
  • Oncogenic Parallels in Alzheimer Disease
    ONCOGENIC PARALLELS IN ALZHEIMER DISEASE by ARUN K. RAINA Submitted in partial fulfillment of the requirements For the degree of Doctor of Philosophy Dissertation Advisors Dr. Mark A. Smith & Dr. Xiongwei Zhu Department of Pathology Case Western Reserve University Janurary 2005 Copyright © 2005 by Arun K. Raina All rights reserved ii CASE WESTERN RESERVE UNIVERSITY SCHOOL OF GRADUATE STUDIES We hereby approve the dissertation of ARUN K. RAINA candidate for the Ph.D. degree *. (signed)___George Perry___________________________ (chair of the committee) ____Mark A. Smith__________________________ ____Xiongwei Zhu___________________________ ____Robert B. Petersen__________________________ ____David Boothman__________________________ (date) ____________________ *We also certify that written approval has been obtained for any proprietary material contained therein. iii Dedication To Bhairavah Uma, Autar, Arvind and P iv Table of Contents List of Tables 7 List of Figures 8 Acknowledgements 11 Abbreviations 12 Abstract 16 Chapter 1 Introduction 18 1.1 Historical 18 1.2 Definition of Dementias 19 1.3 Epidemiology of AD 19 1.4 Pathology of AD 19 a. Neurofibrillary Tangles 20 b. Senile Plaques 22 1.5 Clinical Features of AD 22 1.6 Etiopathogenesis of AD 23 a. Age 23 b. Genetics 24 i. Amyloid β Protien Precursor (AβPP) 24 ii. Presenilins 1 and 2 25 iii. ApoE 25 c. Oxidative Stress 27 d. Cell Cycle and AD 28 1 Chapter 2 Oxidative Stress in AD 30 2.1 Introduction 30 a. Oxidative Stress in AD 30 b. Oxidative Events and Apoptosis in AD 32 c. Oxidative and Cell Cycle Events in AD 33 d. Oxidative Stress - An Adaptation in AD? 34 e. Oxidative Relevance to Lesions 35 f.
    [Show full text]
  • Wo 2008/127646 A2
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (43) International Publication Date PCT (10) International Publication Number 23 October 2008 (23.10.2008) WO 2008/127646 A2 (51) International Patent Classification: Not classified AO, AT,AU, AZ, BA, BB, BG, BH, BR, BW, BY,BZ, CA, CH, CN, CO, CR, CU, CZ, DE, DK, DM, DO, DZ, EC, EE, (21) International Application Number: EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, HR, HU, ID, PCT/US2008/004699 IL, IN, IS, JP, KE, KG, KM, KN, KP, KR, KZ, LA, LC, LK, LR, LS, LT, LU, LY,MA, MD, ME, MG, MK, MN, (22) International Filing Date: 10 April 2008 (10.04.2008) MW, MX, MY, MZ, NA, NG, NI, NO, NZ, OM, PG, PH, (25) Filing Language: English PL, PT, RO, RS, RU, SC, SD, SE, SG, SK, SL, SM, SV, SY, TJ, TM, TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, (26) Publication Language: English ZA, ZM, ZW (30) Priority Data: (84) Designated States (unless otherwise indicated, for every 60/922,994 11 April 2007 (11.04.2007) US kind of regional protection available): ARIPO (BW, GH, GM, KE, LS, MW, MZ, NA, SD, SL, SZ, TZ, UG, ZM, (71) Applicant (for all designated States except US): BIOVER- ZW), Eurasian (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM), DANT, INC. [US/US] ; 7330 Carroll Road, San Diego, CA European (AT,BE, BG, CH, CY, CZ, DE, DK, EE, ES, FI, 92121 (US). FR, GB, GR, HR, HU, IE, IS, IT, LT,LU, LV,MC, MT, NL, NO, PL, PT, RO, SE, SI, SK, TR), OAPI (BF, BJ, CF, CG, (72) Inventors; and CI, CM, GA, GN, GQ, GW, ML, MR, NE, SN, TD, TG).
    [Show full text]
  • Caspase-14 Is Required for Filaggrin Degradation to Natural Moisturizing
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector See related commentary on pg 2173 ORIGINAL ARTICLE Caspase-14 Is Required for Filaggrin Degradation to Natural Moisturizing Factors in the Skin Esther Hoste1,2,11, Patrick Kemperman3,4,11, Michael Devos1,2,11, Geertrui Denecker1,2, Sanja Kezic5, Nico Yau5, Barbara Gilbert1,2, Saskia Lippens1,2, Philippe De Groote1,2, Ria Roelandt1,2, Petra Van Damme6, Kris Gevaert6, Richard B. Presland7,8, Hidenari Takahara9, Gerwin Puppels3,10, Peter Caspers3,10, Peter Vandenabeele1,2 and Wim Declercq1,2 Caspase-14 is a protease that is mainly expressed in suprabasal epidermal layers and activated during keratinocyte cornification. Caspase-14-deficient mice display reduced epidermal barrier function and increased sensitivity to UVB radiation. In these mice, profilaggrin, a protein with a pivotal role in skin barrier function, is processed correctly to its functional filaggrin (FLG) repeat unit, but proteolytic FLG fragments accumulate in the epidermis. In wild-type stratum corneum, FLG is degraded into free amino acids, some of which contribute to generation of the natural moisturizing factors (NMFs) that maintain epidermal hydration. We found that caspase-14 cleaves the FLG repeat unit and identified two caspase-14 cleavage sites. These results indicate that accumulation of FLG fragments in caspase-14À/À mice is due to a defect in the terminal FLG degradation pathway. Consequently, we show that the defective FLG degradation in caspase-14-deficient skin results in substantial reduction in the amount of NMFs, such as urocanic acid and pyrrolidone carboxylic acid.
    [Show full text]
  • Purification and Characterization of Bleomycin Hydrolase, Which Represents a New Family of Cysteine Proteases, from Rat Skin
    J. Biochem. 119, 29-36 (1996) Purification and Characterization of Bleomycin Hydrolase, Which Represents a New Family of Cysteine Proteases, from Rat Skin Atsushi Takeda,*,' Dousei Higuchi,t Takako Yamamoto ,* Yoshiko Nakamura,* Y utaka Masuda,t Takahiro Hirabayashi,t and Kazuyasu Nakaya•ö Departments of *Clinical Pathology and tDermatology , Showa University Fujigaoka Hospital, 1-30 Fujigaoka, A oba-ku, Yokohama 227; and•öDepartment of Biochemistry, School of Pharmaceutical Sciences, Showa University, 1-5-8 Hatanodai, Shinagawa-ku, Tokyo 142 Received for publication, June 12 , 1995 Bleomycin (BLM) hydrolase, which hydrolyzes the carboxyamide bond in the ,ƒÀ-amino alanine moiety, was purified from newborn rat skin. The enzyme was purified 2,500-fold over the crude extract to apparent homogeneity in five steps in the presence of 2-mercap toethanol: 45-55% ammonium sulfate fractionation, followed by chromatographies on Sephacryl S-200, DEAE-cellulofine, Phe-Superose, and Mono Q ion-exchange. The native enzyme had a molecular mass of 280kDa according to gel filtration. The subunit molecular mass was estimated as 48kDa by SDS-PAGE, indicating that the enzyme was comprised of six identical subunits. The amino acid sequence of its NH,-terminus was determined to be acetyl-Met-Asn-Asn-Ala-Gly-Leu-Asn-Ser-Glu-Lys-, which was not found in the amino acid sequence database. The optimum pH of the enzyme was 7.5 with pepleomycin (PLM). The Km and Vmax values were 2.1mM and 6.8ƒÊmol•Emg-1•Eh-1 for PLM, and 1.8mM and 7.2 ƒÊ mol•Emg-1•Eh-1 for BLM-A2, respectively.
    [Show full text]