Journal of Cell Science n rpclDsae,TeHbe nvriyHdsa eia col euae 12,Israel 91120, Jerusalem School, Medical University-Hadassah Hebrew The Diseases, Tropical and ulooi of chromatin-associated nucleoporin unusual an is PfSec13 Article Research N earadrpiain(uee ta. 01.I many In is 2011). NE inner al., the to et adjacent is (Zuleger region and nucleoplasmic NE replication the splicing eukaryotes and the including transcription, repair that processes epigenetics, nuclear DNA shown many organization, of was genome regulation a it the as periphery in as nuclear involved the compartment, to given sub-nuclear was al., condensed attention et contain Special Takizawa that 2008). 2011; regions Brickner, and in (Egecioglu transcription located localized heterochromatin for are regions are permissive genes are genes silent that euchromatic while activation, regions sub-nuclear Upon in these 2005). to compartments, al., factories’ sub-nuclear et (Chakalova discrete ‘transcriptional in were located machinery creating be transcriptional to the suggested of activity. genome components of control Regulatory in the dynamics to that contribute emerged organization has nuclear evidence increasing years recent In Introduction to (PNA) acids erythrocytes. nucleic human peptide in used proliferation we parasite Finally, chromatin. for is words: with essential Key Nup to associated is unusual addition is it in this it that that, that where revealed show indicate nucleoplasm analyses and the PfSec13 immunoprecipitation PfSec13 in with HP1 chromatin found downregulate markers associated and is heterochormatin proteins ultrastructural PfSec13 the The Indeed, NPCs, with NPCs. processes. the are co-localize cellular dynamics the not these several of does that in PfSec13 location and involved addition, euchromatic NPCs In suggesting the F-actin. pore of H3K9me3, with that and than nuclear with rather corresponds the microtubules development and with compose in intra-erythrocytic (3D-SIM) associated parasites’ microscopy that envelope during fluorescence nucleoporins resolution PfSec13 nuclear super of to Using the localization yeast. given in of of envelope Nup145C been of nuclear components and the Sec13 has nucleoporin implicated of components unusual attention have about an Special known data is PfSec13, eukaryotes. little Recent very several However, expression. (NPC). in complex gene expression virulence gene in regulating involved compartment nuclear In Summary 10.1242/jcs.122119 doi: 3055–3069 126, ß Science Cell of Journal 2013 April 24 Accepted ( correspondence for *Author 8 7 6 5 4 3 2 1 Dahan-Pasternak Noa o Dzikowski Ron human in erythrocytes proliferation parasite for essential yn Turnbull Lynne ..DGot nttt o netosDsaeRsac,MMse nvriy aitn NLNZ,Canada L8N3Z5, ON Hamilton, Germany University, Hamburg, McMaster 20359 Research, Medicine, Disease Tropical Israel Infectious for 76100, for Institute Rehovot Institute Nocht Science, DeGroote Bernhard of M.G. Australia Parasitology, Institute Australia 2007, Molecular Weizmann 3052, NSW, of Interfaces, VIC, Sydney, Department and Parkville, Sydney, Israel Materials Research, Technology 76100, of Israel Medical of 91120, Rehovot Department of University Jerusalem Science, 12065, Institute institute, of Box Hall ithree PO Institute Eliza The Jerusalem, Weizmann of and Unit, University Walter Hebrew Microscopy Infectious Immunity, The of Electron Medicine, and Study of the Infection Faculty for of Pharmacy, Center of Department Kuvin School The Research, Israel-Canada, Drug Research for Medical Institute for Institute The Genetics, Molecular and Microbiology of Department 03 ulse yTeCmayo ilgssLtd Biologists of Company The by Published 2013. lsoimfalciparum Plasmodium hoai,Mlra ula oecmlx u,Pamdu acprm eeexpression Gene falciparum, Plasmodium Nup, complex, pore Nuclear Malaria, Chromatin, 1, 5 yti .Whitchurch B. Cynthia , * [email protected] h edis omo ua aai,tencerprpeyhsdanmc teto u oisrl sasub- a as role its to due attention much drawn has periphery nuclear the malaria, human of form deadliest the , 1 bdNasereddin Abed , .falciparum P. ) lsoimfalciparum Plasmodium 5 ihe Elbaum Michael , 1 hc hw nqesrcua iiaiissgetn hti safso between fusion a is it that suggesting similarities structural unique shows which , eae Kolevzon Netanel , igebde nteN,tectpamcflmnsadthe and filaments cytoplasmic the NE, inner the the are complex in (Grossman this cell of embedded components the ring main in The complexes 2012). protein al., largest of et the copies of multiple one of form composed is Tan- NPC 2006; al., The , gene of et 2009). Taddei 2004; al., 2006; of Walter, al., et maintenance et Wong and regulation Dieppois 2006; in Brickner al., the et 1985; Cabal and (Blobel, in the memory organization and involved epigenetic nucleus also chromatin 2011; the are between are Akhtar, expression, NPCs barrier the but and selective that a cytoplasm clear Arib just became than 2007; It more 2009). genetic Gasser, Hetzer, loose and and of Capelson the islands (Akhtar define microenvironment (NPCs) matter complexes heterochromatic 2007). pore Gasser, this and nuclear (Akhtar within telomeres and However, shown genes was silent and harbor heterochromatin to condensed of mainly composed 6 i .Gilberger W. Tim , 0poen,tre uloois(us,wihasml to assemble which (Nups), nucleoporins termed proteins, 30 2 ihe Pe’er Michael , Plasmodium nvivo in 7,8 1 isnWong Wilson , yo Yavin Eylon , htis that mgn,w hwta h dynamic the that show we imaging, aaie.Hr echaracterize we Here parasites. 2 aeBaum Jake , 3 eaShinder Vera , 3 3055 and 4 , Journal of Cell Science ihpoen novdi ifrn ellrpoessadis and processes associated cellular PfSec13 different that in found involved have we proteins heterochromatin NPCs, In with cycle. the the cell to intra-erythrocytic location entire with addition development, the euchromatic throughout a NPCs co-localize suggesting the parasite of H3K9me3, not and during HP1 does super markers using it localization PfSec13 however, dynamic Sec13 of and shows dynamics eukaryotic (3D-SIM) and microscopy parasites cellular most resolution formed transgenic the created complex than We the investigated Nup145C. protein to and ScSec13 homology larger by structural with a orthologues, is that PfSec13 found We ID). PlasmoDB.org (PFL1480w/PF3D7_1230700, 2010). in al., orthologue et (Capelson Sec13 Vaquerizas 2010; expression al., gene et with Kalverda regulating 2010b; interact in al., et implicated preferentially were to of and foci shown specific Nups at certain were chromatin of Recently, episomal nucleoplasm Sec13 2003). an the al., NPC, in including et the located the (Enninga of be cells component to of mammalian shown a maintenance also as 1996). was role export, al., Sec13-GFP its et mRNA to (Siniossoglou addition in integrity In NPC role essential COPII-coated and most an the a envelope is of nuclear plays Sec13 in component cytoplasm. that a the conserved Nup in is of system it is component transport addition, integral vesicle an protein In as NPCs. an mammals This the is to identified yeast Sec13. was material from that eukaryotes Nups (supplementary to interesting organisms the orthologue of other One to S1). from Table orthologues Nups few known very reveals organisms. (http://plasmodb.org/plasmo/) very these the in However, through NPCs 2011). search the of Computational al., components and et about number known (Weiner is the little NPCs in the in particularly of envelope, organization nuclear unknown the with organization at chromatin changes remains couple development parasite biology during nuclear in of al., involvement et possible Plasmodium Zhang their regulation and 2012; NE al., the the the et virulence of while (Volz of components memory However, 2011), regulation epigenetic the location. specific and in a nuclear genes implicated was of this periphery existence 2009; at nuclear the al., suggesting site et 2010) Howitt expression al., 2007; al., et et Joergensen (Dzikowski genes periphery virulence nuclear active addition, In as transcriptional 2006). Freitas-Junior al., such 2005; in et Voss al., 2005; et changes al., (Duraisingh et 2005) upon 2000) al., al., et positioning (Ralph et status their (Freitas-Junior periphery change nuclear and the at expression in located al., gene evade genes are Virulence of to et variation. is regulation ability antigenic (Aregawi tight its in year resulting through parasite with system associated a immune protozoan was deaths the virulence million its This and a 2010) genes. over for virulence of responsible regulation of the in implicated expression was periphery nuclear the malaria, si ta. 02 cmde l,20;TnWn ta. 2009). al., et Tan-Wong 2006; al., 2005; et al., Schmid et and 2002; Casolari al., (Arib 2009; et Hetzer, proteins Ishii and associated Capelson with 2011; chromatin interact Akhtar, directly and to shown chromatin Nups were DNA, basket Some nuclear 2009). the Hetzer, at located and (Capelson basket nucleoplasmic 3056 ntecretsuyw dniidadcaatrzda unusual an characterized and identified we study current the In architecture nuclear in changes that shown recently have We In lsoimfalciparum Plasmodium var ora fCl cec 2 (14) 126 Science Cell of Journal and rayohraiopea parasite. apicomplexan other any or rif ee olclz otesm ou tthe at focus same the to co-localize genes .falciparum P. Drosophila h edis omo human of form deadliest the , Plasmodium hc enmdPfSec13 named we which nvivo in oyeechromosomes polytene mgn.PfSec13 imaging. eoedatabase genome .falciparum P. ial,w hwta fe1 sesnilfrparasites for essential is Results PfSec13 that erythrocytes. human show in chromatin. proliferation with we associated is it Finally, where nucleoplasm the in located 2 apoen(0ka.A is tpw aeaindand aligned several have of we step sequences that first acids found of and a protein species amino larger As the a kDa). to (90 compared domains rise protein give WD40 to aa predicted unusual822 predicted an is has thus the PfSec13 However, and 2008a). extension contain al., et that (Struck 1A) distinct N-terminus (Fig. aa evolutionarily 376 its PFL1480w/PF3D7_1230700, first the several in of conservation of of level high (PfSec13, that a indicated eukaryotes with ID) orthologue PlasmoDB.org the Sec13 of sequence acid amino the of Comparison al.,2006). et Stagg 2009; Schwartz, and the (Brohawn protein organisms shaped propeller most In is Sec13 humans. of to size evolutionarily yeast among from conservation eukaryotes of distinct level high maintains in Sec13 orthologue Sec13 unusual An splmnaymtra.Fg 2.Teeprstswr sdfor used were GFP parasites These to both S2). fused Fig. was expression material. PfSec13 (supplementary the which with in transfected pHSec13IDH-GFP were plasmid parasites and aim, detail in this dynamics for pore Towards marker study molecular to difficult a it of made lack NPCs the However, 2011). al., et cells (Weiner daughter among division (IDC) undergoes and biogenesis envelope development clustering, involving nuclear intra-erythrocytic the during at changes NPCs significant the of organization that in dynamics nuclear of analyses 3D Previous NPCs the with of correspond those erythrocytes human during in PfSec13 development of dynamics nuclear The berghei but proteins Sec13 loecnemcocp 3-I) nodrt aeprecise have to order In (3D-SIM). microscopy fluorescence osre eino e1 splmnaymtra i.S) tthe At S1). Fig. material (supplementary Sec13 of region conserved ne ig(ol ta. 01 iisolue l,2000; al., et Siniossoglou Nup84 of 2011; architecture al., molecular yeast the the In et 1996). al., (Hoelz et Siniossoglou the of scaffold ring the compose that inner sub-complexes core which complexes, the heptameric shaped of Y one the are of part a is Sec13 NPC, fe1 ae niscmaio otecmlxsrcueof structure complex the to comparison cerevisiae its on based perform PfSec13 to us allowed data 2009).These Schwartz, and (Brohawn Nup84 and Nup145C of interaction the of association structural the revealing crystallography by elucidated osberl fPSc3a opnn fteNCin NPC the of any component to a homology as no PfSec13 falciparum of show role insertions possible These 731. acids Plasmodium amino between and located is insertion 654 longest and a third 205, 629 the and and 595 and acids 181 amino between acids located amino is insertion between second longer located proteins. is known insertion other first any additional to The homology three show contains not do also that PfSec13 insertions to Nup145C. similarity of high structure shows to C-terminus the similarity the high at has extension PfSec13 the ScSec13, of N-terminus the a while form However, to predicted is PfSec13 of N-terminus b nvivo in poelrSc3adNp4Ca ela h structural the as well as Nup145C and Sec13 -propeller and . Sec13 .yoelii P. n ihrslto mgn sn ue resolution super using imaging high-resolution and rti.Atgte,teedt on oad a towards point data these Altogether, protein. , ? u15 Fg B.A xetdteconserved the expected As 1B). (Fig. Nup145C 0 awt eea D0dmisfriga forming domains WD40 several with aa 300 akti xeso n noeol h shorter the only encode and extension this lack .vivax P. .falciparum P. n h oetmlraspecies malaria rodent the and in-silico and .falciparum P. ? Nup145C acaoye cerevisiae Saccharomyces .knowlesi P. tutrlpeito of prediction structural .falciparum P. b poelrstructure. -propeller .falciparum P. ? e1 a been has Sec13 .falciparum P. noelarge encode Plasmodium showed nvivo in b P. P. S. - . , Journal of Cell Science hoai-soitdNpi lsoim3057 Plasmodium in Nup Chromatin-associated niae nrd(D oe3JRO). code (PDB red is in Nup84 indicated of structure crystal 3JRO). The code PDB (green; and Nup145c 3JRO) code PDB ScSec13 (yellow; of structure crystal with PfSec13 the ihihe nrdtx.( text. red in highlighted are residues Homologous shading. by red highlighted are Strictly residues I1–I3. conserved as labeled are to PfSec13 specific the Insertions in box. Nup145C green to box homology black the the and by indicated is domain The the alignment. below shown are ScSec13 of alignment. elements the structural of Secondary top on is PfSec13 for numbering Residue Nup145C. ScSec13 and with PfSec13 of alignment ( ScSec13 structural of a homolog is PfSec13 1. Fig. A tutr-ae sequence Structure-based ) nsilico in b poelrforming -propeller ? oe (purple) model Nup145C. B vra of Overlay ) Journal of Cell Science eeo notohzie 13 p)adagauldces uigshzgn 3 n 8hi.Tehg eouino hs mgsealsdifferenti enables a images is these there of hpi) resolution 46 high to The hpi 2 hpi). 38 bars: 48 (from Scale and stage ones. schizont (36 fainter correspon late schizogony the nucleus the during and stained At decrease signals DAPI hpi. gradual strong the 46 a large of to and the periphery hpi hpi) between the 1 (1–30 at from trophozoites PfSec13-GFP 1 documented into of bars: were develop Scale signals orientation orientation. Strong and NPC IDC. number in the cluster change during in invasion) Dynamics post clusters. hours NPC (hpi, points during time PfSec13-GFP different of Dynamics 2. Fig. respectively hpi, 46 and 38 at 1.36 and nuclei 2.2 an of to number decreased of gradually the clusters average NPCs as of schizogony, number the During increased a are NPCs. represent they signals these of that of indicated cluster each stage that per this suggesting round, signals at not signals clearly 3.75 the in of at look closer resolution peak A high hpi. a 30 the at reaching S3) Fig. at material increased, (supplementary nucleus focus signals distinct NPC invasion)] number a the of cycle post cell at the (hour of progression clustered the hpi With periphery. be nuclear 1 weaker to to seemed the min phase PfSec13-GFP [10 early while development the parasite At clusters vesicles. of COPII nuclear NPCs represent the signals at with cytoplasmic signals COPII strong correspond the the of that component periphery rational a is as and it the Nup vesicles, coated a in the as Given seen Sec13 1). of signals function Movie dual weaker material supplementary and 2B; periphery using (Fig. nuclear cytoplasm when faint the However, at and strong signals 2A). between periphery differentiate could (Fig. nuclear we microscopy cytoplasm resolution the super the at in we signals ‘background’ microscopy strong detect fluorescence PfSec13-GFP. of could conventional dynamics cellular using the detail Interestingly, in allowed investigate and window to time tight us of a in method invade isolation This parasites 2010). all by that al., ensures et synchronized (Boyle described precisely recently as were merozoites during parasites development of IDC, stages the different the of resolution temporal 3058 ora fCl cec 2 (14) 126 Science Cell of Journal m .( m. .falciparum P. B ihrslto irsoy(DSM fPSc3GPsoiga nraei h ubro oia parasites as foci of number the in increase an showing PfSec13-GFP of (3D-SIM) microscopy resolution High ) nr-rtrctcdevelopment. intra-erythrocytic m o ,1,2,3 n 8hi 1 hpi; 48 and 38 24, 16, 1, for m ta. 01 uprigterl fPSc3a h is Nup first the as PfSec13 of role the supporting in described 3D 2011) by al., observed as et NPCs observed of PfSec13 of reconstruction dynamics microscopy electron of the dynamics with cellular correspond of here patterns The material S5). (supplementary Fig. shows patterns PfSec13 to localization that sub-cellular demonstrate markers we unique cellular Golgi known and ER using mitochondria, Fig. addition, material In (supplementary S4). results similar showed PfSec13-GFP 2011). al., et (Weiner merozoites described new previously the the we of as cytoplasm of the to different cytoplasm possibly a 2A) to the points (Fig. direction cluster each towards schizonts late outwards in while cell point mothers clusters of most merozoites, NPC schizonts daughter early the the of in cellularization before addition, hpi) In (38 S3). Fig. material (supplementary -ci iescnetaea iceeznsa h nuclear the at zones discrete at allow concentrate that fibers that advances indicated (F-actin) F-actin recent actin biology and filamentous of addition, uptake parasite visualization specific haemoglobin In in motility, roles trafficking. as important vesicular such have processes to including shown was Actin IDC during F-actin with associated is PfSec13 n ig)(nrsn ta. 02.Fatnwsas mlctdin implicated (merozoites also was development F-actin 2012). parasite al., of et (Angrisano stages rings) and early in periphery ( A ovninlfursetiaigo fe1-F gen at (green) PfSec13-GFP of imaging fluorescent Conventional ) Plasmodium m o 0hpi. 30 for m . c tblnrte hnwith than rather -tubulin .falciparum P. nvivo In uli(Weiner nuclei Plasmodium mgn of imaging ation with d Journal of Cell Science olclzto fPSc3adFatnuigseii antibodies specific enable using that F-actin parasites [ and PfSec13-GFP PfSec13 the of used co-localization We throughout IDC. F-actin and association entire PfSec13 possible the of dynamics the We nuclear investigate 2012). the al., to between et interested (Steinberg therefore dynamics NPC were for responsible be to eepstoiga h ula eihr Zage l,21)in 2011) in al., addition, et In (Zhang stages. periphery ring nuclear early the at positioning gene eihr atog hyd o olclz) ae nteIDC nuclear the is the F-actin in while at periphery later nuclear F-actin co-localize), the at with not located remains do associated PfSec13 they min is (10 (although stages PfSec13 periphery ring hpi) and merozoites 16 early to in 3D-SIM. while by proteins that both found of We dynamics cellular the visualized and a GPand -GFP a -Act 239–253 Agiaoe l,21) respectively] 2012), al., et (Angrisano .cerevisiae S. -ci a found was F-actin agdwt nH ptp Fg A n efre co-IP in dynamics The NPCs 3D). performed in (Fig. microtubules fraction and this with in PfSec13 5A) detected of association (Fig. be not while could epitope that actin PfSec13, found HA We an experiments. endogenously was with PfSec13 which tagged in below, described line parasite with PfSec13 of association possible NPC PfSec13 that , found of We 2012). with fungal dynamics al., co-localized et some that (Steinberg protein use In motor others demonstrated main while 3A). F-actin recently by (Fig. mediated is was cell organization it entire the species, throughout spread hoai-soitdNpi lsoim3059 Plasmodium in Nup Chromatin-associated 0 fteiae uli(i.3,) ofrhrvldt the validate further To 3B,C). (Fig. nuclei imaged the of 60% ci ( actin with re-labeled for and antibodies stripped then was membrane ( panel). (upper parasites HA ( IP PfSec13 (WB) using blot analysis Western extracts. parasite NF54 asynchronous or either PfSec13-HA from were extracts beads with agarose incubated to bound covalently antibodies of immunoprecipitation with associated were ( NPCs the examined were 5 and bars: (green) Scale (blue). DAPI with 1 stained were Nuclei 2012). -ci rd sn rabbit using with (red) co-stained F-actin were that parasites expressing (green) GFP F-actin. with with associated is PfSec13 3. Fig. , D c m m etr ltaayi eosrtn co- demonstrating analysis blot Western ) 7ka a sda odn oto.Tesame The control. loading a as used was kDa) 37 tblna ifrn tgso eeomn,in development, of stages different at -tubulin .( m. ( m. a C B -Act Fssoigc-oaiaino PfSec13-GFP of co-localization showing IFAs ) )In 239–253 c c , tbln(e)drn h D.Saebar: Scale IDC. the during (red) -tubulin , tblnmyidct osberl of role possible a indicate may -tubulin ( c 3ka,wihi pcfct h PfSec13- the to specific is which kDa), 93 a A tbln( -tubulin 0 fte7 ulifo l tgsthat stages all from nuclei 73 the of 60% H nioisidctdefficient indicated antibodies -HA ue eouinIA ftePfSec13- the of IFAs resolution Super ) , , .falciparum P. 0ka oe panel). lower kDa; 40 c c c tblnw sdatransgenic a used we -tubulin , tblnc-rcptt with co-precipitate -tubulin tblnwt PfSec13. with -tubulin a 8ka idepnl n F- and panel) middle kDa; 48 -Act a Adls antibody -Aldolase 239–253 c tblnrte than rather -tubulin . Agiaoe al., et (Angrisano c tblna the as -tubulin c a -tubulin. -HA Journal of Cell Science heterochromatin ta. 09 uigteIC lhuhPSc3(re)adPH1(e)lclzdt h ula eihr hyd o olclz.Saebr 1 bar: Scale co-localize. not do they periphery nuclear the to localized (red) PfHP1 and (green) PfSec13 Although IDC. the 2 during bar: 2009) Scale al., panel). et (right-hand co-localize not did eerce ihseii eeohoai ak uhas Lopez-Rubio such 2007; marks al., et heterochromatin (Chookajorn specific PfHP1 2009). and euchromatic with al., H3K9me3 to designated enriched et generally is Trelle heterochromatin be epigenome 2010; a unusual al., this Within et within (Salcedo-Amaya epigenome regions of landscape heterochromatic chromatin The 2 of bar: NPCs Scale The PfHP1-HA-mCherry. and PfSec13-GFP both expressing parasites of microscopy confocal with co-localize not a does PfSec13 4. Fig. 3060 GP(re)and (green) -GFP ora fCl cec 2 (14) 126 Science Cell of Journal .falciparum P. a HKm3(e)a ifrn tgso h D.I 5 ftecutdnce falsae ( stages all of nuclei counted the of 85% In IDC. the of stages different at (red) -H3K9me3 r on wyfrom away found are .falciparum P. .falciparum P. m .( m. otisdistinct contains heterochromatin. B ) nvivo In mgn fprstsepesn ohPSc3GPadPH1H-Cer (Flueck PfHP1-HA-mCherry and PfSec13-GFP both expressing parasites of imaging ( A Fso h fe1-F xrsigprststa eec-muoaee with co-immunolabeled were that parasites expressing PfSec13-GFP the of IFAs ) h ula eihr Fuc ta. 00.T eemn if line parasite determine PfSec13-GFP To the used 2010). we al., regions in heterochromatic et at NPCs located (Flueck in genes the periphery implicated virulence nuclear of were memory the marks epigenetic heterochromatin and silencing these the addition, at Pe foci 2009; In distinct al., at et other PfHP1 (Flueck each periphery and with nuclear H3K9me3 associated be 2009). to al., shown et were Salcedo-Amaya 2009; al., et .falciparum P. m m. n 5 0) h 39e inladPfSec13-GFP and signal H3K9me3 the 100), r on necrmtcor euchromatic in found are ´ e-oeoe l,2009). al., et rez-Toledo m .( m. C ) nvivo In Journal of Cell Science oence,PSc3i eni h ulols N swl si h ula oe(P ht ro)adteE rgthn ae) ,cytoplasm. C, panel). (right-hand ER the and arrow) white (NP; pore nuclear the (left- vesicles in cytosolic ( as and stages. well ER developmental the as in late (N) seen and nucleoplasm also early be the in can in particles fractions seen gold cytosolic but is and envelope PfSec13 nuclear nuclear nuclei, the the some to both mainly localizes in PfSec13 blot trophozoites. western expressing by detected was ( PfSec13-HA control. loading as used rohasadadse ie epciey nA h dniyo hsapio a ofre ysqecn.( 2 the sequencing. only by using plasmid confirmed band the was kDa and amplicon 93 fragment this expected kb of the 12 identity yielding a line The yield transgenic A. to the in expected in respectively, expression are line, parasites dashed NF54 a concatamer. and plasmid arrowheads the within and site ( integration fragment. the across A in shown using cut were a ofre ySuhr lt( blot Southern by confirmed was n efre muoloecneasy IA)wt specific with (IFAs) a assays immunofluorescence performed and NPCs. 3 the PfSec13 to the addition of in replacement nucleoplasm the the showing in found diagram is PfSec13 5. Fig. eeohoai akrHKm3a l tgso parasite the from of away stages found all is at PfSec13 H3K9me3 that marker found heterochromatin We 4A). (Fig. GPand -GFP C C costeitgainst ie . bapio pcfct h fe1-Aprsts rmradapio oainaesona bold as shown are location amplicon and Primer parasites. PfSec13-HA the to specific amplicon kb 1.2 a gives site integration the across PCR ) a Sac HKm3atbde tdfeetsae fIDC of stages different at antibodies -H3K9me3 n rbdwt the with probed and I E ellrfatoaino h fe1-Aepesn aaieln,sprtn h yooi n ula otn.Tefl length full The content. nuclear and cytosolic the separating line, parasite expressing PfSec13-HA the of fractionation Cellular ) B .gNsfo h rngncPSc3H n F4prstsa ela rmtetasetdpamd(pHSec13-3 plasmid transfected the from as well as parasites NF54 and PfSec13-HA transgenic the from gDNAs ). PfSec13 3 9 9 rgetue ntepamd h oainadszs( bad21k)o h xetdpoe rget are fragments probed expected the of kb) 2.1 and kb (8 sizes and location The plasmid. the on used fragment n ih3 with end 6 Afo h osrc pHSec13-3 construct the from HA ( A a fe1 a noeosytge iha Aeioeb 3 by epitope HA an with tagged endogenously was PfSec13 ) H nioywien adi hw nteN5 parasites. NF54 the in shown is band no while antibody -HA otasetdtePSc3GPprst iewt vector a with line parasite PfSec13-GFP we We PfHP1. findings the with these PfSec13 co-transfected of confirm association To possible euchromatic periphery. the investigated nuclear in the localizes of PfSec13 regions that indicating development, hoai-soitdNpi lsoim3061 Plasmodium in Nup Chromatin-associated 9 -3 6 Ab igecosvrrcmiain h integration The recombination. crossover single a by HA D etr ltaayi fPSc3H specific PfSec13-HA of analysis blot Western ) F muoE fPfSec13-HA of Immuno-EM ) 9 a elcmn.Schematic replacement. Adls nioywas antibody -Aldolase adpnl.In panel). hand 9 -3 6 1kb .1 HA) Journal of Cell Science splmnaymtra i.S) eraoe hti the in that tag epitope reasoned test To chromatin. HA We with associated These the S6). be might panel). PfSec13 to Fig. nucleoplasm also right-hand specific material is 5F, it were (supplementary (Fig. but staining PfSec13-HA nucleoplasm periphery nuclear nuclei immuno-gold the the many in to restricted in found known vesicles. not that coated the is COPII observed location the and of we in microscopy component a Interestingly, and resolution as ER Sec13 super of cytoplasmic the function by the in with seen present compatible nuclear signals is also nuclear the which the is with vesicles, at at PfSec13-HA cytoplasmic clusters located it 5F). immuno-EM that (Fig. is and pore using nuclei PfSec13 trophozoite that of level envelope found at structural We PfSec13 the of antibodies. ultra localization both cellular this the within the used determine further to present parasite We line 5E). of is parasite (Fig. fractionation fractions PfSec13-HA cytoplasmic cellular and marker that nuclear step experiments ER one revealed the IDC with a these lysate co-localize addition, NE entire not In the In did the at Pf39. and organization above during S5). dynamic described similar as expressed a Fig. showed is PfSec13-HA material it using visualized length that (supplementary also full indicating was a as PfSec13-HA IFA expressed expressed 5D) is (Fig. The PfSec13 kDa protein. 93 tagged of the size that expected the indicating at Using product single 5B,C). specific (Fig. a site with blots, analysis integration Southern blot in across western by populations sequencing confirmed clonal and was of PCR integration isolation correct line and the parasite 2006) which DC-J al., the into et p005-Sec13-HA Methods) (Dzikowski transfecting and by Materials created (see was plasmid line This 5A). (Fig. fe1 a ue iha Aeioetgb 3 by tag epitope a HA created an we endogenous with the PfSec13 fused which was of in PfSec13 (PfSec13-HA) expression line episomal parasite transgenic to addition In nucleoplasm the in these chromatin of with of associated is PfSec13 results NE. the the of Altogether regions in euchromatic NPCs in periphery. the that regions nuclear suggest heterochromatic experiments indicating from the IDC, away the found of of is stage PfSec13 any that at co-localize again each not to do adjacent found they often other, PfHP1are found and we PfSec13 experiment, although enables co-localization to that H3K9me3 Similar the which parasite. of same results the mCherry the within proteins to both of fused visualization PfHP1 expressing 3062 .falciparum P. ora fCl cec 2 (14) 126 Science Cell of Journal a H nioyw eeal odetect to able were we antibody -HA .falciparum P. 9 replacement r located are nvivo in a -HA ee eeceryerce nteI rcin fPfSec13 of fractions IP ( the antibody perform in mock the enriched to with clearly compared several line that found were We transgenic qRT-PCR. genes by enrichment using PfSec13-HA IP measured (ChIP) and the immunoprecipitation used chromatin we this ugssta fe1 sascae ihpriua chromosomal particular with data associated This loci. is 6). include PfSec13 (Fig. that PFC0210c) no (PF08_0054) suggests protein However, that HSP70 (circusporozoite (TARE). with CSP regions observed loci and repeats was telomeric enrichment chromosomal the significant in in as (PFD0630c) well internal observed and enrichment (PFB1055c) IP in subtelomeric was not change was fold PfSec13 Significant which levels tag. in epitope parasites an wt to in fused not and line transgenic ulddw rti ihc-P fN5 aaie.Teproteins The parasites. NF54 of co-IPs with the protein of repertoire down the pulled compared and using spectrometry mass of parasites by followed PfSec13-HA co-IP roles performed the cellular We on were proteins. we the experiments associated component, its NPC for core identify a to evidence as interested role its further to addition provide in PfSec13, to order In variable with functions proteins cellular with associated is PfSec13 fe1 sa nsa u ihpsil diinlrlsi the in locations. roles cellular additional other possible as with well as Nup nucleoplasm unusual that support an further is provide data associatedPfSec13 These also expected. were as machinery PfSec13 trafficking with complex vesicles coat COPII the the compose Sec13 of with together The that chromatin. proteins with three association for and location support nucleoplasmic further their with providing (PF3D7_0409600), implicated replication proteins and including PF3D7_0310500) and (PF3D7_1417200 proteins regulation RNA transcriptional binding several with the DNA associated in specifically and determine is PfSec13 to addition, important In of components be additional contain will these if future It 7A,B). (Fig. unknown are proteins among associated PfSec13 Factor conserved the NPC. Transport of the eight with Nuclear associated though, be Interestingly might a it that indicating contains specifically domain (NTF) be PfSec13 to with found was associated As that (PF3D7_1423700) 7A. proteins Fig. the in in identified be presented line Nup PfSec13-HA could few are homologues this very S1) transgenic parasites in Table material (supplementary enriched NF54 above the mentioned significantly the were in to that compared only those or recovered parasites, were which asterisks. es he ilgclrpiae.Sgiiac a etduiga using tested at was Mann-Whitney of Significance non-parametric s.e. replicates. and biological average the three represents least data was The PFC0210c] qPCR. CSP by and measured PF08_0054 HSP70, Associated TARE; Telomeric Repeats, respectively); PFD0630c, internal and and (PFB1055c specific subtelomeric of [a wild Enrichment loci in columns). chromosomal change (light fold parasites the NF54 with type compared the columns) using (dark enrichment mock parasites in a change and of antibody fold HA as presented using are parasites Data chromatin. PfSec13-HA with on associated performed selectively was is PfSec13 6. Fig. Plasmodium a GPatbd nPfSec13-HA on antibody -GFP pce u hi ucinis function their but species Plasmodium t a ts ( -test GP ntePfSec13-HA the in -GFP) P , .5 n akdwith marked and 0.05) Plasmodium oee,oeof one However, . a a var H antibody -HA a H antibody -HA H antibody. -HA var genes ee as genes NPC. ChIP a - Journal of Cell Science hw ob seta rtisadtergntcdlto was deletion genetic their and proteins were complex essential Nup84 the be in Nups to other as shown well as Sec13 yeast, In co or RBCs (31%) proteins human Th for binding asterisk. DNA/RNA essential an either ( is are with co-IP. PfSec13 proteins marked NF54 the are the of control with Most negative compared functions. the co-IP cellular (31%). in PfSec13-HA predicted function not their the unknown on but in with based co-IP enriched proteins sorted PfSec13-HA were were the that PfSec13 in proteins with only for associated identified indicated were is that enrichment Proteins fold Exp2). (Exp1, experiments PfSec13. IP with associated Proteins 7. Fig. .falciparum P. ( A ito rtista eefudt eascae ihPSc3H yL-SM nlsso w needn co- independent two of analysis LC-MS/MS by PfSec13-HA with associated be to found were that proteins of List ) rlfrto in proliferation diin niiino ula rnpr a on ob lethal be to found In was shown). transport not nuclear (data of deleted genetically inhibition parasites was addition, transgenic recover PfSec13 to which failed 1996). in we al., et why Siniossoglou explain 2002; might al., This et (Giaever lethal be to found hoai-soitdNpi lsoim3063 Plasmodium in Nup Chromatin-associated B h rtista eefudt be to found were that proteins The ) nserved e Journal of Cell Science elcddiy(i.8) n eeainps-nuainwith post-incubation generation One and was 8A). specific 1.2 medium (Fig. both culture the with daily h h replaced 24 24 After should for molecules. PfSec13- incubated PNA non-specific The thus was used control. line we negative parasite and as addition, HA synthetic molecule In sequence PNA sequence-specific mRNA. non-specific PfSec13 a PfSec13 a are to in molecule hybridize the PNA specifically targets a complements synthesized PNAs new RNA We 2004). that and a Xu, and DNA (PNA). can (Wang try manner both that specific to backbones to Acid modified gene bind decided chemically using with we that Nucleic oligonucleotides PfSec13 evidence gene direct downregulate Peptide essential provide to to an order methodology in is 2009), in PfSec13 exist al., not et gene does of (Baum interference mechanism RNA the by Since knockdown S7). Fig. material (supplementary 3064 fe1 nteprst ouainta a nuae ihthe with incubated was that population parasite the in PfSec13 m Ns eotie pcfc3.%dwrglto of downregulation 36.5% specific a obtained we PNAs, M ora fCl cec 2 (14) 126 Science Cell of Journal Plasmodium aaie olce 6hps nuainwt h PNA increased confirm we the PNA the To in of effect populations. with 30% stronger a parasite in almost obtain and incubation two of results later, these the decrease post between generation a expression was h one control 96 there the However, molecules collected with panel). compared parasites lower PNA PfSec13 8B, we (Fig. the culture) in the with post to difference incubated h molecules 48 no PNA Interestingly, the detected molecules. of (insertion PNA incubation control 1.2 and the targeted with incubated viability were of parasites measurement simple enables using and if an expressed test used constitutively We to viably. interested parasite also NF45- affects were PfSec13 We control of of panel). the with downregulation region upper incubated 8B, coding those (Fig. in the observed PNA was to effect hybridize no while to designed PNA luc aaieln nwihthe which in line parasite luciferase sas(aaa ta. 02.These 2012). al., et (Salazar assays ..LU uiecnert unit. rate luminescence LRU, withs.e. presented is average the and triplicate in performed were experiments healthy All schizonts. mature of a amount lower had significantly population parasite this this At point, incubation. time post h 72 PNA PfSec13 with incubated cultures in deformation with parasites with compared PNA non-specific eeomn fprststetdwt 4.8 with treated parasites of development normal showing smears blood stained Giemsa panels: Lower panel). (upper control populations with compared incubation after h 72 parasitemia lower significantly reached PNA 4.8 with incubated Parasites RBCs. human in proliferation parasite ( ( for falciparum essential is PfSec13 8. Fig. nuainwt 1.2 with incubation in 25.7% decrease a showed PNA PfSec13 specific the with incubated Parasites respectively. (NS) PNA, control or PNA PfSec13 either with incubated were gene reporter luciferase the NF54- viability. parasites’ the reduces PfSec13 of downregulation panel: Lower (upper panel). PNA specific after the h with 48 incubation 36.5% by reduced were of PfSec13 levels Expression respectively. PNA molecules, (NS) non-specific control or PNA the express constitutively NF54- or line transgenic HA nuae ih1.2 with incubated were that PfSec13-HA the expressing parasites of analysis blot Western PNA. respectively]. 3, ( and 2 [time 1, h (TP) point 24/72/96 additional an for keptgrowing were parasites removed and then medium was culture PNA with The h. 24 for (NS- PNA) PNA non-specific or (Sec13PNA) PNA specific Sec13 with incubated were gene C A B luciferase fe1 sdwrgltdb specific by downregulated is PfSec13 ) oneuaino fe1 alters PfSec13 of Downregulation ) uln feprmna ein PfSec13- design. experimental of Outline ) luc aaie osiuieyexpressing constitutively parasites luciferase rlfrto nhmnRBCs. human in proliferation luciferase m ftesm PfSec13- same the of M xrsini parasites in expression m m MofeitherPfSec13 MPfSec13PNA. xrsin9 post h 96 expression eotrgn is gene reporter luciferase luc m MPfSec13 aaie that parasites P. luciferase PfSec13 reporter m M , Journal of Cell Science aaie ouain htwr nuae ihtecnrlPNA the control with the compared with incubated cultures were these mature that specific no populations in almost parasites observed the and deformed were the with were of schizonts cultures incubated many these Interestingly, in population panel). parasites upper parasite 8C, parasitemia (Fig. the PfSec13-PNA in decrease in significant only a obtained 4.8 we to concentration concentration its Wie ta. 01.I al ciooyte aeoutward, face NPCs they of schizogony early distribution In clustered 2011). al., the cellular et Similar specific to (Weiner maintains 2012). similar PfSec13 al., Furthermore, directionality 2011). et in al., reported the (Steinberg et also into while intact were extensions extensions nucleus NE nuclear nuclear in involves the the reported motility from previously NPC maintaining been which away in NPC has pulled yeast an phenomenon be observe This we to cytoplasm. Occasionally, seems 2011). this al., which at et seen clusters (Weiner NPC late single the stage one with in corresponding egress, observed, to late is ready peak spot are In merozoites a schizogony. mature the during when reaches as schizonts gradually increases decreases progress nucleus and per cycle trophozoites NPCs of erythrocyte that number PfSec13 spot parasites’ from The one detected stage. at signal that together single at cluster strong that the with NPCs model corresponds few 3D Using are NPCs. there the stages of those to similar of is IDC of the during evolution the into insight additional Plasmodium provide in could species specifically co-evolve of structures why protein falciparum speculate to unique hard is such makes machinery trafficking COPII and of version in which of found feature extended also is the Nups is Interestingly, known determined. more) be (or to as two yet of isoform similarities its structural large have in Nups as its Nups in additional well Whether only falciparum annotation. as found genome not complex, by is does predicted PfSec13 and Nup84 hands, our processing In the undergo component. COPII of a as part functions Sec13 as the of by functions vertebrates) structural assembled the maintains seems that complex which fusion a organisms as other evolve in to than protein larger we significantly the Here of component organisms. in first these the NPC as the in PfSec13 as characterized studied well and as thoroughly identified NE expression, not the gene were of components NPC virulence knowledge in our to involved however, is which periphery compartment, nuclear The 2006). Capelson Hetzer, 2011; of and Akhtar, D’Angelo and 2010a; al., (Arib as in et genome repair emerging splicing, DNA involved transcription, and are as are organization such complexes functions which pore nuclear compartments several nuclear sub-nuclear the specialized years recent in In that proliferation Discussion indicates parasite data alters this PfSec13 RBCs. Altogether, human of panel). downregulation lower 8C, (Fig. h yaiso fe1 raiaina h ula envelope nuclear the at organization PfSec13 of dynamics The Plasmodium .falciparum P. .falciparum P. Sec13 Plasmodium Sec13 aesmlrsrcua hrceitc nwihlarge which in characteristics structural similar have and NPCs. a eune,hv nytesotconserved short the only have sequenced, was ulooisadgnm eune fadditional of sequences genome and nucleoporins .knowlesi P. h urn nweg on knowledge current The . uliw aercnl hw hta al ring early at that shown recently have we nuclei .knowlesi P. ihuiu tutrlfaue.PSc3i a is PfSec13 features. structural unique with rwmc teto sasub-nuclear a as attention much drew m .7 oticbto ihthis with incubation post h 72 M. ute ucinsrcueanalyses structure function Further . hl other while , ? u15 o u1710in Nup107-160 (or Nup145C .falciparum P. Plasmodium Plasmodium (Weiner p. in spp., Sec13 NPCs P. P. rvnb irtbls iei- n yenwiein while with NPCs dynein the and of association kinesin-1 microtubules, cerevisiae by driven r cieyivle nrgltn rncito in transcription regulating in and involved have chromatin nucleoplasm, actively bind Nups the are additional Recent in and 1997). Nups Sec13 al., that of demonstrated et role Griffis al., the Zimowska et 2002; investigating 2000; Rabut 1995; al., studies, al., al., et et et Powers Enninga Smitherman 2002; al., 2003; 2004; et the al., Lindsay (Daigle 2002; at et eukaryotes al., role Enninga et higher 2001; their of mobile al., to nucleoplasm be neighboring et the addition to within reported In were found the 2002). Sec13 and al., including active (Dilworth of Nups et several lamina Ishii protect NPCs, effect nuclear 2005; al., that the repressive et of boundaries the environment chromatin heterochromatic 2006) from al., as et Taddei promoters 2006; function al., to et shown (Schmid that were NPCs periphery Ko the nuclear with the 2009; interact at transcribed Hetzer, genes Akhtar, and Active and Arib in Capelson 2007; Gasser, transport, 2011; and nuclear organization (Akhtar chromatin in expression in gene role implicated and were their NPCs (Blobel, the to interacting years genome addition recent of the in capable in Indeed, organelle portions 1985). gating transcribable a with as specifically serve indicate can periphery the they nuclear that the that at ago NPCs years of many supportive distribution proposed nonrandom are hypothesis results gating’ were ‘gene These the the 2009). of al., which Pe in et 2009; Salcedo-Amaya al., et heterochromatin 2009; PfHP1, Lopez-Rubio 2009; in silent al., et and located Flueck for of not H3K9m3 epigenome markers are unusual clusters as contain NPC demonstrated that that analysis shows ultra-structural regions data previous al., our current et with (Weiner our matter agreement genetic In were lucent NPCs electron 2011). the of that regions interesting in is found it development, parasite NPCs during regulating in possibility the involvement test are IDC. to (Fowler during proteins required dynamics polarity motor are merozoite these studies with Further that 2001). associated al., be in et abundant to are shown that were dynein and kinesin addition, ugse htfnicntnl earneterNC and in nuclear NPCs movement for their NPCs need the Interestingly, re-arrange overcome lamina. constantly to chromosomes fungi was corresponding It for 2012). that responsible al., et is (Steinberg suggested demonstrated fungi movement several was in dependent for organization it ATP NPCs responsible Recently, driven are elusive. motor that still that mechanisms are the dynamics and their NPC lamina for as no responsible such is is eukaryotes there lower which in lamina are however, NPCs (Colo nuclear organization, the 1997) the eukaryotes al., higher in In et 2010). embedded Winey Ho, 2006; 2003; al., al., Fiserova et et in 1997; Ramos Maeshima reported Wente, 2009; were and al., cycle (Bucci number et eukaryotes cell the and the in plants during dynamics certain NPCs Similar of cytoplasm. distribution the the transport and of efficient into each with mRNA of consistent of cytoplasm is the which face merozoites, they daughter schizonts late in whereas hog h Psdrn lsdmtssi apicomplexan in mitosis closed centrosome during cytoplasmic the NPCs with the interact through form that with microtubules agreement that centers showed in kinetic that are study data ultra-structure early These an F-actin. with association than aaie (Schre parasites hoai-soitdNpi lsoim3065 Plasmodium in Nup Chromatin-associated osdrn h rmtccagsi hoai organization chromatin in changes dramatic the Considering ti eedn nFatn u eut niaean indicate results Our F-actin. on dependent is it ´ e ta. 97 tipne l,20) In 2007). al., et Striepen 1977; al., et vel .falciparum P. c tblnin -tubulin Cokjr ta. 2007; al., et (Chookajorn he n ut 2010). Hurt, and ¨hler .falciparum P. siaomaydis Ustilago ´ e-oeoe al., et rez-Toledo .falciparum P. Plasmodium Drosophila rather ´ n- S. is Journal of Cell Science ecnaeo netdeyhoye a sesdb lo ma htwas that smear blood a (Sigma). by Giemsa assessed with stained was and erythrocytes fixed methanol infected of Percentage l aaie sdwr eiaie fteN5 aaieln,cliae t5% at cultivated sodium line, ml 0.25% mg parasite (Invitrogen), 0.1 II NF54 Albumax and the 0.5% bicarbonate medium, of 1640 derivatives RPMI in were haematocrit used parasites All culture Parasite Methods and Materials buds. and membrane the of deforms assembly cytosolic the Sec13 requires the vesicles COPII the of Budding the where unclear which is domain it the the Nup145C contains Since truncated to and 2008a). homology larger al., structural much et shares is (Struck Golgi PfSec13 the native to similar conserved that the dynamics PfSec13 forms of which part domains b N-terminal repeat WD-40 aa the 340 included conserved the the GFP in to and a ER expressing fusion present episomes the also Interestingly, in vesicles. was immune-EM cytoplasmic by in PfSec13 detected nucleus reasonable and endoplasmic the fraction therefore cytoplasmic to is the It addition from apparatus. in Golgi that transport the to mediate (ER) reticulum that vesicles coated well. as in eukaryotes role lower regulatory in possible expression a gene indicate of chromatin nucleoplasm with sub- the association The in the proteins. PfSec13 in associated of found chromatin presence contains also that was fraction the PfSec13 nuclear to fraction, addition bound in Interestingly, membrane determined. of was hundreds proteins of nuclear location sub-nuclear the the fractionation of biochemical analysis recent of by proteome supported with nuclear is DNA proteins, associated several binding with selectively RNA associated is and is and al., nucleoplasm PfSec13 et the in Vaquerizas that chromatin 2010; finding al., Our et Kalverda 2010). 2010b; al., et (Capelson 3066 37 u addtsin as suggested candidates were Nup PF14_0706 and PFI0250c proteins, Additional in NPCs the organism. this unique determine in COPII to forming the interesting are the be considering vesicles will COPII it form However, how PfSec13 native to cytoplasm. the of PfSec31 the structure endogenous in the vesicles the with that speculate assemble can N one and truncated (PFB0640c) Sec31 to orthologue of complex Y the into assemble could it ta. 08 auae l,21)wihwl rvd valuable provide will function. which and 2010) structure NPC al., Apicomplexan et about Tamura information 2008; the al., unveil and to et trypanosomes order African in for lines NPCs performed entire transgenic in be the repertoire could The Nup of tagged entire co-IP 2010). endogenously perform is al., to PfSec13 used et which in evolutionarily (Tamura here that was created plants as or repertoires in PfSec13 nucleoporin more shown for different as have suggested function organisms to as to distinct Nup analysis differently one evolved sequence have than could simple Nups in the some homologs of Nups al., were inefficiency et identify Zhang genes 2010; The these al., et of (Volz 2011). each markers periphery of nuclear peptides as used single against raised were poelrlclzdt eie u-oan fteE with ER the of sub-domains defined to localized -propeller ˚ ntectpam e1 ucina opnn fteCOPII- the of component a as function Sec13 cytoplasm, the In h rsn td rvdstefrtgac tcmoet of components at glance first the provides study present The na topeeo %oye,5 abndoiead9%nitrogen. 90% and dioxide carbon 5% oxygen, 5% of atmosphere an in C ? ora fCl cec 2 (14) 126 Science Cell of Journal b e3 eeoie htcnplmrz noacg that cage a into polymerize can that heterodimer Sec31 poelrpr ftepoenwudbn n whether and bind would protein the of part -propeller Plasmodium 9 PSc3GPfrsa forms -PfSec13-GFP .falciparum P. .falciparum P. 2 1 Plasmodium etmcn(im) aaie eeicbtdat incubated were Parasites (Sigma). Gentamycin neln h is u nti organism. this in Nup first the unveiling .falciparum P. n oylnlatbde that antibodies polyclonal and Ohige l,21) Using 2012). al., et (Oehring iia owa a recently was what to similar .falciparum P. b Arabidopsis poelrta could that -propeller .falciparum P. Plasmodium ih niaethat indicate might otisan contains (DeGrasse n its and NPCs. irsoeeupe ihEiBlue Exi with equipped microscope ldsadimdaeyvsaie.Iae eetknuigAohoa oil Apochromat using taken were Images visualized. with objective immersion immediately and slides 09 n HSc3GPIH h utr a utvtdwt obeselection double with cultivated al., was et culture (Flueck The pBcamHP1-HA-Cherry pH-Sec13-GFP-IDH. co-transfected and was 2009) line parasite NF54 The vivo In following the in at (Sigma) used rabbit BSA 1/500, antibodies 3% (Roche) primary with slight with blocked incubated with then dilutions: then and PBSx1, were 2011) in (Sigma) Cells (Bio-Rad) PBSx1. al., Paraformaldehyde and Tx-100 treated washed and (4% 0.1% pelleted et were were with parasites solution parasitemia Fixed (Riglar PBSx1). in 5% fixative (EMS) glutaraldehyde at before 0.0075% fresh culture described with a from re-suspended as cells Briefly, performed modifications. was IFA assay Immunofluorescence http://www.pymol.org). LLC, PfSec13 figure Scientific across the The Sec13 (Delano and 2012). of 2010) PyMOL al., al., alignment et et Sequence using (Roy Yang server generated 1999; I-TASSER the al., was using et generated using (Gouet was generated Espript model was and ScSec13 1.6.1 and PfSec13 Chimera of alignment PfSec13 sequence for Structure-based homology sequence and Structural eewse ihPS1adr-upne ih2 with Parasites re-suspended ice. on and saponin PBSx1 5% with with lysed were washed iRBCs were proteins, parasite collect analysis To blot western and SDS-PAGE Maryland, Bethesda, ImageJ Health, by of assessed was Institutes 1997–2009). fractions National http://rsb.info.nih.gov/ij/, relative cytosolic US USA, The and ImageJ, described. nuclear as W.S., Each of blot fraction. (Rasband, bands nuclear western the the and as of SDS-PAGE kept intensity the by then and and analyzed fraction clear was cytosolic until the fraction CLB as for with kept ice washed was on was supernatant incubated saponin pellet The (CLB) Briefly, pelleted. buffer and 2009). lysis minutes al., cell 30 et with re-suspended (Flueck were before parasites described lysed as done was Fractionation Fractionation 0.1M in glutaraldehyde 0.1% with paraformaldehyde (pH 4% buffer cacodylate in fixed 3D were Parasites DeltaVisionOMX a EM Immuno in visualized and IFA System for Microscopy Illumination prepared Structured were Samples imaging optical resolution Super Scientific). 18 (Thermo with covered stain (EMS), slide fluorescent coated Teflon 33342 a on Hoechst laid were with samples Then incubated and 2 PBS and WR99210 nM 5 using irsoeTca prt(E)a 2 VuigCDEgecmr ihTIA with camera Eagle temperature. CCD using room electron kV at transmission 120 on at min (FEI). viewed 30 (FEI) software digitally Spirit dilution) The and Tecnai 1986). scanned (1:20 (Tokuyasu, microscope Tokuyasu were particles by sections 10- performed embedded gold to were 20. coupled embedding nm) IgG Tween and anti-mouse 15 Contrasting 1% goat by (or and followed temperature gelatin nm blocking room 0.1% at a mouse hours glycine, by using 1.5–2 blocked 0.1% performed were was BSA, Sections Immunolabeling 1% grids. containing nickel coated solution formvar 200-mesh on eepoesduigteAivso . eovlto otaepackage. software deconvolution 4.8 Axiovision the Z-stacks (Zeiss). using camera processed Mrm in AxioCam were an mounted with equipped (Zeiss) and microscope 200M coverslips coated 100 (Sigma) Apochromat Polyethyleneimine a VectaShield on settled and goat conjugated n srp Cen ta. 03 oe ta. 1999). al., et Gouet 2003; al., et (Chenna Espript and W h ebaewt rmr nioydltdwt lcigslto sfollows: as milk solution skim blocking incubating with 5% by diluted out with antibody carried blocked was primary nitrocellulose Immunodetection a were RT. to with at Membranes membrane hour electroblotted minutes. the 1 90 for were PBST (Bio- for in apparatus Proteins mA (Difco) SDS- transfer 135 hour. wet to a 1 at subjected using Rad) BioScience) for were Schuell and along & volts (Schleicher Bio-Rad) (Bio-Rad) membrane 100 plus, gels at (Precision polyacrylamide marker PAGE 4–20% size on protein loaded with were Proteins (Sigma). 2011). al., et (Riglar previously described as USA), Issaquah, Inc., iudntoe.Foe lrti 7–0n)scin eectwt diamond a with cut were in sections frozen rapidly nm) and (70–90 sucrose at ultrathin 2.3M knife in Frozen overnight nitrogen. soaked were liquid samples The days. 2 nuae ihete Alexa-488 either with incubated mouse and 1/500 (Abcam) tubulin imaging 2 a 120 H Rce /0,rabbit 1/500, (Roche) -HA H ˚ naLiaE C lrmcooe h etoswr collected were sections The ultramicrotome. UC6 EM Leica a on C AIsan loecneiae eeotie sn Plan- a using obtained were images Fluorescence stain. DAPI 6 a rbi eodr niois(nirgn.Smlswr washed were Samples (Invitrogen). antibodies secondary -rabbit 14 i meso hs otatln Zis na AxioVert an on (Zeiss) lens contrast Phase immersion oil /1.40 5 a -Act .) o ora omtmeaueadkp t4 at kept and temperature room at hour 1 for 7.4), 6 0 anfcto Oyps na lmu IX71S8F Olympus an on (Olympus) magnification 100 239–253 m fbatcdn el eeplee,dltdwt 1 with diluted pelleted, were Cells blasticidin. of g a Agiaoe l,21)150 rabbit 1/500, 2012) al., et (Angrisano H P3 M4 /0.Smlswr ahdand washed were Samples 1/500. (MR4) -Pf39 TM a Plasmodium ojgtdgoat conjugated HKm3(ilpr)130 mouse 1/300, (Millipore) -H3K9me3 atcmr (QImaging). camera Fast H OX3-I,ApidPrecision Applied 3D-SIM, (OMX a H nioy(:0;Rce for Roche) (1:100; antibody -HA pce a oeuigClustal using done was species 6 a aml apebuffer sample Laemmli mueo Alexa-594 or -mouse 6 a ˚ 8cover 18 o 1– for C -gamma a -GFP 6 H Journal of Cell Science fe1 rgetadapie tteH a (F-GCGCCTCGAGCTGGTCA- tag HA nM the 5 at endogenous with primer the R-AAGCTTTTAGAGCTCGGCATAATCTGGAAC). on a selection primer AATGAACGG; a and drug using ‘‘off’’ fragment done was and PfSec13 site ‘‘on’’ integration across of PCR WR99210. cycles following recombination Cret60)uigpie esa ecie eoe(leke l,2010; al., immuno- locus. et after each and DNA, for recovered (Flueck input input of DNA of series before target dilution percentage ten-fold as of described a defined to amount PCR as compared time The directly real was sets 2007). precipitation quantitative al., by primer et tested using was Chookajorn locus 6000) genomic specific (Corbett each at ChIP of PfSec13 construction Plasmid Mouse 1/700 . mfo h otmo h odn el.Te h eswr ahdtwice washed were gels the of Then distance wells. a loading reached samples the the of until bottom bound 4–20% gel the the a on from on loading down run cm pull by and 1.5 control NF54 prepared (BioRad) the gel were and down acrylamide analyses pull PfSec13-HA LC-MS\MS the of the fraction for samples The analysis spectrometry Mass was extract the debris, cell 4 discard at min To 3 ice. for on rpm 3000 min at 20 parasite 1 centrifuged for The in Tx-100 saponin. (Roche)] [0.5% 1 0.05% buffer cold inhibitor IP using iced cold parasite ml of ice wild-type ml 5 on NF54 3 with lysed twice or washed was line was transgenic parasitemia pellet Sec13-HA 7% either at of cultures portion ml 300 A Co-IP 1 with incubated was chromatin out Sonicated carried was bp. Sonication 800 concentration. final Bioruptor M 0.125 the halted a was by to Crosslinking Glycine modifications. of slight described addition with by as 2007) chromatin al., crosslinked et formaldehyde (Chookajorn 1% before using out carried were ChIPs IP Chromatin probe. Detection a and as used Labeling was DNA and Prime construct 3 Sec13 High The DIG (Roche). kit using starter DNA high- performed to denaturation. to alkaline transferred was after digested was action detection DNA capillary was by The membrane (TBE). nitrocellulose parasites Tris/borate/EDTA bond in recombinant agarose enzyme 1% restriction from using 1989). the al., isolated and by et Southern blots (Sambrook DNA completion sequencing. protocols Southern by genomic established using to followed Briefly, according sites performed performed integration were was the blots construct crossing PCR integrated diagnostic the of Analysis analysis blot Southern using epitope, using HA plasmid an pHRIDH with the PfSec13 into endogenous R-ccccggga- cloned (F-ccccgggaaaatgaacgaattagtagtg; and PfSec13R ttgttcatatgtgtatt) and PfSec13F using primers using amplified cloned R-cccaagcttttatttgtat- was and GFP (F-gaagatctatgagtaaaggagaagaact; agttcatccat) pH-Sec13GFP-IDH. GFPF-GFPR generate primers to the C-terminus its at GFP l 0m DA %SSad5m T)fr1 i t65 at min 15 for DTT) mM 5 Tris- and mM (50 SDS buffer 1% elution EDTA, with sample mM the 10 incubating Cl, by eluted was chromatin H8.Teprstsetat eeicbtdwt h ed o r t4 at hrs 2 for beads NaCl the 0.5M with HCl, incubated Tris unbound were mM of extracts removal (50 parasites the wash The for pH 3) 8). high pH pH neutralizing NaCl a 0.5M by glycine, followed mM antibodies (50 buffer pH low with 30 (Roche); pH005-3 plasmid the into cloned and ttgttcatatgtgtattttg) R-catgccatgga- (F-aactgcagcctccagcacaacaacaag; PfSec133’F-PfSec133’R primers with incubation by followed WEHI) Baum, Jake Dr rabbit by given rabbit kindly (polyclonal, 1/500 Millipore), (07442, apewsicbtdwt 20 with incubated was sample wrig hnlae na15m pnclm Boa)adfe hog by through flew and (BioRad) column in spin kept and ml collected 1.5 was fraction a unbound The on gravity. loaded Then swirling. rcinwsdcosikdb nuainoe ih t65 at night over incubation by decrosslinked was fraction eto h oun eewse ietmsb rvt lwwt 500 with flow gravity by 500 times with five twice washed and were buffer columns the on left itcnlg)oengta 4 at overnight Biotechnology) LTD). Industries, Membranes Biological (Israel INC). solution EZ/ECL Laboratories, by ImmunoResearch developed were (Jackson, (HRP) Peroxidase 65 150 i n ltdit la tube. clean a into eluted and min 5 ˚ .DAwsprfe sn C uiiainclms(ign.Teefficiency The (Qiagen). columns purification PCR using purified was DNA C. m m e oueof volume bed l fnnrdcn apebfe 4 D,10m rsHl H8 for 8) pH Tris-HCl, mM 100 SDS, (4% buffer sample reducing non of l Pst a mueo mouse or -mouse a lndit h xrsinvco HIH(ie l,20)fsdto fused 2008) al., et (Li pHRIDH vector expression the into cloned was a and I GP(ba) npeec f30 of presence in (AbCam)] -GFP a H Rce,150rabbit 1/500 (Roche), -HA Nco H ls(ignd)fr1 usst e N ierneo 100– of range size DNA a get to pulses 12 for (diagenode) Plus .Itgainit h eoeocre nasnl crossover single a in occurred genome the into Integration I. a H on grs ed Acm htwr prewashed were that (Abcam) beads agarose bound -HA 9 a m n fPSc3wsctwith cut was PfSec13 of end rbi eodr nioiscnuae oHorseradish to conjugated antibodies secondary -rabbit l1 Bgl ˚ 6 .Tesml a hruhywse n bound and washed thoroughly was sample The C. m lcgnad100 and Glycogen g B.Tebaswr hnicbtdwt warm with incubated then were beads The PBS. Iand II a GP(oh)ad110 rabbit 1:1000 and (Roche) -GFP Sac 6 Hin ˚ .Tespraatwsicbtdwith incubated was supernatant The C. a B,1 PBS, P3 M4,150rabbit 1/500 (MR4), -Pf39 n ujce oglelectrophoresis gel to subjected and I dIII. PfSec13 m 6 / ehrs ed SnaCruz (Santa beads Sepharose A/G l B n a hnicbtdwith incubated then was and PBS PfSec13 6 opeeET reProtease free EDTA Complete 3 m 9 m 6 2 rtiaeKfr1h at hr 1 for K Proteinase g nioy[ antibody g Nco a mlfe sn the using amplified was A(leke l,2010) al., et (Flueck HA 20 a mlfe sn the using amplified was ˚ ˚ .Tedecrosslinked The C. I .Teaaoebeads agarose The C. -Pst Xma rmtep005- the from I ˚ .Tebound The C. .T a the tag To I. a a m -H3K9me3 H 3F10 -HA a fteIP the of l -aldolase ˚ while C h fe1-Apl oncmaigwt h oto n nwiha es three least at which in presented. and in are control the twice identified the least using at were with (FDR), enriched comparing peptides were rate down that pull discovery Proteins PfSec13-HA false engine. the search the Mascot determine the to and Sequest order (in databases The decoy software analyses. the Discoverer against by spectrometry on identified 1.3 LC-MS/MS Mass and version by spectrometer for and analyzed mass min were sent (Thermo) peptides 30 OrbitrapXL tryptic and for the the water out and with for trypsinized cut washed were (Geba) than were samples was solution samples stain staining The stained protein swirling. SeeBand the while RT ml at 100 hour with 1 stained and water with GAATT)CTTG rnnseii N oeue[5 molecule PNA non-specific or TGGATAGT(TO)CCTTCTAG] Cer xrsinvco.W lotakDvdRga and Riglar David GRASP- thank the also for We University vector. McMaster the expression and from mCherry vector expression Herrmann Basel PfHP1 of Susann the University The with from us pH005-3 Voss providing Till Dr. kindly thank for to like would We Acknowledgements protein PfSec13 endogenous the of using expression blot the measure western in by to downregulation of enabled level lines the parasite were These 2012) [5 al., TCTAGCACCT(TO)ATGCAGC(TR)]. molecule PfSec13PNA et specific (Salazar either with parasites hours NF54-luc 24 for and incubated line molecules transgenic PNA specific PfSec13-HA using PfSec13 of Downregulation ktr .adGse,S M. S. Gasser, and A. Akhtar, References at http://jcs.biologists.org/lookup/suppl/doi:10.1242/jcs.122119/-/DC1 online available material Scheme Supplementary Operational Support NHMRC Government Infrastructure Government made Institutes Australian State number (IRIISS). was Research the [grant and Victorian here Independent Support Fellowship presented through Infrastructure Australian Future data an possible through Experimental (ARC) [grant supported FT100100112]. Fellowship Council is Career Young J.B. Early Research NHMRC Program APP1053801]. an W.W. Science number through RGY0071/2011]. number number Frontier supported [grant [grant is Human Grant Grant Program Project a Investigator laboratory NHMRC and Baum an the APP1024678] through in Research supported the (NHMRC). was Australia Research from Medical Senior of and a Health Council Fellowship by National is the supported from Postdoctoral is L.T. Fellowship C.B.W. Research Exchange Jerusalem. Sydney. Chancellor’s Technology, University, of Scientific a University Senior Hebrew the by Australia-Israel the from Foundation scholarship supported of an a Friends Memorial and by fellowship Australian Joels N.D.- student supported Sciences. (AISEF) Medical Foundation Lena and was Life and the P. in Binational Excellence Jacob States-Israel for supported Lectureship United also the is the R.D. 2007350]. by by number [grant supported Foundation Science was work This Funding paper. and the wrote experiments R.D. interpreted designed and and reagents, N.D.-P. experiments results. interpreted new interpreted designed C.B.W. provided and J.B. and T.W.G. data and L.T. results. analyzed E.Y. V.S., W.W. M.E., M.P., results. experiments. N.K., experiments in A.N., performed participated and results. designed interpreted conceived, and R.D. and N.D.-P. synchronization contributions establishing Author in help techniques. their microscopy for and Zuccala Elizabeth utr eimwscagddiyadPAmlclswr ahdaway. washed slides. were stained molecules Giemsa on PNA microscopy direct and the by incubation daily counted of also h changed was 24 Parasitemia After was 2012). al., medium et (Salazar culture described as viability parasites’ hoai-soitdNpi lsoim3067 Plasmodium in Nup Chromatin-associated a.Rv Genet. Rev. Nat. 6 Apamdue satmlt o lnn.W hn Dr. thank We cloning. for template a as used plasmid HA 8 507-517. , a Plasmodium H nioyadt efr uieaeasy omeasure to assays luciferase perform to and antibody -HA 20) h ula neoeadtasrpinlcontrol. transcriptional and envelope nuclear The (2007). eto fteNB-Rdtbs n against and database NCBI-NR the of section 9 9 COOH-(K)8 COOH-(K) 8 Journal of Cell Science aesn .adHte,M W. M. Hetzer, and M. Capelson, hna . uaaa . ok,T,Lpz . isn .J,Hgis .G and G. D. Higgins, J., T. Gibson, R., Lopez, T., Koike, H., P. Sugawara, Fraser, R., Chenna, and S. C. Osborne, A., J. Mitchell, E., A. P. Debrand, Silver, L., and Chakalova, J. O. Rando, A., W. D. Drubin, M. R., Hetzer, C. Brown, and M., U. J. Casolari, Wagner, W., Mair, R., Schulte, W. Y., Liang, M. M., Hetzer, Capelson, and C. Doucet, M., Capelson, Lesne, O., Gadal, C., Zimmer, S., Rodriguez-Navarro, A., Genovesio, G., G. Cabal, uc,M n et,S R. S. Wente, and M. Bucci, U. T. Schwartz, and G. S. Brohawn, nig,J,Lv,D . lbl .adFnor,B M. B. Fontoura, and G. Blobel, E., D. Levy, J., Enninga, H. J. Brickner, and D. Egecioglu, K. Deitsch, and M. Frank, R., Dzikowski, Thompson, T., R. Good, F., M. Duffy, J., A. Marty, S., T. Voss, T., M. Duraisingh, rcnr .H n atr P. Walter, and H. J. Brickner, zkwk,R,L,F,Aui,B,Eseg . rn,M,Ptl . elm,T E. T. Wellems, S., Patel, M., Frank, A., Eisberg, B., Amulic, F., Li, R., Dzikowski, J., J. Smith, H., R. Christmas, C., E. Yi, S., R. Rogers, J., A. Tackett, J., D. Dilworth, ol,M . isn .W,Rcad,J . ilr .T,Tte,K . Conway, K., K. Tetteh, T., D. Riglar, S., J. Richards, W., D. Wilson, J., M. Boyle, G. Blobel, ipos . geis .adSuz F. P. Stutz, M. and Rout, N. and Iglesias, G., C. Dieppois, M. Field, T., B. Lippincott- Chait, E., A., J. Hallberg, DeGrasse, G., Imreh, L., Hartnell, J., Beaudouin, N., W. Daigle, M. Hetzer, and A. M. D’Angelo, am . aefs,A . ar .R,Jne .J,Vahu . aes .P., A. Waters, D., Vlachou, J., C. Janse, R., G. Mair, T., A. Papenfuss, J., Baum, R.; A. Williams, Akhtar, and M., G. Arib, Otten, Y., Kita, E., R. Cibulskis, S., E. M., Zuccala, Aregawi, J., M. Delves, C., J. Volz, A., Sturm, T., D. Riglar, F., Angrisano, 3068 hoaon . zkwk,R,Fak . i . iai .Z,Hrl .L and L. D. Hartl, Z., Colo A. Jiwani, F., Li, M., Frank, R., Dzikowski, T., Chookajorn, programs. D. J. Thompson, genome. the of landscape the 6 shaping transcription: and Replication organization spatial chromosomes. alter program across transcriptional in in changes expression induced Developmentally gene regulate components pore eukaryotes. higher nuclear Chromatin-bound (2010b). disease. nuclear and the development to genes transcribed al. of et sub-diffusion C. E. confine envelope. Hurt, factors C., J. interacting Olivo-Marin, SAGA F., Feuerbach-Fournier, H., Buc, A., urin ftencergenome. nuclear the of guardians yeast. lattice. complex pore nuclear the Biol. in element edge Nup145C-Sec13 nuto nrlaiga RAncerepr block. export nuclear mRNA an releasing in induction Biol. Cell virulence F. of A. regulation Cowman, to falciparum. and linked Plasmodium S. repositioning in B. genes locus Crabb, A., and Scherf, silencing H., Heterochromatin L. Freitas-Junior, K., J. h ula membrane. nuclear the iuec ee ymlraparasites. malaria by genes virulence W. K. Deitsch, and production. antigen of independently regulated Pathog. is PLoS parasites malaria by genes virulence NPC- endogenous in function Prp20p D. control. chromatin-bound J. transcriptional Aitchison, and mediated and W. R. Nup2p Wozniak, T., nucleoporin B. Chait, F., A. Siegel, .J,Rlh .A,Bu,J n esn .G. J. Beeson, and advance J. development. and drug events Baum, invasion and erythrocyte vaccine A., define to S. merozoites falciparum Plasmodium Ralph, J., D. RAepr eetrMx7 otiue oncerpr nhrn factivated of anchoring pore nuclear to subnuclear contributes Mex67p genes. and receptor export nuclear mRNA of characterization proteomic trypanosomes. from subcellular structures and isolation cells. mammalian live in turnover low 84. very a J. have Ellenberg, and networks and J. Schwartz, organization. cellular eeisadcmaaiegnmc eelRA sntfntoa nmalaria in functional not F. is T. RNAi Koning-Ward, reveal de genomics and S. comparative parasites. B. and Crabb, genetics F., A. Cowman, control. Organisation. Health Programme World Malaria Geneva: parasite. Global malaria Organization. the of stages developmental across al. ONE et filaments PLoS S. D. actin Marapana, of A., M. localisation Olshina, C., Dekiwadia, L., Turnbull, opee n h yolsi lo cytoplasmic reinhardtii. the Chlamydomonas and complexes Garcı and W. K. Deitsch, cd c.USA Sci. Acad. nRms .A,Slsuy .L,Snes .A,Seo,S . igr .H. R. Singer, M., S. Shenoy, A., M. Sanders, L., J. Salisbury, A., D. ´n-Ramos, 669-677. , 16 .Cl Biol. Cell J. o.Cl.Biol. Cell. Mol. 1173-1177. , 18) eegtn:ahypothesis. a gating: Gene (1985). ur pn elBiol. Cell Opin. Curr. uli cd Res. Acids Nucleic Nature 23 ora fCl cec 2 (14) 126 Science Cell of Journal uli cd Res. Acids Nucleic aBac,M A. M. ´a-Blanco, 7 338-345. , e32188. , 2 e22. , 104 20) pgntcmmr tmlravrlnegenes. virulence malaria at memory Epigenetic (2007). 441 Cell 20) utpesqec lgmn ihteCutlsre of series Clustal the with alignment sequence Multiple (2003). 136 899-902. , 20) ehnssudryn uulyecuieepeso of expression exclusive mutually underlying Mechanisms (2007). 770-773. , ee Dev. Genes el o.Lf Sci. Life Mol. Cell. 21) utpefct fncerprpeyi eeexpression gene in periphery nuclear of facets Multiple (2011). 1185-1199. , 26 LSBiol. PLoS 140 7858-7870. , MORep. EMBO 372-383. , 19) nvv yaiso ula oecmlxsin complexes pore nuclear of dynamics vivo In (1997). e.Cell Dev. 20) eercuteto h ciae N1lcsto locus INO1 activated the of recruitment Gene (2004). 37 31 ehd o.Biol. Mol. Methods 23 20) smercdsrbto fncerpore nuclear of distribution Asymmetric (2003). 3788-3798. , rc al cd c.USA Sci. Acad. Natl. Proc. 21) eepstoigadexpression. and positioning Gene (2011). 20) h oeo ula oe ngn regulation, gene in pores nuclear of role The (2009). 3497-3500. , .Cl Biol. Cell J. odSrn ab yp un.Biol. Quant. Symp. Harb. Spring Cold 19 346-353. , Cell 20) ula oecmlxsfr immobile form complexes pore Nuclear (2001). 2 1188-1198. , e342. , MORep. EMBO 20) oeua rhtcueo h Nup84- the of architecture Molecular (2009). 20) h oeo h ula neoein envelope nuclear the of role The (2006). 121 10 4 20) orncitoa erimn othe to recruitment Cotranscriptional (2006). 941-952. , aiaino ea-uui RAin mRNA beta2-tubulin of calization 697-705. , 63 rc al cd c.USA Sci. Acad. Natl. Proc. 13-24. , 20) uulyecuieepeso of expression exclusive Mutually (2006). . 316-332. , (2010). 171 21a.Ncerpr complexes: pore Nuclear (2010a). 955-965. , 8 463 959-965. , ol aai eot2010 Report Malaria World 77-92. , Science 21) slto fviable of Isolation (2010). 20) oeo nucleoporin of Role (2002). 107 14378-14383. , 295 .Cl Biol. Cell J. 20) h mobile The (2005). 20) High-yield (2008). 20) Molecular (2009). 1523-1525. , a.Src.Mol. Struct. Nat. a.Rv Genet. Rev. Nat. 82 21) Spatial (2012). ol Health World 75 8527-8529. , ur Opin. Curr. rc Natl. Proc. 585-597. , 154 (2006). (2005). (2005). (2005). 71- , . avra . ikrgl,H,Slm,V .adFreo,M. Fornerod, and V. V. Shloma, H., Pickersgill, B., Kalverda, au,G,Le G., Rabut, J. D. Forbes, and R. F. Masiarz, C., Macaulay, A., M. Powers, Pe oresn . egso,D . egso,A,Rnne,E,Bre,S S., S. Berger, E., Ronander, A., Bengtsson, C., K. D. U. Bengtsson, Laemmli, and L., G. Houwe, Joergensen, Van C., Lin, G., Arib, K., Ishii, ern,S . odrf,B . os . ezl . it,O,Ple,A., Pulfer, O., Dietz, J., Wetzel, S., Moes, J., B. Woodcroft, C., S. Oehring, T., Hashikawa, T., Tachibana, R., Nakatomi, Y., Sasaki, K., Yahata, K., Maeshima, A. Scherf, and L. Mancio-Silva, J., G. J. I. Lopez-Rubio, Macara, and E. B. Clurman, E., A. Smith, K., Plafker, E., M. Lindsay, lek . ata,R,Vl,J,Neewee,I,SleoAaa .M,Alako, M., A. Salcedo-Amaya, I., Niederwieser, J., Volz, R., Bartfai, C., Flueck, rfi,E . la,N,Lpict-cwrz .adPwr,M A. M. Powers, and J. Lippincott-Schwartz, Me N., and Altan, R., I. E. Griffis, D. Stuart, E., Courcelle, P., Gouet, oit .A,Wlnk,D,Llina D., Wilinski, G. A., C. Blobel, Howitt, and W. E. Debler, A., Hoelz, i . obcnr . ys .A,Ep .adDish .W. K. Deitsch, and C. Epp, A., S. Kyes, L., Sonbuchner, F., Li, iee,G,Cu .M,N,L,Cnel,C,Rls . Ve L., Riles, C., Connelly, L., Ni, M., A. Chu, G., Giaever, o .C. H. M. Ho, Zwerger, and O. Medalia, E., Grossman, Ko ieoa . ieea .adGlbr,M W. M. Goldberg, and E. Kiseleva, J., M. Fiserova, B. Fontoura, and A. Levay, J., Enninga, ria-uir .H,HradzRvs . ap,S . ote-odd,D., Montiel-Condado, A., S. Ralph, R., Hernandez-Rivas, H., L. Freitas-Junior, Guinet, C., Scheidig, W., K. Deitsch, A., L. Pirrit, E., Bottius, H., L. Freitas-Junior, oyisi .C,Fy .D n ihrsn .H. J. Richardson, and D. B. Foy, C., K. Kobylinski, olr .E,Sih .M,Wieon . ilas .T,Bnitr .H and H. L. Bannister, T., I. Williams, J., Whitehorn, S., M., A. Moes, Smith, T., E., B. R. Fowler, Alako, K., Witmer, I., Niederwieser, R., Bartfai, C., Flueck, rzTld,K,RjsMz,A . acoSla . Herna L., Mancio-Silva, P., A. Rojas-Meza, K., ´rez-Toledo, he,A n ut E. Hurt, and A. ¨hler, lsoimfliau-netdeyhoye aiiae idn oIA1and al. ICAM1 et to T. binding Lavstsen, d E., facilitates M. two erythrocytes Victor, PECAM1. of K., falciparum-infected G. co-expression plasmodium Cham, Surface B., M. (2010). Dalgaard, L., Turner, ulidpee favrert LGncerpr rti,p7 motbtare but import cycle. p97, cell the protein, through pore organization nuclear replication. GLFG and growth vertebrate nuclear a in of defective of expression depleted exclusive mutually nuclei to linked is and 9 genes. lysine var 3 parasite histone tri-methylated malaria R. Martı the M., Rivas, Vargas, in M., D. al. proteins Delgadillo, et nuclear K. novel Witmer, of C., falciparum. hundreds Plasmodium Flueck, reveals P., proteomics Maeser, C., Dekiwadia, lamins. and islands N. pore-free Imamoto, pores: and F. Imamoto, parasites. vari malaria in clonally centers repressive associates heterochromatin .T,Ele,F,Rlh .A,Cwa,A . odc,Z tal. et Z. Bozdech, F., A. Cowman, A., S. Ralph, F., Ehlgen, T., B. onaisi udn es:tencerpr connection. pore nuclear the yeast: budding in boundaries factor. activation common W. K. complex. pp0Np0i r-tbesic htsiuae importin-alpha:beta-mediated stimulates that switch import. tri-stable protein nuclear a is Npap60/Nup50 are and falciparum chromatin. Plasmodium centromeric of with centromeres the associated from transcribed are RNAs coding utpesqec lgmnsi PostScript. in alignments sequence multiple genome. cerevisiae Saccharomyces Andre K., Anderson, A., Lucau-Danila, ula neoei os spermatids. mouse in envelope nuclear dynamics. transcription-dependent with 1282-1297. nucleoporin mobile a o.Cell Mol. oecmlxsrcueadognzto ntbcoB- cells. BY-2 tobacco in organization and structure complex pore rpgto n itn ctlto oto uulyecuieepeso of expression exclusive al. mutually et parasites. control S. malaria in Shorte, acetylation genes M., variation histone antigenic A. and Gontijo, Ma propagation P., J., P. A. Rojas-Meza, R. of K., A. clusters O. chromosome Ruvalcaba-Salazar, Scherf, telomeric and in E. genes factor T. falciparum. virulence Wellems, of U., recombination Nehrbass, F., ula oecomplex. pore nuclear prgn fPamdu acprmi npee gambiae. Anopheles in falciparum Plasmodium of sporogony ulu n h yols n tbyitrcswt u9 ttencerpore nuclear the at Nup96 with interacts stably and cytoplasm complex. the and nucleus acprmmerozoites. H. falciparum biology. G. end Mitchell, chromosome in PfSIP2 protein Pathog. ApiAP2 S. PLoS T. falciparum Voss, and Plasmodium G. H. the Stunnenberg, P., Jenoe, Z., Bozdech, ietysiuaeepeso fdvlpetladcl-yl ee niethe inside genes cell-cycle and developmental of expression nucleoplasm. stimulate directly lsoimfliau eeohoai rti ak eoi oilne to linked loci genomic factors. marks virulence exported 1 of protein variation phenotypic heterochromatin falciparum Plasmodium 20) lnlyvratgn aiisi lsoimfliau hr a share falciparum Plasmodium in families gene variant Clonally (2009). 21) eitiuino ula oe uigfraino h redundant the of formation during pores nuclear of Redistribution (2010). nu e.Biochem. Rev. Annu. o.Cl.Biol. Cell. Mol. 38 uli cd Res. Acids Nucleic LSPathog. PLoS ´na 20) lsoimfliau eeohoai rti id to binds 1 protein heterochromatin falciparum Plasmodium (2009). Nature 6-15. , r,P n lebr,J. Ellenberg, and P. ´rt, Cell 6 e1000784. , 20) irtbl soitdmtrpoen fPlasmodium of proteins motor associated Microtubule (2001). 140 407 360-371. , nu e.Biophys. Rev. Annu. 1018-1022. , 21) eerglto ynceprn n ik ocancer. to links and nucleoporins by regulation Gene (2010). o.Bohm Parasitol. Biochem. Mol. Cell eoeBiol. Genome 6 23 e1001083. , o.Microbiol. Mol. 110 7271-7284. , 37 s . epeo,T . zkwk,R n Deitsch, and R. Dzikowski, J., T. Templeton, M., ´s, 80 2596-2606. , 349-360. , 20) elccedpnetdnmc fnuclear of dynamics Cell-cycle-dependent (2006). 613-643. , Nature ur pn elBiol. Cell Opin. Curr. .Cl Sci. Cell J. nzClil,S,Shr,A n Hernandez- and A. Scherf, S., ´nez-Calvillo, elHs Microbe Host Cell 13 .Anat. J. .Bo.Chem. Biol. J. ,B tal. et B. ´, 20) yaiso ula oecomplex pore nuclear of Dynamics (2004). 21) h tutr ftencerpore nuclear the of structure The (2011). R108. , 418 73 n eerglto ihperinuclear with regulation gene ant 41 feetPEP nieso single on antigens PfEMP1 ifferent Bioinformatics .Cl Biol. Cell J. 1171-1185. , 21) ucinlacietr fthe of architecture Functional (2012). 557-584. , Cell tz F. ´toz, 20) ula neoeadnuclear and envelope Nuclear (2009). 387-391. , 20) e1 htlsbtenthe between shuttles Sec13 (2003). 20) eoei heterochromatin Telomeric (2005). 216 119 117 20) ucinlpoiigo the of profiling Functional (2002). 20) eoewd nlssof analysis Genome-wide (2009). LSPathog. PLoS 121 525-532. , 4442-4451. , ni-iv,L,Leal-Silvestre, L., ˆncio-Silva, 187-200. , 21) vretnihbt the inhibits Ivermectin (2012). 283 25-36. , 19) Srp:aayi of analysis ESPript: (1999). 128 20) rqetectopic Frequent (2000). 5692-5698. , Cell 5 16 15 179-190. , rneu . o,S., Dow, S., ´ronneau, 21) ao oefor role major A (2010). 721-736. , 314-321. , aa.J Malar. ne-uvs .A., N. ´ndez-Cuevas, 305-308. , 19) Reconstituted (1995). 21) Nucleoporins (2010). ln J. Plant 20) ula non- Nuclear (2008). 109 o.Bo.Cell Biol. Mol. 21) Organellar (2012). 20) Chromatin (2002). 5 e1000569. , 551-562. , 20) u9 is Nup98 (2002). . 59 11 243-255. , 381. , (2002). (2009). 13 , Journal of Cell Science tipn . odn .N,Rif .advnDoe,G G. G. Dooren, van and S. Reiff, N., C. Jordan, B., Striepen, E. B. Clurman, and R. Kapur, J., Swanger, K., Lee, M., Smitherman, tibr,G,Shse,M,Tesn . iau . og,A n Martin-Urdiroz, and A. Forge, S., Kilaru, U., Theisen, M., Schuster, G., Steinberg, Gu M., S. Stagg, Aebi, S., Mueller, K., Leonard, H., Santos-Rosa, M., Lutzmann, S., Siniossoglou, S., Emig, C., Weise, H., Tekotte, V., Doye, M., Rieger, C., Wimmer, S., Siniossoglou, K. Schre U. Laemmli, and T. Durussel, J., Nishikawa, C., Laemmli, G., Arib, M., Schmid, T. Maniatis, and E. Fritsch, J., Sambrook, Ba A., W. Hoeijmakers, M., A. Salcedo-Amaya, Elzen, den van B., M. Trelle, T., B. Alako, A., M. Driel, van M., A. Salcedo-Amaya, Y. Zhang, and A. Kucukural, A., Roy, adi . a ow,G,Hdgr . ac,V,Cbzle,F,Shbr .and H. Schober, F., Cubizolles, V., Kalck, F., Hediger, G., Houwe, Van A., Taddei, K., Engelberg, J., B. Foth, A., Krueger, C., Langer, S., Herrmann, S., N. Struck, S., Haase, S., Dias, Souza de I., Schmuck-Barkmann, S., Herrmann, S., N. Struck, aaa,E,Bn,E . asy . es .C,Dish .W,Lvn .R and R. L. Levin, W., K. Deitsch, C., K. Hess, N., Ramsey, M., E. Bank, E., Salazar, L., Turnbull, C., Dekiwadia, J., M. Boyle, W., D. Wilson, D., Richard, T., D. A. Riglar, Scherf, and C. Scheidig-Benatar, A., S. Ralph, efc aaie eldvso napicomplexa. in division cell parasite: perfect transport. nucleocytoplasmic fosters M. p27(Kip1)-interacting a complex. pore Nup50, nuclear murine the of of disruption component targeted and Characterization 149 E. Hurt, and pores. U. nuclear normal for essential is homolog, 275. Sec13p a and C. Sec13p E. Hurt, and A. Segref, berghei]. b. Plasmodium 332-350. of sporogony during mitoses multiple yeast. in genes of interaction 379-391. nucleopore-promoter the Nup-PI: (2006). Laboratory. Harbor Spring Cold York: New Manual. spot? weak the be epigenome Biol. unusual its could Malaria: (2010). falciparum. 9655-9660. Plasmodium R. of Selzer, cycle al. M., Vegte-Bolmer, et intraerythrocytic de L. van A. M., Iniguez, E. Janssen-Megens, R., M., A. Cohen, M., A. parasites. stage erythrocytic in role its nidcbeyatgene. yeast inducible an M. S. Gasser, M. Marti, mechanism. Golgi lower-eukaryote-like and the and to 2129. M. higher- targeted differentially a Treeck, are via that complex S., proteins GRASP Haase, two possesses falciparum L., parasite malaria A. the Cabrera, in compartments al. et trans-Golgi F. and A. cis- Cowman, falciparum. C., the Plasmodium Langer, of C., dissection Bruns, M., Spatial Treeck, L., A. Cabrera, arge,B n ac,W E. Nature W. Balch, and B. Carragher, J. Buck, prediction. function and structure protein automated al. of et invasion B. parasite C. malaria erythrocyte. Whitchurch, during human L., events the K. coordinated of Rogers, dissection S., Super-resolution D. Marapana, F., Angrisano, lsoimfliau sascae ihmvmn fvrlc ewe subnuclear between loci var of movement with locations. associated is falciparum Plasmodium vl . saxFuhr .adBfr,J M. J. Bafort, and G. Asfaux-Foucher, J., ´vel, 21) oo-rvnmtlt ffna ula oe raie hoooe and chromosomes organizes pores nuclear fungal of motility Motor-driven (2012). 41-54. , 42 439 781-784. , 21) hrceiaino lsoimfliau dnllcyclase- adenylyl falciparum Plasmodium of Characterization (2012). rc al cd c.USA Sci. Acad. Natl. Proc. 234-238. , ra,C,Fwe,D . aone . os .R,Pte,C S., C. Potter, R., T. Foss, P., LaPointe, M., D. Fowler, C., ¨rkan, 20) ula oeascaincnesotmlepeso eesfor levels expression optimal confers association pore Nuclear (2006). 20) tutr n sebyo h u8pcomplex. Nup84p the of assembly and Structure (2000). elHs Microbe Host Cell 20) yai itn 3eieoemrigdrn the during marking epigenome H3 histone Dynamic (2009). Nature o.Microbiol. Mol. 19) oe ope fnceprn,wihincludes which nucleoporins, of complex novel A (1996). 441 20) tutr fteSc33 OI otcage. coat COPII Sec13/31 the of Structure (2006). 774-778. , .Cl Biol. Cell J. 102 LSONE PLoS 21) -ASR nfe ltomfor platform unified a I-TASSER: (2010). o.Cl.Biol. Cell. Mol. 67 5414-5419. , 18) oeua lnn:ALaboratory A Cloning: Molecular (1989). 9 1320-1330. , 9-20. , LSPathog. PLoS rfi .adSunneg .G. H. Stunnenberg, and R. ´rtfai, 198 7 rc al cd c.USA Sci. Acad. Natl. Proc. e39769. , 17) Utatutrlsuyof study [Ultrastructural (1977). a.Protoc. Nat. 343-355. , 20) niei aito in variation Antigenic (2005). 20 5631-5642. , 3 .Cl Sci. Cell J. .Utatut Res. Ultrastruct. J. 20b.Plasmodium (2008b). e78. , 20) uligthe Building (2007). n.J ice.Cell Biochem. J. Int. 5 725-738. , Cell o.Cell Mol. .Cl Biol. Cell J. 121 84 (2008a). 2123- , (2000). (2011). 265- , b 106 and 59 21 , , , ie,M,Yrr . idns .H,J n atoad,D N. D. Mastronarde, and Jr H., T. Giddings, D., Yarar, M., Winey, aua . ua,Y,Iaoo . aauh,T n aaNsiua I. Hara-Nishimura, and T. Haraguchi, M., Iwamoto, Y., Fukao, K., Tamura, ag .adX,X S. X. Xu, and G. Wang, iosa . rs .P n ad,M R. M. Paddy, and P. J. Aris, G., Zimowska, A., Namane, M., Duchateau, A., Claes, X., Fang, Y., Zhang, Y., Huang, Q., Zhang, Pettersen, C., C. Huang, B., Webb, D., Schneidman-Duhovny, K., Lasker, Z., Yang, Elbaum, P., Huth, von V., Shinder, E., Shimoni, N., Dahan-Pasternak, A., Weiner, asaf .M,Svkmrn . etn .M,Hrih .adJn,D A. D. Jans, and D. Harrich, M., S. Heaton, H., Sivakumaran, M., K. Wagstaff, T. Misteli, and J. K. Meaburn, T., Takizawa, uee,N,Rbo,M .adShre,E C. E. Schirmer, and I. M. Robson, N., Zuleger, os .S,Hae,J,Mry .J,Dfy .F,Topo,J . esn .G., J. Beeson, K., J. Thompson, F., M. Duffy, J., A. Marty, J., Healer, S., T. Voss, J., Ba C. C., Tonkin, J. Volz, J., Thompson, P., Gilson, A., S. Ralph, G., T. Carvalho, Akhtar, J., and Volz, M. N. Luscombe, K., Miura, J., Kind, R., Suyama, M., J. Vaquerizas, Jensen, and G. H. Stunnenberg, M., A. Cohen, M., A. Salcedo-Amaya, B., M. Trelle, J. T. K. N. Tokuyasu, Proudfoot, and D. H. Wijayatilake, M., S. Tan-Wong, hoai-soitdNpi lsoim3069 Plasmodium in Nup Chromatin-associated regulation. 856. iaetu ci nsailrpstoigadmtal xlsv xrsinof expression exclusive mutually and parasites. repositioning malaria in spatial genes A. virulence in Scherf, and actin W. filamentous Pan, E. J., T. J. Ferrin, Lopez-Rubio, and A. Sali, C., system. modeling E. integrated 269-278. Meng, an IMP: D., and MODELLER, T. Chimera, nuclear Goddard, F., of E. micrographs electron from cell reconstruction cerevisiae Plasmodium envelopes. three-dimensional Saccharomyces parasite the by throughout malaria distribution cycle and the number complex in pore pores nuclear and chromatin falciparum. of R. dynamics Dzikowski, and M. 21) vretni pcfcihbtro motnapabt-eitdnuclear alpha/beta-mediated importin of inhibitor specific a is Ivermectin (2012). thaliana. characterizatio Arabidopsis and Identification positioning. motal oihbtrpiaino I- n egevirus. dengue and HIV-1 of replication inhibit to able import slclzdbt nteetahoooa hne ewr n oncerpore nuclear to and organizer. network chromatin channel extrachromosomal the in complexes. both localized is otosallcecuino iuec ee nPamdu acprmmalaria. falciparum Plasmodium in F. genes A. virulence Cowman, and of Nature S. exclusion B. allelic Crabb, controls C., J. Reeder, falciparum. Plasmodium in Parasitol. sub-compartments J. nuclear F. distinct A. to Cowman, localise and proteins S. B. Crabb, C., Langer, genome. Drosophila the in regions A. falciparum. Plasmodium parasite malaria Res. the in residues lysine acetylated N. O. pore nuclear the with interaction through complex. memory transcriptional maintain to function . am . anr .C,Sunneg .G tal. et G. poised a H. in gene Stunnenberg, division. var parasite C., active during the state J. maintains methyltransferase, Rayner, falciparum Plasmodium J., Baum, F., Microsc. J. 21) ula oepoen u13admgtrdfn rncitoal active transcriptionally define megator and nup153 proteins pore Nuclear (2010). 8 3439-3450. , 20) lblhsoeaayi yms pcrmtyrvasahg otn of content high a reveals spectrometry mass by analysis histone Global (2009). 439 ee Dev. Genes o.Bo.Cell Biol. Mol. 1004-1008. , elRes. Cell rfi . etr . agr . oln,G . sbi . Schwach, T., Tsuboi, A., G. Josling, C., Langer, M., Petter, R., ´rtfai, .Cl Sci. Cell J. 143 el Microbiol. Cell. Cell 40 18) plcto fcyutairtm oimmunocytochemistry. to cryoultramicrotomy of Application (1986). 109-121. , 139-149. , 135 9-13. , 14 Nucleus ln Cell Plant 23 111-116. , 110 20) etd uli cd(N)bnigmdae gene binding-mediated (PNA) acid nucleic Peptide (2004). 2610-2624. , 21) Dnceracietr eel ope elcycle cell coupled reveals architecture nuclear 3D (2011). 8 927-944. , 2119-2132. , 13 2 elHs Microbe Host Cell 967-977. , 339-349. , 22 4084-4097. , LSGenet. PLoS fncerpr ope opnnsin components complex pore nuclear of n elHs Microbe Host Cell 19) rspiaTrpoenhomolog protein Tpr Drosophila A (1997). 21) oeta pgntcregulatory epigenetic Potential (2010). 21) rtclrl fperinuclear of role critical A (2011). 6 21) h ula neoea a as envelope nuclear The (2011). 11 e1000846. , 20) h enn fgene of meaning The (2008). 7-18. , 20) a eepromoter gene var A (2006). 10 451-463. , ice J. Biochem 21) fE1,a PfSET10, (2012). 20) eeloops Gene (2009). .Src.Biol. Struct. J. 19) Nuclear (1997). 21) UCSF (2012). .Proteome J. 443 (2010). 851- , 179 Int. ,