Genome-Wide Identification and Characterization of Well-Defined Genes Involved in Glaucoma and Pterygium Corneae

Genome-wide identification and characterization of well-defined genes involved in glaucoma and pterygium corneae

Den Naturwissenschaftlichen Fakultäten der Friedrich-Alexander-Universität Erlangen-Nürnberg

zur Erlangung des Doktorgrades

vorgelegt von Gabriela Chavarría Soley aus San José

Als Dissertation genehmigt von der Naturwissenschaftlichen Fakultät der Universität Erlangen-Nürnberg

Tag der mündlichen Prüfung: 27.03.2008

Vorsitzender der Promotionskommission: Prof. Dr. Eberhard Bänsch Erstberichterstatter: Prof. Dr. Georg Fey Zweitberichterstatter: Prof. Dr. Andreas Winterpacht

Gedruckt mit Unterstützung des Deuschen Akademischen Austauschdienstes

iii

iv Index 1 Introduction...... 1 1.1 Glaucoma, general aspects ...... 1 1.1.1 Classification of glaucoma ...... 2 1.2 Genetics of POAG...... 3 1.2.1 Inheritance and implicated loci ...... 3 1.2.2 Known glaucoma genes ...... 6 1.2.2.1 Myocilin (MYOC) ...... 6 1.2.2.2 OPTN...... 7 1.2.2.3 WDR36 ...... 8 1.3 Primary congenital glaucoma (PCG) ...... 8 1.3.1 CYP1B1 gene and protein...... 9 1.4 Pterygium corneae ...... 11 1.4.1 Genetics of Pterygium corneae...... 12 1.4.2 Factors implicated in the pathogenesis of pterygium corneae...... 12 2 Methods...... 14 2.1 Patients...... 14 2.2 DNA standard methods ...... 14 2.2.1 DNA isolation ...... 14 2.2.1.1 Salting out procedure for DNA extraction...... 14 2.2.1.2 Automated DNA isolation...... 15 2.2.2 Agarose gel electrophoresis ...... 15 2.2.3 Gel extraction of PCR products...... 15 2.2.4 Quantification of dsDNA ...... 15 2.3 RNA standard methods ...... 15 2.3.1 RNA isolation...... 15 2.3.2 Quantification of RNA with absorbance at 260nm ...... 16 2.3.3 Evaluation of RNA quality...... 16 2.4 PCR (polymerase chain reaction), microsatellite analysis, and sequencing ...... 16 2.4.1 Polymerase chain reaction (PCR)...... 16 2.4.2 Microsatellite Analysis...... 16 2.4.3 Purification of PCR products ...... 17 2.4.3.1 Enzymatic purification of PCR products ...... 17 2.4.3.2 Purification of PCR-products magnetic beads...... 17 2.4.4 Sequencing of purified PCR products with the Sanger method ...... 17 2.4.5 Purification of sequencing products with magnetic beads ...... 18 2.5 Plasmid procedures...... 18 2.5.1 Site-directed mutagenesis...... 18 2.5.2 Midi Plasmid-DNA-Preparation...... 19 2.6 Yeast methods...... 19 2.6.1 Yeast Stocks...... 19 2.6.2 Competent yeast cells...... 19 2.6.3 Yeast transformation ...... 19 2.6.4 Induction of expression and microsome isolation ...... 20 2.6.5 Microsome Isolation...... 20 2.6.6 Determination of enzymatic activity ...... 20 2.7 Standard protein methods...... 20 2.7.1 Determination of total protein concentration...... 20 2.7.2 Western Blot...... 20 2.8 Bioinformatics tools ...... 21 2.8.1 PCR primer design ...... 21 2.8.2 Sequencing analysis ...... 21

v 2.8.3 Microsatellite Analysis...... 21 2.8.4 Genome Browsers ...... 21 2.8.5 Single nucleotide polymorphisms (SNPs) databases...... 21 2.8.6 Linkage disequilibrium visualization ...... 22 2.8.7 Haplotype reconstruction ...... 22 2.8.8 Multiple sequence alignment...... 22 2.8.9 Expression data analysis...... 22 2.8.10 Gene Ontology ...... 22 2.9 Nomenclature ...... 22 2.10 Reagents and Materials ...... 23 2.10.1 Kits ...... 23 2.10.2 Instruments ...... 23 2.10.3 Enzymes ...... 23 2.10.4 Plattes and other consumables...... 24 2.10.5 Reagents ...... 24 2.10.6 Media and solutions...... 25 2.10.7 Oligonucleotides (5´-3´, for each gene in alphabetical order) ...... 26 3 Results...... 34 3.1 Linkage analysis for POAG with the Costa Rican family CR-2...... 34 3.2 Studies with pterygium corneae...... 36 3.2.1 Linkage for pterygium with family CR-2...... 36 3.2.2 Expression study of pterygium...... 39 3.3 The CYP1B1 gene ...... 48 3.3.1 CYP1B1 screening in PCG patients...... 48 3.3.2 Screening of CYP1B1, PAX6, PITX2, and FOXC1 in individuals with anterior segment dysgenesis...... 49 3.3.3 Haplotype analysis for CYP1B1 mutations...... 53 3.3.4 Functional analysis of CYP1B1 mutations ...... 62 3.3.4.1 CYP1B1 Activity ...... 62 3.3.4.2 CYP1B1 fraction in microsomal protein extracts...... 65 3.3.4.3 Relative CYP1B1 activity (activity x CYP1B1 fraction in total protein)...... 65 3.3.4.4 Molecular modelling...... 65 3.3.4.5 Primary congenital glaucoma families from Oman ...... 69 4 Discussion...... 72 4.1 Linkage analysis...... 72 4.2 Pterygium corneae studies...... 76 4.2.1 Linkage analysis for pterygium in the CR-2 family ...... 76 4.2.2 Whole genome expression study for pterygium corneae with microarrays...... 77 4.3 Primary congenital glaucoma (PCG) and the CYP1B1 gene...... 81 4.3.1 Genetics of PCG...... 81 4.3.2 CYP1B1, PAX6, PITX2, and FOXC1 screening in individuals with ASD ...... 82 4.3.3 Haplotype analysis for CYP1B1 mutations...... 83 4.3.4 Functional analysis of CYP1B1 mutations...... 85 4.4 Perspectives ...... 87 5 Summary...... 89 6 Zusammenfassung ...... 91 7 References...... 93 8 Appendix ...... 107 8.1 Abbreviations ...... 107 8.2 Acknowledgements ...... 108

1 Introduction

1.1 Glaucoma, general aspects

Glaucoma is the second cause of global blindness, after cataract (Resnikoff, et al., 2004). This medical condition comprises an heterogeneous group of disorders characterized by a degeneration of the optic nerve, a specific loss of visual field, and a chronic painless progression, usually (but not always) associated with elevated intraocular pressure (IOP) (Shields, et al., 1996). In most cases, the elevation of IOP results from impaired drainage of aqueous humour. The aqueous humour is produced by the ciliary body in the posterior chamber of the eye and enters the anterior chamber through the pupil, then drains out through the trabecular meshwork into Schlemm’s canal, which drains into the bloodstream (Fig. 1.1).

Image modified from National Eye Institute, National Institutes of Health

Fig.1.1 Aqueous humour production and outflow

Glaucoma causes irreversible blindness due to death of retinal ganglion cells that can only be prevented by therapeutic intervention in the early stages of the disease. Since peripheral visual damage occurs first, and because the disease is typically pain free with no obvious symptoms, substantial visual damage can occur before diagnosis.

1.1.1 Classification of glaucoma

The different kinds of glaucoma are classified according to their etiology (primary versus secondary), to the anatomy of the anterior chamber of the eye (open angle versus closed angle), and to the age of onset (congenital, juvenile, adult) (Shields, et al., 1996). Primary open angle glaucoma (POAG) is the major primary type of glaucoma in most populations worldwide, while Asian populations have a high frequency of closed angle glaucoma (Foster and Johnson, 2001; Lai, et al., 2001). The incidence and prevalence of POAG are higher in black than in white populations (Leske, et al., 1994; Leske, et al., 2007; Rudnicka, et al., 2006). High IOP is known to be the strongest known risk factor for glaucoma, but it is neither necessary nor sufficient in itself to cause the disease (Anderson, 2003; Heijl, et al., 2002; Leske, et al., 1995; Sommer, et al., 1991). Other reported risk factors for POAG are: elevated IOP, family history, hypertension, diabetes and cigarette smoking (Boland and Quigley, 2007; Bonovas, et al., 2004; Bonovas, et al., 2004; Fan, et al., 2004; Leske, 1983; Leske, et al., 2007; Wolfs, et al., 1998). POAG is divided according to age of onset into juvenile primary open angle glaucoma (JOAG) and adult onset POAG. JOAG is a rare aggressive form of glaucoma, which develops before the age of 35, presents high intraocular pressure (IOP), usually requiring surgery and is typically inherited in autosomal dominant manner (Johnson, et al., 1996; Wiggs, et al., 1995). In contrast, in adult onset POAG the age of onset is more advanced, and there is no obvious inheritance pattern; it is considered a complex trait (Wiggs, et al., 1996). A subset of adult onset POAG presents what is known as normal tension glaucoma (NTG), in which individuals suffer from optic nerve damage and visual loss at normal values of IOP (Anderson, 2003). Although some NTG cases may be etiologically distinct from high- tension POAG, there appears to be a pressure-dependent spectrum of disease that reflects different susceptibilities to a given pressure level. Lowering of the pressure from normal to even lower values results in an improvement in the condition of a subset of NTG patients ( Collaborative Normal-Tension Glaucoma Study Group 1998a; Collaborative Normal-Tension Glaucoma Study Group 1998b).

1.2 Genetics of POAG

1.2.1 Inheritance and implicated loci

The genetics of POAG are complex. Family history is clearly a risk factor for the disease. The Rotterdam glaucoma study found a relative risk for open angle glaucoma more than ten times higher in first degree relatives of patients than in the general population (Wolfs, et al., 1998). In the Barbados population family study (including persons of African ancestry), 10% of living relatives examined had open angle glaucoma (Nemesure, et al., 2001). Some families with glaucoma appear to present autosomal dominant inheritance, but POAG appears mainly as a complex disease. In addition, environmental factors are thought to be implicated in its etiology. The genetic basis of POAG is supported by the fact that some non-human animal species also develop heritable forms of POAG. Inherited spontaneous POAG has been identified in rhesus monkeys (Macaca mulatta) and both autosomal dominant and recessive POAG is present in dog breeds (in particular the beagle and miniature poodle) (Gelatt, et al., 1998). Discovering genes that contribute to disorders with complex inheritance is difficult. One strategy which has been used for glaucoma is studying families affected with rare Mendelian forms of the disease. This approach led to the identification of all three known glaucoma genes: myocilin (MYOC), optineurin (OPTN) and WD repeat domain 36 (WDR36) (Monemi, et al., 2005; Rezaie, et al., 2002; Stone, et al., 1997). Of these, only MYOC is accepted as clearly glaucoma-causing, while there is conflicting evidence for the other two (Ariani, et al., 2006; Aung, et al., 2003; Baird, et al., 2004; Bergen, et al., 2004; Forsman, et al., 2003; Fuse, et al., 2004; Hauser, et al., 2006; Hewitt, et al., 2006; Leung, et al., 2003; Miyazawa, et al., 2007; Mukhopadhyay, et al., 2005; Sarfarazi and Rezaie, 2003; Stone, et al., 1997; Toda, et al., 2004; Weisschuh, et al., 2005; Weisschuh, et al., 2007; Willoughby, et al., 2004). A disadvantage of this strategy is that genes identified in this manner don’t often play a major role in the complex phenotype. MYOC mutations account for only 1,1-4% of POAG, depending on the population (Aldred, et al., 2004; Allingham, et al., 1998; Bruttini, et al., 2003; Choudhary, et al., 2003; Kanagavalli, et al., 2003; Lam, et al., 2000; Lopez-Garrido, et al., 2006; Mataftsi, et al., 2001; Melki, et al., 2003b; Michels-Rautenstrauss, et al., 2002; Rose, et al., 2007; Sripriya, et al., 2004; Weisschuh, et al., 2005). Another strategy in the search for glaucoma genes has been performing genome scans using families demonstrating clustering of the disease (mainly sibpairs), which have led to a number of large genetic intervals containing many possible candidate genes (Nemesure, et 3 al., 2003; Wiggs, et al., 2000; Wiggs, et al., 2004). These two strategies have produced at least 20 glaucoma related loci (Table 1.1). Among them, 11 loci have been designated GLC1A to GLC1M by the HUGO Genome Nomenclature Committee (www.gene.ucl.ac.uk/nomenclature).

Table 1.1 Known glaucoma loci

Chromosomal Location Locus Name Gene Reference 1q21-q31 GLC1A MYOC (Sheffield, et al., 1993) 2p14 - - (Wiggs, et al., 2000) 2p15-p16 GLC1H - (Suriyapperuma, et al., 2007) 2cen-q13 GLC1B - (Stoilova, et al., 1996) 2q33-q34 - - (Nemesure, et al., 2003) 3p21-p22 - - (Baird, et al., 2005) 3q21-q24 GLC1C - (Wirtz, et al., 1997) 5q22.1 GLC1G WDR36 (Monemi, et al., 2005) 7q35-q36 GLC1F - (Wirtz, et al., 1999) 8q23 GLC1D - (Trifan, et al., 1998) 9q22 GLC1J - (Wiggs, et al., 2004) 10p12-p13 - - (Nemesure, et al., 2003) 10p15-p14 GLC1E OPTN (Sarfarazi, et al., 1998) 14q11 - - (Wiggs, et al., 2000) 14q21-q22 - - (Wiggs, et al., 2000) 15q11-q13 GLC1I - (Allingham, et al., 2005) 17p13 - (Wiggs, et al., 2000) 17q25 - (Wiggs, et al., 2000) 19q12-q14 - (Wiggs, et al., 2000) 20p12 GLC1K (Wiggs, et al., 2004) 3p21-22 GLC1L (Baird, et al., 2005) 5q22.1-q32 GLC1M (Fan, et al., 2007)

A number of these POAG loci have cytogenetic support in the literature. Cases of congenital glaucoma due to cytogenetic derangement at the GLC1B (Allderdice, et al., 1975; Kondo, et al., 1979; Mu, et al., 1984), GLC1C (Allderdice, et al., 1975; Kondo, et al., 1979), GLC1D (Cohn, et al., 2005), and GLC1F (CITAS 95 y 96 HEWITT) loci have been described. It is possible that mildly deleterious mutations cause POAG, while more significant rearrangement of these underlying genes cause a more severe disease phenotype.

4 Some evidence linking different genes to glaucoma has come from association studies. Sequence variants in at least 17 genes have been reported to show association to POAG. (Table 1.2).

Table 1.2. Genes harboring variants with reported association to POAG

Gene Gene Name Chromosomal Original Study Symbol Location ACP1 Acid phosphatase-1 2p25 (Abecia, et al., 1996) AGTR2 Angiotensin II receptor, type 2 Xq22-q23 (Hashizume, et al., 2005) APOE Apolipoprotein E 19q13.2 (Copin, et al., 2002) CDKN1A Cyclin-dependent kinase inhibitor 1A 6p21.2 (Tsai, et al., 2004) CYP1B1 Cytochrome P450, subfamily 1, 2p22-p21 (Vincent, et al., 2002) polypeptide 1 CDH1 E-cadherin 16q22.1 (Lin, et al., 2006) EDNRA Endothelin receptor, type A 4q31.2 (Ishikawa, et al., 2005) GSTM1 Glutathione S-transferase, 1p13.3 (Juronen, et al., 2000) mu-1 IGF2 Insulin-like growth factor II 11p15.5 (Tsai, et al., 2003) IL1A Interleukin 1-alpha 2q14 (Wang, et al., 2006) IL1B Interleukin 1-beta 2q14 (Lin, et al., 2003) MTHFR 5,10-methylenetetrahydrofolate reductase 1p36.3 (Junemann, et al., 2005) NOS3 Nitric oxide synthase 3 7q36 (Tunny, et al., 1998) NPPA Natriuretic peptide precursor A 1p36.2 (Tunny, et al., 1996) OCLM Oculomedin1 1q31.1 (Fujiwara, et al., 2003) OPA Optic atrophy 1 3q28-q29 (Aung, et al., 2002) TAP1 Transporter, ATP-binding cassette 6p21.3 (Lin, et al., 2004) TNF- Tumor necrosis factor alpha 6p21.3 (Lin, et al., 2003) alpha TP53 Tumor protein 53 17p13.1 (Lin, et al., 2002)

Most of these genes have been reported in one single study. For those of them investigated in several studies there is controversy as to whether they show association or not to POAG. The role of these genes in the etiology of POAG has not yet been clearly established.

5 1.2.2 Known glaucoma genes

Even though at least 20 loci for glaucoma have been identified through linkage analysis (Table 1.1), the disease-causing gene is only known for three of these loci.

1.2.2.1 Myocilin (MYOC)

Myocilin was the first POAG gene to be identified (Stone, et al., 1997). As mentioned above, MYOC mutations are found in 1,1-4% of late onset POAG patients (Aldred, et al., 2004; Allingham, et al., 1998; Bruttini, et al., 2003; Choudhary, et al., 2003; Kanagavalli, et al., 2003; Lam, et al., 2000; Lopez-Garrido, et al., 2006; Mataftsi, et al., 2001; Melki, et al., 2003; Michels-Rautenstrauss, et al., 2002; Rose, et al., 2007; Sripriya, et al., 2004; Weisschuh, et al., 2005). In JOAG patients, who present a more aggressive form of the disease and autosomal dominant inheritance, MYOC mutations are more frequent with frequencies ranging from 6% to 36% in different populations (Alward, et al., 2002; Shimizu, et al., 2000; Wiggs, et al., 1998). Myocilin is a secreted 55-57 kDa glycoprotein that forms dimers and multimers. Although myocilin is found ubiquitously in the eye, it is also expressed in many extraocular tissues, suggesting that it may not have an eye-specific function (Fingert, et al., 2002; Karali, et al., 2000). In the eye myocilin is expressed in high amounts in the trabecular meshwork, sclera, ciliary body, and iris, and at considerable lower levels in retina and optic nerve head (Tamm, 2002). The protein has an amino terminal signal sequence, a myosin like domain, a leucine zipper domain, and an olfactomedin domain. Most of the known mutations occur in the olfactomedin domain, which is highly conserved among species (Tamm, 2002). To date more than 70 disease-associated mutations in MYOC have been identified (Human Gene Mutation Database), with the Gln368STOP mutation being the most common known individual glaucoma causing variant worldwide (Fingert, et al., 1999). A founder effect has been revealed for this frequent mutation (Baird, et al., 2004; Faucher, et al., 2002). The function or functions of myocilin in the eye remain unknown. It has been postulated that MYOC facilitates aqueous humour outflow, or that it has a protective role against stress (Johnson, 2000). However, early truncations and deletions are not pathogenic in humans (Lam, et al., 2000; Wiggs and Vollrath, 2001), and mice with null alleles do not develop high IOP or glaucoma (Kim, et al., 2001). These two observations suggest that MYOC is not necessary for normal IOP homeostasis, and that mutations in the gene do not cause the disease by a loss of function effect. Different groups have shown in vitro that mutant MYOC forms insoluble, unsecreted aggregates that are not secreted and accumulate in the intracellular space (Caballero, et al., 2000; Fan, et al., 2004; Gobeil, et al., 2004; Jacobson, et al., 2001; Joe, et al., 2003; Zhou

6 and Vollrath, 1999). Such an accumulation might interfere with TM function and lead to impaired outflow. In the TM myocilin has been shown to principally interact with optimedin, an olfactomedin- related protein (Torrado, et al., 2002), as well as binding with flotin-1, a lipid raft protein (Joe, et al., 2005).

1.2.2.2 OPTN

OPTN was originally identified in a large study involving 54 NTG families. Three sequence variants were considered disease causing, and OPTN was estimated to be responsible for 16,7% of the cases (Rezaie, et al., 2002). Another change, M98K, was significantly more frequent in patients than in controls, and was suggested to confer increased susceptibility to glaucoma (Rezaie, et al., 2002). However, a later study including more than a 1000 POAG patients implicated only one of these mutations with POAG and in only one patient (Alward, et al., 2003). Several other large studies found similar mutation distributions in patients and controls (Ariani, et al., 2006; Aung, et al., 2003; Ayala-Lugo, et al., 2007; Baird, et al., 2004; Leung, et al., 2003; Lopez-Garrido, et al., 2006; Mukhopadhyay, et al., 2005; Sripriya, et al., 2006; Tang, et al., 2003; Toda, et al., 2004; Weisschuh, et al., 2005; Wiggs, et al., 2003; Willoughby, et al., 2004). Similarly, since the original work, only two studies have found significant association between M98K and POAG (Sripriya, et al., 2006; Willoughby, et al., 2004), although several studies did see an increased frequency within their patient populations (Alward, et al., 2003; Ayala-Lugo, et al., 2007; Baird, et al., 2004; Mukhopadhyay, et al., 2005). It has been proposed that M98K may be associated with a lower IOP at the time of diagnosis, and may even modify MYOC glaucoma (Melki, et al., 2003). In summary, OPTN mutations do not appear to be a common cause of NTG or POAG in general. OPTN is a 577 amino acid protein that appears to be secreted. It is localized throughout the eye, including the TM, Schlemm’s canal, ciliary epithelium, retina, and optic nerve (Rezaie, et al., 2002; Rezaie, et al., 2005; Sarfarazi and Rezaie, 2003). In the mouse, expression studies suggest that Optn expression is triggered during early stages of eye development (Rezaie, et al., 2007). Expression of the protein in neuronal and glial cells of the retina and optic nerve indicates that it could directly affect retinal ganglion cell survival (Rezaie, et al., 2002; Rezaie, et al., 2005; Sarfarazi and Rezaie, 2003). OPTN appears to interact with proteins that regulate apoptosis and may induce TNF-alpha. Therefore it may directly regulate cell death (Chen, et al., 1998; Li, et al., 1998). Nevertheless, few studies have directly tested the function of OPTN.

7 1.2.2.3 WDR36

The third glaucoma gene, WDR36 at the GLCIG locus, was identified using the linkage analysis strategy. In this first study the gene was then sequenced in 130 unrelated POAG patients, and found 4 sequence variants which were classified as disease-causing mutations (Monemi, et al., 2005). The WDR36 gene has 23 exons, resulting in a protein with 951 amino acids, and multiple G-beta WD40 repeats (Monemi, et al., 2005). In the eye, WDR36 is expressed in the lens, iris, sclera, ciliary muscles, ciliary body, TM, and optic nerve. However, once again subsequent studies have failed to confirm the role of WDR36 as a glaucoma-causing gene. A large family linked to GLC1G did not present any mutations in WDR36 (Kramer, et al., 2006). The authors mentioned that the family could possibly have a mutation in the promoter, or alternatively, that another gene mapping to GLC1G causes glaucoma in this family. A two-stage study with over 400 POAG patients and over 400 age- matched controls failed to confirm the original findings (Fingert 2007). The most common disease-associated variant in the original study, p.Asp658Gly, was found in similar frequencies in patients and controls. Two other variants were found in patients and not in controls, but the authors pointed out that this finding is not statistically significant. WDR36 has been found to play a minor role in German (Weisschuh, et al., 2007), Japanese (Miyazawa, et al., 2007), and US American (Hauser, et al., 2006) glaucoma patients. The situation of the p. Asp658Gly variant needs to be clarified, as most studies have not found this variant to differ in frequency between patients and controls (Fingert, et al., 2007; Hauser, et al., 2006; Hewitt, et al., 2006; Miyazawa, et al., 2007).

1.3 Primary congenital glaucoma (PCG)

In patients with congenital glaucoma, the development of the anterior segment of the eye and aqueous humour outflow pathways is abnormal. The improper structural development of the aqueous outflow system leads to accumulation of aqueous humour in the anterior chamber of the eye, causing elevated intraocular pressure, enlargement of the globe (buphthalmos), optic nerve damage, and eventually blindness (Anderson, 1981). PCG is normally inherited as an autosomal recessive trait and is prevalent in countries where consanguinity is common (Alfadhli, et al., 2006; Bejjani, et al., 1998; Panicker, et al., 2002; Plasilova, et al., 1999; Stoilov, et al., 1997). The first locus discovered for PCG was GLC3A, located on chromosome 2p21 (Sarfarazi, et al., 1995). Mutations in CYP1B1, the glaucoma causing gene in this locus, were first found in consanguineous families from Turkey (Stoilov, et al., 1997). Subsequently, different mutations have been found in a variety of ethnic groups, including those from Saudi Arabia and Egypt (Bejjani, et al., 1998; Bejjani, et al.,

8 2000), Morocco (Belmouden, et al., 2002), Slovak Gypsies (Plasilova, et al., 1999), Indonesia (Sitorus, et al., 2003), India (Chakrabarti, et al., 2006; Reddy, et al., 2004; Reddy, et al., 2003), Japan (Kakiuchi-Matsumoto, et al., 2001; Kakiuchi, et al., 1999; Mashima, et al., 2001), Australia (Dimasi, et al., 2007), Europe (Colomb, et al., 2003; Curry, et al., 2004; Michels-Rautenstrauss, et al., 2001; Sena, et al., 2004; Sitorus, et al., 2003; Soley, et al., 2003; Stoilov, et al., 2002), North-, Central-, and South America (Curry, et al., 2004; Sena, et al., 2004; Soley, et al., 2003; Stoilov, et al., 2002). Several of these mutations have been reported in the literature repeatedly, in individuals from different ethnic backgrounds. Most patients with PCG caused by mutations in CYP1B1 have a severe case of the disease; however, there are some families which show variation in phenotypic severity and even reduced penetrance (Bejjani, et al., 2000). Linkage studies have identified at least two other chromosomal regions that likely harbor a gene for PCG, GLC3B at 1p36 (Akarsu, et al., 1996) and GLC3C at 14q24.3 (Stoilov IR, ARVO Meeting, 2002, Abstract). Cytogenetic reports indicate other chromosome regions where PCG genes may be located (Cohn, et al., 2005; Verbraak, et al., 1992). In addition, autosomal dominant forms of PCG have been identified (Simha, et al., 1989). The role of CYP1B1 in eye development is further strengthened by the report of homozygous or compound heterozygous CYP1B1 mutations in individuals suffering from two forms of anterior segment dysgenesis associated with secondary glaucoma: Peters’ anomaly (Churchill and Yeung, 2005; Edward, et al., 2004; Vincent, et al., 2001) and Rieger’s anomaly (Chavarria-Soley, et al., 2006). In addition, heterozygous CYP1B1 mutations have been proposed as a risk factor for primary open angle glaucoma (POAG) (Acharya, et al., 2006; Lopez-Garrido, et al., 2006; Melki, et al., 2004), or as modifiers in an individual with juvenile open angle glaucoma with a MYOC mutation (Vincent, et al., 2002).

1.3.1 CYP1B1 gene and protein

The CYP1B1 gene consists of three exons, two of which are coding. Within the CYP1B1 protein, a transmembrane domain is present at the amino (N) terminal, whereas the highly conserved j-helix, k-helix, and heme binding regions are present at the carboxy (C) terminal (Graham-Lorence and Peterson, 1996). A proline-rich hinge region near the N-terminal permits flexibility in the overall protein structure. The highly conserved nature of these regions in the enzyme underscores their importance to overall function. Approximately 70 PCG-causing mutations have been identified, including missense and frameshift mutations, as well as small insertions and deletions (Human Gene Mutation Database). Most missense mutations occur in these highly conserved functional regions. Orthologs of CYP1B1 are

9 found in vertebrates from bony fish through humans, again suggesting a fundamental role for the protein. Alterations in enzymatic stability and activity as a result of mutations in CYP1B1 have been demonstrated in vitro in prior studies (Bagiyeva, et al., 2007; Jansson, et al., 2001; Mammen, et al., 2003). A loss of protein function is probably the underlying genetic mechanism in the development of PCG (Vasiliou and Gonzalez, 2007). Cytochrome P450 is a superfamily of hemoproteins; a total of 18 families of CYP have been classified in mammals based upon sequence homology. In humans there are 58 forms, while the mouse has 102 forms (Nelson, et al., 2004). Families 1-3 are responsible for xenobiotic metabolism in mammals, and act by altering and eliminating compounds foreign to the body (Choudhary, et al., 2004). Accordingly, a high expression of CYP proteins belonging to families 1-3 has been observed in the liver, which is a major site of xenobiotic metabolism. However CYP1B1, and some other CYP enzymes, have a primarily extrahepatic distribution (Choudhary, et al., 2003). CYP1B1 has been identified in at least 15 different non-ocular human tissues in addition to its expression in the trabecular meshwork, iris, ciliary body, and retina (Muskhelishvili, et al., 2001; Stoilov, et al., 1998; Stoilov, et al., 1997). In addition to its role in the metabolism of xenobiotics, CYP1B1 metabolizes endogenous substrates such as steroids, retinoic acid (RA), and melatonin (Vasiliou and Gonzalez, 2007). In the mouse, CYP1B1 (along with other CYP enzymes) has been found to be expressed constitutively in the embryo, at different levels in different temporal stages, suggesting a role in development. Expression of CYP1B1 in the mouse begins at E11 and continues throughout uterine development (Choudhary, et al., 2003). CYP1B1 expression in the embryo has likewise been shown in humans (Hakkola, et al., 1997; Jansson, et al., 2001). Contrary to the findings for most other CYPs, the level of CYP1B1 has been found to be higher in human fetal tissue than in adult tissue (Choudhary, et al., 2005). The temporal pattern of appearance of CYP1B1 in the developing embryo differs from the pattern shown by other P450s with similar substrate specificities (belonging to families 1-3) (Choudhary, et al., 2006). The distinctive temporal expression pattern suggest that the protein performs a critical function in development and explains why other P450 forms cannot compensate for defective CYP1B1. In the mouse, three main regions of Cyp1b1 expression have been observed (Choudhary, et al., 2006): one which includes the aqueous humour, the lens epithelium and the inner ciliary epithelium; a second region which is exposed to the environment, the corneal epithelium; and a third one which consists of two of the neural retina layers, the ganglion cell layer, and the inner nuclear layer. It has been proposed that CYP1B1 could possibly have different roles in the different regions. According to this model, in the first region Cyp1b1 could act to modify some substrate necessary for normal trabecular meshwork development and function

10 that gets secreted in the aqueous humour. In the second one, the corneal region with contact to the exterior, Cyp1b1 could perform its function as xenobiotic metabolizing enzyme. In the retina, CYP1B1 function may involve the enzyme’s ability to catalyze the rate-limiting step in retinoic acid synthesis, oxidizing retinol to all-trans-retinal (Chen, et al., 2000). Retinoic acid has a role in cell proliferation and polarity establishment in early eye development (Sen, et al., 2005), as well as a possible antiapoptotic function (Ahn, et al., 2005; Dheen, et al., 2005). A recent study found that CYP1B1 is up-regulated in retinal ganglion cells during development, and that overexpression of the gene increased survival of the cells (Wang, et al., 2007). CYP1B1 may be an important source of retinoic acid during embryonic and early postnatal development, and therefore mutations in the gene which affect its function could alter retinoic acid levels, and impair retinal ganglion cell survival during development.

1.4 Pterygium corneae

Pterygium corneae is a benign condition characterised by epithelial overgrowth of the cornea, usually bilateral and with a nasal interpalpebral location. It has a characteristic wing- shaped appearance (Fig. 1.4.1) (Di Girolamo, et al., 2004).

Fig. 1.4.1 Diagram of an eye presenting pteryigum of the cornea.

The prevalence rates of pterygium obtained from a number of populations vary widely (Forsius, et al., 1995; Gazzard, et al., 2002; Johnson, et al., 1996; Khoo, et al., 1998; Luthra, et al., 2001; McCarty, et al., 2000; Panchapakesan, et al., 1998; Rojas and Malaga, 1986; Saw and Tan, 1999), from 1.2% in white people in a region with temperate climate (McCarty, et al., 2000) to 23.4% in the black population of tropical Barbados (Luthra, et al., 2001). In general, prevalence rates in the tropics are higher than at temperate latitudes. There is compelling evidence that UV-mediated limbal damage acts as trigger for pterygium pathogenesis (Coroneo, et al., 1999). A link between pterygia and sunlight exposure has been extensively documented (Coroneo, 1993; Coroneo, et al., 1999; Hilgers, 1960b; Hill and Maske, 1989; McCarty, et al., 2000; Moran and Hollows, 1984; Paula, et al., 2006; Saw, 11 et al., 2000; Saw and Tan, 1999; Taylor, et al., 1989; Threlfall and English, 1999), and it has been proposed that the typical location of pterygia is explained by a corneal focusing of the incident sunlight on the medial limbus (Coroneo, et al., 1999).

1.4.1 Genetics of Pterygium corneae

Even though very little is known about genetics of pterygium corneae, a familial clustering has been recognized. Studies as early as 1960 proposed an autosomal dominant mode of inheritance in some cases of pterygium (Hilgers, 1960). A reduced penetrance of about 70% has been proposed (Murken and Dannheim, 1965A). A handful of families with pterygium corneae have been described in the literature, which show autosomal dominant inheritance and reduced penetrance (estimated to be around 70%) (Hecht and Shoptaugh, 1990; Hilgers, 1960; Islam and Wagoner, 2001; Jacklin, 1964; Murken and Dannheim, 1965; Schwartz, 1960; Zhang, 1987). Zhang (Zhang, 1987) studied a large rural family and found pterygia in 11 subjects. The affected members were all offspring of an affected individual. Hecht and Shoptaugh (Hecht and Shoptaugh, 1990) described a 3-generation family with 11 affected members and a unique onset of pterygia from the late teens to late twenties. This finding, and the fact that 2 of the affected persons were monozygotic twins, is additional evidence that genetic factors influence predisposition to pterygia. A more recent case study (Islam and Wagoner, 2001) reported a family with three members affected by aggressive and early onset of pterygia, at 4, 6, and 20 years of age.

1.4.2 Factors implicated in the pathogenesis of pterygium corneae

A two-stage hypothesis has been proposed for the pathogenesis of pterygium. In the first stage there is initial and progressive disruption of the limbal corneal-conjunctival epithelial barrier. The second stage is characterized by extensive cellular proliferation, inflammation, connective tissue remodeling, and angiogenesis (Coroneo, et al., 1999). An considerable number of cytokines and growth factors and their receptors, such as fibroblast growth factor, platelet derived growth factor, transforming growth factor beta, and tumor necrosis factor alpha, have been reported in pterygium. This findings suggest that these cytokines and growth factors, which are involved in the corneal wound-healing cascade, contribute to the extensive cellular proliferation, inflammation, connective tissue remodeling, and angiogenesis seen in pterygia (Coroneo, et al., 1999; Di Girolamo, et al., 2004). Many of these proteins are modulated by UV exposure, which supports the role of cumulative UV damage in pterygium corneae formation.

12 These cytokines modulate a class of proteolytic enzymes termed matrix metalloproteinases (MMPs), which are active against all components of the extracellular matrix. Extracellular matrix remodeling is a prominent feature in pterygium corneae. MMPs play an important role in corneal wound healing, a tightly controlled and regulated process. In pterygium corneae there is a defective regulation of the activity of MMPs and their inhibitors. Several MMPs, such as MMP-1, MMP-2, MMP-3, and MMP-9, are overexpressed in pterygium corneae when compared with the conjuctiva (Di Girolamo, et al., 2004). MMP expression is observed in the processes of tissue repair, inflammation, cell signaling, invasion, and neovascularization (Sivak and Fini, 2002). Pterygium fibroblasts display characteristics of transformed cells, including loss of heterozygosity, and microsatellite instability (Detorakis, et al., 2000; Detorakis, et al., 1998; Reisman, et al., 2004). Pterygium epithelium presents less apoptosis than the conjunctiva, suggesting that it is resistant to normal UV-induced apoptosis (Tan, et al., 2000). Mutations have been reported in pterygium corneae samples in the p53 and KI-ras genes, supporting the evidence that it is a proliferative condition (Detorakis, et al., 2005; Tsai, et al., 2005).Cellular immunity (Beden, et al., 2003; Tsironi, et al., 2002) and viral infection (Detorakis, et al., 2000; Detorakis, et al., 2001; Gallagher, et al., 2001; Piras, et al., 2003), have also been proposed to be implicated in the pathogenesis and recurrence of pterygium. Among the currently more acceptable theories for the pathogenesis of pterygium corneae are those that propose alterations in apoptosis and cell proliferation (Tan, et al., 2000). In addition, elevated cytokines and/or growth factors may support the proliferative and invasive capacity of pterygia, with the MMPs (and their inhibitors) acting as effector molecules (Di Girolamo, et al., 2004).

13 2 Methods

2.1 Patients

The study protocols were approved by the ethics committees of the University Hospital of Erlangen, and before inclusion all individuals gave their informed consent. The investigations were conducted according to Declaration of Helsinki principles. The family with primary open angle glaucoma (POAG) for which linkage analysis was performed and one family with congenital glaucoma were recruited in Costa Rica. The rest of the individuals included in the investigation were recruited at the Ophthalmological Department of the FAU Erlangen- Nuremberg, or referred through other European ophthalmologists. Primary open angle glaucoma was defined as the presence of intraocular pressure greater than 21 mmHg, glaucomatous optic disc damage, and visual field defects. The control samples were obtained from individuals who had intraocular pressure below 20 mmHg, no glaucomatous disc damage, and no family history of glaucoma. Congenital glaucoma was defined as the presence of intraocular pressure higher than 21 mm Hg in both eyes before the age of three years, presence of optic disc cupping, enlarged axial diameter of the globe, and an increased corneal diameter with or without Haab's lines. Rieger’s anomaly was defined by the presence of iris hypoplasia, embryontoxon posterius, and anterior synechiae to the prominent Schwalbe’s line or posterior cornea. Peters’ anomaly comprised findings defined as in Rieger’s Anomaly and leucoma adhaerens. Aniridia was characterized by remnants of the iris in form of a small cuff which extends forward and may occlude the chamber angle by anterior synechiae.

2.2 DNA standard methods

2.2.1 DNA isolation

2.2.1.1 Salting out procedure for DNA extraction

Isolation of DNA from peripheral blood samples was performed in Costa Rica with the salting out procedureTo begin, 9 volumes of extraction buffer A were added to the blood collected in EDTA, well mixed and placed on ice for 2 min. Centrifugation at 1500 rpm at 4°C for 15 min was carried out, and the pellet was resuspended in a 5 mL polypropylene tube. 500 uL 10% SDS and 55 uL proteinase K (10mg/ml stock) were added and incubated at 37°C overnight on a low-speed shaker. 1,4 mL saturated NaCl solution (approx. 6M) was added and then shaken vigorously for 15s. Tubes were centrifuged at 2500 rpm for 15 min. The supernatant was transferred to another 15 mL polypropylene tube. Two volumes of absolute ethanol were added to precipitate the DNA. The DNA was transferred to a tube with 100-200 uL TE.

2.2.1.2 Automated DNA isolation At the Institute of Human Genetics of the FAU Erlangen-Nuremberg genomic DNA samples were extracted from peripheral blood leukocytes automated techniques (AutoGenFlex 3000, Holliston MA, USA) using Flexigene chemistry (QIAGEN, Hilden, Germany).

2.2.2 Agarose gel electrophoresis In order to separate DNA molecules (PCR products) by size, agarose gel electrophoresis was used. Negatively charged nucleic acid molecules move through an agarose matrix with an electric field. Shorter molecules moves faster and migrate further than longer ones. The agent ethidium bromide is incorporated in the gel and intercalates in the DNA, allowing the visualization of the DNA when the gel is exposed to ultraviolet light. Agarose concentration of the gel oscillates between 1 and 2% for normal size PCR products (< 2 Kb). Between 3 and 10 µl of the PCR product were loaded on the gel.

2.2.3 Gel extraction of PCR products The QIAquick Gel extraction kit (Qiagen) was used for cleanup of DNA fragments from agarose gels according to the instructions of the manufacturers. The procedure is based on the binding of the DNA to a column, with subsequent washing and elution of the pure DNA fragment.

2.2.4 Quantification of dsDNA Using the formula 1 Unit Absorbance (260nm) = 50µg dsDNA/ml, concentration of DNA samples was measured in a photometer with a previous appropriate dilution of the DNA sample.

2.3 RNA standard methods

2.3.1 RNA isolation RNA was isolated from pterygium corneae and conjuctiva samples with the TRIZOL Reagent (Invitrogen, Carlsbad, CA, USA), according to instructions of the manufacturer. Briefly, the tissue samples were manually homogenized in TRIZOL, using a syringe. After addition of chloroform and centrifugation, the solution separates into an organic and an aqueous phase. The RNA is then precipitated from the aqueous phase with isopropyl alchohol.

15 2.3.2 Quantification of RNA with absorbance at 260nm Using the formula 1 Unit Absorbance (260nm) = 40µg RNA/ml. The concentration of RNAsamples was measured in a photometer, after an appropriate dilution of the RNA sample.

2.3.3 Evaluation of RNA quality The quality and concentration of the RNA was evaluated using the Bionalyzer (Agilent Technologies, Santa Clara, California) according to the instructions of the manufacturers.

2.4 PCR (polymerase chain reaction), microsatellite analysis, and sequencing

2.4.1 Polymerase chain reaction (PCR) PCR was used to produce copies from specific DNA fragments by means of two oligonucleotides (primers) that are complementary to DNA sequences that flank the desired region. Normally, 10-20 ng of DNA template are used, plus 100 µM each of deoxyribonucleotide (dATP, dCTP, dGTP, dTTP), 10 pmol of each primer, 0.5 Units of Taq- DNA polymerase, and PCR-Buffer, in a total reaction volume of 15 µl. The structure of the amplification product and its context dictated the addition of some additives, such as 10% 5 M betaine and/or DMSO at 5% final concentration. A “touchdown” cycler program was used, which consists of 5 min. at 94°C initial denaturation, 10 cycles of: 20 sec. denaturation at 94°C, 1 min. annealing at 65°C (descending 1°C in each of the following nine cycles) and 1 min. elongation at 68°C, followed by 30 cycles: 20 sec. at 94°C, 1 min. at 55°C and 1 min. at 68°C. Finally, a 10 min. elongation step at 68°C. Different DNA-polymerases were used in order to achieve an amplification product. First, the WinTaq-polymerase (own production at the Institute) was used. When amplification was unsuccessful, recombinant Taq DNA polymerase (Invitrogen), Platinum Taq DNA polymerase (Invitrogen) or Ampli Taq Gold polymerase (Applied Biosystems) was used.

2.4.2 Microsatellite Analysis Microsatellite markers were amplified in singleplex reactions in a final reaction volume of 15 μl containing 10 mM Tris, 1.5 mM MgCl2, 100 μM each dNTP, 0.35 U DNA polymerase (Invitrogen), 7.0 pmol of each primer, and 20 ng of genomic DNA. One of the primers was end-labeled with a fluorescent dye (FAM, TET, or HEX). For amplification we used a touchdown PCR program with an annealing temperature decreasing from 61 °C to 55 °C over 6 cycles, followed by 31 cycles with an annealing temperature of 55 °C. Products were usually pooled according to product size and fluorescent label and analyzed on an ABI Genetic Analyzer 3100 (Applied Biosystems, Foster City, CA, USA).

2.4.3 Purification of PCR products

2.4.3.1 Enzymatic purification of PCR products

The combination of two enzymes provides a method for simple and fast purification of PCR products, necessary before subsequent applications. Exonuclease I catalyzes the removal of nucleotides from single-stranded DNA in the 3' to 5' direction, degrading excess single- stranded primer oligonucleotide from the reaction mixture containing double-stranded extension products. Antarctic Phosphatase catalyzes the removal of 5´ phosphate groups from DNA, removing unincorporated dNTPs. A 10µl mixture containing 4 units of Exonuclease I and 2 units of Antarctic Phosphatase is added directly to the PCR reaction and then incubated in a thermocycler at 37°C during 15 minutes, followed by inactivation of the enzymes at 80°C during 15 minutes.

2.4.3.2 Purification of PCR-products magnetic beads

The AMPure (Agencourt Bioscience, Beverly MA, USA) system provides an efficient removal of unincorporated dNTPs, primers and salts used during PCR amplification, which can interfere with downstream applications. It is based on the binding of the PCR amplification products to magnetic beads, allowing their separation from the rest of the reaction mixture. Finally, the PCR amplicons are separated from the beads and can be transferred in a new plate. The whole process is performed automatically with the use of the pipetting station Beckman Coulter Biomek NX96 (Beckman Coulter, Fullerton, CA, USA)

2.4.4 Sequencing of purified PCR products with the Sanger method Sanger´s enzymatic approach relies on specially modified reagents (2´, 3´ - dideoxynucleotide triphosphates) whose incorporation into a growing DNA strand terminates the extension reaction. Briefly, 6 µl mixture containing 0.35 µl BigDye Terminator v3.1 (DNA polymerase, dNTPs and four 2´, 3´ - dideoxynucleotide triphosphates, each labelled with a different fluorophore) (Applied Biosystems, Foster City, CA, USA), 2 µl of 5x Sequencing Buffer (Applied Biosystems, Foster City, CA, USA), 0,3 µl of sequencing primer (10 µM) and water are added to 4 µl of purified PCR product and subject to the standard sequencing reaction program: 25 cycles of 10 sec. at 96°C, 10 sec. at 55°C and 2 min. at 60°C.

17 2.4.5 Purification of sequencing products with magnetic beads The CleanSEQ (Agencourt Bioscience, Beverly MA, USA) system is a rapid process for the removal of unincorporated dye-terminators in the sequencing reaction. It is based on the binding of the sequencing products to magnetic beads, allowing their separation from the rest of the reaction mixture. Finally, the products are separated from the beads and can be transferred in a new plate. The whole process is performed automatically with the use of the pipetting station Beckman Coulter Biomek NX96 (Beckman Coulter, Fullerton, CA, USA)

2.5 Plasmid procedures

2.5.1 Site-directed mutagenesis Site directed mutagenesis was performed using the QuikChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA, USA) according to the instructions of the manufacturer. The kit is based on the replication of both plasmid strands with PfuTurbo DNA polymerase with two primers containing the desired mutation, and subsequent digestion of the parental DNA template through DpnI endonuclease treatment. Most of the remaining plasmids should then carry the mutation and were used to transform One Shot TOP10 competent E. coli (Invitrogen Carlsbad, CA, USA), with a heat shock at 42°C according to the suggestions of the manufacturer. Colony selection was performed by means of PCR and sequencing of the mutagenised site. With this method the various CYP1B1 constructs carrying different SNP haplotypes and mutations (see section 3.3.4) were constructed based on wild type human CYP1B1 cDNA cloned into the pYeDP60 expression plasmid (Urban, et al., 1990). Several rounds of site- directed mutagenesis were needed to establish the different SNP haplotypes. For difficult mutations the XL- version of the kit was used. All plasmids were sequenced using the ABI Prism Big Dye terminator cycle sequencing kit and analyzed on an ABI Genetic Analyzer 3730 (Applied Biosystems, Foster City, CA, USA) to ensure that the constructs were correct.

18 2.5.2 Midi Plasmid-DNA-Preparation

The isolation of large amounts of plasmid DNA of high purity was performed with the “QIAGEN Plasmid Midi Kit” according to the manufacturer’s instructions (QIAGEN, Hilden). Briefly, one E. coli colony harboring the plasmid of interest was inoculated in 3mL of LB medium and incubated at 37°C with shaking for approx. 8 hours, the 3mL pre-culture was then poured in 200 mL LB medium and incubated overnight. The bacteria in this culture were then precipitated through centrifugation (4°C, 15min, 6000xg). The plasmid purification protocol is based on a modified alkaline lysis procedure, followed by binding of plasmid DNA to QIAGEN Anion-Exchange Resin under low-salt and pH conditions. RNA, proteins, dyes, and low-molecular-weight impurities are removed by a medium-salt wash. Plasmid DNA is eluted in a high-salt buffer and then concentrated and desalted by isopropanol precipitation. The isolated plasmid DNA was used directly for sequencing or transfection.

2.6 Yeast methods The Saccharomyces cerevisiae strain, INVSc1-HR MAT αhis3∆1 leu2 trp1-289 ura3-52 (pFL-35 human reductase), which expresses human reductase was used for all yeast experiments.

2.6.1 Yeast Stocks Yeast stocks from transformed and untransformed colonies were prepared by dissolving one colony in 200 uL selective medium and 100-200 ul Glycerine. The stocks were stored at - 80°C until further use.

2.6.2 Competent yeast cells Yeast cells can be made competent when exposed to alkali cations (such as Li+). Briefly, the yeast cells were grown in YPGA medium, centrifuged, and resuspended in 0.1 M LiAc in TE.

2.6.3 Yeast transformation For the transformation 100 ul of competent yeast were mixed with 50-80 ug salmon sperm DNA, approx. 3ug plasmid DNA which had been mutagenized to carry the desired CYP1B1 variant, and 300 ul of 40% polyethylenglycol in 0.1 M LiAc in TE. The mixture was incubated at 30°C for 30 minutes, followed by a 15 min heat shock at 42°C. After centrifugation, the pellet was dissolved in TE. The transformed yeast was then grown in selective plates (lacking uracil).

19 2.6.4 Induction of expression and microsome isolation The transformed yeast were grown for several days in selective plates, followed by selective medium, and finally non-selective medium. At this point galactose was added to induce CYP1B1 expression, in preparation for microsome isolation 12-16 hours later.

2.6.5 Microsome Isolation The yeast cells were centrifuged and resuspended in TEK buffer, then centrifuged again and resuspended in TESO buffer. The cells were lysed by mechanical disruption with glass beads at 4°C. After centrifugation the supernatant was selected and subjected to an ultra- centrifugation step. The resulting pellet consisting of the yeast microsmes was resuspenden in TEG buffer, aliquoted, and stored a -70°C.

2.6.6 Determination of enzymatic activity CYP1B1 activity in microsome extracts was quantified using the P450-Glo CYP1B1 Assay Kit (Promega, Wisconsin, USA), according to the instructions of the manufacturer. Total P450 content was determined using previously described methods (Bradford, 1976; Omura and Sato, 1964) at the Karolinska Institute in Stockholm (by collaborators of the investigation). To measure enzymatic activity 1pmol of each CYP1B1 variant was incubated with a luminogenic substrate and NADPH regeneration system. As a result, a luciferin product (D-Luciferin) was generated, and luminescence (proportional to cytochrome P450 activity) was measured with the GENios microplate reader (TECAN, Maennedorf, Switzerland). The assays were performed in triplicate.

2.7 Standard protein methods

2.7.1 Determination of total protein concentration Total protein concentration was determined using the Bradford assay (Bradford, 1976).

2.7.2 Western Blot

Samples for SDS-PAGE were prepared by mixing aliquots of the microsomes (corresponding to 50 to 220 pmol CYP1B1) with NuPAGE sample buffer (Invitrogen, Carlsbad, CA, USA) and heated at 70°C for 10 min. Protein samples were run on NuPAGE 4–12% gradient Bis- Tris gels at 150 V for 35 minutes with MES SDS running buffer (Invitrogen, Carlsbad, CA, USA). For western blot analysis, gels were electrotransferred to a nitrocellulose membrane (Invitrogen, Carlsbad, CA, USA) for 1 hour. Non-specific binding sites were blocked by incubation in TBS containing 0.5 % Tween-20 and 5 % milk powder. Proteins were detected 20 by chemiluminescence (Santa Cruz Biotechnology, Santa Cruz, CA, USA) using a rabbit anti- human CYP1B1 polyclonal antibody (Alpha Diagnostics, San Antonio, TX, USA) and an anti-rabbit secondary antibody conjugated with horseradish peroxidase (Bio-Rad Life Sciences, Hercules, CA, USA).

2.8 Bioinformatics tools

2.8.1 PCR primer design For the design of the PCR primers, Primer3 (http://frodo.wi.mit.edu/cgi- bin/primer3/primer3_www.cgi) was normally used with default conditions, except reduced self complementarity. In cases where the coding sequence of a whole gene had to be screened for mutations the “Exon Locator and Extractor for Resequencing” program was used (http://elxr.swmed.edu/ex-lax/about.html). After the input of the mRNA accession number for the gene, the program can design primers for all exons.

2.8.2 Sequencing analysis At the beginning of the investigation the Chromas (Technelysium, Tewantin, Australia) software was used for analyzing sequences. This software was later replaced by SeqMan, from the program package DNA-Star (DNASTAR, Inc., Madison, Wi, USA), which allows several sequences to be analyzed at once and compared to a reference sequence.

2.8.3 Microsatellite Analysis The Genotyper program (Applied Biosystems, Foster City, CA, USA) was used for genotyping of microsatellites.

2.8.4 Genome Browsers

For annotation on genomes, the web-based UCSC Genome Browser (http://genome.ucsc.edu/cgi- bin/hgGateway) and Ensembl (http://www.ensembl.org/index.html) were used.

2.8.5 Single nucleotide polymorphisms (SNPs) databases In addition to the official SNP databank Entrez SNP (http://www.ncbi.nlm.nih.gov/sites/entrez?db=snp), HapMap data (http://www.hapmap.org/cgi-perl/gbrowse/hapmap_B35/) were used.

2.8.6 Linkage disequilibrium visualization For measure and graphical visualization of linkage disequilibrium between SNPs, either from the HapMap data or from own sequencing or genotyping, the program Haploview (Barret et al., 2005) was used. According to the LD-structure, those segments in which SNPs alleles showed strong linkage disequilibrium (little evidence of recombination) were defined as haplotype blocks (also called LD blocks).

2.8.7 Haplotype reconstruction A combination of alleles at different loci on the same chromosome is a haplotype. Based on an accelerated EM algorithm, the Haploview software (Barret et al., 2005) estimates haplotypes and their frequencies in a whole group of DNAs. For determination of individual haplotypes, the software PHASE (Stephens et al., 2001), which implements a Bayesian statistical method for reconstructing haplotypes from population genotype data, was applied.

2.8.8 Multiple sequence alignment Homology search was performed using the software ClustalW 1.8 (http://searchlauncher.bcm.tmc.edu/multi-align). The graphic representation was performed with Boxshade (www.ch.embnet.org/software).

2.8.9 Expression data analysis The normalization and statistical analysis of expression data from the Agilent microarrays was performed with the software GeneSpring (Agilent Technologies, Santa Clara, California)

2.8.10 Gene Ontology The classification of differentially expressed genes was made by means of the Gene Ontology Tree Machine program (Zhang, et al., 2004).

2.9 Nomenclature GenBank accession NM_000104 was used as the cDNA reference sequence. The nomenclature recommendations of den Dunnen and Antonarakis [28] were followed. Nucleotide +1 is the A from the ATG-translation initiation codon. For amino acid numbering the translation initiation methionine is considered +1.

22 2.10 Reagents and Materials

2.10.1 Kits

DyeEx 2.0 spin kit Qiagen, Hilden QIAGEN plasmid midi kit Qiagen, Hilden QIAquick gel extraction kit Qiagen, Hilden QuikChange Site-Directed Mutagenesis Kit Stratagene, La Jolla, CA, USA Prism Big Dye terminator cycle sequencing kit Applied Biosystems, Foster City, CA P450-Glo CYP1B1 Assay Kit Promega, Wisconsin, USA

2.10.2 Instruments

Autoclave Hiclave HV25 (HMC, Engelsberg) Centrifuges Eppendorf 5415D and 5810 (Eppendorf, Hamburg) Electrophoresis chamber peqLab, Erlangen Gel documentation BioDoc analyze 2.0 (Biometra, Göttingen) Ice machine Ziegra, Isernhagen Pipettes Pipetman (Gilson, Bad Camberg) Plates mixer Incutec, Wiesloch Power supply Power Pac 300(BioRad,Hercules, CA) EPS 3500XL (Pharmacia, Munich) Robotics Tecan Genesis RSP 100 Tecan Miniprep 75-2 (Tecan, Crailsheim) Beckman Coulter Biomek NX (Beckman Coulter, Fullerton, CA) Hydra (Robbins Scientific, Asbach) Spectrophotometer Ultrospec III (Biotech, Freiburg) Tecan GENios (Tecan, Crailsheim) Biophotometer (Eppendorf, Hamburg) Sequencer ABI Prism 3730 or 3100 (Applied Biosystems, Foster City, CA) Thermocyclers MJ Research (Biozym, Hessisch Oldendorf) MBS Satellite O.2G (Thermo, Ulm) Dual 384-well GeneAmp 9700 (Applied Biosystems, Foster City, CA) Thermomixer Thermomixer compact (Eppendorf, Hamburg) Vortex Janke&Kunkel, Staufen Water bath GFL, Burgwedel

2.10.3 Enzymes

AmpliTaq Gold Applied Biosystems, Foster City, CA, Antartic Phosphatase NEB, Frankfurt am Main DNase I, RNase free Roche, Mannheim Exonuclease I NEB, Frankfurt am Main Pfu Turbo DNA polymerase Stratagene, Amsterdam, Holland Platinum Taq DNA polymerase Invitrogen, Carlsbad, CA, USA WinTaq DNA polymerase Erlangen, own production

2.10.4 Plattes and other consumables

96 Well Polystyrol Microplatten white Greiner, Kremsmünster, Austria G4112F microarrays 4x44K Agilent Technologies, Santa Clara, CA Microseal B Adhesive Seal Biozym, Hessisch Oldendorf Millipore Montage PCR Cleanup filter plates Millipore, Schwalbach Millipore Montage SEQ Cleanup filter plates Millipore, Schwalbach NuPAGE 3-8% Tris-Acetate Gel Invitrogen, Carlsbad, CA, USA Sealing Mat Thermowell 96 Costar, Krackeler Scientific, NY, USA Thermowell 96 well plate Costar, Krackeler Scientific, NY, USA Thermowell Sealers Clear Polyethylene Costar, Krackeler Scientific, NY, USA

2.10.5 Reagents

Agar-agar Merck, New Jersey, USA Agarose Seakem LE Biozym, Hessisch Oldendorf Agencourt Ampure Beckman Coulter, Fullerton, CA, Agencourt CleanSEQ Beckman Coulter, Fullerton, CA, Ampicillin Roth, Jersey City, NJ, USA Anti- human CYP1B1 polyclonal antibody, rabbit Alpha Diagnostics, San Antonio, TX Anti-rabbit secondary antibody Bio-Rad Life Sciences, Hercules, CA Bactopeptone Sigma-Aldrich, St Louis, MO, USA Betaine Sigma-Aldrich, St Louis, MO, USA BigDye Terminator v1.1 Cycle Sequencing Applied Biosystems, Foster City, CA, Boric acid Roth, Jersey City, NJ, USA Bromophenol blue Roth, Jersey City, NJ, USA Chloroform Merck, New Jersey, USA D-Galactose Sigma-Aldrich, St Louis, MO, USA D-Glucose Sigma-Aldrich, St Louis, MO, USA dNTPs Invitrogen, Carlsbad, CA, USA DMSO (Dimethilsulfoxid) Merck, New Jersey, USA EDTA Roth, Jersey City, NJ, USA Ethanol Roth, Jersey City, NJ, USA Ethidium bromide Roth, Jersey City, NJ, USA Fixer for X-ray films Tetenal, Norderstedt Enhancing Roti-Lumin detection system Roth, Jersey City, NJ, USA Glycerine Roth, Jersey City, NJ, USA HiMark pre-stained HMW protein standard Invitrogen, Carlsbad, CA, USA Isopropanol Roth, Jersey City, NJ, USA KCl Roth, Jersey City, NJ, USA LDS-NuPAGE Sample Buffer Invitrogen, Carlsbad, CA, USA LiAc Sigma-Aldrich, St Louis, MO, USA Methanol Roth, Jersey City, NJ, USA MgSO4 Merck, New Jersey, USA NaCl Roth, Jersey City, NJ, USA NaOH Roth, Jersey City, NJ, USA Non-fat dry milk Lasana, Herford Novex Tris-Acetate SDS running buffer Invitrogen, Carlsbad, CA, USA NuPAGE Antioxidant Invitrogen, Carlsbad, CA, USA NuPAGE transfer buffer Invitrogen, Carlsbad, CA, USA PCR-Buffer Invitrogen, Carlsbad, CA, USA Phenol Roth, Jersey City, NJ, USA Polyethylenglycol Roth, Jersey City, NJ, USA Ponceau S Roth, Jersey City, NJ, USA pUC Mix Marker 8 peqLab, Erlangen Reducing Agent Invitrogen, Carlsbad, CA, USA Roentgen developer for X-ray films Tetenal, Norderstedt Sequencing Buffer 5x Applied Biosystems, Foster City, CA,

24 Silencer Sorbitol Sigma-Aldrich, St Louis, MO, USA Tris Roth, Jersey City, NJ, USA Trypton Roth, Jersey City, NJ, USA Trypton/Pepton Merck, New Jersey, USA Tween 20 Roth, Jersey City, NJ, USA Xylene cyanol Roth, Jersey City, NJ, USA Yeast extract Roth, Jersey City, NJ, USA Yeast nitrogen base Roth, Jersey City, NJ, USA

2.10.6 Media and solutions

Agar plates 15 g Agar-agar 1 L LB-medium Extraction Buffer A 0.32M Sucrose 10mM Tris HCl pH 7.6 5mM MgCl2 DNA-Loading Buffer (6 x) 0.25 % Bromophenol blue 0.25 % Xylene cyanol 30 % Glycerine LB-Medium 10 g Trypton 5 g yeast extract 10 g NaCl 1% Triton-X-100 volume to 1 L with water volume to 1L with water Selective medium for yeast 7g yeast nitrogen base 20g Glucose Yeast synthetic dropout medium supplement without uracil Selective plates 15g Agar up to 1L selective medium up to 1L bidest. Water, pH 7.5 TBS-Tween 24.2 g Tris 80 g NaCl 15 ml 32% HCl, pH 7.6 10 ml Tween-20 volume to 1L bidest. water, pH 7.6 TBE (1 x) 90 mM Tris 90 mM boric acid 1.25 mM EDTA, pH 8.3 TE (1 x) 10 mM Tris 1 mM EDTA TEG 50 mM Tris-HCl pH 7.4 1 mM EDTA 20% glycerol (v/v) TEK 50 mM Tris-HCl pH 7.4 1mM EDTA 100mM KCl TESO 50 mM Tris-HCl pH 7.4 1 mM EDTA 0.6 M Sorbitol YPGA medium (non selective medium for yeast) 10g yeast extract 10g Bactopeptone 5g Glucose volume to 1L bidest. water, pH 7.5 YPGA plates 15 g Agar volume to 1L YPGA medium

2.10.7 Oligonucleotides (5´-3´, for each gene in alphabetical order)

They were ordered from Invitrogen (Karlsruhe) or Thermo Scientific (Ulm).

Primer Name Primer Sequence (5'-3') ADAMTSL1 ADAMTSL1_1f CTCGGTCAGGAAATGTGAGAG ADAMTSL1_1r CCATGCAGTATGTCCCAAAGT ADAMTSL1_2f CCCCCTGAACATATAGGCATT ADAMTSL1_2r AGCTGCAGATGGACGTAAGAA ADAMTSL1_3f GAAAAGAGAGGCCCTTTTACTA ADAMTSL1_3r ACTGCTTAGCACCATTCAGTG ADAMTSL1_4f CTGCTCTGGTTTCATGTTTGG ADAMTSL1_4r TTCGCACAATACAACACTTGG ADAMTSL1_5f AGGGATGAAGGGAGGGTTATT ADAMTSL1_5r GACTGCAGCTGGTAACCTGAC ADAMTSL1_6f GGTATGGAAGTCAGTGCCTTTA ADAMTSL1_6r CCCATTGGGAGCATCTATTTT ADAMTSL1_7f TTTGACAGGAACCCTTGAATG ADAMTSL1_7r TCAGAACCAAAAATCGCTCTC ADAMTSL1_8f CAGTCCCTCACACAGCCTAAA ADAMTSL1_8r AAGGATCTGGTCCAAGACAGC ADAMTSL1_9f ATGACTAAGGCATTGGGGAAT ADAMTSL1_9r GCATGTCACCTGCTGCTTTAT ADAMTSL1_10f ATGGTGCCCTTTCAAAGAACT ADAMTSL1_10r CAAAAGCAGAACTCAGGATGG ADAMTSL1_11f GGCAATAGATGGCTTTTGGTT ADAMTSL1_11r GGAGCTAAGCTGGTAGGCTTC ADAMTSL1_12f TTTCGATGGGAAGTGAAGAAA ADAMTSL1_12r TCCGTATTCTTCAGCAATAGTCC ADAMTSL1_13f CATCATCAGAGGCAGCAATTT ADAMTSL1_13r CCAAAAAGCTTTGGTGAGATG ADAMTSL1_14f ACAGCTCTGGGCACTGGA ADAMTSL1_14r TTTGAGGCAGTCACATGATCC ADAMTSL1_15f CAGCTCAAGTGATGCTTGACA ADAMTSL1_15r TAGAATTCCAAAGCCCTGGTT ADAMTSL1_16f CACCTGGTTCCACATTTCTGT ADAMTSL1_16r GACCCTTTTGCATGTTTTTCA ADFP ADFP_2f CTTTGCCTCAAAAGAGGGAGT ADFP_2r TCTCTGCCATCTCACACACAG ADFP_3f CCACAACCGGTATGAATTTTG ADFP_3r TACGGTAATGAGGGTCACCTG ADFP_4f CAGCCCATTATTGCCATTTTT ADFP_4r ATCCAGGTTGGGAAAACAAGT ADFP_5f TTCAGCTGTGCTGCCTTAGTT ADFP_5r AACTGGATTGCAGTGATGCTT ADFP_6f CCAGGCCTTATCACTTGTCAC ADFP_6r GACCCCTCAGAGCGAGATTAG ADFP_7f CTGCAAACAGGCTAACGTGAA ADFP_7r TGTACCCATTATGAGGGCAAG ADFP_8f TGTGGTGGACACATAACCAG ADFP_8r TGCTTCCCAATTTAGGGTTG

26 CDKN2A CDKN2A_1af GACTTCAGGGGTGCCACA CDKN2A_1ar GAGAATCGAAGCGCTACCTG CDKN2A_1bf CAACGCACCGAATAGTTACG CDKN2A_1br GGAGGCTAAGTAGTCCCAGCA CDKN2A_2f TAGACACCTGGGGCTTGTGT CDKN2A_2r TGTGCTGGAAAATGAATGCT CDKN2A_2is058195f CTCAGAGCCGTTCCGAGAT CDKN2A_2isof058195r AGTCGTTGTAACCCGAATGG CDKN2A_3f TACATGCACGTGAAGCCATT CDKN2A_3r CGTGAGTGCTCACTCCAGAA CYP1B1 CYP1B1_e1F CAGTCCTTAAAACCCGGAGG CYP1B1_e1R CCACCCGCTACCTGTAATAATC CYP1B1_e2p1F ACCCAACGGCACTCAGTC CYP1B1_e2p1R CGAGTAGTGGCCGAAAGC CYP1B1_e2p2F ATAGTGGTGCTGAATGGCG CYP1B1_e2p2R GGAAGTACTGCAGCCAGGG CYP1B1_e2p3F CTACAGCCACGACGACCC CYP1B1_e2p3R GCATATTCTGTCTCTACTCCGC CYP1B1_e3p1F TTTTGCTCACTTGCTTTTCTCT CYP1B1_e3p1R TAGAAAGTTCTTCGCCAATGC CYP1B1_e3p2F GCCTGTCACTATTCCTCATGC CYP1B1_e3p2R CAGCTTGCCTCTTGCTTCTTA CYP1B1_e3p3F TGTGAATCATGACCCAGTGAA CYP1B1_e3p3R TTCATTGGGCCCTTTAAGTCT 3UTRyexon1af GTACCGAGCGTGGTTCTGG 3UTRyexon1ar GGCAAGACGTCAACAGGAAC 3UTRCYPf CAGGTCAATAATAGCACGAGATTC 3UTRCYPr CGCCGCTTCTGGAAAGTC 5UTRaf GAATTTGAATTATCAGCAAAGAAAAA 5UTRar TTGGGCAGACACAGCTTAGA 5UTRbf GCCATTCTGATTATTGAGTTCCA 5UTRbr CCATCTTTCCTTCTTTTCAGTG 5UTRcf AAGCTTTTTGGAATCTTTGTACC 5UTRcr GGGCCTACATACGTAAAAACAGA 5UTRdf TTGGAGGCTGGAGTAATCAGA 5UTRdr TTGGTATATCAAACAGTAAAGGCTACA 5UTRef TGAATGCTTTTAGTGTGTGCAT 5UTRer ACCCATCTTATTTTATTGGACATT exon1b_int1f GAGCGAGGCACCCTTCTC exon1b_int1r ACACTCAGGGGTGCAGAGAC intron2af TATGCTGAGTTTGCAAGCAG intron2ar GTCTTCTACCCCGGCATTTC intron2bf CAGGTAACCCGCACAGAAAC intron2br AAGGAAATATAGATTGCAGTGGA intron2cf GCGCCACAGAAAGGTGTT intron2cr TTTTAGACTTTGTGGACCAAACC intron2df TCTACAACACAAGGCAGAGCA intron2dr TCCCGCCTCATTTTAAACC rs232542f GCCTTAACCCTACTGCACCA rs232542r TTTATATCACTCACCATTCTCTTCC rs2432661f GCCCAGAGAACACCTGACTC rs2432661r ATTCACACGCAGCAGACTTG rs232620f TTGCTTTCAGCCTGACCAAT rs232620r GGGCCACTGCAAATAGAAAG 27 rs232610f GGGAGAAGTGGGTAAGAACG rs232610r CTGTTGGGCTGCTTTTCATT rs162549f TGGGCTGCTGTAGCCTATTT rs162549r CTCTCCGGTAGAAACACAATGA rs1056843-162562f TGCATCTTGGTTATTTCTGAAGG rs1056843-162562r TTTCACACTATTTGGTGACTTTTT rs162561-7599999f CATTTCTAGGCATGGATTACTGG rs162561-7599999r GGTACCGCAGGGACAGTG rs2567206-162558f GCTCTACCAGCAGGCTTTCA rs2567206-162558r GGATATGACTGGAGCCGACTT DAPK2 DAPK2_1f AGACAGATCTGAAGACCTGAGGA DAPK2_1r CTGACAACTGTGCCAGAAGAAG DAPK2_2f GAATTTGTGTGACCTGGTAGCTG DAPK2_2r CACCACTGACTTCACCTCCTCT DAPK2_3f GTGATTCCTGCCCTTGTGAT DAPK2_3r GAAAGACACCAGGAGGGACTAAG DAPK2_4f CACAGAGAAGACTGAGGACCAAA DAPK2_4r ATCTCTTTGCTCAGAGGCCATAG DAPK2_5f CAGATCACCTTTATCTGCTGCTC DAPK2_5r GCTCTGAACAGTGAGTGTGGAGT DAPK2_6f CAGGAGTCTGATCTTGAACTTGG DAPK2_6r CTGTGTGGACTTAACACATCTGG DAPK2_7f GGAGCTCCATGAACATGTATTG DAPK2_7r TAGACCACAACAGTGCAGATGAC DAPK2_8f GGTGTAGGTAACAAGGCCACTCT DAPK2_8r GGGTCAGTGTTTAAAGCAAAGG DAPK2_9f CAACTCCTGAACAGCTGAGACAT DAPK2_9r AGGTGAGAATGTGCATGGAGAC DAPK2_10f CTGGAGAACTTCAGGAAGCAGTA DAPK2_10r GAAGATCACACTTCAGCCTTCAG DAPK2_11f GGCGTCTCATGATCCTCCT DAPK2_11r GAGCTGGGTCCAAAAGTCTG ELAV2 ELAV2_2f CACTTTTTGTTGAAGCATTGTTG ELAV2_2r GCAGCAGTGAATTATTTACAAGCA ELAV2_3f CTGTTGAGGAAATATGCTGGTG ELAV2_3r GAGACTTGATTCCGTAGGCTTC ELAV2_4f GTTAGCACCTGACTTGCTTGAAC ELAV2_4r CTGGCCCACATATACCTTTGAT ELAV2_5f GAAAGTTTCCTCCTGGTGTGAT ELAV2_5r GCAAACCAGAGATCCTGTCAA ELAV2_6f CTGACCCTTGTAGAGAGAAACCA ELAV2_6r GCTGTAACGTCGTAACGCAATA ELAV2_7f ATTCTTGGGGATGGAAAAGG ELAV2_7r TCCCCATCTCAACACTGACTT FOXC1 FOXC1_1f CCCGGACTCGGACTCGGC FOXC1_1r AAGCGGTCCATGATGAACTGG FOXC1_2f CCCAAGGACATGGTGAAGC FOXC1_2r CTGAAGCCCTGGCTATGGT FOXC1_3f ATCAAGACCGAGAACGGTACG FOXC1_3r GTGACCGGAGGCAGAGAGTA FOXC1_4f TACCACTGCAACCTGCAAGC FOXC1_4r GGGTTCGATTTAGTTCGGCT Ki-Ras 28 Ki-Ras_2f TACGATACACGTCTGCAGTCAA Ki-Ras_2r GTATCAAAGAATGGTCCTGCAC Ki-Ras_3f CTTTGGAGCAGGAACAATGTCT Ki-Ras_3r GCATGGCATTAGCAAAGACTC Ki-Ras_4f CATTGTTTTCTTTCAGCCAAA Ki-Ras_4r AAGAAGCAATGCCCTCTCAA Ki-Ras_5f CAAACCAGGATTCTAGCCCATA Ki-Ras_5isofbf CTGTACACATGAAGCCATCGTA Ki-Ras_5isofbr GTAATCAACTGCATGCACCA Ki-Ras_5r GGTTGCCACCTTGTTACCTTTA Microsatellites MicroCYP1f AGGGTGTTCCCTTCTGCTCA MicroCYP1r AGGACAATCCCAAGTGACTA MicroCYP2f GTGCTGCATTTCTTATGAAA MicroCYP2r CATGATTTAGTACATATCTC MicroCYP3f TACGCCAAGACAATAGCCCA MicroCYP3r AAAGAGCCAGACTCCGTCTC MicroCYP4f CTGCTTCCAAAAACTTTTGA MicroCYP4r TGTGTAAGGATTTGATCACC MicroCYP5f ATCTAAGTGTCCATCAACAG MicroCYP5r TAACAAGATGCCCTTCAATT MicroCYP6f TCTGTAGGAGCACATAGTCC MicroCYP6r GGCACAATCTCAGGAGACTC MicroCYP7f TTCAGGAGAAGAGCACTTGG MicroCYP7r AGTCACACTGAGCTCAAAAC D1S228f AACTGCAACATTGAAATGGC D1S228r GGGACCATAGTTCTTGGTGA D1S402f AGTGAGATTTCAGAAAGAAAAG D1S402r TTATGGAACTTGGAAATTGAC D1S2834f TGTCGGATGTGGGCAG D1S2834r TATGAAATGGGGATAATAGTACGG D1S1176f GCGAAACTCCATCTCAAAAGAA D1S1176r GGAGCGTGTGAAGATAATGC MLLT3 MLLT3_1f CTCCGCAATCATCTTCTTTACC MLLT3_1r AGCCGTACCAACCTTTCTCTAA MLLT3_2f CGTTACAATCCTGTCCGATGTAG MLLT3_2r GCCAAGCGATTGTTTCAAAG MLLT3_3f CGTGTGATCTAGATGGTAGAATGG MLLT3_3r GGCTAATGGTGGATCGTCTACT MLLT3_4f TGTTTCACTGATGATTCCATGA MLLT3_4r TGAATCCACAGCTAAGCCATT MLLT3_5af TTTTTGGTATTTTAATGATAGCTTGA MLLT3_5ar CTTGTCCACTGGTGATGGTG MLLT3_5bf TGGCCTTCAAGGAACCTAAA MLLT3_5br GGCCAGATCTACCTCTGTGCTA MLLT3_6f GGGAGACCTGTATAGCAGTAAACG MLLT3_6r CCGTGTTAGCTAGGATGGTCTT MLLT3_7f AACCAGTGTTCAGTGCTGGTAAG MLLT3_7r AAGTGTGTGTAGGCATACCAAGG MLLT3_8f CTTTCCACGCCTATTTCTATGG MLLT3_8r TCTTCTCATGACAGCAGAACCTC MLLT3_9f AGGTGGCTGGTTAGCTAAGAGAT MLLT3_9r CAAACTACAAAGCACTGGGATG MLLT3_10f CTGCTGCCTGTGTGTTCTTACTT MLLT3_10r AGCTCCAGAGCAGACTTCTAGGT 29 MLLT3_11f CCCTCCATTACTCTCTCTTTGC MLLT3_11r AAGGCTATCCAGGCTAACTCTTC Mutagenesis 4832delCTC_f CCACCGCGCTGCAGTGGCTGCTCCTCTTCACCAGGTAAAG 4832delCTC_r CTTTACCTGGTGAAGAGGAGCAGCCACTGCAGCGCGGTGG 4832delCTC_del2C_f GCTGCAGTGGCTGCTCTCCTCTTCACCAGG 4832delCTC_del2C_r CCTGGTGAAGAGGAGAGCAGCCACTGCAGC 4832delCTC_del1C_f CGCGCTGCAGTGGCTGTCCTCCTCTTCACCAG 4832delCTC_del1C_r CTGGTGAAGAGGAGGACAGCCACTGCAGCGCG 4832delCTC_delT_r CGCTGCAGTGGCTGCCCTCCTCTTCACCAG 4832delCTC_delT_f CTGGTGAAGAGGAGGGCAGCCACTGCAGCG Glu229Lysr CTGCTCAGCCACAACAAAGAGTTCGGGCGCAC Glu229Lysf GTGCGCCCGAACTCTTTGTTGTGGCTGAGCAG Glu387Lysf CCTGGCCTTCCTTTATAAAGCCATGCGCTTCTC Glu387Lysr GAGAAGCGCATGGCTTTATAAAGGAAGGCCAGG Gly61Gluf GCGTGGCCACTGATCGAAAACGCGGCGGCGGTG Gly61Glur CACCGCCGCCGCGTTTTCGATCAGTGGCCACGC Arg48Glyf CGGAGGCGGCAGCTCGGGTCCGCGCCCCCGGG Arg48Glyr CCCGGGGGCGCGGACCCGAGCTGCCGCCTCCG Ala119Serf CCTTCGCCGACCGGCCGTCCTTCGCCTCCTTCC Ala119Serr GGAAGGAGGCGAAGGACGGCCGGTCGGCGAAGG Val432Leuf GTGAATCATGACCCAGTGAAGTGGCCTAACCC Val432Leur GGGTTAGGCCACTTCACTGGGTCATGATTCAC Asp449Aspf CGATTCTTGGACAAGGATGGCCTCATCAACAAGG Asp449Aspr CCTTGTTGATGAGGCCATCCTTGTCCAAGAATCG Asn453Serf GGACGGCCTCATCAGCAAGGACCTGACCAG Asn453Serr CTGGTCAGGTCCTTGCTGATGAGGCCGTCC Tyr81Asnf CGCCTGGCGCGGCGCAACGGCGACGTTTTCC Tyr81Asnr GGAAAACGTCGCCGTTGCGCCGCGCCAGGCG Asn203Serf CGTCGTGGCCGTGGCCAGCGTCATGAGTGCCG Asn203Serr CGGCACTCATGACGCTGGCCACGGCCACGACG Ala443Glyf GGAGAACTTTGATCCAGGTCGATTCTTGGACAAGG Ala443Glyr CCTTGTCCAAGAATCGACCTGGATCAAAGTTCTCC P52Pwegf GGTCCGCGCCCCCGGGCCCGTTTGCGTGG P52Pwegr CCACGCAAACGGGCCCGGGGGCGCGGACC DespATGr CGACAGGAGTAGCAGGAGC AntesStopf CCTTGGCTTGTAAATTTTGG Pro52Leuf GCTCCGGTCCGCGCCCCTGGGCCCGTTTGCGTGGC Pro52Leur GCCACGCAAACGGGCCCAGGGGCGCGGACCGGAGC pYeDP60f CTATACTTCTATAGACAC pYeDP60r ACCACCAGTAGAGACATGGGA Gly168Asp_s CAAGTCCTCGAGGACCACGTGCTGAGC Gly168Asp_as GCTCAGCACGTGGTCCTCGAGGACTTG Gly329Val_s CACTGACATCTTCGTCGCCAGCCAGGACA Gly329Val_as TGTCCTGGCTGGCGACGAAGATGTCAGTG Arg368His_s CGTGGGGAGGGACCATCTGCCTTGTATGG Arg368His_as CCATACAAGGCAGATGGTCCCTCCCCACG Ala443Gly_s GGAGAACTTTGATCCAGGTCGATTCTTGGACAAGG Ala443Gly_as CCTTGTCCAAGAATCGACCTGGATCAAAGTTCTCC Val465Ala_s AGAGTGATGATTTTTTCAGCGGGCAAAAGGCGGTG Val465Ala_as CACCGCCTTTTGCCCGCTGAAAAAATCATCACTCT MYOC T1af GCTTAGACCTGGAGGCCA T1ar CAGGTCACTACGAGCCATATC T1bf TAAACCTCTCTGGAGCTCGG T1br CTGGTCCAAGGTCAATTGGT 30 T2f ACATAGTCAATCCTTGGGCC T2r ATGAATAAAGACCACGTGGG T3af TGGAACTCGAACAAACCTGG T3ar GAAAGCAGTCAAAGCTGCCT T3bf ATCAGCCAGTTTATGCAGGG T3br ACAAGGTGCCACAGATGATG T3cf CGGGTGGTAGAGCCTAGCTT T3cr CACCCGTGCTTTCCAGTG PAX6 PAX6_4F GAGGTTGAGTGGATCAATTCCT PAX6_4R CAGTATCGAGAAGAGCCAAGC PAX6_5F ATTGTGGTTGTCTCCTCCTCCT PAX6_5R CCAGGTTGAAAGAGATAGGGAAG PAX6-5cF TTGTCCTTTATTTGATCGATAGCA PAX6-5cR GGGTCCATAATTAGCATCGTTTAC PAX6_6F CACTTTAAGCAAGGTCAGCACA PAX6_6R TCGCTACTCTCGGTTTACTACCA PAX6_7F AAAGTCCAAGTGCTGGACAATC PAX6_7R AGGTAAAGAGGAGAGAGCATTGG PAX6_8F GAGATGGGTGACTGTGTCTTCA PAX6_8R AGAGGAAATGGTTGGGAGAGTAG PAX6_9F AAGAAGGCTGACAGTTACCTTGG PAX6_9R CAAAGGGCCCTGGCTAAAT PAX6_10F GTGGGAAAGTTCTTCCAAGTACAG PAX6_10R CAGAGCATTTAGCAGACTGAACC PAX6_11F TTTCCTAGAGACAGAGGTGCTTG PAX6_11R CAGATGTGAAGGAGGAAACTGAG PAX6_12F CAGTGTCTACCAACCAATTCCAC PAX6_12R GATTGACTGTCTCCGACTTGACT PAX6_13F CATAGGCAGCTTTCTTCTAGCTG PAX6_13R CCCATAAGACCAGGAGATTCTGT PAX6_14F GCTCCTCTAGACCTTTTGCTG PAX6_14R AAGTCCATTCCTTCCCCAGT PAX6_5bf ATGTCTGGCATGGCTGGT PAX6_5br AAGGATGGTGGAAGGAGAGG pax6_14bf AACCTATAAATTTGTATTCCATGTCTG pax6_14br CGGCTCTAACAGCCATTTTT PAX-14cf TTCCATGTCTGTTTCTCAAAGG PAX-14cR AAGTCCATTCCTTCCCCAGT PITX2 PITX2_1f AAAAACACGCCTGAAGCCTA PITX2_1r CTGGCGATTTGGTTCTGATT PITX2_2f GCAGAAAGAGTACGCCATCC PITX2_2r CCAGAGGCGGAGTGTCTAAG PITX2_3f ACACTTGCGCCTGCACAC PITX2_3r CCTCGGAGAGGGAACTGTAA PITX2_4f AAAGCTGGCCCTGGTATCTT PITX2_4r ACGGGCTACTCAGGTTGTTC PITX2_5f CCAAGAGCTTCCCCTTCTTC PITX2_5r GAGCTCTCTCTTTGATTCAGTGG PITX2-6f ACTTTCCGTCTCCGGACTTT PITX2-6R GAACGACCACTCCCACCAC RRAGA RRAGA_1af GCGCTCTCGACTCTCCTG RRAGA_1ar TTTCCAGTTCGCGGCTCT RRAGA_1bf TAGGGAACCTGGTGCTGAAC 31 RRAGA_1br TTCATCGGCCTCAATGATTT RRAGA_1cf ACGCTCTACAAAGCCTGGTC RRAGA_1cr AGCCCACTTTTAAGCACACG RPS6 RPS6_1f GGTTAGCCCTCAGAATTACACG RPS6_1r CTACTTGAGACCCTTCTCCACCT RPS6_2f GCTTCTTGACTGCTACTCTGCTT RPS6_2r ACCAGTTACCAATGGCGTTTAC RPS6_3f GTGTTCACAGAGGTCACAATCCT RPS6_3r GGTCTGTAAGTCTGGATACTGCAA RPS6_4f GCAGTATCCAGACTTACAGACCAA RPS6_4r GCACTCTACAAGGCACTGGATA RPS6_5y6f GGTTTTCATAGATGCTGTTAAGC RPS6_5y6r ACCATATATACATATCCCCATTTTCT SH3GL2 SH3GL2_1f GAGTGTTTCTCCGCAAGAGC SH3GL2_1r AGCGCTACCAGGCAGGAC SH3GL2_2f GCTTGCTTCTATACCCACCAGAT SH3GL2_2r CAGGACAGTACAAAGGGAAGACA SH3GL2_3f TACAGTGTCAGCATGACTTCCAG SH3GL2_3r CTATCCATGAAGTCGCTAACCTCT SH3GL2_4f GACTGACTGACGGAGAGAACACT SH3GL2_4r GATTTGACCGATTCCCTACAGA SH3GL2_5f GGGAGCTTCCTAAATTGCTTCT SH3GL2_5r CTGACAACACACAGGGTAAGCTA SH3GL2_6f TCTCTGGTGGCGTTGTATTT SH3GL2_6r TGTTGTGCCTCGATGATAAG SH3GL2_7f AGTGGCTGTTTAGGGATGGTAAC SH3GL2_7r TGGCATCCATTATCAGCAGTAG SH3GL2_8f AGAGGAAGTGAGGGATTGAGAGA SH3GL2_8r CCTATGCAGCCAGATTGGACTAT SH3GL2_9f AGGCAGCAGATTCTGTGAGTTA SH3GL2_9r CCCACCAGGCTAAGAGGATA SLC24A2 SLC24A2_10f CGTGTCTGACTACTCCCTTGTCT SLC24A2_10r CCAGTGTGAATCCATCTCTCCT SLC24A2_1af ATCCCTGATTGTGAAAGTACCC SLC24A2_1ar ACTATTCTCAGACTCGCCTTCCT SLC24A2_1bf GGTAGCACAGGGTTACCATCAG SLC24A2_1br GCCACCATGTCAGGTTTAAGAT SLC24A2_1cf GGGTATTTATCGCTCACAGCA SLC24A2_1cr CCCAAACACCATCACATCAA SLC24A2_2f AACTGCTCTGTATTGCTGGACA SLC24A2_2r CCAAGGGAGAGAGTAATGTGTTG SLC24A2_3f CACCAGACTAGGTGAGGATCTTG SLC24A2_3r GGCAGAAGCTAAACAAGAGGAG SLC24A2_4f CTATTCTGTAATGCAGGGCACAC SLC24A2_4r GTCACTGAAGTCATGCAGAGAGG SLC24A2_5f CAGTAGGGAAGCTTTAGTGTTGC SLC24A2_5r ACACTGGTCCTGACTCTCTGCT SLC24A2_6f ACTATCCTCTGCTTTAGCCCAAC SLC24A2_6r CAAGGATGTATAAGGCCCTACCT SLC24A2_7f TCCTAGGACTCAGACTGTGACAAA SLC24A2_7r GCAGACTATGCACCCTGTTATGT SLC24A2_8f GGAGAATCTTACTGTCCCAGCTT SLC24A2_8r ACACTTGACAATCAGGACTGGAG 32 SLC24A2_9f GCCTTGGGTCTGAATATCCTAA SLC24A2_9r CAGAGATCCTGGTCATGTCTTTC SNAPC3 SNAPC3_1f ACTACAACTTCCATCACGCTCTG SNAPC3_1r CTAGCCCAGGTCTAAACCACAG SNAPC3_2f CTAACTCGCTGTGAACCAGATG SNAPC3_2r ATCCCATACACACGGCTAAAGT SNAPC3_3f GGAAGCTGAACAAGAGATAGAAGG SNAPC3_3r CCCAGACTCAAAGGAGTTTCTCT SNAPC3_4f CTTGCTGATAGCCATTGTACCAC SNAPC3_4r TCTCACTGTGTTACCCAGGTTG SNAPC3_5f GACCATGAGTTTGGCCCTAT SNAPC3_5r GGTGATAAAGGGAAGGAATGAG SNAPC3_6f CAGCAATAGGGTAAAATTGAAAA SNAPC3_6r TGGATGTATGTAATGCAAAAGACA SNAPC3_7f GTTGGGTGAGCTAGGTTAATGTG SNAPC3_7r GGATGCAAATGGATGGAAAG SNAPC3_8f TGGTGAAACATGGCATAACAA SNAPC3_8r TGATTTTCTGGCACTTCCCTA SNAPC3_9af TGTAGAGAGAGTATTGGTGGTGATG SNAPC3_9ar GCTTTAGCGGACTGTTCAAA SNAPC3_9bf CCCCCTCATGAAATAACTGTTC SNAPC3_9br GGCAACAAGAGCGAGATTTT SNAPC3_10otraisf TTACAGGCATGAACCACAGC SNAPC3_10otraisr TGGTTTGCTGGCAGTTATCA SNAPC3_11otraisf TGTTGCAGAATTACACGACACA SNAPC3_11otraisr CCATGACCAAGCAGAACTGA SNAPC3_12otraisf CAAAGGGATTTTCTCCCTCA SNAPC3_12otraisr GATTTTGAAATATGTTGGTATCACAG ZDHHC21 ZDHHC21_4f TCAACTACAGAAAGAAAATGTCAAA ZDHHC21_4r AGGCCATTATTTCCATAAGTTCA ZDHHC21_5f GTCCTCCTGACAGTGTTATTTGG ZDHHC21_5r GTGATACAGAAGCCAAGAGATGG ZDHHC21_6f CAGCAGCATTTATGGCAAAC ZDHHC21_6r GACTTTGGGAGTTGACAGAACC

3 Results

3.1 Linkage analysis for POAG with the Costa Rican family CR-2

A genome-wide scan with around 400 microsatellite markers (the Weber panel) was performed for the Costa Rican family CR-2, in which POAG appeared to segregate in an autosomal dominant manner. A total of 32 members of the family were recruited, 7 of which were affected (Fig. 3.1).

I:1 I:2

? II:1 II:2 II:3 II:4

317 III:2 III:3 III:4 III:5 199 III:7 III:8 305 228 223 211 225 227 193 194 212

315 314 316 318 187 213 214 217 310 210 311 208 313 301 292 296 221 226 192 196 195

Fig. 3.1. Pedigree of the CR -2 family with POAG.

After performing linkage analysis, assuming autosomal dominant mode of inheritance and complete penetrance, LOD scores suggestive of linkage had been obtained for several chromosomal regions. In order to refine the analysis, a genome-wide scan was performed for 10 persons in family CR-2 with the 10K microarray from Affymetrix, with which over 10 000 SNPs can be genotyped in one run. In the parametric analysis several peaks could be observed in different regions, but none of them reached significance (Fig 3.2).

Fig. 3.2. Parametric analysis for family CR-2 based on the original clinical data. The vertical lines divide the 23 chromosomes.

In the non-parametric analysis the highest scores were obtained in chromosomes 1p22.3 and 14q11.2-q12 (Fig. 3.3). However, a detailed analysis revealed in both loci unaffected persons who carried the affected haplotype. One of the two regions is located in chromosome 14q11-q12, a region which had been identified in two genome-wide linkage analyses for POAG (Nemesure, et al., 2003; Wiggs, et al., 2000). Both regions are relatively large (more than 7Mb), and for this reason it was not possible to sequence all genes in both intervals.

Fig. 3.3. Non-parametric analysis for family CR-2 based on the original clinical data. The vertical lines divide the 23 chromosomes.

In order to confirm the clinical diagnosis, and possibly find new family members a scientific excursion was made with Dr. Bergua (from the Ophthalmological Department of the University Hospital of the Friedrich-Alexander University of Erlangen-Nürnberg) to Costa Rica. The members of family CR-2 were examined at home, with a limited number of tests including IOP measurement, optic nerve examination, and a rudimentary visual field test. Two of the affected individuals included in the analysis had died in the meantime and their status could not be confirmed. For a woman who had been classified as affected, and was under medication, it was not possible for the ophthalmologist to determine if she indeed presented an early stage of glaucoma, or macropapilla (a large optic disc). A man who had been classified as unaffected, was identified by Dr. Bergua as possibly affected. In order to confirm the diagnosis, a more detailed examination in a well-equipped practice, and follow up appointments would have been needed. This person lived several hundred kilometres away from the capital and refused to make an appointment with an ophthalmologist. Therefore, the 2 deceased persons, and the 2 unclear cases hat to be classified as “phenotype unknown” for the new linkage analysis. Due to the reduction in the number of affected individuals, the family did not have enough statistical power, and as a result no clear peaks were obtained after the linkage analysis calculation (Fig. 3.4).

Fig. 3.4. Non-parametric analysis for family CR-2 after the modification of the clinical data.

It became clear, that a classic positional cloning strategy could not be followed with family CR-2. A candidate gene approach was then adapted for this family in cooperation with the glaucoma group at the Institute of Human Genetics. Before performing the genome-wide scan, mutations in the glaucoma genes myocilin and optineurin had been excluded. Afterwards, the gene WDR36 (Monemi, et al., 2005) was sequenced in the family as well as the genes on which the glaucoma group has focused, RPGRIP1, NTF5 and LPHN1, without finding any mutations. The cause of the glaucoma in the family remains yet undiscovered.

3.2 Studies with pterygium corneae

3.2.1 Linkage for pterygium with family CR-2

During the ophthalmologic examinations of family CR-2, an additional affection of the eye was found in 14 members, pterygium corneae. The pedigree of family CR-2, now modified to show the persons affected with pterygium is shown in figure 3.5.

? ?

Fig. 3.5. Pedigree for the CR-2 family from the point of view of pterygium corneae. Only the right branch of the family (circled) was used for the calculation. The linkage analysis was recalculated for the CR-2 family, with pterygium corneae as phenotype instead of POAG, and assuming autosomal dominant inheritance and a penetrance of 70%. In this case, more importance was given to the non-parametric calculation, due to the incomplete penetrance which has been reported. After the new analysis peaks suggestive of linkage were found at chromosomes 9p23-p21.2 and 15q22.2- q24.2 (Fig. 3.6).

Fig. 3.6. Non parametric linkage analysis for pterygium corneae in the CR-2 family.

However, the haplotype analysis for both regions shows affected individuals who do not present the affected haplotype. The haplotypes for the chromosome 9 region, which displayed a non-parametric score of over 9, are shown in figure 3.7. Due to the reduced penetrance assumed in the analysis, it is expected to find unaffected individuals carrying the affected haplotype. In this case there are 4 unaffected individuals, and 3 persons classified as phenotype unknown who present the affected haplotype. Individual 313 was classified as affected, but does not present the affected haplotype.

? ? II:3 II:4

(2) (1) (1) (1) (2) (2) (2) (2) (1) (2) (2) (2) SNP (1) (1) (1) (1) (2) (1) (2) (1) (2) (2) (2) (2) (2) (2) (2) (2) rs679047 (2) (1) (1) (1) (2) (2) (1) (2) (2) (2) (2) (2) rs2009991 ?? ?? (2) (1) (2) (2) (2) (2) (2) (1) rs1887377

12,3 Mb 12,3 (2) (1) (1) (1) (2) (1) (1) (2) 13,6 Mb (2) (2) (2) (2) (1) (1) (1) (1) (2) (2) (2) (2) (1) (1) (1) (?) (1) (1) (1) (1) (2) (2) (1) (2) rs754257 (1) (1) (1) (1)

? ? ? III:4 III:5 199 III:7 III:8 305 228 III-11 223 211 225 193 212 III-12 (1) (1) (2) (?) 21 (1) (1) (1) (1) 22 21(2) (?) 11 11 21 1121(1) (?) (2) (2) (2) (?) 22 (2) (2) (2) (2) 22 22(2) (?) 22 22 22 2222(2) (?) (2) (2) (1) (?) 12 (2) (1) (2) (2) 22 12(2) (?) 22 22 12 2212(2) (?) (1) (1) (1) (?) 11 (1) (1) (1) (1) 11 11(2) (?) 11 11 11 1111(1) (?) (1) (2) (2) (?) 22 (2) (2) (2) (1) 22 22(1) (?) 12 12 22 1122(1) (?) (2) (2) (2) (?) 22 (2) (2) (2) (2) 22 22(2) (?) 22 22 22 2222(2) (?) (2) (2) (2) (?) 22 (2) (2) (2) (2) 22 22(2) (?) 22 22 22 2222(2) (?) (1) (1) (1) (?) 21 (1) (1) (2) (1) 11 21(1) (?) 11 11 21 1121(2) (?) (2) (1) (2) (?) 21 (2) (2) (1) (1) 22 21(1) (?) 21 21 21 2221(2) (?) (2) (2) (2) (?) 22 (2) (2) (1) (2) 21 22(2) (?) 22 22 22 2222(2) (?) ?? ?? ?? ?? ?? ?? ?? ?? ?? ?? ?? ???? ?? (1) (2) (2) (1) 22 (2) (?) (1) (2) 22 12(2) (?) 12 22 22 1222(1) (?) (2) (2) (2) (1) 22 (2) (?) (2) (2) 22 22(1) (?) 22 22 22 2122(2) (?) (1) (1) (2) (1) 21 (1) (?) (1) (1) 11 11(2) (?) 11 21 21 1121(2) (?) (1) (1) (1) (2) 21 (1) (?) (1) (1) 12 11(1) (?) 11 21 21 1221(1) (?) (2) (2) (1) (2) 22 (2) (?) (2) (2) 21 22(2) (?) 22 22 22 2222(2) (?) (1) (?) ?? 11 (1) (?) (1) (1) ?? 11 ?? 11 11 11 1111 ?? (2) (2) (1) (1) 22 (1) (?) (2) (2) 11 22(1) (?) 22 22 22 2222(2) (?) (1) (1) (2) (1) 11 (1) (?) (1) (1) 12 11(2) (?) 11 11 11 ?111(1) (?) (1) (1) (1) (1) 11 (1) (?) (1) (1) 11 11(1) (?) 11 11 11 1111(1) (?) (2) (1) (1) (1) 21 (1) (?) (2) (1) 21 21(1) (?) 21 21 21 2221(2) (?) (1) (1) (2) (1) 11 (1) (?) (1) (1) 12 11(1) (?) 11 11 11 1111(2) (?)

? 213 214 217 310 311 313 301 296 287 220 212121 111112 2121 12 11 222222 222222 2222 22 22 12 1212 221221 2222 22 22 111111 111111 1111 12 11 212221 222222 2121 21 12 222222 222222 2222 22 22 22 2222 222222 2222 22 22 111111 111112 1111 11 21 222122 212122 2121 11 21 22 2222 222222 2222 22 22 ?????? ?????? ???? ?? ?? 112221 222222 2222 22 12 12 2222 222222 2222 21 22 112121 111112 1111 12 21 211111 111112 1111 11 11 22 1212 222222 2222 22 22 ??1??? 111111 ?1?1 ?1 ?1 121212 121212 1212 21 22 21 2121 111111 1111 12 11 111111 111111 1111 11 11 121112 111112 2221 11 21 1 1 2 1 2 1 1 1 1 1 1 1 1 1 1 1 1 1 2 1 Figure 3.7. Haplotypes for family CR-2, in the putative linkage interval at 9p23-p21.2. Due to the fact that some of the SNPs are not informative, the exact size of the region can not be determined. It can range between 12,3 and 13,6 Mb.

Due to the complex nature of pterygium and the possibility of the existence of non penetrance and phenocopies, the decision was made to analyze selected candidate genes in the interval with the highest non-parametric linkage scores, on chromosome 9, in spite of the fact that affected individual 313 does not carry the affected haplotype. Using the expression

38 data from the National Eye Institute (http://neibank.nei.nih.gov), and the Expression Profile Viewer Software (Larsson, et al., 2000) the candidate region in chromosome 9 was searched for genes showing expression in cornea or whole eye, and found a total of 11 genes which met these criteria. The coding region of each gene was sequenced in three members of the CR-2 family, two affected and one healthy (Table 3.1). Several coding variants were found, most of them synonymous variants which did not segregate with the disease phenotype. The Ser94Leu variant in exon 4 of the ADAMTSL1 gene did segregate with the disease in the CR-2 family. After sequencing 96 controls, the SNP was found to have a minor allele frequency of 0,16, for which reason it was categorized as a polymorphism.

Table 3.1. Candidate genes at chromosome 9p23-p21.2 which were screened for mutations in the CR-2 family

Coding variants RPS6 - MLLT3 - ELAVL2 p.Thr19Thr SH3GL2 - ADAMTSL1 p.Ser94Leu ADFP - CDKN2a - SLC24A2 p.Pro320Pro, p.Arg401Arg SNAPC3 - ZDHHC21 p.Cys106Cys RRAGA -

3.2.2 Expression study of pterygium

In light of the findings with the Costa Rican family, a cooperation was started with the Ophthalmological Department of the University Hospital of the Friedrich-Alexander University of Erlangen-Nürnberg. In this manner it was possible to have access to several pterygium corneae samples excised from patients’ eyes during surgery, as well as healthy conjunctival tissue to be used as control. Several experiments were done in order to find a procedure which permitted the isolation of enough quantities of good quality RNA from the very small samples. Only 4 conjunctiva samples were obtained, and after RNA isolation there was enough material for just 2 samples. Therefore, 4 pterygium samples and the 2 conjunctiva

39 samples were chosen for an expression analysis with microarrays. The quality and concentration of the samples was analyzed. Table 3.2 shows the RIN (RNA integrity number) values for the different samples. The RIN reflects the degree of degration that an RNA sample has suffered. A RIN higher than 8 is the ideal value for microarray experiments, although starting at a RIN of 6 the quality of the RNA is acceptable (Schroeder, et al., 2006). As can be seen in the table, none of our samples had a RIN above 8, but all except one of the conjunctiva samples were above 6.

Table 3.2 RIN values for the samples used in the expression microarray study

Sample RIN (RNA integrity number) Conjunctiva-1 7.7 Conjunctiva-2 5 Pterygium-1 7.8 Pterygium-2 6 Pterygium-3 6.4 Pterygium-4 6.2

A genome-wide expression analysis with the G4112F microarrays from Agilent (Agilent Technologies, Santa Clara, California) was performed, in order to find genes up- or downregulated in pterygium when compared to conjunctiva. Over 41,000 unique human genes are represented in these microarrays. The samples were analyzed in the Biochemistry institute of the Friedrich-Alexander University. During the realization of the experiment an error occured and the conjunctiva sample with the lowest RIN was lost. Therefore, a total 4 pterygium samples and 1 control sample (conjunctiva), were included in the final experiment. The raw data were analyzed with the GeneSpring software (Agilent Technologies, Santa Clara, California) in order to find all genes showing differential expression between pterygia and the control. The criteria used were that the gene should be at least two times up-or downregulated, at 5% significance. A list including all genes significantly up-regulated (starting at 5-fold change in expression) in pterygia as compared with the control is presented in Table 3.3, and the down-regulated genes in Table 3.4. This gene list was analyzed with the software Gene Ontology Tree Machine (Izumi, et al., 2003) in order to classify them according to the biological processes in which they are involved. With this software several categories were identified which show an excess of genes with modified expression (Fig. 3.8). Some of these categories are immune response, inflammatory response, physiological defense response, and physiological response to wounding.

40 Table 3.3. Up-regulated genes in the pterygium samples compared to the conjunctiva. The genes showing a change in expression of 5-fold and greater are included in the table.

Gene Fold RefSeq Chr Description 1 151 NM_001 14 Homo sapiens anti-rabies SO57 immunoglobulin heavy chain (IGHG1), mRNA 040077 [NM_001040077] 2 77 NM_145 6 Homo sapiens glutathione S-transferase A1 (GSTA1), mRNA [NM_145740] 740 3 56 6 Human MHC class II HLA-DQ-beta (DR2-DQw1/DR4 DQw3) mRNA, complete cds, clone ROF2D. [M20432] 4 43 NM_002 7 Homo sapiens prolactin-induced protein (PIP), mRNA [NM_002652] 652 5 42 NM_006 13 Homo sapiens olfactomedin 4 (OLFM4), mRNA [NM_006418] 418 6 27 NM_001 13 Homo sapiens ATPase, H+/K+ transporting, nongastric, alpha polypeptide (ATP12A), 676 mRNA [NM_001676] 7 25 NM_004 10 Homo sapiens 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3 (PFKFB3), mRNA 566 [NM_004566] 8 21 NM_001 3 Homo sapiens transferrin (TF), mRNA [NM_001063] 063 9 21 NM_000 6 Homo sapiens glutathione S-transferase A2 (GSTA2), mRNA [NM_000846] 846 10 15 NM_080 18 Homo sapiens serpin peptidase inhibitor, clade B (ovalbumin), member 11 (SERPINB11), 475 mRNA [NM_080475] 11 15 7 12 13 4 Homo sapiens cDNA FLJ46167 fis, clone TESTI4003179. [AK128047] 13 13 NM_001 3 Homo sapiens transferrin (TF), mRNA [NM_001063] 063 14 13 NM_005 14 Homo sapiens sine oculis homeobox homolog 1 (Drosophila) (SIX1), mRNA [NM_005982] 982 15 13 13 UI-H-CO0-aqy-e-01-0-UI.s1 NCI_CGAP_Sub9 Homo sapiens cDNA clone IMAGE:3105839 3', mRNA sequence [BQ028381] 16 13 17 17 13 NM_000 6 Homo sapiens glutathione S-transferase A2 (GSTA2), mRNA [NM_000846] 846 18 12 NM_180 5 Homo sapiens solute carrier organic anion transporter family, member 4C1 (SLCO4C1), 991 mRNA [NM_180991] 19 12 6 20 11 22 Human rearranged immunoglobulin lambda light chain mRNA. [X57818] 21 11 NM_001 7 Homo sapiens cholinergic receptor, muscarinic 2 (CHRM2), transcript variant 1, mRNA 006630 [NM_001006630] 22 11 1 BX112397 Soares_multiple_sclerosis_2NbHMSP Homo sapiens cDNA clone IMAGp998A21616 23 11 NM_014 1 Homo sapiens nephrosis 2, idiopathic, steroid-resistant (podocin) (NPHS2), mRNA 625 [NM_014625] 24 10 NM_016 19 Homo sapiens Theg homolog (mouse) (THEG), transcript variant 1, mRNA [NM_016585] 585 25 10 NM_004 20 Homo sapiens matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV 994 collagenase) (MMP9) 26 10 12 27 10 NM_007 13 Homo sapiens SRY (sex determining region Y)-box 21 (SOX21), mRNA [NM_007084] 084 28 10 NM_000 19 Homo sapiens cytochrome P450, family 2, subfamily F, polypeptide 1 (CYP2F1), mRNA 774 [NM_000774] 29 10 10 Homo sapiens cDNA FLJ44383 fis, clone TRACH3036207. [AK126354] 30 10 20 BF949582 MR3-NN0218-031100-003-a11 NN0218 Homo sapiens cDNA, mRNA sequence [BF949582] 31 9 NM_152 4 Homo sapiens mucin 7, secreted (MUC7), mRNA [NM_152291] 291 32 9 21 33 9 XM_934 16 PREDICTED: Homo sapiens hypothetical protein LOC647022 (LOC647022), mRNA 220 [XM_934182] 34 9 NM_005 22 Homo sapiens splicing factor 3a, subunit 1, 120kDa (SF3A1), transcript variant 1, mRNA 877 [NM_005877] 35 9 NM_006 7 Homo sapiens paired box gene 4 (PAX4), mRNA [NM_006193] 193 36 9 NM_174 7 Homo sapiens hypothetical protein LOC136306 (LOC136306), mRNA [NM_174959] 959

41 37 9 11 38 8 13 Human (clone CTG-A4) mRNA sequence. [L10374] 39 8 XM_930 17 Homo sapiens similar to Keratin, type I cytoskeletal 16 (Cytokeratin-16) (CK-16) (Keratin- 406 16) (K16) 40 8 NM_018 10 Homo sapiens oxoglutarate dehydrogenase-like (OGDHL), mRNA [NM_018245] 245 41 8 NM_014 14 Homo sapiens zinc finger and BTB domain containing 1 (ZBTB1), mRNA [NM_014950] 950 42 8 8 Q98D23 (Q98D23) Transcriptional activator; glycine cleavage system transcription activator; GcvA, partial (5%) 43 8 NM_006 22 Homo sapiens uroplakin 3A (UPK3A), mRNA [NM_006953] 953 44 8 17 Homo sapiens cDNA FLJ13735 fis, clone PLACE3000155 45 8 0 46 8 13 Homo sapiens cDNA clone IMAGE:4157517, with apparent retained intron. [BC008631] 47 8 2 Human clone 120Pa immunoglobulin light chain variable region (VkJ) mRNA, partial cds. [U21012] 48 8 9 Homo sapiens cDNA FLJ10232 fis, clone HEMBB1000244. [AK001094] 49 8 18 50 8 NM_017 9 Homo sapiens asporin (LRR class 1) (ASPN), mRNA [NM_017680] 680 51 7 NM_194 10 Homo sapiens solute carrier family 16 (monocarboxylic acid transporters), member 9 298 (SLC16A9), mRNA [NM_194298] 52 7 1 Homo sapiens CD1a molecule, mRNA (cDNA clone MGC:35168 IMAGE:5170038), complete cds. [BC031645] 53 7 NM_015 1 Homo sapiens nephronophthisis 4 (NPHP4), mRNA [NM_015102] 102 54 7 NM_000 14 Homo sapiens serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), 624 member 5 (SERPINA5) 55 7 NR_0028 11 Homo sapiens metastasis associated lung adenocarcinoma transcript 1 (non-coding RNA) 19 (MALAT1) 56 7 NM_174 17 Homo sapiens ATPase, Ca++ transporting, ubiquitous (ATP2A3), transcript variant 5, 953 mRNA [NM_174953] 57 7 4 BE926212 RC5-BN0193-310800-034-A04 BN0193 Homo sapiens cDNA, mRNA sequence [BE926212] 58 7 3 Human PO42 gene, complete cds. [U88965] 59 7 21 Homo sapiens EST from clone 208499, full insert. [AL355688] 60 7 NM_001 1 Homo sapiens sterile alpha motif domain containing 13 (SAMD13), mRNA 010971 [NM_001010971] 61 7 NM_006 7 Homo sapiens mitochondrial transcription termination factor (MTERF), nuclear gene 980 encoding mitochondrial protein 62 7 16 Homo sapiens cDNA FLJ39193 fis, clone OCBBF2004866. [AK096512] 63 7 NM_007 5 Homo sapiens brain-specific protein p25 alpha (TPPP), mRNA [NM_007030] 030 64 7 NM_025 17 Homo sapiens SNAP25-interacting protein (SNIP), mRNA [NM_025248] 248 65 7 16 66 7 NM_017 18 Homo sapiens ring finger protein 125 (RNF125), mRNA [NM_017831] 831 67 7 12 Homo sapiens cDNA FLJ34764 fis, clone NT2NE2002311. [AK092083] 68 7 NM_013 2 Homo sapiens Kv channel interacting protein 3, calsenilin (KCNIP3), transcript variant 1, 434 mRNA [NM_013434] 69 7 XM_929 11 Homo sapiens cDNA FLJ44864 fis, clone BRALZ2013621, moderately similar to 374 Heterogeneous nuclear ribonucleoprotein K 70 6 NM_000 1 Homo sapiens cholinergic receptor, muscarinic 3 (CHRM3), mRNA [NM_000740] 740 71 6 XM_057 1 Homo sapiens KIAA1922 protein, mRNA (cDNA clone IMAGE:2960715), complete cds. 040 [BC033082] 72 6 2 73 6 NM_001 1 Homo sapiens chromosome 1 open reading frame 173 (C1orf173), mRNA 002912 [NM_001002912] 74 6 7 75 6 13 Homo sapiens cDNA clone IMAGE:2959727, partial cds. [BC064982] 76 6 NM_002 3 Homo sapiens retinol binding protein 1, cellular (RBP1), mRNA [NM_002899] 899 77 6 17 78 6 NM_178 1 Homo sapiens cytochrome P450, family 4, subfamily Z, polypeptide 1 (CYP4Z1), mRNA 134 [NM_178134]

42 79 6 10 80 6 NM_024 10 Homo sapiens chromosome 10 open reading frame 81 (C10orf81), mRNA [NM_024889] 889 81 6 1 Homo sapiens cDNA FLJ12260 fis, clone MAMMA1001551. [AK022322] 82 6 1 83 6 18 Homo sapiens cDNA: FLJ22806 fis, clone KAIA2845. [AK026459] 84 6 NM_032 5 Homo sapiens multiple EGF-like-domains 10 (MEGF10), mRNA [NM_032446] 446 85 6 NM_032 16 Homo sapiens zinc finger protein 206 (ZNF206), mRNA [NM_032805] 805 86 6 XM_930 6 PREDICTED: Homo sapiens similar to putative G-protein coupled receptor (LOC442206), 584 mRNA [XM_930584] 87 6 NM_012 20 Homo sapiens chromosome 20 open reading frame 103 (C20orf103), mRNA [NM_012261] 261 88 6 NM_175 3 Homo sapiens immunoglobulin-like domain containing receptor 1 (ILDR1), mRNA 924 [NM_175924] 89 6 XM_371 17 Homo sapiens mRNA for putative ankyrin-repeat containing protein (ORF1). [AJ278120] 074 90 6 NM_013 11 Homo sapiens zinc finger protein 215 (ZNF215), mRNA [NM_013250] 250 91 6 1 Homo sapiens cDNA FLJ12900 fis, clone NT2RP2004321. [AK022962] 92 6 15 Homo sapiens cDNA clone IMAGE:5261717. [BC035091] 93 5 NM_005 22 Homo sapiens v-crk sarcoma virus CT10 oncogene homolog (avian)-like (CRKL), mRNA 207 [NM_005207] 94 5 NM_194 10 Homo sapiens chromosome 10 open reading frame 39 (C10orf39), mRNA [NM_194303] 303 95 5 10 Homo sapiens mRNA for hypothetical protein (C10ORF5B gene). [AJ535621] 96 5 15 Homo sapiens cDNA FLJ33063 fis, clone TRACH2000047. [AK057625] 97 5 NM_000 7 Homo sapiens cytochrome P450, family 3, subfamily A, polypeptide 7 (CYP3A7), mRNA 765 [NM_000765] 98 5 NM_020 4 Homo sapiens sortilin-related VPS10 domain containing receptor 2 (SORCS2), mRNA 777 [NM_020777] 99 5 NM_024 16 Homo sapiens iroquois homeobox protein 6 (IRX6), mRNA [NM_024335] 335 100 5 NM_152 19 Homo sapiens zinc finger and SCAN domain containing 4 (ZSCAN4), mRNA [NM_152677] 677 101 5 7 ALU7_HUMAN (P39194) Alu subfamily SQ sequence contamination warning entry, partial (17%) [THC2437430] 102 5 14 Homo sapiens cDNA: FLJ20931 fis, clone ADSE01282. [AK024584] 103 5 4 Homo sapiens mRNA; cDNA DKFZp686M03111 (from clone DKFZp686M03111) [BX537816] 104 5 NM_175 17 Homo sapiens RAB37, member RAS oncogene family (RAB37), transcript variant 3, 738 mRNA [NM_175738] 105 5 NM_023 2 Homo sapiens calpain 10 (CAPN10), transcript variant 1, mRNA [NM_023083] 083 106 5 6 107 5 NM_000 11 Homo sapiens potassium inwardly-rectifying channel, subfamily J, member 5 (KCNJ5), 890 mRNA [NM_000890] 108 5 NM_000 2 Homo sapiens protein C (inactivator of coagulation factors Va and VIIIa) (PROC), mRNA 312 [NM_000312] 109 5 7 Homo sapiens testin-related protein TRG mRNA, complete cds. [AY143171] 110 5 NM_002 20 Homo sapiens peptidase inhibitor 3, skin-derived (SKALP) (PI3), mRNA [NM_002638] 638 111 5 XM_927 8 Homo sapiens cDNA FLJ42560 fis, clone BRACE3006462. [AK124551] 367 112 5 NM_020 3 Homo sapiens leucine rich repeat neuronal 1 (LRRN1), mRNA [NM_020873] 873 113 5 NM_004 3 Homo sapiens vasoactive intestinal peptide receptor 1 (VIPR1), mRNA [NM_004624] 624 114 5 13 Homo sapiens cDNA FLJ11204 fis, clone PLACE1007810. [AK002066] 115 5 17 Homo sapiens cDNA FLJ46399 fis, clone THYMU3004632. [AK128263] 116 5 NM_004 6 Homo sapiens vanin 2 (VNN2), transcript variant 1, mRNA [NM_004665] 665 117 5 NM_080 16 Homo sapiens T-box 6 (TBX6), transcript variant 2, mRNA [NM_080758] 758 118 5 8 119 5 XM_933 16 Homo sapiens mRNA; cDNA DKFZp686H21113 (from clone DKFZp686H21113). 727 [CR627362] 120 5 21 Homo sapiens full length insert cDNA clone ZE12B03. [AF086547]

43 121 5 23 Q7ZX66 (Q7ZX66) RNPC7 protein (Fragment), partial (9%) [THC2309960] 122 5 NM_020 4 Homo sapiens shroom (SHRM), mRNA [NM_020859] 859 123 5 0 Homo sapiens major histocompatibility complex, class II, DR beta 3, mRNA (cDNA clone MGC:117330 IMAGE:4385464) 124 5 NM_153 6 Homo sapiens glutathione S-transferase A5 (GSTA5), mRNA [NM_153699] 699 125 5 15 126 5 NM_002 19 Homo sapiens polypyrimidine tract binding protein 1 (PTBP1), transcript variant 1, mRNA 819 [NM_002819] 127 5 2 Homo sapiens mRNA; cDNA DKFZp667H0616 (from clone DKFZp667H0616). [AL713718] 128 5 XR_0006 2 PREDICTED: Homo sapiens hypothetical protein LOC150759 (LOC150759), misc RNA 61 [XR_000661] 129 5 NM_002 1 Homo sapiens chemokine (C motif) ligand 1 (XCL1), mRNA [NM_002995] 995 130 5 NM_002 7 Homo sapiens pleiotrophin (heparin binding growth factor 8, neurite growth-promoting 825 factor 1) (PTN) 131 5 XM_934 17 Homo sapiens cDNA clone IMAGE:4797785. [BC042947] 752 132 5 13 Homo sapiens cDNA clone IMAGE:2959727, partial cds. [BC064982] 133 5 NM_207 15 Homo sapiens ADAMTS-like 3 (ADAMTSL3), mRNA [NM_207517] 517 134 5 NM_003 4 Homo sapiens secreted frizzled-related protein 2 (SFRP2), mRNA [NM_003013] 013 135 5 NM_002 22 Homo sapiens guanine nucleotide binding protein (G protein), alpha z polypeptide (GNAZ), 073 mRNA [NM_002073] 136 5 23 Q7ZX66 (Q7ZX66) RNPC7 protein (Fragment), partial (9%) [THC2309960] 137 5 11 Homo sapiens mRNA; cDNA DKFZp779F2345 (from clone DKFZp779F2345). [BX647543] 138 5 NM_015 12 Homo sapiens cytokeratin 2 (KRT2B), mRNA [NM_015848] 848 139 5 NM_032 6 Homo sapiens serine/threonine kinase 19 (STK19), transcript variant 2, mRNA 454 [NM_032454]

44 Table 3.4. Down-regulated genes in the pterygium samples compared to the conjunctiva. The genes showing a change in expression of 5-fold and greater are included in the table.

Gene Fold RefSeq Chr Description 1 23 NM_000170 9 Homo sapiens glycine dehydrogenase (decarboxylating) (GLDC), mRNA [NM_000170] 2 19 NM_002422 11 Homo sapiens matrix metallopeptidase 3 (stromelysin 1, progelatinase) (MMP3), mRNA [NM_002422] 3 13 NM_020980 15 Homo sapiens aquaporin 9 (AQP9), mRNA [NM_020980] 4 11 NM_005099 1 Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif, 4 (ADAMTS4), mRNA [NM_005099] 5 11 NM_004921 1 Homo sapiens chloride channel, calcium activated, family member 3 (CLCA3), mRNA [NM_004921] 6 9 NM_000600 7 Homo sapiens interleukin 6 (interferon, beta 2) (IL6), mRNA [NM_000600] 7 9 NM_152321 12 Homo sapiens chromosome 12 open reading frame 46 (C12orf46), mRNA [NM_152321] 8 9 NM_001085 14 Homo sapiens serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3 (SERPINA3) 9 8 NM_016084 17 Homo sapiens RAS, dexamethasone-induced 1 (RASD1), mRNA [NM_016084] 10 8 NM_014358 12 Homo sapiens C-type lectin domain family 4, member E (CLEC4E), mRNA [NM_014358] 11 8 NM_133445 9 Homo sapiens glutamate receptor, ionotropic, N-methyl-D-aspartate 3A (GRIN3A), mRNA [NM_133445] 12 8 14 HUMA1ACM alpha-1-antichymotrypsin {Homo sapiens;} , partial (17%) [THC2336713] 13 8 NM_001351 3 Homo sapiens deleted in azoospermia-like (DAZL), mRNA [NM_001351] 14 8 NM_006108 11 Homo sapiens spondin 1, extracellular matrix protein (SPON1), mRNA [NM_006108] 15 7 NM_000439 5 Homo sapiens proprotein convertase subtilisin/kexin type 1 (PCSK1), mRNA [NM_000439] 16 7 NM_003182 7 Homo sapiens tachykinin, precursor 1 17 7 NM_201553 8 Homo sapiens fibrinogen-like 1 (FGL1), transcript variant 4, mRNA [NM_201553] 18 7 NM_012275 2 Homo sapiens interleukin 1 family, member 5 (delta) (IL1F5), transcript variant 1, mRNA [NM_012275] 19 7 9 Q94N11 (Q94N11) Cytochrome oxidase subunit 1 (Fragment), partial (7%) [THC2339347] 20 6 0 21 6 NM_002982 17 Homo sapiens chemokine (C-C motif) ligand 2 (CCL2), mRNA [NM_002982] 22 6 NM_003956 10 Homo sapiens cholesterol 25-hydroxylase (CH25H), mRNA [NM_003956] 23 6 NM_032861 6 Homo sapiens serine active site containing 1 (SERAC1), mRNA [NM_032861] 24 6 8 Homo sapiens cDNA clone IMAGE:4081583, partial cds. [BC062758] 25 6 NM_016084 17 Homo sapiens RAS, dexamethasone-induced 1 (RASD1), mRNA [NM_016084] 26 6 NM_002934 14 Homo sapiens ribonuclease, RNase A family, 2 (liver, eosinophil-derived neurotoxin) (RNASE2), mRNA [NM_002934] 27 6 NM_007289 3 Homo sapiens membrane metallo-endopeptidase (neutral endopeptidase, enkephalinase, CALLA, CD10) (MME) 28 6 NM_004617 3 Homo sapiens transmembrane 4 L six family member 4 (TM4SF4), mRNA [NM_004617] 29 6 15 BE644757 7e39h04.x1 NCI_CGAP_Lu24 Homo sapiens cDNA clone IMAGE:3284887 30 6 NM_002029 19 Homo sapiens formyl peptide receptor 1 (FPR1), mRNA [NM_002029] 31 6 XM_926796 4 Homo sapiens cDNA FLJ40745 fis, clone TRACH2000287, weakly similar to CLAUDIN-6. [AK098064] 32 6 17 33 6 NM_012242 10 Homo sapiens dickkopf homolog 1 (Xenopus laevis) (DKK1), mRNA [NM_012242] 34 6 NM_139211 4 Homo sapiens homeodomain-only protein (HOP), transcript variant 2, mRNA [NM_139211] 35 6 NM_005621 1 Homo sapiens S100 calcium binding protein A12 (calgranulin C) (S100A12), mRNA [NM_005621] 36 5 20 37 5 NM_007289 3 omo sapiens membrane metallo-endopeptidase (neutral endopeptidase, enkephalinase, CALLA, CD10) (MME) 38 5 NM_144586 2 Homo sapiens LY6/PLAUR domain containing 1 (LYPD1), mRNA [NM_144586] 39 5 NM_080657 2 Homo sapiens radical S-adenosyl methionine domain containing 2 (RSAD2), mRNA [NM_080657] 40 5 NM_000087 4 Homo sapiens cyclic nucleotide gated channel alpha 1 (CNGA1), mRNA [NM_000087] 41 5 NM_000112 5 Homo sapiens solute carrier family 26 (sulfate transporter), member 2 (SLC26A2), mRNA [NM_000112] 42 5 NM_013377 12 Homo sapiens PDZ domain containing RING finger 4 (PDZRN4), mRNA [NM_013377] 43 5 NM_000677 1 Homo sapiens adenosine A3 receptor (ADORA3), transcript variant 2, mRNA [NM_000677] 44 5 NM_005127 12 Homo sapiens C-type lectin domain family 2, member B (CLEC2B), mRNA [NM_005127] 45 5 NM_032849 13 Homo sapiens hypothetical protein FLJ14834 (FLJ14834), mRNA [NM_032849]

46 5 NM_001817 19 Homo sapiens carcinoembryonic antigen-related cell adhesion molecule 4 (CEACAM4), mRNA [NM_001817] 47 5 NM_004900 22 Homo sapiens apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3B (APOBEC3B), mRNA [NM_004900] 48 5 NM_176870 16 Homo sapiens metallothionein 1M (MT1M), mRNA [NM_176870] 49 5 NM_175617 16 Homo sapiens metallothionein 1E (functional) (MT1E), mRNA [NM_175617] 50 5 NM_152473 19 Homo sapiens FLJ32214 protein (FLJ32214), mRNA [NM_152473] 51 5 NM_080657 2 Homo sapiens radical S-adenosyl methionine domain containing 2 (RSAD2), mRNA [NM_080657] 52 5 NM_001039165 11 Homo sapiens MAS-related GPR, member E (MRGPRE), mRNA [NM_001039165] 53 5 NM_001017986 1 Homo sapiens Fc-gamma receptor I B2 (LOC440607), transcript variant 1, mRNA [NM_001017986] 54 5 NM_020731 5 Homo sapiens aryl-hydrocarbon receptor repressor (AHRR), mRNA [NM_020731] 55 5 NM_138788 11 Homo sapiens transmembrane protein 45B (TMEM45B), mRNA [NM_138788] 56 5 4 57 5 NM_139211 4 Homo sapiens homeodomain-only protein (HOP), transcript variant 2, mRNA [NM_139211] 58 5 NM_018689 15 Homo sapiens KIAA1199 (KIAA1199), mRNA [NM_018689] 59 5 NM_003955 17 Homo sapiens suppressor of cytokine signaling 3 (SOCS3), mRNA [NM_003955] 60 5 NM_017947 18 Homo sapiens molybdenum cofactor sulfurase (MOCOS), mRNA [NM_017947]

Fig. 3.8 Classification of the differentially regulated genes according to the biological process (es) in which they are involved. The categories which are overrepresented in our samples are shown in bold. The black columns represent the observed number of genes in a category, and the grey the expected number of genes.

47 The objective was to identify genes which show altered expression and are located in the regions in chromosome 9p23-p21.2 and 15q22.2-q24.2 with the high non parametric scores in the linkage analysis. However, none of the genes up or down regulated was located in the interval in chromosome 9. In the interval in chromosome 15 the gene DAPK2 seemed to be a good candidate gene, due to its 4-fold reduced level of expression and involvement in an apoptosis pathway. The 11 coding exons of the gene were sequenced in the pterygium family, without finding any mutation.

3.3 The CYP1B1 gene

3.3.1 CYP1B1 screening in PCG patients

A total of 30 individuals with PCG (recruited within the scope of the glaucoma project at the Institute of Human Genetics in Erlangen) were screened for mutations in CYP1B1. Three individuals presented only one mutation in heterozygous form, seven individuals had two CYP1B1 mutations (either homozygous or compound heterozygous) and the rest presented no mutation. The results are summarized in Table 3.5.

Table 3.5 CYP1B1 mutations detected in 30 PCG patients.

Mutation 1 Mutation 2 Number of PCG individuals p.E229K - 2 p.Y81N - 1 c.1064-1076del c.1064-1076del 1 c.1064-1076del c.1200-1209dup 1 c.1064-1076del c.155insC 1 c.1064-1076del Q42X 1 c.1200-1209dup c.1200-1209dup 1 c.279delC c.279delC 1 R355X R355X 1 - - 20 Total:30

48 DNA samples from the parents were available for 13 out of the 20 individuals without CYP1B1 mutations. The GLC3B locus was ruled out in these families by means of microsatellite analysis with four markers: D1S1176, D1S228, D1S402, and D1S2834.

3.3.2 Screening of CYP1B1, PAX6, PITX2, and FOXC1 in individuals with anterior segment dysgenesis

In total, 21 individuals with anterior segment dysgenesis (10 with Peters anomaly (PA), 9 with Rieger’s anomaly (RA), and 3 with aniridia) were screened for mutations in the PAX6, PITX2, FOXC1 and CYP1B1 genes. The available clinical data (not for all the patients) are shown in Table 3.6. A total of 48 individuals without glaucoma were used as controls. For the 5 individuals with mutations, available family members were also screened.

Table 3.6. Patients with clinical diagnosis, glaucoma present yes/no and age of onset, if glaucoma present, peak intraocular pressure (mmHg, IOP), right (OD) or left (OS) eye, chamber angle (if gonioscopy available), maximum corneal diameter (more advanced eye), cup/disc ratio (CD, if available), type of surgery performed.

Patient Diagnosis GLC/ Peak Eye Chamber Max. Optic Surgery Age IOP angle corneal nerve of diameter head onset PA-1 Peter’s anomaly, No 19 OD/OS Open, 10.0 - - microphthalmus anterior synechiae PA-4 Coloboma, Peter’s No 9 OD/OS Open 10 0.3/0.3 - anomaly, microphthalmus PA-6 Peter’s anomaly, Yes/ 25 OD/OS - 13 - Keratoplasty, sec. buphthalmus At vitrectomy birth PA-9 Peter’s anomaly, No 19 OD/OS Open 9.5 - Optic sector nystagmus iridectomy RA-1 Rieger’s Anomaly, Yes/ - OD/OS - - - Keratoplasty iris coloboma At birth RA-2 Rieger’s anomaly, No 12 OS Open, 12 0.1/0.1 Korepraxia subluxation of lens singular anterior

49 synechiae RA-5 Rieger’s anomaly Yes/ 36 OD/OS Open - 0.8/0.9 Trabeculotomy 18 RA-7 Rieger’s anomaly Yes/ 60 OD/OS Closed 12 0.4/0.4 Trabeculotomy Spherophakia 6 RA-8 Rieger’s anomaly No 12 OD/OS Open, - 0.2/0.2 - anterior synechiae A-1 Aniridia, No 18 OD/OS Open with - 0.1/0.1 Phacectomy, subluxation of rudimental keratoplasty lens, nystagmus iris A-2 Aniridia, No - OD/OS Open - 0.2/0.2 - Nystagmus

Two RA (RA-1, RA-3) patients with compound heterozygous mutations in the CYP1B1 gene were detected, as well as patient RA-7 with just one heterozygous mutation in the coding region (Table 3.7). Patient RA-1 presents the W57X mutation as well as a novel mutation, c.1033-1035del, which results in the deletion of one out of three leucin residues at positions 343-345. The deleted amino acid is located in the highly conserved I-helix region of the protein (Fig. 3.9). This novel mutation was not found in 48 controls. The previously reported W57X (Colomb, et al., 2003; Stoilov, et al., 2002; Vincent, et al., 2001) mutation truncates the protein by 486 aminoacids. The healthy mother of the patient carries the c.1033-1035del in heterozygous form.

50 Table 3.7. Mutations found in the CYP1B1 and PAX genes in 5 out of 21 individuals and CYP1B1 SNP haplotypes for all individuals.

Family CYP1B1 PAX6 SNP haplotype rs2617266 p.R48G p.A119S p.L432V p.D449D p.N453S Mutation Mutation C C G G T A PA-1 Yes C C G C C G C C G C C G PA-2 Unknown C C G C C G C C G G T A PA-3 No T G T C C A C C G G T A PA-4 No T G T C C A C C G G T A PA-5 No C C G C C A C C G G T A PA-6 Adopted C C G C C A C C G G T A PA-7 Yes? T G T C C A C C G G T A PA-8 No C C G G T A T G T C C A PA-9 No T G T C C A C C G G T A PA-10 No C C G G T A C C G G T A W57X RA-1 No C C G C C G c.1033-1035del C C G G T A RA-2 No T G T C C A C C G G T A W57X RA-3 No C C G G T A c.1200-1209dup C C G G T A RA-4 No C C G G T A C C G G T A RA-5 Yes C C G G T A C C G G T A RA-6 unknown T G T C C A C C G G T A p.R368H RA-7 No C C G G T A ? C C G G T A RA-8 Yes C C G C C A C C G G T A A-1 Yes p.R103X C C G G T A C C G G T A A-2 No p.R217X C C G C C A C C G C C G A-3 Yes C C G C C G

SNP1: rs2617266 (c>t), SNP2:R48G(cgg>ggg), SNP3:A119S(gcc>tcc), SNP4:V432L(gtg>ctg), SNP5:D449D (gat>gac), SNP6:N453S(aac>agc) The CYP1B1 mutations are shown next to the corresponding SNP haplotype

W L L L deletion

I-helix Fig. 3.9. Electropherogram showing the 3-base pair deletion c.1033-1035del (a) and Multiple sequence alignment of the conserved I-helix amino acid sequence of CYP1B1 in different species (b). The c.1033-1035del mutation results in the deletion of one of three leucine residues in humans in the I-helix of the protein (indicated by a rectangle).

Patient RA-3 carries the p.W57X mutation, and additionally the c.1200-1209dup (Colomb, et al., 2003; Michels-Rautenstrauss, et al., 2001; Sena, et al., 2004; Soley, et al., 2003; Stoilov, et al., 2002) small insertion frequently observed in PCG. This variation results in a frame shift, truncates the protein by 140 aminoacids and eliminates the functionally essential heme- binding site. Each of the healthy parents carry one mutation in heterozygous form. Patient RA-7 carries the R368H (Bejjani, et al., 2000; Panicker, et al., 2002; Reddy, et al., 2003; Stoilov, et al., 2002) mutation in heterozygous state (Fig 3-9). No other variation in the coding exons was detected. His paternal grandmother and his father are not affected and are heterozygous for the mutation. In accordance with the founder effect described for them, the p.W57X, c,1200-1209dup, and R368H mutations are associated with the intragenic haplotype 5’-CCGGTA-3’ (Chavarria- Soley, et al., 2006; Stoilov, et al., 2002) and the c.1033-1035del presents the haplotype 5’- CCGCCG-3’ (Chavarria-Soley, et al., 2006; Stoilov, et al., 2002) (Table 3.7). The CYP1B1 SNP haplotypes for all patients are shown in Table 3.7 (See section 3.3.3 for further results on CYP1B1 founder effects).

52 Two of the three patients with aniridia (A-1 and A-2) presented heterozygous truncating mutations in the PAX6 gene: p.R103X and p.R203X (in exons 7 and 9, respectively). The mother of individual A-1 is affected and carries the mutation in heterozygous form. The positions of the PAX6 variants are given according to isoform a (accession nr.: NM_000280). Several intronic variants and previously reported exonic polymorphisms (Mears, et al., 1998), which were considered benign variants, were found in FOXC1, PITX2, and PAX6 (Table 4). Each of the two variants in the coding region of FOXC1 consists of an insertion of an extra GGC triplet in two different GGC repeats. Their polymorphic nature was confirmed by identification of this variation in patients and controls (Table 3.8). Table 3-8. Benign variants found in 21 ASD patients

Gene Variant RA patients PA Aniridia Total Controls patients patients (n=21) (n=48) FOXC1 375insGGC 4 (RA- 3 (PA-7,8,10) 2 (A-1,2) 9 11 2,5,7,8) FOXC1 447insGGC 5 (RA- 3 (PA-5,6,8) 1 (A-1) 9 13 3,4,5,7,8) PAX6 IVS2+107C>T 3 (RA-4,6,8) 8 (PA- 1 (A-1) 12 - 2,3,5,6,7,8,9,10) PITX2 IVS1-30T>C 1(RA-8) 0 2 (A-1,2) 3 - PITX2 IVS2-105C>A 0 2 (PA-4,7) 1(A-3) 3 - PITX2 IVS2+20delCinsGTT 0 1 (PA-7) 0 1 -

-controls were only tested for the coding variants

3.3.3 Haplotype analysis for CYP1B1 mutations

In order to determine whether the repeated occurrence of mutations in CYP1B1 is explained by a “hot spot” for a mutation, or by a founder effect extended haplotypes were constructed for CYP1B1 variant carriers using a combination of SNPs in the complete CYP1B1 genomic region and microsatellites (Sena, et al., 2004) flanking the gene. In total, 30 (29 patients and 1 variant carrier) individuals with CYP1B1 variants were analyzed. Three of them belong to two PCG families originating in Costa Rica (PCG-CR1) and in Russia (PCG-R1). The index patient of each family was included in our study, plus one more individual from family PCG-R1 who carries the E229K variant. Two other patients had an affected sibling (PCG-14 and PCG-15), 22 are simplex PCG patients (PCG-1 to

53 PCG-13, PCG16 to PCG-24), and three are simplex Rieger’s anomaly patients (RA-1 to RA- 3). Available family members from the simplex cases were included to establish phase. Table 3.9 contains the list of patients with ethnic origin and the mutations they present.

Table 3.9. Patients included in this study, their diagnosis and observed CYP1B1 mutations.

Country of Other Patient Diagnosis Mutation 1 Mutation 2 origin Variation Family PCG- Costa Rica PCG c.1200-1209dup c.1200-1209dup CR1 Family PCG-R1 PCG Russia c.1064-1076del c.155insC E229K PCG-1 PCG Turkey R355X R355X PCG-2 PCG Turkey c.279delC c.279delC PCG-3 PCG Germany c.1064-1076del c.1200-1209dup PCG-4 PCG Switzerland c.1064-1076del Q42X PCG-5 PCG Germany c.1064-1076del c.1377-1403dup PCG-6 PCG Germany ? ? Y81N PCG-7 PCG Germany c.1064-1076del W434X PCG-8 PCG USA c.1064-1076del E387K PCG-9 PCG USA E387K R469W PCG-10 PCG USA E387K R469W PCG-11 PCG USA c.1377-1403dup c.1377-1403dup PCG-12 PCG USA R368H c.1200-1209dup PCG-13 PCG USA W57X E387K PCG-14 PCG USA G61E c.1200-1209dup PCG-15 PCG USA E387K E387K PCG-16 PCG Saudi Arabia G61E G61E PCG-17 PCG Saudi Arabia G61E G61E PCG-18 PCG Saudi Arabia G61E G61E PCG-19 PCG Saudi Arabia G61E G61E PCG-20 PCG Saudi Arabia G61E G61E PCG-21 PCG Saudi Arabia G61E G61E PCG-22 PCG Saudi Arabia G61E G61E PCG-23 PCG Saudi Arabia G61E G61E PCG-24 PCG Saudi Arabia c.433-442del c.433-442del RA-1 RA Germany R368H ? RA-2 RA Germany W57X c.1200-1209dup RA-3 RA Germany W57X c.1033-1035del PCG: Primary Congenital Glaucoma, RA: Rieger’s Anomaly. For patients PCG-6 and RA-1 the assumed second mutation is not known. 54 All but three individuals carry two CYP1B1 mutations, either in the homozygous or the compound heterozygous state. For patient PCG-6 and patient RA-1 only one heterozygous mutation is known. The CYP1B1 variations Q42X in patient PCG-4, W434X in patient PCG-8 and c.1033-1035del in patient RA-3 were found for the first time. The PCG pedigrees consistent with autosomal recessive inheritance were reconstructed for 2 families of Central American (PCG-CR1) and Russian (PCG-R1) origin (Fig. 3.10). The PCG patients in family PCG-R1 are compound heterozygous for the c.1064-1076del and c.155insC mutations. The unaffected mother (I:2) of patients II:2 and II.3 carries the c.1064- 1076del deletion and a E229K variant in compound heterozygous state.

PCG CR-1 PCG R-1 .. I:1 I:2 I:1 I:2 c.155ins 1064-1076delc.1064-1076del1410del13 E229K

II:1 II:2 II:3 II:4 . . III:1 III:2 III:3 III:4 II:1 II:2 II:3 . . E229K c.155ins c.155ins . . 1064-1076delc.1064-1076del1410del13 1064-1076delc.1064-1076del1410del13 IV:1 IV:2 IV:3 IV:4

V:1 V:2 V:3 V:4

Figure 3.10. Pedigrees from the Costa Rican (PCG-CR1) and Russian (PCG-R1) families are shown. The Costa Rican family presented the mutation c.1200-1209dup in homozygous form. The affected individuals in the Russian family are compound heterozygotes for CYP1B1 mutations.

Initially I searched publicly available data for haplotype information on CYP1B1 mutations. Six well-studied intragenic SNPs in CYP1B1 are frequently used to form haplotypes (Stoilov, et al., 2002)(Stoilov, et al., 2002). Five SNPs are located in the coding region and one is 12bp upstream of the first coding exon. Table 3.10 summarizes the thereof resulting intragenic haplotypes as published for different mutations, as well as the countries where these mutations have been found. This analysis allowed us to clarify the association of

55 certain haplotypes with known mutations. Modern uniform nomenclature rules were applied to these mutations (den Dunnen and Antonarakis, 2001). About 50% of known mutations are associated with the 5‘-CCGGTA-3‘ SNP haplotype previously discussed by Stoilov (Stoilov, et al., 2002) and Sena (Sena, et al., 2004). Twelve mutations in our patients are associated with this 5’-CCGGTA-3’ SNP haplotype, while the p.Y81N, p.E229K and p.E387K variants reside on the 5’-TGTCCA-3’ haplotype and the c.1033-1035del mutation presents the 5’- CCGCCG-3’ SNP haplotype. In public available data these haplotypes are associated with about 9,7% and 7% of CYP1B1 mutations, respectively (Table 3.10).

Table 3.10. SNP based haplotypes associated with CYP1B1 mutations.

Mutation Haplotype Country

Synonymous Nucleotide c.1063C>T 7900C>T p.R355X C C G G T A Germany c.124C>T 3929C>T p.Q42X C C G G T A Germany c.155insC 3956insC FS C C G G T A Germany Brazil, c.171G>A 3976G>A p.W57X CC G G T A Germany Saudi Arabia, c.182G>A 3987G>A p.G61E CC G G T A Morocco, Ecuador Saudi c.1405C>T 8242C>T p.R469W CC G G T A Arabia Saudi c.1120G>A 7957G>A p.D374N CC G G T A Arabia Brazil, c.1103G>A 7940G>A p.R368H CC G G T A Saudi Arabia c.279delC 4081delC FS CC G G T A Turkey Saudi p.S268_F270d Arabia, c.806_814delGCAACTTCA 4611del9 C C G G T A el USA, France Brazil, c.535delG6,14,17 4340delG FS CC G G T A France, Morocco c.1064_1076delGAGTGCAGGCA Germany 7901del13 FS CC G G T A GA , Brazil Brazil, Costa c.1200_1209dupTCATGCCACC c.1200-1209dup FS C C G G T A Rica, Germany , USA c.1310C>T 8147C>T p.P437L CC G G T A Brazil Turkey, c.1377-1403dup 8214dup27 FS CC G G T A Germany c.1331G>A 8168G>A p.R444Q - C G G T - Japan c.161insC 3964delC FS - C G G T - Japan c.575A>T 4380A>T D192V - C G G T - Japan Saudi c.230T>C 4035T>C p.L77P C C G C C G Arabia c.1033_1035delCTC 4832delCTC FS C C G C C G Germany

56 c.1345delG 8182delG FS C C G C C G Brazil Saudi c.1168C>A 8005C>A p.R390S - C G C C G Arabia c.55C>T 3860C>T p.Q19X C C G C C A Brazil c.840C>A 4645C>A p.C280X - C G C C - Japan c.971_972insAT 4776insAT FS - C G C C - Japan 4793G>T,4794C> c.978G>T, 979C>T p.A330F - C G C C - Japan T c.1090G>A 7927G>A p.V364M - C G C C - Japan c.1331G>A 8168G>A p.R444Q - C G C T A Japan Saudi c.433_442delCGGCGCGCAG 4238del10 FS T G T C C A Arabia Brazil, Romania c.1159G>A 7996G>A p.E387K T G T C C A , USA, Slovakia France, c.685G>A 4490G>A p.E229K T G T C C A Germany France, c.241T>A 4046T>A p.Y81N T G T C C A Germany Mutation nomenclature (left column) is according to Dunnen and Antonarakis (den Dunnen and Antonarakis, 2001) and based on the GenBank accession cDNA NM_000104. The formerly used names (based on the genomic sequence U56438) of the respective mutations are listed in the second left column.

The complete genomic region was sequenced in our patients in order to find SNPs in addition to the six previously reported (Stoilov, et al., 2002), allowing us to construct extended haplotypes for the mutations. We discovered 11 further intronic SNPs in the CYP1B1 genomic region (Table 3.11) and constructed haplotypes for each mutation using a combination of SNPs and 6 microsatellites (Sena, et al., 2004) that flank the gene.

57 Tabla 3.11. Extended haplotypes asscociated with 17 CYP1B1 variants

CYP1B1 is located within one LD block (LD block A) comprising approximately 63kb on chromosome 2 (Fig. 3.11).

Figure 3.11. LD structure of region surrounding the CYP1B1 gene. The location of the microsatellite markers relative to the CYP1B1 gene is shown (physical positions in chromosome 2 are according to UCSC).

Microsatellites M1 and M2 are located in LD block A as well. M4 is located in LD block B, while M5 lies in a region of low LD between two LD blocks, and M6 and M7 are together in LD block C. The here constructed extensive haplotypes show that the previously reported 5’- CCGGTA-3’ haplotype (Stoilov, et al., 2002) represents in reality two different ancestral haplotypes (CYP1B1-A and CYP1B1-B), that happen to share some common SNPs. For the 17 mutations included in our study 5 possible haplotypes in LD block A were found (Table 3.11). Eight mutations are associated with the CYP1B1-A haplotype and 4 with CYP1B1-B. From the three other haplotypes CYP1B1-C is associated with 3 variants, while CYP1B1-D and CYP1B1-E are associated with just 1 mutation each (Table 3.11). Population frequencies for our haplotypes were also obtained from HapMap data, which in the genomic region of CYP1B1 include genotypes for 10 of the 17 SNPs of our study. According to HapMap data 7 distinct haplotypes can be detected in Caucasians for the CYP1B1 region (Table 3.12). The mutations analyzed here are associated with the 5 most frequent ones.

59 Table 3.12. Haplotype frequencies for the M4 and CYP1B1 LD blocks from HapMap data.

M4 LD block CYP1B1 LD block

rs10916 rs162549 rs162561 rs162562 rs232610 rs232620 rs232541 rs232542 rs2855658 rs9341266 rs2551188 rs1056836 rs1056837 rs1800440 rs2432661 rs9309022 Frequency Frequency

T T A T G G 0,458 T C C C A A T G C A 0,254 C C G G G A 0,180 C C G T A A T A C T 0,203 C C G G A A 0,145 C A G T A C G A C A 0,186 C T A T G G 0,083 C C C C G A T G C A 0,161

C T G G G G 0,058 C C C C A A T G C A 0,119 C C A T G G 0,025 C C G T A C G A C A 0,034 T T A G G G 0,017 T C C C A A T G T A 0,025 C C G T G G 0,017

The LD structure for CYP1B1 explains the observation that mutations are also tightly associated with microsatellites, especially M1 and M2, which are within the same high LD- block. Therefore, every haplotype is associated with a certain microsatellite allele and variation observed at these markers is due to mutation rather than recombination. For example, SNP haplotype CYP1B1-A contains alleles 159 and 253 for microsatellites M2 and M1, respectively, while haplotype CYP1B1-B carries allele 161 and 251, respectively (Table 3.11). Microsatellite marker M4, however, varies within mutations presenting identical CYP1B1 haplotypes. It is located in LD block B which shows recombination with the LD block in historical time scales. In order to determine whether variation at M4 was indeed due to recombination or rather mutation 6 further SNPs flanking the microsatellite were analyzed (Table 3.11). Eight of the mutations studied were found in our patients more than once (Table 3.11), Our extended haplotype reconstruction shows, that each mutation which occurs more than once is always associated with just one haplotype, supporting the hypothesis of a founder effect for each of these mutations. The shared haplotypes extend in many cases to the M4 region, or even further to the more distal microsatellites M6 and M7, located in different LD blocks. The c.1064-1076del mutation occurs six times in patients with different ethnic origin (Germany, Russia, USA, Switzerland) and in all instances the individuals share a haplotype up to the M6-M7 block (approximately 160 kb), except for microsatellite M4. At M4 there is some variation, e. g. patients PCG-R1: II:2 and PCG-4 present allele 198 instead of 196. This is probably due to mutation at the microsatellite locus, not recombination, because the remaining SNP-based haplotype is shared by the chromosomes with this small deletion. Hence our data support a founder effect for the c.1064-1076del variation. This variation is old

60 enough for a mutation to have occurred at a microsatellite locus, but not old enough that recombination events within the shared haplotype are observed. The G61E mutation was present in 9 Saudi Arabian patients and 1 from USA. In general, they share one haplotype including the M4 region, indicating a common origin. However, a recombination each has occurred in two Saudi Arabian patients PCG-20 and PCG-21. The site of the recombination events between LD blocks A and B fits with a region of LD breakdown and thus historical recombination as seen in HapMap data (Figure 3.11). The fact that two apparently independent recombinations have occurred and that the more distant microsatellite marker M5 shows large variation suggests that additional recombination / mutation events have occurred and that therefore this is a historically old mutation, which has originated outside America and became frequent in Saudi Arabia due to a founder effect. The R368H and c.1377-1403dup and R469W mutations were each found only twice. The respective patients share a complete SNP-based ancestral CYP1B1-A haplotype but show variation at the microsatellites, again indicating a common respective founder and additional mutation events in the microsatellites. The c.1200-1209dup duplication clearly represents an ancestral founder mutation, as patients from USA, Germany and Costa Rica share a single haplotype CYP1B1-B in the genomic region including the adjacent regions at microsatellites M4-M7. Only patient RA-2 presents a recombination event between the CYP1B1 and M4 LD blocks. In addition, patient PCG-12 has one mutation event in microsatellite M4. The presence of variations in the microsatellites and recombination detected by means of SNP analysis suggest that this is also a historically old mutation. Further evidence of the founder effect is provided by the fact that 4 out of 5 patients carrying this small duplication carry the SNP-haplotype 5-CTATGG-3’ for the M4 region (excluding the microsatellite), which according to data obtained from HapMap has only a frequency of 8% in Caucasians (Table 3.12). The three patients with the W57X mutation share the complete CYP1B1-B haplotype as well as the microsatellites on both sides of the gene. This suggests a German origin of the mutation and a later migration to the USA. Six patients from USA carrying the E387K mutation share the CYP1B1-C haplotype and have the same haplotype for the M4 block, as well. In the M5-M7 block there is some variation for these individuals, again indicating a common founder. The variation pattern observed with most patients sharing either the 180 or 182 base pair allele is indicative of this being a historically rather recent mutation, where probably only one mutation event at microsatellite M6 has occurred in a common ancestor (180 to 182 or vice versa). The remaining mutations (c.155insC, R355X, c.279delC, Q42X, E229K, Y81N, W434X, c.433-442del, c.1033-1035del; Table 3.11) were found only once and thus could not be analysed for a founder effect.

61 3.3.4 Functional analysis of CYP1B1 mutations

In order to refine the mutation analysis, a functional characterization of the effect of selected CYP1B1 mutations on enzymatic activity was performed. Due to the reported variation in enzymatic activity for several CYP1B1 variants with different SNP haplotypes (Aklillu, et al., 2005; Hanna, et al., 2000; Shimada, et al., 1999), the analysed mutations were embedded in the founder SNP haplotype (consisting of 5 frequent coding SNPs, p.R48G, p.A119S, p.V432L, p.D449D and p.N453S (Stoilov, et al., 2002) in which they occur in the population. Five CYP1B1 mutations reported for PCG patients (p.G61E, p.N203S, p.L343del, p.Y81N and p.E229K) and 4 wild type CYP1B1 variants presenting different SNP haplotypes were functionally characterized.

3.3.4.1 CYP1B1 Activity

The different human CYP1B1 cDNA constructs (4 wild type SNP haplotypes and 5 mutations) were cloned into the pYeDP60 expression vector and expressed in a S. cerevisiae strain modified by insertion of the human reductase gene. Each mutation was embedded in its corresponding founder SNP background haplotype (Table 3.13).

Table 3.13. CYP1B1 variants in this study

Variants Mutation Background Haplotype (5 coding SNPs)* CYP1B1 allele Protein DNA (5’-3’) nomenclature** 1 - CYP1B1.1 RALDN CGCCA 2 - CYP1B1.2 GSLDN GTCCA 3 - CYP1B1.3 RAVDN CGGTA 4 - CYP1B1.4 RALDS CGCCG 5 p.Y81N CYP1B1.2 GSLDN GTCCA 6 p.E229K CYP1B1.2 GSLDN GTCCA 7 p.G61E CYP1B1.3 RAVDN CGGTA 8 p.N203S CYP1B1.3 RAVDN CGGTA 9 p.L343del CYP1B1.4 RALDS CGCCG

* SNP 1: p.R48G (rs10012), SNP 2: p.A119S (rs1056827), SNP3: p.V432L (rs1056836), SNP 4: p.D449D (rs1056837), and SNP 5: p.N453S (rs1800440) ** official P450 nomenclature (www.cypalleles.ki.se)

CYP1B1 expression was induced by addition of galactose and confirmed by western blot (Fig. 3.12). The RAVDN (CYP1B1.3) haplotype showed the highest molar activity at 0.32 U/umol CYP1B1, while the other 3 wild type haplotypes were in the range of 0.08 to 0.19 (Fig. 3.13a). Mutations p.G61E, p.N203S and p.L343del each revealed a clear decrease in activity below 10% of their respective haplotype, indicating a loss-of-function. However, p.Y81N and p.E229K had molar activities similar to the corresponding background haplotype (Fig. 3.13b).

l o nt o c

e iv N t N S N D a D D D g L V L L e A A A S N R R R G

62 kDa 49 kDa

Fig. 3.12. Western Blot of microsomal extracts from yeast expressing the frequent CYP1B1 variants. The CYP1B1 protein has a predicted molecular weight of 60.5 kDa. In the negative control a pYeDP60 plasmid without a CYP1B1 insert was used for the transfection.

Fig 3.13. Enzymatic activity, relative CYP1B1 abundance, and CYP1B1 activity relative to total protein. a) enzymatic activity of the wild type variant b) enymatic activity of the mutations c) relative CYP1B1 abundance for the wild type variants d) relative CYP1B1 abundance for the mutations e) CYP1B1 activity relative to total protein of the wild type variants f) CYP1B1 activity relative to total protein of the mutations

The columns for the mutations are depicted with the same color as the corresponding background variant. Statistical comparisons were performed with a one-way ANOVA. The wild type variants were compared against the haplotype with the highest activity. The mutants were compared against the corresponding background haplotype. * indicates significance at the 5% level

3.3.4.2 CYP1B1 fraction in microsomal protein extracts

The CYP1B1 fraction for the different variants ranged between 6*10-6 and 24*10-6 umol/mg of total protein. There was also significant variation between the background SNP haplotypes (Fig. 3.13c). Reduced enzyme proportions in comparison to the background SNP haplotype were observed for the p.L343del, p.Y81N and p.E229K mutations, but not for p.G61E and p.N203S. (Fig. 3.13d).

3.3.4.3 Relative CYP1B1 activity (activity x CYP1B1 fraction in total protein)

In an organism the effect of an enzyme depends on molar enzymatic activity, but also on how much enzyme is present. For this reason the enzymatic activity and enzymatic proportions were combined by multiplying them. In this manner a relative activity value was obtained, with the unit U/mg total protein (Fig. 3.13e,f). As shown in figure 3.10e, the RAVDN (CYP1B1.3) haplotype presented the highest relative activity, while lower values were obtained for the other 3 background SNP haplotypes. This relative activity of all 5 mutations in our study is significantly lower than that of the corresponding background haplotype (Fig 3.13f).

3.3.4.4 Molecular modelling The resulting three-dimensional model of the human CYP1B1 protein (based on the crystal structure of CYP2B4) showing the positions of the mutations in this study is presented in figure 3.14.

Fig. 3.14. Three-dimensional model of human cytochrome P450 1B1 which is based on the crystal structure of cytochrome P450 2B4 (PDB code: 1PO5). The model comprises the globular part (residues G48-E524) of P450 1B1. The protein is shown in backbone presentation and the alpha-helices and beta-sheets are depicted schematically in red any yellow, respectively. The heme group and the central iron atom are shown in green and brown, respectively. Sequence positions that were shown to be related to disease in human are shown as cyan balls and their spatial vicinity is shown as enlargement for the original protein and mutants in Fig. 3.12. The black dotted lines indicate the location of the main substrate access channel.

G61 is located at a sterically demanding position and adopts unusual backbone angles (φ=70°; ψ=-136°). The respective combination of torsion angles can be adopted by glycines (Fig. 3.15a) but leads to steric clashes and a strained side chain conformation for other types of amino acids (arrow in Fig. 13.15b).

Fig. 3.15. Detailed analysis of the structural effects of the p.G61E, p.Y81N, p.N203S, p.E229K, and p.L343del mutations. Models of the original and mutant proteins are shown in the left and right panel, respectively. Green dotted lines and green arrows indicate important polar interactions which are affected by the mutation Red and black arrows indicate steric clashes and poor van der Waals packing, respectively. For clarity, only those parts of the protein backbone which are close to the site of mutation are shown as a blue ribbon. The

67 effect of the amino acid substitution is shown for the missense variants a,b)G61E, c,d) Y81N, e,f) N203S, g,h) E229K i,k) L343del. Y81 packs tightly on G53 and P54 which are located at the N-terminus of the globular P450 1B1 domain. Due to the shorter side chain and the lack of the aromatic ring, N81 cannot form these interactions which might increase the flexibility of the N-terminus or even lead to the entire loss of its orientation towards the rest of the globular domain (Fig 3.12c, 3.12d). The amide group of N203 forms two side chain hydrogen bonds to the backbone amide and carbonyl group of Y214 (green dotted lines in Fig. 3.15e). These hydrogen bonds cannot be formed by the shorter side chain of S203 in the mutant (Fig. 3.15f). The side chain carboxyl group of E229 forms polar interactions to the guanidino group of R233 thereby stabilizing a tight turn (green dotted lines in Fig. 3.12g). Due to electrostatic repulsion, these interactions cannot be formed by K229 in the mutant protein and the respective side chain is expected to adopt a different orientation (Fig. 3.15h). The p.L343del mutation is located within the hydrophobic stretch 343L-L-L-F346 that forms the C-terminus of the I-helix of CYP1B1. In particular F346 tightly packs against the adjacent helices and forms hydrophobic contacts with V356, F384, I484, and A388 thereby stabilizing the three-dimensional structure of the protein (Fig. 3.15i). The deletion of L343 has severe effects on F346, which now is shifted one position towards the N-terminus of the helix and T347 now is located at the position which was occupied by F346 in the original protein (Fig. 3.15j). Due to the polar nature of its side chain, T347 cannot compensate for the hydrophobic interactions originally formed by F346 thus leading to a loss of hydrophobic packing and destabilization of the protein (Fig. 3.15j). For a more detailed investigation of the effects of the five mutations on the overall protein stability, the differences of the free energy of folding (∆∆G) were calculated for each variant compared to the respective background haplotype using the Fold-X program (Guerois, et al., 2002). Positive values of ∆∆G indicate that the mutant is less stable than the original protein suggesting that these mutants are more prone to protein degradation resulting in a lower total amount of protein. The analysis reveals that all five changes decrease the protein stability compared to the original, but the overall magnitude of the effect differs significantly. For the RAVDN (CYP1B1.3) haplotype, the destabilizing effect of the p.N203S mutation (∆∆G = 2.8 kcal/mol) is significantly larger than the effect of the p.G61E mutation (∆∆G = 0.7 kcal/mol). In the case of the GSLDN (CYP1B1.2) haplotype, the p.Y81N mutation (∆∆G = 3.0 kcal/mol) leads to a larger destabilization than p.E229K mutation (∆∆G = 0.8 kcal/mol). Thus, for both haplotypes the relative effect of different mutants is qualitatively in good agreement with the experimental data on protein abundance (Fig. 3.15c,d). This is also true for the p.L343del deletion, which exhibits the strongest destabilization (∆∆G = 3.4 kcal/mol) compared to the RALDS (CYP1B1.4) background haplotype. This data suggest that the

68 lower stability of the mutants is one key property leading to the experimentally observed lower protein abundance.

3.3.4.5 Primary congenital glaucoma families from Oman

Our institute established a cooperation with Dr. Stefan El-Gayar from the Department of Ophthalmology at the Sultan Qabood University, Muscat, which gave us access to consanguineous families with PCG from Oman. A total of 9 families with PCG were included in the study. A clinical examination was performed in Oman, DNA was extracted from peripheral blood (Kit QiAGEN), and sent to our institute. The coding exons of the CYP1B1 gen were sequenced for the index patient of each family. In this manner, mutations in the gene were identified as the cause of PCG in 7 of the 9 families (Table 3.14).

Table 3.14 CYP1B1 mutations in 9 families from Oman affected with primary congenital glaucoma

Family Mutation 1 Mutation 2 Other 1 R368H R368H 2 D374N D374N 3 G61E G61E 4 E229K (heterozygous) 5 G61E R368H 6 7 D374N D374N 8 G61E G61E 9 R368H R368H

In order to exclude the possibility that families 4 and 6 present mutations in the non-coding regions, haplotype analysis was performed using the 5 previously mentioned frequent coding SNPs in the gene, R48G, A119S, V432L, D449D and N453S (Fig. 3.16) (Chavarria-Soley, et al., 2006; Stoilov, et al., 2002).

Family 4 Family 6

T C T C C C C C C C G C G C G C C C C C T G T G : E229K T G G G G G C C C G C C G C G C C C C T C C T C T C A G A A A A A A A G

C C T C T C C C C C C C C C G C G C C C C C C C G G T G T G G G G G G G C G C G C G G C G G G G C T C T C T T T T T T C G A A A A A A G A A A A

Fig 3.16. Pedigrees and CYP1B1 haplotypes in families 4 and 6.

Family 6 presents homozygosity in this region, suggesting that affected individuals could have a CYP1B1 mutation in a non-coding sequence, such as in the promoter or in an intron (for example affecting a splice site). In family 4, on the contrary, affected individuals show heterozygosity. The E229K variant is a hypomorphic CYP1B1 allele (as shown above) which by itself is not sufficient to cause PCG. Due to the consanguinity in the family a homozygous mutation would be expected to be the cause of PCG, and it is not expected to find compound heterozygote individuals. For this reason, it seems that the gene causing PCG in this family is not CYP1B1. The second locus known for PCG, GLC3B at chromosome 1p36 was excluded by means of microsatellites in both families. Therefore, homozygosity mapping was performed for family 4. The five individuals in family 4 were analyzed with the 250K SNP microarray from Affymetrix (half of the 500K Chip). Two peaks suggestive of linkage were seen in chromosome 1 at 1p34.2-32.2 and 1q25.2-q31.2 (Fig 3.17). The interval is too large in order to sequence all genes. New family members will be recruited in Oman, analyzed with the SNP microarray, and the linkage scores will be recalculated. In this way, the intervals interest could be refined, or one of the regions could be eliminated.

HLOD

Fig. 3.17. Parametric linkage analysis for the PCG family 4 from Oman. The vertical lines represent the 23 chromosomes.

71 4 Discussion

Glaucoma represents one of the main causes of blindness in the world. The damage to the optic nerve which occurs during the course of the disease is irreversible, but avoidable if treatment is begun early enough. Early diagnosis of the disorder is, therefore, of paramount importance. This affection is a common complex disorder, but can also be inherited as Mendelian trait. Glaucoma represents a typical disorder where genetic screening can be of great use to determine the individual risk especially in glaucoma families. Furthermore individuals at risk of developing POAG could be identified early enough and closely monitored. In this manner individuals would be treated as soon as they present the first signs of glaucoma, and visual loss would be prevented. This goal has been the basis for many research efforts by many groups all over the world in the last years. Most of the research on the genetics of POAG has employed the strategy of postional cloning, mainly through linkage analysis.

4.1 Linkage analysis

Positional cloning approaches such as linkage analysis have the advantage that the location of the genes responsible for a disease can be identified without any knowledge of the biological processes involved in the pathogenesis of the disease. The knowledge required, however, is that the phenotype is inherited (Botstein and Risch, 2003). Genome-wide linkage analysis is the method traditionally used to identify disease genes, and has been greatly successful for mapping genes that underlie monogenic Mendelian diseases (Jimenez- Sanchez, et al., 2001), which are often rare. In the case of most common complex diseases, however, linkage analysis has achieved only limited success (Altmuller, et al., 2001). The lack of success can be attributed to several factors such as the low heritability of most complex traits, the presence of incomplete penetrance, phenocopies, genetic heterogeneity and epistasis (Weeks and Lathrop, 1995), the inability of standard sets of microsatellite markers to extract complete information (Evans and Cardon, 2004; John, et al., 2004; Sawcer, et al., 2004), the imprecise definition of phenotypes (Levy, et al., 2000) and inadequately powered study designs (Blangero, 2004). This project started out with the goal of discovering the gene which causes glaucoma in the Costa Rican POAG family CR-2. Other families of Costa Rica have been discarded for this analysis due to the lack of enough statistical power for performing linkage analysis. This family appeared to display autosomal dominant inheritance of the disease, across three generations, and DNA samples were available for 7 affected and 25 unaffected family

72 members. Therefore, this family initially met the requirements for successfully identifiying a locus through linkage analysis. This, however, could finally not be accomplished. Our search for glaucoma genes in the CR-2 family exemplifies the difficulties in finding genes which play a role in complex diseases. One of the challenges is finding families which appear to have monogenic inheritance and show a clear inheritance pattern, as was the case in the CR-2 family. The initial linkage analysis revealed two candidate regions on chromosomes 1p22.3 and 14q11.2-q12. Due to the fact that unaffected persons in both regions appeared to have the affected haplotype, the excursion to Costa Rica with a glaucoma specialist from tihe Ophthalmological Department of the University Hospital of the Friedrich-Alexander University was planned. At this stage, the project faced what is probably the greatest challenge in glaucoma research: the diagnosis. The patients were examined in their homes in Costa Rica, many of them several hundred kilometres from the capital, with limited equipment. The ophthalmologist classified several individuals as “glaucoma suspects” and recommended follow up examinations every few months, which is the practice in Germany. But even though a Costa Rican ophthalmologist offered to examine these individuals free of cost, most of them did not want to travel to his practice. After the trip to Costa Rica the affection status of 4 individuals changed to “unknown” due to unclear diagnosis or death. This does not mean that the ophthalmologists in Costa Rica misdiagnosed the patients. In fact, the persons examined by the three glaucoma specialists who collaborated with us in San José were correctly diagnosed. The difficulty lies in the borderline cases, which would require careful follow up, and in the lack of appropriate equipment for the examinations at home on the countryside. In linkage and association studies the most critical aspect is a secure assessment of the phenotype. The determination of linkage is fundamentally a statistical process, and uncertainties introduced by confusion about the affected status of individuals included in the study produce noise in the best case and completely obscure the linkage signal in the worst case, as it did in the CR-2 family. After performing the changes in affection status, the power of the family decreased and after the next calculation no locus could be found. The great importance of phenotyping poses a challenge in POAG genetic studies, because the criteria for diagnosing glaucoma can vary between ophthalmologists, medical centers, countries, etc. The main sign of glaucoma is cupping of the optic nerve head, this observation is somewhat subjective and its recognition depends on the experience of the ophthalmologist, size of the papilla, etc. The late age on onset of the disease further complicates things, individuals classified as healthy at 40 may develop the disease at 50 years. Besides, even in the same family age of onset can be variable. Yet another limitation of such studies is that even in cases where statistically significant evidence of linkage is obtained, extensive candidate gene studies are still required in order to identify the causal gene within the region. Further, even in cases where linkage was

73 successful and a gene was found (MYOC, OPTN), the gene plays often a limited role in the frequent sporadic cases in the general population. It has been ten years since the first gene involved in glaucoma was discovered, MYOC (Stone, et al., 1997), and the progress in the search for the genetic causes of glaucoma has been slow. The evidence available to the present supports POAG as a complex genetic disorder. Mutations in the three known POAG genes (MYOC, OPTN, WDR36), account for no more than 10% of all POAG patients, suggesting that only a small portion of all POAG cases follows classical Mendelian inheritance. In most individuals with POAG, the disease is probably caused by a large number of variants in several genes, each contributing small effects. Besides, gene-gene or gene-environment interactions might contribute to the development or progression of POAG. It has become clear that conventional linkage analysis is not the ideal strategy in glaucoma research. Alternative options are candidate gene resequencing studies, association studies with common variants in candidate genes, or genome-wide association studies. The candidate gene strategy in the search for glaucoma genes is followed by the glaucoma group at the Institute of Human Genetics at the Friedrich-Alexander University of Erlangen-Nuremberg. This group looks for candidate genes in regions with reported linkage in glaucoma genome- wide scans (Wiggs, et al., 2000) and performs mutation analysis in a large group of POAG patients and controls. A handful of genes are under investigation in this manner, but no mutations have been found in the Costa Rican family yet. Additional candidate genes will be analised in this family, and in the event that a new family member is diagnosed as having the disease the linkage analysis could be recalculated. However, the possibility of genetic heterogeneity in this family cannot be discarded completely. There is a general lack of knowledge about the cellular and biochemical events that are necessary for normal regulation of intraocular pressure (IOP) and retinal ganglion cell function, a fact that greatly complicates the choice of candidate genes. Beyond expression of the gene in the eye, and/or shared protein domains with known glaucoma genes, there is very little clue as to which candidate gene could possibly be glaucoma-causing. Examples of genes considered as potentially good candidates for POAG studies are genes which interact with MYOC, as well as genes with an olfactomedin domain similar to the one in MYOC. The question which arises regarding this strategy is how representative the pathogenesis of MYOC glaucoma is for the majority of sporadic POAG cases. A further challenge facing the candidate gene resequencing strategy lies in discerning which sequence variations are pathogenic and which are simply polymorphisms. Making a convincing case for causation is not easy: innocent polymorphisms are often present and their ability to confuse is enhanced by the presence of LD. Identifying several different significant mutations in the same gene segregating in unrelated but clinically similar families

74 offers the most convincing evidence for a causal relationship between a gene and a disease (Botstein and Risch, 2003). When candidate genes are screened for mutations in large groups of sporadic patients and controls, it becomes even more difficult to prove that a sequence variant is the cause of the disease. Amino acid replacements can be analyzed for the biochemical severity of the missense changes, the location and/or context of the altered amino acid in the protein sequence, and their degree of evolutionary conservation. A higher frequency of the variant in patients than in controls is also evidence in favour of its status as mutation. However, due to the fact that glaucoma is a complex disorder, the variant is expected to be more common in the affected individuals, but is also expected to be found in controls. In order to determine whether differences in allelic frequencies are statistically significant large numbers of patients and controls should be analyzed. A segregation analysis of the potential mutation can be performed in cases where there is access to DNA and phenotypic information for family members of an individual displaying the variant. However, once again segregation analysis is complicated by the fact that cases of incomplete penetrance and phenocopies are entirely possible, therefore making functional and tissue expression studies crucial. Association studies require large numbers of affected individuals, appropriate selection of controls and testing for stratification (Hirschhorn and Daly, 2005). Due to technical limitations, until recently, association studies have been limited to the study of variants in the coding or non-coding regions of candidate genes. In the case of POAG the many association studies to date are difficult to compare due to the large variation between: study design, populations, considered alleles in one gene, samples sizes, criteria for diagnosis, suitability of the control groups, etc. For several alleles the association has been investigated only once, and several other association reports have not been confirmed by other groups (see Table 1.2). In the past few years advances such as the completion of the human genome sequence (Reich, et al., 2001; Venter, et al., 2001), the deposition of millions of SNPs into public databases (Sachidanandam, et al., 2001), the rapid improvement in SNP genotyping technology, and the initiation of the International HapMap Project (Consortium, 2003) have made genome-wide association studies feasible, but still very expensive (Hirschhorn and Daly, 2005). This kind of study has resulted in the discovery of genetic factors contributing to disease susceptibility in studies with several complex diseases like age related macular degeneration, diabetes, and coronary artery disease (Welcome Trust Case Control Consortium 2007; Klein, et al., 2005; McPherson, et al., 2007; Saxena, et al., 2007; Scott, et al., 2007; Zeggini, et al., 2007). In order to perform such a study for POAG, several research groups would have to work together in order to reach significant results.

75 4.2 Pterygium corneae studies

4.2.1 Linkage analysis for pterygium in the CR-2 family

It is suprising that although pterygium corneae is a relatively common ocular disease, particularly in tropical countries, there is very little knowledge about the genetics of pterygium corneae. A search of the literature revealed that no linkage attempt for this disorder has ever been published. A confounding factor in genetic studies of pterygium is that the environment, especially sunlight exposure, clearly plays an important role in the development of the disease. It is possible to find in a pedigree a mixture of “genetic” and “environmental” cases of the disease, which complicates linkage analysis. An additional factor which causes difficulties in linkage analysis is the reduced penetrance of the pterygium, estimated to be around 70% (Hecht and Shoptaugh, 1990; Hilgers, 1960; Islam and Wagoner, 2001; Izumi, et al., 2003; Jacklin, 1964). Reduced penetrance implies reduced statistical power (Chen, et al., 1992) in a linkage analysis, which means more difficulty in finding a locus. In the present study it was not possible to detect one single locus where the gene responsible for the development of pterygium in the family could be located. The non- parametric linkage analysis resulted in 2 regions with scores suggestive of linkage. Particularly the region at chromosome 9p23-p21.2 had a promising non-parametric linkage score of over 9. The non-parametric or model-free analysis is essentially an analysis including only the affected individuals. However, when the haplotypes for this region are observed carefully it is obvious that several unaffected individuals carry this affected haplotype (Fig. 3.7). Specifically, 4 individuals classified as healthy and 3 as phenotype unknown present the affected haplotype. In turn, seven affected individuals display the affected haplotype. In the event that the three individuals classified as unknown are affected, the penetrance in this family would be 50%. If these three individuals are healthy the penetrance would be 71%. These penetrance values fit with what is expected for this disorder. However, the main impediment in accepting the interval in chromosome 9 as a pterygium locus is the presence of one affected individual (313) without the affected haplotype. In linkage analysis for a disorder with reduced penetrance, unaffected individuals carrying the affected haplotype are expected, but affected individuals without the affected haplotype are not. The individual in question suffered an accident in his childhood involving one of his eyes. Thus, it is plausible that this person represents in fact a phenocopy. However, the locus is not sure enough to justify the sequencing of all 80 genes in a 13 Mb region in this family. For this reason, it was decided to screen the family for mutations in the genes located in this interval for which expression in the eye is known. However, no mutations were found in any of the 11 analyzed genes.

4.2.2 Whole genome expression study for pterygium corneae with microarrays

The complex nature of a microarray experiment introduces many potential sources of variability of results. These include sample extraction, sample quality, array design, labeling protocol, hybridization conditions, wash conditions, scanning instrument, image processing, data normalization and analysis, data quality assessment, and interpretation of the results (Wilkes, et al., 2007). When performing a microarray expression analysis multiple array experiments should be carried out including replicates of each RNA sample (technical replication) as well as independent RNA preparations (biological replication) (Allison, et al., 2006; Chuaqui, et al., 2002). For designs in which two groups are analysed for differential expression, the recommendation is that a minimum of 5 biological cases per group should be analysed (Pavlidis, et al., 2003; Tsai, et al., 2003). A total of 10 tissue samples from pterygium corneae and 4 for conjunctiva derived from German patients were obtained. Unfortunately no tissue samples were available from family CR-2. The extraction of enough RNA of good quality out of the very small samples was not always possible. Therefore, the expression study was finally planned with 4 biological cases of pterygium and 2 biological cases of conjunctiva. Due to an error during the experiment, only one sample of conjunctiva was left and this constitutes the main weakness of the experiment. To compensate for this, one technical replicate was performed for all analyzed samples. After obtaining the data, there are many ways of analyzing it and there is no consensus approach to statistical analysis (Slonim, 2002). However, at a minimum there are basic methods that should be applied. Numerical management of the data permits removal of artifacts caused by low gene expression and low ratios (Mills, et al., 2001). Following data pre-processing and numerical management, a statistical approach must be chosen to determine the significance of the changes in expression levels of individual genes (Mutch, et al., 2001). Finally, high-end computational analysis should be used to identify gene expression patterns (Ellis, et al., 2002). The goal of all these efforts is accurate identification of differences in the gene expression between the sample sets, and maximal use of the information toward a better understanding of the biological process(es) under study (Chuaqui, et al., 2002). After performing statistical analysis, a total of 401 genes were found to show at least a 2-fold increase in expression (and were statistically significant) when compared to conjunctiva, while 181 genes displayed reduced expression when compared to conjunctiva (Tables 3.3 and 3.4, only the genes starting at 5-fold change in expression were included in the tables).

77 The results obtained by means of microarray expression analysis should be independently confirmed. There are two ways in which this can be done. The first one is in silico. agreement between array results from other groups, as well as with known expression information in the literature, which validates the general performance of a system and provides confidence in the overall data, including the unique and novel discoveries made in a study (Chuaqui, et al., 2002). The second way of validating the microarray results is in the laboratory. This kind of validation implies independent experimental verification (using techniques such as Real-time RT-PCR) of gene expression levels, and usually begins with the samples studied in the microarray experiments. Verification of the results at protein level is equally important (Chuaqui, et al., 2002). In this study validation of the change in expression in the laboratory cannot yet be performed because there is no more material left. As continuation of the project, new pterygium samples will be collected, RNA isolated, and gene expression re-examined by means of real time RT-PCR. Up to now, the in silico approach has been used in an attempt to validate our findings. There are three published microarray studies for pterygium corneae (John- Aryankalayil, et al., 2006; Kuo, et al., 2007; Solomon, et al., 2003). The comparison of the results between studies is difficult because they were performed employing different platforms. The number of genes included in the different microarrays varies greatly from 10,000 (John-Aryankalayil, et al., 2006) to 40, 000 (present study). In spite of the difficulty in directly comparing the results, it was found that a few differentially expressed genes in this study had presented altered expression in previous studies (Table 4.1).

Table 4.1. Differentially expressed genes in pterygium identified in this study and other microarray expression studies

Gene Name Gene Accesion Number Fold Increase in Original study Symbol expression in this study Retinol binding RBP1 NM_002899 6 (John-Aryankalayil, protein 1 et al., 2006) ATP-binding ABCG1 NM_207630 3 (John-Aryankalayil, cassette, sub- et al., 2006) family G (WHITE), member 1 Cytochrome CYP3A5 NM_000777 4 (Kuo, et al., 2007) P450 3A5

78 In other cases, the genes identified in this study are related to other previously reported genes, for example belonging to the same gene family. That is the case of the RAB31 (John- Aryankalayil, et al., 2006), and RAP27A (Kuo, et al., 2007) genes, which have shown increased expression in other studies, and the RAB37 gene which was upregulated in our study, all of them belonging to the RAS family of oncogenes. Increased expression of oncogenes fits with the idea of pterygium as a kind of benign tumor, presenting uncontrolled growth. An increased expression of some matrix metalloproteinases, MMP-1 and MMP-7 had been previously been reported in expression microarray experiments for pterygium corneae (Kuo, et al., 2007). In the present study there is increased expression of MMP-9 and MMP-11, and decreased expression of MMP-3. MMP-3 and MMP-9 have been reported as being abundantly expressed in pteryium (Di Girolamo, et al., 2004; Di Girolamo, et al., 2003; Vincent, et al., 2001). The MMP-3 downregulation observed by us does not fit with what is known of MMP expression in pterygium, this finding will be tested by other methods and additional tissue samples. Extracellular matrix remodeling is a prominent feature in the disorder. Some of these changes are attributed to the action of matrix metalloproteinases, which, influenced by genetic and environmental factors, contribute to the local invasive nature of the disease (Di Girolamo, et al., 2004). Many of the ocular diseases with which MMP expression has been associated can be reduced to more basic underlying processes of tissue repair, inflammation, cell signaling, invasion, and neovascularization (Sivak and Fini, 2002). Two interleukins, IL-6 and IL-1F5, presented decreased expression in the pterygium samples in our study. This finding seems to contradict what is known from the literature, because UV light induces IL-1, IL-6, and IL-8 (Di Girolamo, et al., 2004), and IL-6 has been reported as being over-expressed in pterygium epithelium (Di Girolamo, et al., 2002). However, it should be taken into account, that the analyzed samples were derived from German patients, who normally have not suffered unusually high UV exposure. These findings will be evaluated by other methods and with additional tissue samples. The cholinergic receptor, muscarinic 1 had been previously reported as differentially expressed (Kuo, et al., 2007), and this study detected upregulation of variants 2 and 3 of this receptor. The cholinergic receptor has been implicated in cell proliferation and angiogenesis (Costa, et al., 2001; Fiszman, et al., 2007; Frucht, et al., 1999), two processes observed in the development of pterygium. Other factors with differential expression in more than one study are different variants of purinergic receptors, phospholipases, and intercellular adhesion molecules (Kuo, et al., 2007; Solomon, et al., 2003). Several glutathione S-transferases have been reported to have increased expression in pterygium corneae samples: GSTM1 in a previous study (Kuo, et al., 2007), as well as

79 GSTA1 (more than 70-fold), GSTA2 (more than 20-fold), GSTA5, and GSTM2 in our study. GST enzymes are responsible for the detoxification against a toxic or harmful environment. Their overexpression in pterygium may be related to the defense mechanism of the ocular tissue (Kim, et al., 1998), and may represent a response to UV-mediated oxidative stress (Hayes, et al., 2005; Tsai, et al., 2004). The upregulation of HLA genes in our study seems to support an immune component in the development of pterygium. In particular HLA-DQ-beta displays more than 50-fold increase in expression (Table 3.3). Aberrant expression of HLA-DR by pterygium epithelium is known from the literature (Ioachim-Velogianni, et al., 1995; Tsironi, et al., 2002). In addition, several immunoglobulin heavy and light chains show an increased expression in our study (Table 3.3). In particular the expression of the IgG1 heavy chain is increased over 150-fold in our pterygium samples. IgG has been reported to be widely expressed in epithelial cancers from many organs, as well as in non-neoplastic proliferating cells (Choudhary, et al., 2007; Qiu, et al., 2003). Due to the reduced apoptosis documented in pterygium (Di Girolamo, et al., 2004; Tan, et al., 2000), the gene DAPK2 which was downregulated in the expression microarray experiment was chosen as a candidate gene because it is located in the possible linkage region at chromosome 9 in the CR-2 family. The gene has been shown to have a pro- apoptotic function (Kawai, et al., 1999) so that its downregulation would result in reduced apoptosis. No coding mutations were detected. However, for a hypothesized decreased expression in CR-2, alterations in the promoter or other non-coding regions would more likely affect expression of the gene. These investigations will be performed in the future. Even though the different whole genome expression studies for pterygium have employed different platforms and the set of differentially expressed genes is partially overlapping, partially different, a general observation is that pterygium is associated with oncogenic, angiogenic, fibrogenic, and inflammatory factors. Further studies of the candidate genes which come to light in such expression studies can provide more information on the general pathogenesis of this disorder, and may lead to less invasive treatments before surgery is required.

4.3 Primary congenital glaucoma (PCG) and the Cytochrome P450 1B1 (CYP1B1) gene

4.3.1 Genetics of PCG

This disorder follows most frequently a recessive mode of inheritance, CYP1B1 mutations are responsible for 100% of familial cases in the Rom (Gypsies) in Slovakia (Plasilova, et al., 1999), 94% of familial cases in Saudi Arabia (Bejjani, et al., 1998), and 50-80% of cases in populations in which consanguinity is common, such as in the Indian subcontinent (Panicker, et al., 2002). Families in whom no mutations in CYP1B1 are identified are most likely linked to other loci, namely GLC3B, GLC3C, or a novel locus. The results of the CYP1B1 screening performed in 9 Omani PCG families agree with these numbers. Mutations in CYP1B1 were found in 7 out of 9 (78%) consanguineous families with PCG from Oman. In the sporadic German patients with PCG, CYP1B1 mutations were found in one third (10/30) of the analyzed individuals. However, knowledge about the genetics of PCG is far from complete. The “simple” Mendelian recessive inheritance in this disorder, appears to be not so simple. Reports exist in the literature of reduced penetrance (Bejjani, et al., 2000), varying phenotypic expression (Soley, et al., 2003), and even dominant inheritance (Bejjani, et al., 2000; Simha, et al., 1989). In previous studies I identified a Costa Rican family with PCG. The three affected children were all homozygous for the c.1200-1209dup duplication. In one of them, however, onset of the disease was not at birth, but at 9-10 years of age, and in a less aggressive form than the other affected individuals (Soley, et al., 2003). This variation in phenotype can probably be explained by the action of one or more modifier genes. Identifying such modifiers is a principal challenge for the future. Yet another unanswered question is why sometimes mutations in CYP1B1 result in anterior segment dysgenesis (Gould and John, 2002) instead of PCG. Even though the gene was identified more than 10 years ago (Stoilov, et al., 1997), the question of why mutations in CYP1B1 result in PCG remains to the present. One function of the enzyme is the metabolism of xenobiotics, which explains why certain polymorphisms in CYP1B1, such as Val432Leu, have been associated with different kinds of cancer (Agundez, 2004). However, it is clear that CYP1B1 has several additional functions. The expression studies in human and mouse which show that the gene has a specific temporal expression during embryonic development suggest a yet unclear role for the gene in morphogenesis of the eye (Choudhary, et al., 2006; Choudhary, et al., 2003; Choudhary, et al., 2005). Due to the finding that the CYP1B1 enzyme has a role in retinoic acid synthesis (Chen, et al., 2000), and the possible functions of retinoic acid in the establishment of cell polarity (Sen, et al.,

81 2005) and as antiapoptotic factor (Ahn, et al., 2005; Dheen, et al., 2005), it has been proposed that. CYP1B1 could play also a role in retinal ganglion cell survival.

4.3.2 CYP1B1, PAX6, PITX2, and FOXC1 screening in individuals with anterior segment dysgenesis (ASD)

Disease-causing mutations could be detected in 5 of 22 patients with anterior segment malformations. The mutations were found in individuals suffering from Rieger’s anomaly (RA) and aniridia, but none were present in the 10 Peters’ anomaly (PA) patients. The c.1033-1035del in frame deletion in CYP1B1 was described for the first time in the course of this study. It affects the functionally important I-helix of CYP1B1. The highest structural conservation in the P450 enzymes is found in the core of the protein around the heme binding site, where this I-helix is located. This reflects a common mechanism of electron and proton transfer and oxygen activation (Hasemann, et al., 1995; Werck-Reichhart and Feyereisen, 2000). Other known CYP1B1 mutations which affect the I-helix of the protein are p.V320L (Mashima, et al., 2001) and p.L345F (Vincent, et al., 2002). For one RA patient a single CYP1B1 mutation was found. Given that in most cases the mode of inheritance for CYP1B1 mutations is recessive, this patient may have yet undetected variations, for example in the promoter or in the 5’ and 3’ untranslated regions. However, with our current knowledge it is not possible to rule out that this mutation could have a dominant effect in this particular patient, as it has been also proposed as cause of primary open angle glaucoma in patients carrying heterozygous CYP1B1 mutations (Melki, et al., 2004). Both of the truncating mutations found in aniridia patients in the PAX6 gene, R103X (Glaser, et al., 1994) and R203X (Martha, et al., 1995), had been previously reported. Mutations in PAX6 are commonly associated with aniridia, but have been found in other forms of ASD as well (Lines, et al., 2002). Our study was the first report of mutations in CYP1B1 as a cause for RA. Three reports existed of CYP1B1 mutations in PA patients either in compound heterozygous form (Churchill and Yeung, 2005; Vincent, et al., 2001), or homozygous form in consanguineous families (Edward, et al., 2004). Two of the RA patients with CYP1B1 mutations discussed here present the W57X mutation. The identical mutation has been found in a compound heterozygous state in a PA patient (Vincent, et al., 2001) and in PCG patients (Stoilov, et al., 2002). The homozygous CYP1B1 mutations which have previously been reported in consanguineous Saudi Arabian families with PA (Edward, et al., 2004) have also been found in PCG patients (Bejjani, et al., 1998). Therefore, there is no evidence that certain mutations are specific for ASD or PCG.

82 Incomplete penetrance (Bejjani, et al., 2000; Edward, et al., 2004; Hollander, et al., 2006; Panicker, et al., 2004), variable phenotype (Soley, et al., 2003) and a possible dominant effect (Melki, et al., 2004) have been reported for mutations of CYP1B1. Due to this genetic and phenotypic heterogeneity at present no conclusive genotype-phenotype correlation can be made for mutations in CYP1B1. Traditionally ASD and PCG have been considered as different entities. ASD results often in secondary glaucoma and its inheritance is described as autosomal dominant, while PCG is a form of primary glaucoma inherited in an autosomal recessive mode. However, the results of this study and those from others (Churchill and Yeung, 2005; Edward, et al., 2004; Vincent, et al., 2001), suggest that PCG and the ASD disorders may share a common pathophysiology.

4.3.3 Haplotype analysis for CYP1B1 mutations

The six frequent SNPs in the CYP1B1 gene, 5 of which are coding, can be used to construct haplotypes (Stoilov, et al., 2002). It has been observed that the majority of CYP1B1 mutations in the Western world are associated with the 5’-CCGGTA-3’ haplotype. As shown in table 3.10, the mutations found in Japan tend to be present on other haplotypes and the respective mutations differ from those in other populations (Mashima, et al., 2001). Our results show that the 5’-CCGGTA-3’ haplotype is actually misleading, as it is in reality part of two different LD-based haplotypes of the 7 found in the CYP1B1 genomic region in Caucasians (Table 3.12). In our study, mutations presenting the five most common haplotypes were found. Some speculation exists over why so many mutations in CYP1B1 present the inner 5’-CCGGTA-3’ haplotype; some have proposed that the haplotype could somehow be “mutation prone”(Sena, et al., 2004). After analysis of the LD structure of the CYP1B1 gene and the haplotype frequency in this region, I propose that the 5’-CCGGTA-3’ associated mutations are frequent simply because the 5’-CCGGTA-3’ haplotype includes not one, but two common haplotypes associated with widespread founder mutations. In family PCG-R1 (Fig. 3.10) the healthy mother (I:2) of two affected children (II:2, II:3) is a heterozygous carrier of the c.1064-1076del mutation. Her second CYP1B1 allele carries the p.E229K variant. This variation was previously thought to be pathogenic (Michels- Rautenstrauss, et al., 2001) and furthermore a dominant effect has been proposed (Colomb, et al., 2003). The healthy mother (I:2) as compound heterozygous mutation carrier indicates that this variation has rather the nature of a benign variation. The controversy regarding this variant led us to examine it further by means of functional tests (see section 3.3.4). For patient PCG-6 yet only one CYP1B1 mutation, p.Y81N, was found. Similarly, patient RA- 2 presented with a single p.R368H mutation. Other variations in non-coding regions have not

83 yet been ruled out, however, the missense mutation present in patient PCG-6 had previously been reported in heterozygous form in patients with early onset primary open angle glaucoma (Melki, et al., 2004). As mentioned before, mutations in the CYP1B1 gene have been reported mainly in primary congenital glaucoma patients, but also in individuals with secondary glaucoma (Churchill and Yeung, 2005; Edward, et al., 2004; Vincent, et al., 2001), Peters’ and Rieger’s anomaly, and even in heterozygous state in persons with adult glaucoma (Melki, et al., 2004). There seems to be a broad spectrum of phenotypes associated with homo- and heterozygous CYP1B1 mutations. In the case of a founder effect the genetic markers on the mutant chromosome are expected to be identical, or almost identical, in every ethnic group. If the recurrence of the mutations is explained by a mutation “hot spot”, different genetic markers in different ethnic groups would be expected. Hence these data provide evidence for a founder effect in all CYP1B1 mutations that were investigated in this study. The SNP and microsatellite haplotypes show that a single mutation present in different ethnic groups is always found on the same or very similar genetic backgrounds. To which degree the background for one mutation varies between ethnic groups depends on the age of the mutation. Having both microsatellite and SNP data is extremely useful because these markers mutate at different rates. SNPs with a high frequency of the minor allele, such as those used in this study and in the HapMap project, are very old and thus often found in all living human populations, although at different frequencies. Microsatellites, are less stable and have a mutation rate of about 1 every 1000 generations (Ellegren, 2000). The variation observed usually consists of an increment or decrease of one repeat unit, i.e. 2 base pairs. Comparison of these two types of polymorphisms thus allows inferences to be made about the age of the mutations. Based on our microsatellite and SNP information three different broad age groups for the mutations can be established: old mutations (c.1200-1209dup, p.G61E), intermediate (c.1064-1076del, c.1377-1403dup, p.R368H, p.R469W) and young (p.E387K, p.W57X). Eight mutations with multiple occurrences share extended haplotypes up to 160kb in size. For 6 of them there are patients from different ethnic origins in our study, thus the ancestral mutation has spread to several countries. The Saudi Arabian patients in our study were all homozygous for the CYP1B1 mutations, due to the high level of consanguinity customary in this country. The other homozygous CYP1B1 mutation carriers originate from Costa Rica (1 from a consanguineous family), from Turkey (2), and from USA (2). Eleven patients with German, US-American, Swiss, or Russian origin are compound heterozygotes. In countries where consanguinity is uncommon the majority of patients are expected to be compound heterozygotes. Most of the mutations found in the compound heterozygous state are

84 ancestral, widespread mutations, which explains their frequent observation worldwide in different ethnic groups.

4.3.4 Functional analysis of CYP1B1 mutations

The next step in the present work was the investigation of the effect of CYP1B1 mutations on enzymatic activity. In order to accomplish that it was necessary to also determine the activity of the wild type background SNP haplotypes. The activity of CYP1B1 constructs corresponding to the 4 most common SNP haplotypes in Caucasians was investigated: RALDN (5’-CCGCCA-3’), RAVDN (5’-CCGGTA-3’), RALDS (5’-CCGCCG-3’) and GSLDN (5’-TGTCCA-3’). There are conflicting results in the literature regarding the enzymatic activity in various CYP1B1 wild type SNP haplotypes, with some groups reporting differences in activity between different haplotypes (Hanna, et al., 2000; Li, et al., 2000; Shimada, et al., 1999), while others have not found significant variation (Aklillu, et al., 2002; Aklillu, et al., 2005; Mammen, et al., 2003; McLellan, et al., 2000). This study reports significant variation in molar enzymatic activity between the 4 different common SNP haplotypes: the haplotype with the highest activity, RAVDN, is 4 times more active (molar activity) than the lowest, GSLDN. Due to the founder effects reported for CYP1B1 (Chavarria-Soley, et al., 2006; Sena, et al., 2004) and the enzymatic activity differences between common variants with different SNP haplotypes shown here, it is of biological significance to study potentially disease causing changes on their background haplotype. A compromised catalytic efficacy has been previously reported for several CYP1B1 mutations: p.G61E, p.R117W, p.G329V, p.G365W, p.D374D, p.P347L, and p.R469W (Bagiyeva, et al., 2007; Jansson, et al., 2001; Mammen, et al., 2003). Due to substrate specific effects (Aklillu, et al., 2005; Jansson, et al., 2001; Li, et al., 2000), it is difficult to directly compare results from studies which have used different substrates. However, because of the drastic reduction in enzymatic activity found for G61E by two different groups, using different substrates (Jansson, et al., 2001; Mammen, et al., 2003), a significant effect for this amino acid substitution was expected. Indeed this mutation has only 9.5% molar activity compared to the background haplotype in our assay. The mutations p.N203S and p.L343del also revealed dramatic reductions in molar enzymatic activity, confirming their causative role in PCG. In the p.L343del mutation is an in-frame deletion of just one in a sequence of 4 leucines. At first glance, a serious effect of this mutation on protein function would not be obviously expected. A structural explanation for the reduced activity of these three mutations can be made on the basis of our CYP1B1 model together with the information available about substrate entry and product exit channels in cytochromes (Cojocaru, et al., 2007; Graham and Peterson, 1999).

85 Residue G61 is located at the mouth of the substrate access channel directly leading to the heme group (Fig. 3.14). Residues in this region of the structure have been shown to play a role both in steric and in electrostatic gating of substrate access (Graham-Lorence, et al., 1997; Graham and Peterson, 1999). The mutations p.N203S and p.L343del are located in the same protein region (Fig. 3.14), close to a product exit pathway located between helices F, G, and I (Ludemann, et al., 2000), which show high amino acid conservation between species (Fig. 3.14), which is usually closed in the static crystal structures of cytochromes. Simulations of product expulsion have shown that the displacement of side chains in this region allows transient formation of a channel for product exit (Ludemann, et al., 2000). Therefore, it is likely that mutations in this region (p.N203S, p.L343del), which affect the local protein structure, will also have an effect on product exit and thus on enzymatic activity in CYP1B1. At the cellular level, the action of an enzyme depends on its abundance as well as its activity. Therefore, our combined relative activity value reflects more accurately the biological significance of the variants (Fig. 15e,f). The RAVDN haplotype showed the maximum relative activity, the other three common haplotypes vary between 35% and 45% of the maximum activity. This implies that relative activity values of 35% are still high enough to prevent an individual from developing congenital glaucoma. It is interesting, that the GSLDN haplotype has low activity and high abundance, which results in an intermediate relative activity and suggests a compensatory mechanism. The relative activity is drastically reduced to less than 11% of the maximum in the p.L343del, p.G61E and p.N203S mutants, confirming their role as bona fide mutations. There is some controversy in the literature regarding amino acid substitution p.E229K. It is generally regarded as a mutation, although it has not yet been reported in homozygous state. I have previously reported a healthy compound heterozygous carrier of p.E229K and the well documented c.1064-1076del mutation in CYP1B1, raising the question of the potential pathogenicity of p.E229K (Chavarria-Soley, et al., 2006). Some groups report a higher frequency of p.E229K in heterozygous form in POAG patients compared to controls (Acharya, et al., 2006; Chakrabarti, et al., 2007; Lopez-Garrido, et al., 2006; Melki, et al., 2004), while others have reported similar frequencies in patients and controls (Di Girolamo, et al., 2002). A similar situation is seen for p.Y81N, which is present in PCG and primary open angle glaucoma (POAG) patients in the heterozygous state, leaving doubt whether it is rather a polymorphism or a mutation (Acharya, et al., 2006; Chakrabarti, et al., 2007; Chavarria-Soley, et al., 2006; Lopez-Garrido, et al., 2006; Melki, et al., 2004). In the present study neither of these two substitutions present significant reduction in molar enzymatic activity compared to the background haplotype, but show a reduction in abundance, probably due to compromised stability. Accordingly, these two substitutions show a mild but significant

86 reduction in our combined value of relative activity compared to their corresponding background haplotype, GSLDN (Fig. 3.13e,f). The reduction in relative activity for these amino acid changes is to 26% in p.E229K and 17% in p.Y81N of the maximum activity shown by the RAVDN variant. These are intermediate relative activity values, lying between the bona fide mutations (with less than 11% of the maximum relative activity) and the common variant with the weakest activity (RALDS) (with 35% of the maximum). This intermediate reduction, coupled to the structural effects on the mature protein, led us to classify p.E229K and p.Y81N not as bona fide mutations but as hypomorphic alleles. A role for CYP1B1 in the survival of retinal ganglion cells has recently been proposed (see section 4.3.1). If this scenario is true, it is conceivable that carrying one of these two mutations (which result in an enzyme with reduced catalytic activity) in the heterozygous state could predispose an individual to develop adult onset glaucoma. Further studies will be required to validate whether they are really risk factors for POAG. In summary, it is proposed in this study that CYP1B1 mutations can act by either reducing enzymatic activity (p.G61E and p.N203S), reducing the abundance of the enzyme (p.Y81N and p.E229K), or both (p.L343del). Mutations which cause a tenfold or greater reduction in relative activity, are pathogenic and result in primary congenital glaucoma (or ASD, see section 3.3.2).

4.4 Perspectives

Glaucoma is without a doubt one of the main causes of blindness worldwide. To date the clinical screening procedures for POAG have incorporated assessment of the optic disc, IOP measurement and investigation for visual field defects. Given the high likelihood of missing an early stage of glaucoma, and the fact that many people are repeatedly reviewed unnecessarily, such methods are not cost-effective for a community (Tuck and Crick, 1997). Strategies seeking to reduce the impact of glaucoma should be aimed at identifying at-risk individuals. A screening system should be highly sensitive and specific so as to only detect potentially serious disease, not pseudo-disease (Harris, 2005). Because POAG is initially asymptomatic, effective screening techniques should identify people with no obvious signs or symptoms of the disease, allowing early diagnosis and management. Currently it is not cost-effective to conduct population-based screening for MYOC mutations (and even less for OPTN or WDR36) which are responsible for glaucoma in a very low percentage of POAG cases. The efficacy of genetic screening would increase when conducting a comprehensive combined screen of many POAG genes and as the cost of genetic tests decreases. One question is how many POAG genes are expected to be found

87 The frequency distribution of disease-associated SNPs is thought to depend to a large extent on the disease risk associated with the allele and how much the disease impairs reproduction. Thus, early onset, severe diseases may have alleles more skewed toward the lower frequency range than later onset and/or milder diseases (Botstein and Risch, 2003). According to this hypothesis the expectation for a late onset complex disease like glaucoma is that the many alleles involved in the etiology of the disease will tend to have high minor allele frequencies, and modest effects, although this generalization is not necessarily always true. If this holds true, and there are no large-effect alleles, it will be almost impossible to completely understand the genetic basis of the disease. Besides, the many genes involved in the etiology of the disease can interact between themselves, and with the environment. Moreover, even if association is found for a variant with large effect, it must be remembered that for complex diseases association (even strong) of gene variants to disease does not represent a causal relationship, as the presence of a single sequence variation is not enough to lead to clinical pathology. Extensive studies would be required to identify the risk associated with the variant or variants detected, the allelic frequencies should be determined in different populations, etc. It is not clear whether knowledge about the genetic determinants in POAG will ever be enough to allow predictive genetic screenings to take place, at least based on current technologies. In view of the modest success of linkage analyses in the identification of glaucoma genes up to the present it is likely that future research will head in the direction of whole-genome association studies with large numbers of patients and controls, using e. g. microarray technology. A deeper understanding of glaucoma pathogenesis at the molecular level is needed. One way of possibly gaining insight in the pathogenesis of POAG is breaking down or “splitting” the POAG phenotype into its constitutional anatomical or pathophysiological components, and attempt to identify the genetic determinants of IOP, disc size, etc. Such knowledge would facilitate the identification of new candidate genes for glaucoma.

88 5 Summary

Linkage analysis for the primary open angle glaucoma (POAG) family CR-2 from Costa Rica After performing a genome wide scan in the CR-2 family with POAG, two regions with possible linkage were identified in chromosomes 1p22.3 and 14q11.2-q12. However, after clinical reexamination the affected status of 4 persons had to be changed to “unknown”, which reduced the statistical power and made it impossible to detect a unique linkage signal.

Pterygium corneae studies for family CR-2 Fourteen individuals present a pterygium corneae, thus the linkage analysis was recalculated for this affection. Peaks suggestive of linkage were found in the non-parametric linkage analysis on chromosomes 9p23-p21.2 and 15q22.2-q24.2. However, haplotype analysis revealed that there are affected individuals who do not present these haplotypes. An expression study with whole-genome expression microarrays was performed finally for 4 RNA samples isolated from pterygium corneae tissue and 1 RNA control sample isolated from conjunctiva of the eye. A total of 139 genes showed at least 5 fold up- and 60 genes down-regulation in the pterygium corneae samples compared to the control.

Primary congenital glaucoma (PCG) and extended analysis of the CYP1B1 gene and protein Mutations in the CYP1B1 gene were found in 10 out of 30 individuals with PCG recruited in Germany and in 7 out of 9 families originating in Oman. Three individuals suffering from Rieger’s anomaly presented CYP1B1 mutations as well. PAX 6 mutations were found to be disease-causing in two individuals with aniridia. The repeated occurence of several CYP1B1 mutations in various ethnic groups stimulated me to investigate possible founder effects versus the existence of mutation prone sites. A detailed haplotype analysis using a combination of SNPs and microsatellites was performed. A total of 30 individuals (26 PCG patients, 3 Rieger’s anomaly patients and one variant carrier), presenting 17 distinct variations in CYP1B1 (15 mutations and 2 variants) were included in the study. The entire genomic region of CYP1B1 was sequenced and additional flanking microsatellites were analysed in all individuals. Subsequently haplotypes for all variations using a combination of SNPs and microsatellites were constructed. For the entire CYP1B1 genomic region 5 extended SNP haplotypes associated with 17 variants could be identified. These haplotypes were complemented with microsatellite information. A total of 8 CYP1B1 mutations were found more than once, each of them presenting one identical haplotype in different individuals. Six of these mutations were represented in different ethnic groups. The earlier hypothesized founder effect for one single core SNP haplotype could be differentiated in two extended haplotypes including the central SNP haplotype.for the majority of CYP1B1 mutations. Thus the vast majority of these mutations occurred as unique events in the past. To determine the pathogenicity of selected mutations a functional analysis on enzymatic activity was performed. Four CYP1B1 wild type variants corresponding to 4 coding SNP haplotypes (RAVDN, RALDN, RALDS, and GSLDN) and five CYP1B1 mutations reported for primary congenital glaucoma patients (p.G61E, p.Y81N, p.N203S, p.E229K, and p.L343del) were included. Each mutation was embedded in its corresponding SNP haplotype. The wild type variants revealed significant variation in enzymatic activity. The mutants p.L343del, p.G61E and p.N203S each revealed only a residual activity of their respective haplotype (<10%). The microsomal CYP1B1 abundance relative to total protein also showed variation in wild type variants and a significant reduction in p.L343L, p.Y81N, and p.E229K. The free

89 energy of folding (∆∆G) values of the mutant proteins suggest that the lower stability of the mutants is one key property leading to the observed lower protein abundance. The relative enzymatic activity (U/mg total protein), which combines activity and abundance values, was significantly lower for all 5 mutations compared to the corresponding haplotype. Y81N and E229K were classified as hypomorphic alleles since their relative activity values are intermediate between bona fide mutations and the wild type variant with the lowest relative activity (RALDS). It was therefore hypothesized that CYP1B1 mutations can act by reducing enzymatic activity (p.G61E, p.N203S), reducing the abundance of the enzyme (p.Y81N, p.E229K) or both pathomechanisms (p.L343del).

90 6 Zusammenfassung

Genomweite Kopplungsanalyse für die Familie CR-2 mit Glaukompatienten aus Costa Rica Eine genomweite Suche in der Costaricanischen Familie CR-2 mit primärem Offenwinkel Glaukom (POWG) ergab 2 Regionen, auf Chromosome 1p22.3 und 14q11.2-q12, in denen das ursächliche Gen für die Glaukom-Erkrankung in dieser Familie liegen könnte. Nach einer neuen klinischen Untersuchung mussten 4 Personen für die Neuberechnung der Kopplungsanalyse als „unbekannter Phänotyp“ klassifiziert werden. Durch die Reduktion der Anzahl an Patienten hatte die Familie nicht mehr genug statistische „Power“ und dementsprechend ergab die Neuberechnung keine eindeutige Kopplung.

Pterygium corneae Analyse für die Familie CR-2 Insgesamt 14 Mitglieder der Familie CR-2 zeigten eine weitere Erkrankung des Auges, ein Pterygium corneae. Eine Neuberechnung der Kopplungsanalyse für diese Erkrankung wurde durchgeführt. Die Neuberechnung ergab in der nicht-parametrischen Analyse Hinweise auf Kopplung für einen Locus auf Chromosom 9p23-p21.2 und auf Chromosom 15q22.2-q24.2. In der Haplotypanalyse für beiden Chromosomen zeigten sich allerdings Betroffene, bei denen das Merkmal unabhängig vom familiären Haplotyp auftrat. Eine genomweite Expressionsanalyse wurde mit 4 RNA Proben aus frisch operierten Pterygien und einer Kontrollprobe aus Bindehaut des Auges durchgeführt. 139 Gene waren dabei mindestens 5-fach hochreguliert und 60 Gene mindestens 5-fach herrunterreguliert.

Primär kongenitales Galukom (PCG) und vertiefte Analyse von CYP1B1 Mutationen in CYP1B1 wurden für 10 von 30 PKG Patienten sowie in 7 von 9 PKG Familien aus Oman gefunden. 3 Patienten einer Rieger Anomalie konnten ebenfalls auf CYP1B1 Mutation zurückgeführt werden. PAX6 Mutationen wurden als Glaukomursache für 2 Aniridie Patienten gefunden. Um die Ursache des wiederholten Auftretens von CYP1B1 Mutationen in unterschiedlichen ethnischen Gruppen - Gründereffekt oder Mutations hot spots – zu klären wurde eine umfangreiche Haplotypanalyse mittels SNPs und Mikrosatelliten durchgeführt. Insgesamt 30 Personen (26 PKG Patienten, 3 Rieger Anomalie Patient und ein Anlageträger) mit 17 Varianten in CYP1B1 wurden analysiert. Im genomischen, kodierenden CYP1B1 Bereich wurden so 5 erweiterte Haplotypen identifiziert. Diese Haplotypen wurden mittels Typisierung von flankierenden Mikrosatelliten ergänzt. Acht CYP1B1 Mutationen wurden mehr als einmal, immer assoziiert mit dem gleichen Haplotyp, gefunden. Sechs Mutationen davon traten in unterschiedlichen ethnischen Gruppen auf. Der ursprünglich gefundene, singuläre Kern-Haplotyp konnte so in zwei erweiterte Haplotypen eingebettet werden, die mit spezifischen Mutationen assoziiert sind. Damit konnte ein Gründer-Effekt bewiesen werden. Ausgewählte CYP1B1 Mutationen wurden funktionell untersucht, um deren Pathogenität näher zu definieren. Vier häufige CYP1B1 Wildtyp-Varianten mit unterschiedlichen kodierenden SNP Haplotypen (RAVDN, RALDN, RALDS, und GSLDN) und 5 assoziierte CYP1B1 Mutationen (p.G61E, p.Y81N, p.N203S, p.E229K, und p.L343del) wurden untersucht. Jede Mutation wurde auf dem entsprechenden SNP Haplotyp untersucht. Die Wildtyp- Varianten ergaben siginifikante Aktivitätsdifferenzen. Die Mutationen p.343del, p.G61E und p.N203S zeigten nur eine minimale Restaktivität im Vergleich zum Hintergrundhaplotyp (<10%). Der CYP1B1 Anteil im Verhältnis zum Gesamtprotein variierte auch zwischen den Wildtyp-Varianten, war aber deutlich vermindert für p.L343L, p.Y81N, und E229K. Die freien Energie-Werte für für die Faltung (∆∆G) der mutierten Proteine deuten auf eine verminderte Stabilität hin. Dies ist möglicherweise der Grund für die reduzierte

91 relative Proteinmenge. Die resultierende relative Enzymaktivität (U/mg Gesamtprotein) war für alle 5 Mutationen im Vergleich zum Hintergrund-Haplotyp reduziert. Die Varianten Y81N und E229K wurden letztlich als hypomorphe Allele bezeichnet, weil sie relative Aktivitätswerte zwischen den Wildtyp-Haplotypen und den bona fide Mutationen zeigten. CYP1B1 Mutationen wirken daher wahrscheinlich mittels einer Reduktion der tatsächlichen Enzymaktivität (p.G61E, p.N203S), der relativen Enzymmenge (p.Y81N, p.E229K), oder durch beide Pathomechanismen (p.L343del).

92 7 References

Abecia E, Martinez-Jarreta B, Casalod Y, Bell B, Pinilla I, Honrubia FM. 1996. Genetic markers in primary open-angle glaucoma. Int Ophthalmol 20(1-3):79-82. Acharya M, Mookherjee S, Bhattacharjee A, Bandyopadhyay AK, Daulat Thakur SK, Bhaduri G, Sen A, Ray K. 2006. Primary role of CYP1B1 in Indian juvenile-onset POAG patients. Mol Vis 12:399-404. Agundez JA. 2004. Cytochrome P450 gene polymorphism and cancer. Curr Drug Metab 5(3):211-24. Ahn JH, Kang HH, Kim YJ, Chung JW. 2005. Anti-apoptotic role of retinoic acid in the inner ear of noise-exposed mice. Biochem Biophys Res Commun 335(2):485-90. Akarsu AN, Turacli ME, Aktan SG, Barsoum-Homsy M, Chevrette L, Sayli BS, Sarfarazi M. 1996. A second locus (GLC3B) for primary congenital glaucoma (Buphthalmos) maps to the 1p36 region. Hum Mol Genet 5(8):1199-203. Aklillu E, Oscarson M, Hidestrand M, Leidvik B, Otter C, Ingelman-Sundberg M. 2002. Functional analysis of six different polymorphic CYP1B1 enzyme variants found in an Ethiopian population. Mol Pharmacol 61(3):586-94. Aklillu E, Ovrebo S, Botnen IV, Otter C, Ingelman-Sundberg M. 2005. Characterization of common CYP1B1 variants with different capacity for benzo[a]pyrene-7,8-dihydrodiol epoxide formation from benzo[a]pyrene. Cancer Res 65(12):5105-11. Aldred MA, Baumber L, Hill A, Schwalbe EC, Goh K, Karwatowski W, Trembath RC. 2004. Low prevalence of MYOC mutations in UK primary open-angle glaucoma patients limits the utility of genetic testing. Hum Genet 115(5):428-31. Alfadhli S, Behbehani A, Elshafey A, Abdelmoaty S, Al-Awadi S. 2006. Molecular and clinical evaluation of primary congenital glaucoma in Kuwait. Am J Ophthalmol 141(3):512-6. Altmuller J, Palmer LJ, Fischer G, Scherb H, Wjst M. 2001. Genomewide scans of complex human diseases: true linkage is hard to find. Am J Hum Genet 69(5):936-50. Alward WL, Kwon YH, Kawase K, Craig JE, Hayreh SS, Johnson AT, Khanna CL, Yamamoto T, Mackey DA, Roos BR and others. 2003. Evaluation of optineurin sequence variations in 1,048 patients with open-angle glaucoma. Am J Ophthalmol 136(5):904-10. Alward WL, Kwon YH, Khanna CL, Johnson AT, Hayreh SS, Zimmerman MB, Narkiewicz J, Andorf JL, Moore PA, Fingert JH and others. 2002. Variations in the myocilin gene in patients with open-angle glaucoma. Arch Ophthalmol 120(9):1189-97. Allingham RR, Wiggs JL, Damji KF, Herndon L, Youn J, Tallett DA, Jones KH, Del Bono EA, Reardon M, Haines JL and others. 1998. Adult-onset primary open angle glaucoma does not localize to chromosome 2cen-q13 in North American families. Hum Hered 48(5):251-5. Allingham RR, Wiggs JL, Hauser ER, Larocque-Abramson KR, Santiago-Turla C, Broomer B, Del Bono EA, Graham FL, Haines JL, Pericak-Vance MA and others. 2005. Early adult-onset POAG linked to 15q11-13 using ordered subset analysis. Invest Ophthalmol Vis Sci 46(6):2002-5. Allison DB, Cui X, Page GP, Sabripour M. 2006. Microarray data analysis: from disarray to consolidation and consensus. Nat Rev Genet 7(1):55-65. Anderson DR. 1981. The development of the trabecular meshwork and its abnormality in primary infantile glaucoma. Trans Am Ophthalmol Soc 79:458-85. Anderson DR. 2003. Collaborative normal tension glaucoma study. Curr Opin Ophthalmol 14(2):86-90. Ariani F, Longo I, Frezzotti P, Pescucci C, Mari F, Caporossi A, Frezzotti R, Renieri A. 2006. Optineurin gene is not involved in the common high-tension form of primary open- angle glaucoma. Graefes Arch Clin Exp Ophthalmol 244(9):1077-82. Aung T, Ebenezer ND, Brice G, Child AH, Prescott Q, Lehmann OJ, Hitchings RA, Bhattacharya SS. 2003. Prevalence of optineurin sequence variants in adult primary open angle glaucoma: implications for diagnostic testing. J Med Genet 40(8):e101.

93 Aung T, Ocaka L, Ebenezer ND, Morris AG, Krawczak M, Thiselton DL, Alexander C, Votruba M, Brice G, Child AH and others. 2002. A major marker for normal tension glaucoma: association with polymorphisms in the OPA1 gene. Hum Genet 110(1):52- 6. Ayala-Lugo RM, Pawar H, Reed DM, Lichter PR, Moroi SE, Page M, Eadie J, Azocar V, Maul E, Ntim-Amponsah C and others. 2007. Variation in optineurin (OPTN) allele frequencies between and within populations. Mol Vis 13:151-63. Bagiyeva S, Marfany G, Gonzalez-Angulo O, Gonzalez-Duarte R. 2007. Mutational screening of CYP1B1 in Turkish PCG families and functional analyses of newly detected mutations. Mol Vis 13:1458-68. Baird PN, Foote SJ, Mackey DA, Craig J, Speed TP, Bureau A. 2005. Evidence for a novel glaucoma locus at chromosome 3p21-22. Hum Genet 117(2-3):249-57. Baird PN, Richardson AJ, Craig JE, Mackey DA, Rochtchina E, Mitchell P. 2004. Analysis of optineurin (OPTN) gene mutations in subjects with and without glaucoma: the Blue Mountains Eye Study. Clin Experiment Ophthalmol 32(5):518-22. Beden U, Irkec M, Orhan D, Orhan M. 2003. The roles of T-lymphocyte subpopulations (CD4 and CD8), intercellular adhesion molecule-1 (ICAM-1), HLA-DR receptor, and mast cells in etiopathogenesis of pterygium. Ocul Immunol Inflamm 11(2):115-22. Bejjani BA, Lewis RA, Tomey KF, Anderson KL, Dueker DK, Jabak M, Astle WF, Otterud B, Leppert M, Lupski JR. 1998. Mutations in CYP1B1, the gene for cytochrome P4501B1, are the predominant cause of primary congenital glaucoma in Saudi Arabia. Am J Hum Genet 62(2):325-33. Bejjani BA, Stockton DW, Lewis RA, Tomey KF, Dueker DK, Jabak M, Astle WF, Lupski JR. 2000. Multiple CYP1B1 mutations and incomplete penetrance in an inbred population segregating primary congenital glaucoma suggest frequent de novo events and a dominant modifier locus. Hum Mol Genet 9(3):367-74. Belmouden A, Melki R, Hamdani M, Zaghloul K, Amraoui A, Nadifi S, Akhayat O, Garchon HJ. 2002. A novel frameshift founder mutation in the cytochrome P450 1B1 (CYP1B1) gene is associated with primary congenital glaucoma in Morocco. Clin Genet 62(4):334-9. Bergen AA, Leschot NJ, Hulsman CA, De Smet MD, De Jong PT. 2004. [From gene to disease; primary open-angle glaucoma and three known genes: MYOC, CYP1B1 and OPTN]. Ned Tijdschr Geneeskd 148(27):1343-4. Blangero J. 2004. Localization and identification of human quantitative trait loci: king harvest has surely come. Curr Opin Genet Dev 14(3):233-40. Boland MV, Quigley HA. 2007. Risk factors and open-angle glaucoma: classification and application. J Glaucoma 16(4):406-18. Bonovas S, Filioussi K, Tsantes A, Peponis V. 2004a. Epidemiological association between cigarette smoking and primary open-angle glaucoma: a meta-analysis. Public Health 118(4):256-61. Bonovas S, Peponis V, Filioussi K. 2004b. Diabetes mellitus as a risk factor for primary open-angle glaucoma: a meta-analysis. Diabet Med 21(6):609-14. Botstein D, Risch N. 2003. Discovering genotypes underlying human phenotypes: past successes for mendelian disease, future approaches for complex disease. Nat Genet 33 Suppl:228-37. Bradford MM. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248-54. Bruttini M, Longo I, Frezzotti P, Ciappetta R, Randazzo A, Orzalesi N, Fumagalli E, Caporossi A, Frezzotti R, Renieri A. 2003. Mutations in the myocilin gene in families with primary open-angle glaucoma and juvenile open-angle glaucoma. Arch Ophthalmol 121(7):1034-8. Caballero M, Rowlette LL, Borras T. 2000. Altered secretion of a TIGR/MYOC mutant lacking the olfactomedin domain. Biochim Biophys Acta 1502(3):447-60. Cardon LR, Bell JI. 2001. Association study designs for complex diseases. Nat Rev Genet 2(2):91-9.

94 Cohn AC, Kearns LS, Savarirayan R, Ryan J, Craig JE, Mackey DA. 2005. Chromosomal abnormalities and glaucoma: a case of congenital glaucoma with trisomy 8q22-qter/ monosomy 9p23-pter. Ophthalmic Genet 26(1):45-53. Cojocaru V, Winn PJ, Wade RC. 2007. The ins and outs of cytochrome P450s. Biochim Biophys Acta 1770(3):390-401. Colomb E, Kaplan J, Garchon HJ. 2003. Novel cytochrome P450 1B1 (CYP1B1) mutations in patients with primary congenital glaucoma in France. Hum Mutat 22(6):496. Consortium TIH. 2003. The International HapMap Project. Nature 426:789-796. Copin B, Brezin AP, Valtot F, Dascotte JC, Bechetoille A, Garchon HJ. 2002. Apolipoprotein E-promoter single-nucleotide polymorphisms affect the phenotype of primary open- angle glaucoma and demonstrate interaction with the myocilin gene. Am J Hum Genet 70(6):1575-81. Coroneo MT. 1993. Pterygium as an early indicator of ultraviolet insolation: a hypothesis. Br J Ophthalmol 77(11):734-9. Coroneo MT, Di Girolamo N, Wakefield D. 1999. The pathogenesis of pterygia. Curr Opin Ophthalmol 10(4):282-8. Curry SM, Daou AG, Hermanns P, Molinari A, Lewis RA, Bejjani BA. 2004. Cytochrome P4501B1 mutations cause only part of primary congenital glaucoma in Ecuador. Ophthalmic Genet 25(1):3-9. Chakrabarti S, Devi KR, Komatireddy S, Kaur K, Parikh RS, Mandal AK, Chandrasekhar G, Thomas R. 2007. Glaucoma-Associated CYP1B1 Mutations Share Similar Haplotype Backgrounds in POAG and PACG Phenotypes. Invest Ophthalmol Vis Sci 48(12):5439-44. Chakrabarti S, Kaur K, Kaur I, Mandal AK, Parikh RS, Thomas R, Majumder PP. 2006. Globally, CYP1B1 Mutations in Primary Congenital Glaucoma Are Strongly Structured by Geographic and Haplotype Backgrounds. Invest Ophthalmol Vis Sci 47(1):43-7. Chavarria-Soley G, Michels-Rautenstrauss K, Caliebe A, Kautza M, Mardin C, Rautenstrauss B. 2006a. Novel CYP1B1 and known PAX6 mutations in anterior segment dysgenesis (ASD). J Glaucoma 15(6):499-504. Chavarria-Soley G, Michels-Rautenstrauss K, Pasutto F, Flikier D, Flikier P, Cirak S, Bejjani B, Winters DL, Lewis RA, Mardin C and others. 2006b. Primary congenital glaucoma and Rieger's anomaly: extended haplotypes reveal founder effects for eight distinct CYP1B1 mutations. Mol Vis 12:523-31. Chen H, Howald WN, Juchau MR. 2000. Biosynthesis of all-trans-retinoic acid from all-trans- retinol: catalysis of all-trans-retinol oxidation by human P-450 cytochromes. Drug Metab Dispos 28(3):315-22. Chen P, Tian J, Kovesdi I, Bruder JT. 1998. Interaction of the adenovirus 14.7-kDa protein with FLICE inhibits Fas ligand-induced apoptosis. J Biol Chem 273(10):5815-20. Chen WJ, Faraone SV, Tsuang MT. 1992. Linkage studies of schizophrenia: a stimulation study of statistical power. Genet Epidemiol 9(2):123-39. Choudhary D, Jansson I, Rezaul K, Han DK, Sarfarazi M, Schenkman JB. 2007. Cyp1b1 protein in the mouse eye during development: an immunohistochemical study. Drug Metab Dispos 35(6):987-94. Choudhary D, Jansson I, Sarfarazi M, Schenkman JB. 2004. Xenobiotic-metabolizing cytochromes P450 in ontogeny: evolving perspective. Drug Metab Rev 36(3-4):549- 68. Choudhary D, Jansson I, Sarfarazi M, Schenkman JB. 2006. Physiological significance and expression of P450s in the developing eye. Drug Metab Rev 38(1-2):337-52. Choudhary D, Jansson I, Schenkman JB, Sarfarazi M, Stoilov I. 2003. Comparative expression profiling of 40 mouse cytochrome P450 genes in embryonic and adult tissues. Arch Biochem Biophys 414(1):91-100. Choudhary D, Jansson I, Stoilov I, Sarfarazi M, Schenkman JB. 2005. Expression patterns of mouse and human CYP orthologs (families 1-4) during development and in different adult tissues. Arch Biochem Biophys 436(1):50-61.

95 Chuaqui RF, Bonner RF, Best CJ, Gillespie JW, Flaig MJ, Hewitt SM, Phillips JL, Krizman DB, Tangrea MA, Ahram M and others. 2002. Post-analysis follow-up and validation of microarray experiments. Nat Genet 32 Suppl:509-14. Churchill AJ, Yeung A. 2005. A compound heterozygous change found in Peters' anomaly. Mol Vis 11:66-70. Collaborative Normal-Tension Glaucoma Study Group.1998a. Comparison of glaucomatous progression between untreated patients with normal-tension glaucoma and patients with therapeutically reduced intraocular pressures.. Am J Ophthalmol 126(4):487-97. Collaborative Normal-Tension Glaucoma Study Group.1998b. The effectiveness of intraocular pressure reduction in the treatment of normal-tension glaucoma. Am J Ophthalmol 126(4):498-505. Dean M, Stephens JC, Winkler C, Lomb DA, Ramsburg M, Boaze R, Stewart C, Charbonneau L, Goldman D, Albaugh BJ and others. 1994. Polymorphic admixture typing in human ethnic populations. Am J Hum Genet 55(4):788-808. den Dunnen JT, Antonarakis SE. 2001. Nomenclature for the description of human sequence variations. Hum Genet 109(1):121-4. Detorakis ET, Drakonaki EE, Spandidos DA. 2000. Molecular genetic alterations and viral presence in ophthalmic pterygium. Int J Mol Med 6(1):35-41. Detorakis ET, Sourvinos G, Spandidos DA. 2001. Detection of herpes simplex virus and human papilloma virus in ophthalmic pterygium. Cornea 20(2):164-7. Detorakis ET, Sourvinos G, Tsamparlakis J, Spandidos DA. 1998. Evaluation of loss of heterozygosity and microsatellite instability in human pterygium: clinical correlations. Br J Ophthalmol 82(11):1324-8. Detorakis ET, Zafiropoulos A, Arvanitis DA, Spandidos DA. 2005. Detection of point mutations at codon 12 of KI-ras in ophthalmic pterygia. Eye 19(2):210-4. Dheen ST, Jun Y, Yan Z, Tay SS, Ling EA. 2005. Retinoic acid inhibits expression of TNF- alpha and iNOS in activated rat microglia. Glia 50(1):21-31. Di Girolamo N, Coroneo MT, Wakefield D. 2003. UVB-elicited induction of MMP-1 expression in human ocular surface epithelial cells is mediated through the ERK1/2 MAPK- dependent pathway. Invest Ophthalmol Vis Sci 44(11):4705-14. Di Girolamo N, Chui J, Coroneo MT, Wakefield D. 2004. Pathogenesis of pterygia: role of cytokines, growth factors, and matrix metalloproteinases. Prog Retin Eye Res 23(2):195-228. Di Girolamo N, Kumar RK, Coroneo MT, Wakefield D. 2002. UVB-mediated induction of interleukin-6 and -8 in pterygia and cultured human pterygium epithelial cells. Invest Ophthalmol Vis Sci 43(11):3430-7. Dimasi DP, Hewitt AW, Straga T, Pater J, MacKinnon JR, Elder JE, Casey T, Mackey DA, Craig JE. 2007. Prevalence of CYP1B1 mutations in Australian patients with primary congenital glaucoma. Clin Genet 72(3):255-60. Edward D, Al Rajhi A, Lewis RA, Curry S, Wang Z, Bejjani B. 2004. Molecular basis of Peters anomaly in Saudi Arabia. Ophthalmic Genet 25(4):257-70. Ellegren H. 2000. Heterogeneous mutation processes in human microsatellite DNA sequences. Nat Genet 24(4):400-2. Ellis M, Davis N, Coop A, Liu M, Schumaker L, Lee RY, Srikanchana R, Russell CG, Singh B, Miller WR and others. 2002. Development and validation of a method for using breast core needle biopsies for gene expression microarray analyses. Clin Cancer Res 8(5):1155-66. Evans DM, Cardon LR. 2004. Guidelines for genotyping in genomewide linkage studies: single-nucleotide-polymorphism maps versus microsatellite maps. Am J Hum Genet 75(4):687-92. Fan BJ, Leung YF, Wang N, Lam SC, Liu Y, Tam OS, Pang CP. 2004. Genetic and environmental risk factors for primary open-angle glaucoma. Chin Med J (Engl) 117(5):706-10. Forsius H, Maertens K, Fellman J. 1995. Changes of the eye caused by the climate in Rwanda, Africa. Ophthalmic Epidemiol 2(2):107-13.

96 Forsman E, Lemmela S, Varilo T, Kristo P, Forsius H, Sankila EM, Jarvela I. 2003. The role of TIGR and OPTN in Finnish glaucoma families: a clinical and molecular genetic study. Mol Vis 9:217-22. Foster PJ, Johnson GJ. 2001. Glaucoma in China: how big is the problem? Br J Ophthalmol 85(11):1277-82. Fujiwara N, Matsuo T, Ohtsuki H. 2003. Protein expression, genomic structure, and polymorphisms of oculomedin. Ophthalmic Genet 24(3):141-51. Fuse N, Takahashi K, Akiyama H, Nakazawa T, Seimiya M, Kuwahara S, Tamai M. 2004. Molecular genetic analysis of optineurin gene for primary open-angle and normal tension glaucoma in the Japanese population. J Glaucoma 13(4):299-303. Gallagher MJ, Giannoudis A, Herrington CS, Hiscott P. 2001. Human papillomavirus in pterygium. Br J Ophthalmol 85(7):782-4. Gazzard G, Saw SM, Farook M, Koh D, Widjaja D, Chia SE, Hong CY, Tan DT. 2002. Pterygium in Indonesia: prevalence, severity and risk factors. Br J Ophthalmol 86(12):1341-6. Glaser T, Jepeal L, Edwards JG, Young SR, Favor J, Maas RL. 1994. PAX6 gene dosage effect in a family with congenital cataracts, aniridia, anophthalmia and central nervous system defects. Nat Genet 7(4):463-71. Gobeil S, Rodrigue MA, Moisan S, Nguyen TD, Polansky JR, Morissette J, Raymond V. 2004. Intracellular sequestration of hetero-oligomers formed by wild-type and glaucoma-causing myocilin mutants. Invest Ophthalmol Vis Sci 45(10):3560-7. Gould DB, John SW. 2002. Anterior segment dysgenesis and the developmental glaucomas are complex traits. Hum Mol Genet 11(10):1185-93. Graham-Lorence S, Truan G, Peterson JA, Falck JR, Wei S, Helvig C, Capdevila JH. 1997. An active site substitution, F87V, converts cytochrome P450 BM-3 into a regio- and stereoselective (14S,15R)-arachidonic acid epoxygenase. J Biol Chem 272(2):1127- 35. Graham SE, Peterson JA. 1999. How similar are P450s and what can their differences teach us? Arch Biochem Biophys 369(1):24-9. Guerois R, Nielsen JE, Serrano L. 2002. Predicting changes in the stability of proteins and protein complexes: a study of more than 1000 mutations. J Mol Biol 320(2):369-87. Hakkola J, Pasanen M, Pelkonen O, Hukkanen J, Evisalmi S, Anttila S, Rane A, Mantyla M, Purkunen R, Saarikoski S and others. 1997. Expression of CYP1B1 in human adult and fetal tissues and differential inducibility of CYP1B1 and CYP1A1 by Ah receptor ligands in human placenta and cultured cells. Carcinogenesis 18(2):391-7. Hanna IH, Dawling S, Roodi N, Guengerich FP, Parl FF. 2000. Cytochrome P450 1B1 (CYP1B1) pharmacogenetics: association of polymorphisms with functional differences in estrogen hydroxylation activity. Cancer Res 60(13):3440-4. Harris R. 2005. Screening for glaucoma. Bmj 331(7517):E376-7. Hasemann CA, Kurumbail RG, Boddupalli SS, Peterson JA, Deisenhofer J. 1995. Structure and function of cytochromes P450: a comparative analysis of three crystal structures. Structure 3(1):41-62. Hashizume K, Mashima Y, Fumayama T, Ohtake Y, Kimura I, Yoshida K, Ishikawa K, Yasuda N, Fujimaki T, Asaoka R and others. 2005. Genetic polymorphisms in the angiotensin II receptor gene and their association with open-angle glaucoma in a Japanese population. Invest Ophthalmol Vis Sci 46(6):1993-2001. Hauser MA, Allingham RR, Linkroum K, Wang J, LaRocque-Abramson K, Figueiredo D, Santiago-Turla C, del Bono EA, Haines JL, Pericak-Vance MA and others. 2006. Distribution of WDR36 DNA sequence variants in patients with primary open-angle glaucoma. Invest Ophthalmol Vis Sci 47(6):2542-6. Hayes JD, Flanagan JU, Jowsey IR. 2005. Glutathione transferases. Annu Rev Pharmacol Toxicol 45:51-88. Hecht F, Shoptaugh MG. 1990. Winglets of the eye: dominant transmission of early adult pterygium of the conjunctiva. J Med Genet 27(6):392-4.

97 Heijl A, Leske MC, Bengtsson B, Hyman L, Bengtsson B, Hussein M. 2002. Reduction of intraocular pressure and glaucoma progression: results from the Early Manifest Glaucoma Trial. Arch Ophthalmol 120(10):1268-79. Hewitt AW, Dimasi DP, Mackey DA, Craig JE. 2006. A Glaucoma Case-control Study of the WDR36 Gene D658G sequence variant. Am J Ophthalmol 142(2):324-5. Hilgers JH. 1960a. Prevention of recurrent pterygium by beta radiation. Ophthalmologica 140:369-79. Hilgers JH. 1960b. Pterygium: its incidence, heredity and etiology. Am J Ophthalmol 50:635- 44. Hill JC, Maske R. 1989. Pathogenesis of pterygium. Eye 3 ( Pt 2):218-26. Hirschhorn JN, Daly MJ. 2005. Genome-wide association studies for common diseases and complex traits. Nat Rev Genet 6(2):95-108. Hollander DA, Sarfarazi M, Stoilov I, Wood IS, Fredrick DR, Alvarado JA. 2006. Genotype and phenotype correlations in congenital glaucoma. Trans Am Ophthalmol Soc 104:183-95. Ioachim-Velogianni E, Tsironi E, Agnantis N, Datseris G, Psilas K. 1995. HLA-DR antigen expression in pterygium epithelial cells and lymphocyte subpopulations: an immunohistochemistry study. Ger J Ophthalmol 4(2):123-9. Ishikawa K, Funayama T, Ohtake Y, Kimura I, Ideta H, Nakamoto K, Yasuda N, Fukuchi T, Fujimaki T, Murakami A and others. 2005. Association between glaucoma and gene polymorphism of endothelin type A receptor. Mol Vis 11:431-7. Islam SI, Wagoner MD. 2001. Pterygium in young members of one family. Cornea 20(7):708- 10. Izumi K, Mashima Y, Obazawa M, Ohtake Y, Tanino T, Miyata H, Zhang Q, Oguchi Y, Tanaka Y, Iwata T. 2003. Variants of the myocilin gene in Japanese patients with normal-tension glaucoma. Ophthalmic Res 35(6):345-50. Jacklin HN. 1964. Familial Predisposition To Pterygium Formation; Report Of A Family. Am J Ophthalmol 57:481-2. Jacobson N, Andrews M, Shepard AR, Nishimura D, Searby C, Fingert JH, Hageman G, Mullins R, Davidson BL, Kwon YH and others. 2001. Non-secretion of mutant proteins of the glaucoma gene myocilin in cultured trabecular meshwork cells and in aqueous humor. Hum Mol Genet 10(2):117-25. Jansson I, Stoilov I, Sarfarazi M, Schenkman JB. 2001. Effect of two mutations of human CYP1B1, G61E and R469W, on stability and endogenous steroid substrate metabolism. Pharmacogenetics 11(9):793-801. Jimenez-Sanchez G, Childs B, Valle D. 2001. Human disease genes. Nature 409(6822):853- 5. Joe MK, Sohn S, Hur W, Moon Y, Choi YR, Kee C. 2003. Accumulation of mutant myocilins in ER leads to ER stress and potential cytotoxicity in human trabecular meshwork cells. Biochem Biophys Res Commun 312(3):592-600. John-Aryankalayil M, Dushku N, Jaworski CJ, Cox CA, Schultz G, Smith JA, Ramsey KE, Stephan DA, Freedman KA, Reid TW and others. 2006. Microarray and protein analysis of human pterygium. Mol Vis 12:55-64. John S, Shephard N, Liu G, Zeggini E, Cao M, Chen W, Vasavda N, Mills T, Barton A, Hinks A and others. 2004. Whole-genome scan, in a complex disease, using 11,245 single- nucleotide polymorphisms: comparison with microsatellites. Am J Hum Genet 75(1):54-64. Johnson AT, Richards JE, Boehnke M, Stringham HM, Herman SB, Wong DJ, Lichter PR. 1996. Clinical phenotype of juvenile-onset primary open-angle glaucoma linked to chromosome 1q. Ophthalmology 103(5):808-14. Johnson DH. 2000. Myocilin and glaucoma: A TIGR by the tail? Arch Ophthalmol 118(7):974- 8. Junemann AG, von Ahsen N, Reulbach U, Roedl J, Bonsch D, Kornhuber J, Kruse FE, Bleich S. 2005. C677T variant in the methylentetrahydrofolate reductase gene is a genetic risk factor for primary open-angle glaucoma. Am J Ophthalmol 139(4):721-3.

98 Juronen E, Tasa G, Veromann S, Parts L, Tiidla A, Pulges R, Panov A, Soovere L, Koka K, Mikelsaar AV. 2000. Polymorphic glutathione S-transferase M1 is a risk factor of primary open-angle glaucoma among Estonians. Exp Eye Res 71(5):447-52. Kakiuchi-Matsumoto T, Isashiki Y, Ohba N, Kimura K, Sonoda S, Unoki K. 2001. Cytochrome P450 1B1 gene mutations in Japanese patients with primary congenital glaucoma(1). Am J Ophthalmol 131(3):345-50. Kakiuchi T, Isashiki Y, Nakao K, Sonoda S, Kimura K, Ohba N. 1999. A novel truncating mutation of cytochrome P4501B1 (CYP1B1) gene in primary infantile glaucoma. Am J Ophthalmol 128(3):370-2. Kanagavalli J, Krishnadas SR, Pandaranayaka E, Krishnaswamy S, Sundaresan P. 2003. Evaluation and understanding of myocilin mutations in Indian primary open angle glaucoma patients. Mol Vis 9:606-14. Kawai T, Nomura F, Hoshino K, Copeland NG, Gilbert DJ, Jenkins NA, Akira S. 1999. Death- associated protein kinase 2 is a new calcium/calmodulin-dependent protein kinase that signals apoptosis through its catalytic activity. Oncogene 18(23):3471-80. Khoo J, Saw SM, Banerjee K, Chia SE, Tan D. 1998. Outdoor work and the risk of pterygia: a case-control study. Int Ophthalmol 22(5):293-8. Kim BS, Savinova OV, Reedy MV, Martin J, Lun Y, Gan L, Smith RS, Tomarev SI, John SW, Johnson RL. 2001. Targeted Disruption of the Myocilin Gene (Myoc) Suggests that Human Glaucoma-Causing Mutations Are Gain of Function. Mol Cell Biol 21(22):7707-13. Kim YJ, Park ES, Song KY, Park SC, Kim JC. 1998. Glutathione transferase (class pi) and tissue transglutaminase (Tgase C) expression in pterygia. Korean J Ophthalmol 12(1):6-13. Klein RJ, Zeiss C, Chew EY, Tsai JY, Sackler RS, Haynes C, Henning AK, SanGiovanni JP, Mane SM, Mayne ST and others. 2005. Complement factor H polymorphism in age- related macular degeneration. Science 308(5720):385-9. Kramer PL, Samples JR, Monemi S, Sykes R, Sarfarazi M, Wirtz MK. 2006. The role of the WDR36 gene on chromosome 5q22.1 in a large family with primary open-angle glaucoma mapped to this region. Arch Ophthalmol 124(9):1328-31. Kuo CH, Miyazaki D, Nawata N, Tominaga T, Yamasaki A, Sasaki Y, Inoue Y. 2007. Prognosis-determinant candidate genes identified by whole genome scanning in eyes with pterygia. Invest Ophthalmol Vis Sci 48(8):3566-75. Lai JS, Liu DT, Tham CC, Li RT, Lam DS. 2001. Epidemiology of acute primary angle- closure glaucoma in the Hong Kong Chinese population: prospective study. Hong Kong Med J 7(2):118-23. Lam DS, Leung YF, Chua JK, Baum L, Fan DS, Choy KW, Pang CP. 2000. Truncations in the TIGR gene in individuals with and without primary open-angle glaucoma. Invest Ophthalmol Vis Sci 41(6):1386-91. Larsson M, Stahl S, Uhlen M, Wennborg A. 2000. Expression profile viewer (ExProView): a software tool for transcriptome analysis. Genomics 63(3):341-53. Leske MC. 1983. The epidemiology of open-angle glaucoma: a review. Am J Epidemiol 118(2):166-91. Leske MC, Connell AM, Schachat AP, Hyman L. 1994. The Barbados Eye Study. Prevalence of open angle glaucoma. Arch Ophthalmol 112(6):821-9. Leske MC, Connell AM, Wu SY, Hyman LG, Schachat AP. 1995. Risk factors for open-angle glaucoma. The Barbados Eye Study. Arch Ophthalmol 113(7):918-24. Leske MC, Wu SY, Honkanen R, Nemesure B, Schachat A, Hyman L, Hennis A. 2007. Nine- year incidence of open-angle glaucoma in the Barbados Eye Studies. Ophthalmology 114(6):1058-64. Leung YF, Fan BJ, Lam DS, Lee WS, Tam PO, Chua JK, Tham CC, Lai JS, Fan DS, Pang CP. 2003. Different optineurin mutation pattern in primary open-angle glaucoma. Invest Ophthalmol Vis Sci 44(9):3880-4. Levy D, DeStefano AL, Larson MG, O'Donnell CJ, Lifton RP, Gavras H, Cupples LA, Myers RH. 2000. Evidence for a gene influencing blood pressure on chromosome 17.

99 Genome scan linkage results for longitudinal blood pressure phenotypes in subjects from the framingham heart study. Hypertension 36(4):477-83. Li DN, Seidel A, Pritchard MP, Wolf CR, Friedberg T. 2000. Polymorphisms in P450 CYP1B1 affect the conversion of estradiol to the potentially carcinogenic metabolite 4- hydroxyestradiol. Pharmacogenetics 10(4):343-53. Li Y, Kang J, Horwitz MS. 1998. Interaction of an adenovirus E3 14.7-kilodalton protein with a novel tumor necrosis factor alpha-inducible cellular protein containing leucine zipper domains. Mol Cell Biol 18(3):1601-10. Lin HJ, Chen WC, Tsai FJ, Tsai SW. 2002. Distributions of p53 codon 72 polymorphism in primary open angle glaucoma. Br J Ophthalmol 86(7):767-70. Lin HJ, Tsai CH, Tsai FJ, Chen WC, Chen HY, Fan SS. 2004. Transporter associated with antigen processing gene 1 codon 333 and codon 637 polymorphisms are associated with primary open-angle glaucoma. Mol Diagn 8(4):245-52. Lin HJ, Tsai FJ, Chen WC, Shi YR, Hsu Y, Tsai SW. 2003a. Association of tumour necrosis factor alpha -308 gene polymorphism with primary open-angle glaucoma in Chinese. Eye 17(1):31-4. Lin HJ, Tsai SC, Tsai FJ, Chen WC, Tsai JJ, Hsu CD. 2003b. Association of interleukin 1beta and receptor antagonist gene polymorphisms with primary open-angle glaucoma. Ophthalmologica 217(5):358-64. Lines MA, Kozlowski K, Walter MA. 2002. Molecular genetics of Axenfeld-Rieger malformations. Hum Mol Genet 11(10):1177-84. Lopez-Garrido MP, Sanchez-Sanchez F, Lopez-Martinez F, Aroca-Aguilar JD, Blanco- Marchite C, Coca-Prados M, Escribano J. 2006. Heterozygous CYP1B1 gene mutations in Spanish patients with primary open-angle glaucoma. Mol Vis 12:748-55. Ludemann SK, Lounnas V, Wade RC. 2000. How do substrates enter and products exit the buried active site of cytochrome P450cam? 2. Steered molecular dynamics and adiabatic mapping of substrate pathways. J Mol Biol 303(5):813-30. Luthra R, Nemesure BB, Wu SY, Xie SH, Leske MC. 2001. Frequency and risk factors for pterygium in the Barbados Eye Study. Arch Ophthalmol 119(12):1827-32. Mammen JS, Pittman GS, Li Y, Abou-Zahr F, Bejjani BA, Bell DA, Strickland PT, Sutter TR. 2003. Single amino acid mutations, but not common polymorphisms, decrease the activity of CYP1B1 against (-)benzo[a]pyrene-7R-trans-7,8-dihydrodiol. Carcinogenesis 24(7):1247-55. Martha A, Strong LC, Ferrell RE, Saunders GF. 1995. Three novel aniridia mutations in the human PAX6 gene. Hum Mutat 6(1):44-9. Mashima Y, Suzuki Y, Sergeev Y, Ohtake Y, Tanino T, Kimura I, Miyata H, Aihara M, Tanihara H, Inatani M and others. 2001. Novel cytochrome P4501B1 (CYP1B1) gene mutations in Japanese patients with primary congenital glaucoma. Invest Ophthalmol Vis Sci 42(10):2211-6. Mataftsi A, Achache F, Heon E, Mermoud A, Cousin P, Metthez G, Schorderet DF, Munier FL. 2001. MYOC mutation frequency in primary open-angle glaucoma patients from Western Switzerland. Ophthalmic Genet 22(4):225-31. McCarty CA, Fu CL, Taylor HR. 2000. Epidemiology of pterygium in Victoria, Australia. Br J Ophthalmol 84(3):289-92. McLellan RA, Oscarson M, Hidestrand M, Leidvik B, Jonsson E, Otter C, Ingelman-Sundberg M. 2000. Characterization and functional analysis of two common human cytochrome P450 1B1 variants. Arch Biochem Biophys 378(1):175-81. McPherson R, Pertsemlidis A, Kavaslar N, Stewart A, Roberts R, Cox DR, Hinds DA, Pennacchio LA, Tybjaerg-Hansen A, Folsom AR and others. 2007. A common allele on chromosome 9 associated with coronary heart disease. Science 316(5830):1488- 91. Mears AJ, Jordan T, Mirzayans F, Dubois S, Kume T, Parlee M, Ritch R, Koop B, Kuo WL, Collins C and others. 1998. Mutations of the forkhead/winged-helix gene, FKHL7, in patients with Axenfeld-Rieger anomaly. Am J Hum Genet 63(5):1316-28.

100 Melki R, Belmouden A, Akhayat O, Brezin A, Garchon HJ. 2003a. The M98K variant of the OPTINEURIN (OPTN) gene modifies initial intraocular pressure in patients with primary open angle glaucoma. J Med Genet 40(11):842-4. Melki R, Belmouden A, Brezin A, Garchon HJ. 2003b. Myocilin analysis by DHPLC in French POAG patients: increased prevalence of Q368X mutation. Hum Mutat 22(2):179. Melki R, Colomb E, Lefort N, Brezin AP, Garchon HJ. 2004. CYP1B1 mutations in French patients with early-onset primary open-angle glaucoma. J Med Genet 41(9):647-51. Michels-Rautenstrauss K, Mardin C, Wakili N, Junemann AM, Villalobos L, Mejia C, Soley GC, Azofeifa J, Ozbey S, Naumann GO and others. 2002. Novel mutations in the MYOC/GLC1A gene in a large group of glaucoma patients. Hum Mutat 20(6):479-80. Michels-Rautenstrauss KG, Mardin CY, Zenker M, Jordan N, Gusek-Schneider GC, Rautenstrauss BW. 2001. Primary congenital glaucoma: three case reports on novel mutations and combinations of mutations in the GLC3A (CYP1B1) gene. J Glaucoma 10(4):354-7. Mills JC, Roth KA, Cagan RL, Gordon JI. 2001. DNA microarrays and beyond: completing the journey from tissue to cell. Nat Cell Biol 3(8):E175-8. Miyazawa A, Fuse N, Mengkegale M, Ryu M, Seimiya M, Wada Y, Nishida K. 2007. Association between primary open-angle glaucoma and WDR36 DNA sequence variants in Japanese. Mol Vis 13:1912-9. Monemi S, Spaeth G, Dasilva A, Popinchalk S, Ilitchev E, Liebmann J, Ritch R, Heon E, Crick RP, Child A and others. 2005. Identification of a Novel Adult-Onset Primary Open Angle Glaucoma (POAG) Gene on 5q22.1. Hum Mol Genet. Moran DJ, Hollows FC. 1984. Pterygium and ultraviolet radiation: a positive correlation. Br J Ophthalmol 68(5):343-6. Mukhopadhyay A, Komatireddy S, Acharya M, Bhattacharjee A, Mandal AK, Thakur SK, Chandrasekhar G, Banerjee A, Thomas R, Chakrabarti S and others. 2005. Evaluation of Optineurin as a candidate gene in Indian patients with primary open angle glaucoma. Mol Vis 11:792-7. Murken JD, Dannheim R. 1965. [On the genetic problems of corneal pterygium]. Klin Monatsbl Augenheilkd 147(4):574-9. Muskhelishvili L, Thompson PA, Kusewitt DF, Wang C, Kadlubar FF. 2001. In situ hybridization and immunohistochemical analysis of cytochrome P450 1B1 expression in human normal tissues. J Histochem Cytochem 49(2):229-36. Mutch DM, Berger A, Mansourian R, Rytz A, Roberts MA. 2001. Microarray data analysis: a practical approach for selecting differentially expressed genes. Genome Biol 2(12):PREPRINT0009. Nelson DR, Zeldin DC, Hoffman SM, Maltais LJ, Wain HM, Nebert DW. 2004. Comparison of cytochrome P450 (CYP) genes from the mouse and human genomes, including nomenclature recommendations for genes, pseudogenes and alternative-splice variants. Pharmacogenetics 14(1):1-18. Nemesure B, He Q, Mendell N, Wu SY, Hejtmancik JF, Hennis A, Leske MC. 2001. Inheritance of open-angle glaucoma in the Barbados family study. Am J Med Genet 103(1):36-43. Nemesure B, Jiao X, He Q, Leske MC, Wu SY, Hennis A, Mendell N, Redman J, Garchon HJ, Agarwala R and others. 2003. A genome-wide scan for primary open-angle glaucoma (POAG): the Barbados Family Study of Open-Angle Glaucoma. Hum Genet 112(5-6):600-9. Omura T, Sato R. 1964. The Carbon Monoxide-Binding Pigment Of Liver Microsomes. I. Evidence For Its Hemoprotein Nature. J Biol Chem 239:2370-8. Panchapakesan J, Hourihan F, Mitchell P. 1998. Prevalence of pterygium and pinguecula: the Blue Mountains Eye Study. Aust N Z J Ophthalmol 26 Suppl 1:S2-5. Panicker SG, Mandal AK, Reddy AB, Gothwal VK, Hasnain SE. 2004. Correlations of genotype with phenotype in Indian patients with primary congenital glaucoma. Invest Ophthalmol Vis Sci 45(4):1149-56.

101 Panicker SG, Reddy AB, Mandal AK, Ahmed N, Nagarajaram HA, Hasnain SE, Balasubramanian D. 2002. Identification of novel mutations causing familial primary congenital glaucoma in Indian pedigrees. Invest Ophthalmol Vis Sci 43(5):1358-66.

Paula JS, Thorn F, Cruz AA. 2006. Prevalence of pterygium and cataract in indigenous populations of the Brazilian Amazon rain forest. Eye 20(5):533-6. Pavlidis P, Li Q, Noble WS. 2003. The effect of replication on gene expression microarray experiments. Bioinformatics 19(13):1620-7. Piras F, Moore PS, Ugalde J, Perra MT, Scarpa A, Sirigu P. 2003. Detection of human papillomavirus DNA in pterygia from different geographical regions. Br J Ophthalmol 87(7):864-6. Plasilova M, Stoilov I, Sarfarazi M, Kadasi L, Ferakova E, Ferak V. 1999. Identification of a single ancestral CYP1B1 mutation in Slovak Gypsies (Roms) affected with primary congenital glaucoma. J Med Genet 36(4):290-4. Qiu X, Zhu X, Zhang L, Mao Y, Zhang J, Hao P, Li G, Lv P, Li Z, Sun X and others. 2003. Human epithelial cancers secrete immunoglobulin g with unidentified specificity to promote growth and survival of tumor cells. Cancer Res 63(19):6488-95. Reddy AB, Kaur K, Mandal AK, Panicker SG, Thomas R, Hasnain SE, Balasubramanian D, Chakrabarti S. 2004. Mutation spectrum of the CYP1B1 gene in Indian primary congenital glaucoma patients. Mol Vis 10:696-702. Reddy AB, Panicker SG, Mandal AK, Hasnain SE, Balasubramanian D. 2003. Identification of R368H as a predominant CYP1B1 allele causing primary congenital glaucoma in Indian patients. Invest Ophthalmol Vis Sci 44(10):4200-3. Reich DE, Cargill M, Bolk S, Ireland J, Sabeti PC, Richter DJ, Lavery T, Kouyoumjian R, Farhadian SF, Ward R and others. 2001. Linkage disequilibrium in the human genome. Nature 411(6834):199-204. Reisman D, McFadden JW, Lu G. 2004. Loss of heterozygosity and p53 expression in Pterygium. Cancer Lett 206(1):77-83. Resnikoff S, Pascolini D, Etya'ale D, Kocur I, Pararajasegaram R, Pokharel GP, Mariotti SP. 2004. Global data on visual impairment in the year 2002. Bull World Health Organ 82(11):844-51. Rezaie T, Child A, Hitchings R, Brice G, Miller L, Coca-Prados M, Heon E, Krupin T, Ritch R, Kreutzer D and others. 2002. Adult-onset primary open-angle glaucoma caused by mutations in optineurin. Science 295(5557):1077-9. Rezaie T, Stoilov I, Sarfarazi M. 2007. Embryonic expression of the optineurin (glaucoma) gene in different stages of mouse development. Mol Vis 13:1446-50. Rezaie T, Waitzman DM, Seeman JL, Kaufman PL, Sarfarazi M. 2005. Molecular cloning and expression profiling of optineurin in the rhesus monkey. Invest Ophthalmol Vis Sci 46(7):2404-10. Risch N, Merikangas K. 1996. The future of genetic studies of complex human diseases. Science 273(5281):1516-7. Risch NJ. 2000. Searching for genetic determinants in the new millennium. Nature 405(6788):847-56. Rojas JR, Malaga H. 1986. Pterygium in Lima, Peru. Ann Ophthalmol 18(4):147-9. Rose R, Karthikeyan M, Anandan B, Jayaraman G. 2007. Myocilin mutations among primary open angle glaucoma patients of Kanyakumari district, South India. Mol Vis 13:497- 503. Rudnicka AR, Mt-Isa S, Owen CG, Cook DG, Ashby D. 2006. Variations in primary open- angle glaucoma prevalence by age, gender, and race: a Bayesian meta-analysis. Invest Ophthalmol Vis Sci 47(10):4254-61. Sachidanandam R, Weissman D, Schmidt SC, Kakol JM, Stein LD, Marth G, Sherry S, Mullikin JC, Mortimore BJ, Willey DL and others. 2001. A map of human genome sequence variation containing 1.42 million single nucleotide polymorphisms. Nature 409(6822):928-33. Sarfarazi M, Akarsu AN, Hossain A, Turacli ME, Aktan SG, Barsoum-Homsy M, Chevrette L, Sayli BS. 1995. Assignment of a locus (GLC3A) for primary congenital glaucoma

102 (Buphthalmos) to 2p21 and evidence for genetic heterogeneity. Genomics 30(2):171- 7. Sarfarazi M, Child A, Stoilova D, Brice G, Desai T, Trifan OC, Poinoosawmy D, Crick RP. 1998. Localization of the fourth locus (GLC1E) for adult-onset primary open-angle glaucoma to the 10p15-p14 region. Am J Hum Genet 62(3):641-52. Sarfarazi M, Rezaie T. 2003. Optineurin in primary open angle glaucoma. Ophthalmol Clin North Am 16(4):529-41. Saw SM, Banerjee K, Tan D. 2000. Risk factors for the development of pterygium in Singapore: a hospital-based case-control study. Acta Ophthalmol Scand 78(2):216- 20. Saw SM, Tan D. 1999. Pterygium: prevalence, demography and risk factors. Ophthalmic Epidemiol 6(3):219-28. Sawcer SJ, Maranian M, Singlehurst S, Yeo T, Compston A, Daly MJ, De Jager PL, Gabriel S, Hafler DA, Ivinson AJ and others. 2004. Enhancing linkage analysis of complex disorders: an evaluation of high-density genotyping. Hum Mol Genet 13(17):1943-9. Saxena R, Voight BF, Lyssenko V, Burtt NP, de Bakker PI, Chen H, Roix JJ, Kathiresan S, Hirschhorn JN, Daly MJ and others. 2007. Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels. Science 316(5829):1331-6. Scott LJ, Mohlke KL, Bonnycastle LL, Willer CJ, Li Y, Duren WL, Erdos MR, Stringham HM, Chines PS, Jackson AU and others. 2007. A genome-wide association study of type 2 diabetes in Finns detects multiple susceptibility variants. Science 316(5829):1341- 5. Schroeder A, Mueller O, Stocker S, Salowsky R, Leiber M, Gassmann M, Lightfoot S, Menzel W, Granzow M, Ragg T. 2006. The RIN: an RNA integrity number for assigning integrity values to RNA measurements. BMC Mol Biol 7:3. Schwartz VJ. 1960. Congenital pterygium. Jama 174:2078-9. Sen J, Harpavat S, Peters MA, Cepko CL. 2005. Retinoic acid regulates the expression of dorsoventral topographic guidance molecules in the chick retina. Development 132(23):5147-59. Sena DF, Finzi S, Rodgers K, Del Bono E, Haines JL, Wiggs JL. 2004. Founder mutations of CYP1B1 gene in patients with congenital glaucoma from the United States and Brazil. J Med Genet 41(1):e6. Sheffield VC, Stone EM, Alward WL, Drack AV, Johnson AT, Streb LM, Nichols BE. 1993. Genetic linkage of familial open angle glaucoma to chromosome 1q21-q31. Nat Genet 4(1):47-50. Shimada T, Watanabe J, Kawajiri K, Sutter TR, Guengerich FP, Gillam EM, Inoue K. 1999. Catalytic properties of polymorphic human cytochrome P450 1B1 variants. Carcinogenesis 20(8):1607-13. Shimizu S, Lichter PR, Johnson AT, Zhou Z, Higashi M, Gottfredsdottir M, Othman M, Moroi SE, Rozsa FW, Schertzer RM and others. 2000. Age-dependent prevalence of mutations at the GLC1A locus in primary open-angle glaucoma. Am J Ophthalmol 130(2):165-77. Simha N, Verin P, Gauthier L. 1989. [Congenital glaucoma of dominant autosomal transmission apropos of a family. Management]. Bull Soc Ophtalmol Fr 89(10):1149- 51. Sitorus R, Ardjo SM, Lorenz B, Preising M. 2003. CYP1B1 gene analysis in primary congenital glaucoma in Indonesian and European patients. J Med Genet 40(1):e9. Sivak JM, Fini ME. 2002. MMPs in the eye: emerging roles for matrix metalloproteinases in ocular physiology. Prog Retin Eye Res 21(1):1-14. Slonim DK. 2002. From patterns to pathways: gene expression data analysis comes of age. Nat Genet 32 Suppl:502-8. Soley GC, Bosse KA, Flikier D, Flikier P, Azofeifa J, Mardin CY, Reis A, Michels- Rautenstrauss KG, Rautenstrauss BW. 2003. Primary congenital glaucoma: a novel single-nucleotide deletion and varying phenotypic expression for the 1,546-1,555dup mutation in the GLC3A (CYP1B1) gene in 2 families of different ethnic origin. J Glaucoma 12(1):27-30.

103 Solomon A, Grueterich M, Li DQ, Meller D, Lee SB, Tseng SC. 2003. Overexpression of Insulin-like growth factor-binding protein-2 in pterygium body fibroblasts. Invest Ophthalmol Vis Sci 44(2):573-80. Sommer A, Tielsch JM, Katz J, Quigley HA, Gottsch JD, Javitt J, Singh K. 1991. Relationship between intraocular pressure and primary open angle glaucoma among white and black Americans. The Baltimore Eye Survey. Arch Ophthalmol 109(8):1090-5. Sripriya S, Nirmaladevi J, George R, Hemamalini A, Baskaran M, Prema R, Ve Ramesh S, Karthiyayini T, Amali J, Job S and others. 2006. OPTN gene: profile of patients with glaucoma from India. Mol Vis 12:816-20. Sripriya S, Uthra S, Sangeetha R, George RJ, Hemamalini A, Paul PG, Amali J, Vijaya L, Kumaramanickavel G. 2004. Low frequency of myocilin mutations in Indian primary open-angle glaucoma patients. Clin Genet 65(4):333-7. Stephens M, Smith NJ, Donnelly P. 2001. A new statistical method for haplotype reconstruction from population data. Am J Hum Genet 68(4):978-89. Stoilov I, Akarsu AN, Alozie I, Child A, Barsoum-Homsy M, Turacli ME, Or M, Lewis RA, Ozdemir N, Brice G and others. 1998. Sequence analysis and homology modeling suggest that primary congenital glaucoma on 2p21 results from mutations disrupting either the hinge region or the conserved core structures of cytochrome P4501B1. Am J Hum Genet 62(3):573-84. Stoilov I, Akarsu AN, Sarfarazi M. 1997. Identification of three different truncating mutations in cytochrome P4501B1 (CYP1B1) as the principal cause of primary congenital glaucoma (Buphthalmos) in families linked to the GLC3A locus on chromosome 2p21. Hum Mol Genet 6(4):641-7. Stoilov IR, Costa VP, Vasconcellos JP, Melo MB, Betinjane AJ, Carani JC, Oltrogge EV, Sarfarazi M. 2002. Molecular genetics of primary congenital glaucoma in Brazil. Invest Ophthalmol Vis Sci 43(6):1820-7. Stoilova D, Child A, Trifan OC, Crick RP, Coakes RL, Sarfarazi M. 1996. Localization of a locus (GLC1B) for adult-onset primary open angle glaucoma to the 2cen-q13 region. Genomics 36(1):142-50. Stone EM, Fingert JH, Alward WL, Nguyen TD, Polansky JR, Sunden SL, Nishimura D, Clark AF, Nystuen A, Nichols BE and others. 1997. Identification of a gene that causes primary open angle glaucoma. Science 275(5300):668-70. Suriyapperuma SP, Child A, Desai T, Brice G, Kerr A, Crick RP, Sarfarazi M. 2007. A new locus (GLC1H) for adult-onset primary open-angle glaucoma maps to the 2p15-p16 region. Arch Ophthalmol 125(1):86-92. Tabor HK, Risch NJ, Myers RM. 2002. Candidate-gene approaches for studying complex genetic traits: practical considerations. Nat Rev Genet 3(5):391-7. Tamm ER. 2002. Myocilin and glaucoma: facts and ideas. Prog Retin Eye Res 21(4):395- 428. Tan DT, Tang WY, Liu YP, Goh HS, Smith DR. 2000. Apoptosis and apoptosis related gene expression in normal conjunctiva and pterygium. Br J Ophthalmol 84(2):212-6. Tang S, Toda Y, Kashiwagi K, Mabuchi F, Iijima H, Tsukahara S, Yamagata Z. 2003. The association between Japanese primary open-angle glaucoma and normal tension glaucoma patients and the optineurin gene. Hum Genet 113(3):276-9. Taylor HR, West SK, Rosenthal FS, Munoz B, Newland HS, Emmett EA. 1989. Corneal changes associated with chronic UV irradiation. Arch Ophthalmol 107(10):1481-4. Threlfall TJ, English DR. 1999. Sun exposure and pterygium of the eye: a dose-response curve. Am J Ophthalmol 128(3):280-7. Toda Y, Tang S, Kashiwagi K, Mabuchi F, Iijima H, Tsukahara S, Yamagata Z. 2004. Mutations in the optineurin gene in Japanese patients with primary open-angle glaucoma and normal tension glaucoma. Am J Med Genet A 125(1):1-4. Trifan OC, Traboulsi EI, Stoilova D, Alozie I, Nguyen R, Raja S, Sarfarazi M. 1998. A third locus (GLC1D) for adult-onset primary open-angle glaucoma maps to the 8q23 region. Am J Ophthalmol 126(1):17-28. Tsai CA, Hsueh HM, Chen JJ. 2003a. Estimation of false discovery rates in multiple testing: application to gene microarray data. Biometrics 59(4):1071-81.

104 Tsai FJ, Lin HJ, Chen WC, Chen HY, Fan SS. 2003b. Insulin-like growth factor-II gene polymorphism is associated with primary open angle glaucoma. J Clin Lab Anal 17(6):259-63. Tsai FJ, Lin HJ, Chen WC, Tsai CH, Tsai SW. 2004a. A codon 31ser-arg polymorphism of the WAF-1/CIP-1/p21/tumour suppressor gene in Chinese primary open-angle glaucoma. Acta Ophthalmol Scand 82(1):76-80. Tsai YY, Cheng YW, Lee H, Tsai FJ, Tseng SH, Chang KC. 2005. P53 gene mutation spectrum and the relationship between gene mutation and protein levels in pterygium. Mol Vis 11:50-5. Tsai YY, Lee H, Tseng SH, Cheng YW, Tsai CH, Wu YH, Tsai FJ. 2004b. Null type of glutathione S-transferase M1 polymorphism is associated with early onset pterygium. Mol Vis 10:458-61. Tsironi S, Ioachim E, Machera M, Aspiotis M, Agnantis N, Psillas K. 2002. Immunohistochemical HLA-DR antigen expression with lymphocyte subsets and proliferative activity in pterygium. In Vivo 16(5):299-306. Tuck MW, Crick RP. 1997. The cost-effectiveness of various modes of screening for primary open angle glaucoma. Ophthalmic Epidemiol 4(1):3-17. Tunny TJ, Richardson KA, Clark CV. 1998. Association study of the 5' flanking regions of endothelial-nitric oxide synthase and endothelin-1 genes in familial primary open- angle glaucoma. Clin Exp Pharmacol Physiol 25(1):26-9. Tunny TJ, Richardson KA, Clark CV, Gordon RD. 1996. The atrial natriuretic peptide gene in patients with familial primary open-angle glaucoma. Biochem Biophys Res Commun 223(2):221-5. Urban P, Cullin C, Pompon D. 1990. Maximizing the expression of mammalian cytochrome P-450 monooxygenase activities in yeast cells. Biochimie 72(6-7):463-72. Vasiliou V, Gonzalez FJ. 2007. Role of CYP1B1 in Glaucoma. Annu Rev Pharmacol Toxicol. Venter JC, Adams MD, Myers EW, Li PW, Mural RJ, Sutton GG, Smith HO, Yandell M, Evans CA, Holt RA and others. 2001. The sequence of the human genome. Science 291(5507):1304-51. Verbraak FD, Pogany K, Pilon JW, Mooy CM, de France HF, Hennekam RC, Bleeker- Wagemakers EM. 1992. Congenital glaucoma in a child with partial 1q duplication and 9p deletion. Ophthalmic Paediatr Genet 13(3):165-70. Vincent A, Billingsley G, Priston M, Glaser T, Oliver E, Walter M, Ritch R, Levin A, Heon E. 2006. Further support of the role of CYP1B1 in patients with Peters anomaly. Mol Vis 12:506-10. Vincent A, Billingsley G, Priston M, Williams-Lyn D, Sutherland J, Glaser T, Oliver E, Walter MA, Heathcote G, Levin A and others. 2001. Phenotypic heterogeneity of CYP1B1: mutations in a patient with Peters' anomaly. J Med Genet 38(5):324-6. Vincent AL, Billingsley G, Buys Y, Levin AV, Priston M, Trope G, Williams-Lyn D, Heon E. 2002. Digenic inheritance of early-onset glaucoma: CYP1B1, a potential modifier gene. Am J Hum Genet 70(2):448-60. Wang CY, Shen YC, Lo FY, Su CH, Lee SH, Lin KH, Tsai HY, Kuo NW, Fan SS. 2006. Polymorphism in the IL-1alpha (-889) locus associated with elevated risk of primary open angle glaucoma. Mol Vis 12:1380-5. Wang JT, Kunzevitzky NJ, Dugas JC, Cameron M, Barres BA, Goldberg JL. 2007. Disease gene candidates revealed by expression profiling of retinal ganglion cell development. J Neurosci 27(32):8593-603. Weeks DE, Lathrop GM. 1995. Polygenic disease: methods for mapping complex disease traits. Trends Genet 11(12):513-9. Weisschuh N, Neumann D, Wolf C, Wissinger B, Gramer E. 2005. Prevalence of myocilin and optineurin sequence variants in German normal tension glaucoma patients. Mol Vis 11:284-7. Weisschuh N, Wolf C, Wissinger B, Gramer E. 2007. Variations in the WDR36 gene in German patients with normal tension glaucoma. Mol Vis 13:724-9.

105 Welcome Trust Case Control Consortium. 2007. Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.Nature 447(7145):661- 78. Werck-Reichhart D, Feyereisen R. 2000. Cytochromes P450: a success story. Genome Biol 1(6):REVIEWS3003. Wiggs JL, Allingham RR, Hossain A, Kern J, Auguste J, DelBono EA, Broomer B, Graham FL, Hauser M, Pericak-Vance M and others. 2000. Genome-wide scan for adult onset primary open angle glaucoma. Hum Mol Genet 9(7):1109-17. Wiggs JL, Allingham RR, Vollrath D, Jones KH, De La Paz M, Kern J, Patterson K, Babb VL, Del Bono EA, Broomer BW and others. 1998. Prevalence of mutations in TIGR/Myocilin in patients with adult and juvenile primary open-angle glaucoma. Am J Hum Genet 63(5):1549-52. Wiggs JL, Auguste J, Allingham RR, Flor JD, Pericak-Vance MA, Rogers K, LaRocque KR, Graham FL, Broomer B, Del Bono E and others. 2003. Lack of association of mutations in optineurin with disease in patients with adult-onset primary open-angle glaucoma. Arch Ophthalmol 121(8):1181-3. Wiggs JL, Damji KF, Haines JL, Pericak-Vance MA, Allingham RR. 1996. The distinction between juvenile and adult-onset primary open-angle glaucoma. Am J Hum Genet 58(1):243-4. Wiggs JL, Del Bono EA, Schuman JS, Hutchinson BT, Walton DS. 1995. Clinical features of five pedigrees genetically linked to the juvenile glaucoma locus on chromosome 1q21-q31. Ophthalmology 102(12):1782-9. Wiggs JL, Lynch S, Ynagi G, Maselli M, Auguste J, Del Bono EA, Olson LM, Haines JL. 2004. A genomewide scan identifies novel early-onset primary open-angle glaucoma loci on 9q22 and 20p12. Am J Hum Genet 74(6):1314-20. Wiggs JL, Vollrath D. 2001. Molecular and clinical evaluation of a patient hemizygous for TIGR/MYOC. Arch Ophthalmol 119(11):1674-8. Wilkes T, Laux H, Foy CA. 2007. Microarray data quality - review of current developments. Omics 11(1):1-13. Willoughby CE, Chan LL, Herd S, Billingsley G, Noordeh N, Levin AV, Buys Y, Trope G, Sarfarazi M, Heon E. 2004. Defining the pathogenicity of optineurin in juvenile open- angle glaucoma. Invest Ophthalmol Vis Sci 45(9):3122-30. Wirtz MK, Samples JR, Kramer PL, Rust K, Topinka JR, Yount J, Koler RD, Acott TS. 1997. Mapping a gene for adult-onset primary open-angle glaucoma to chromosome 3q. Am J Hum Genet 60(2):296-304. Wirtz MK, Samples JR, Rust K, Lie J, Nordling L, Schilling K, Acott TS, Kramer PL. 1999. GLC1F, a new primary open-angle glaucoma locus, maps to 7q35-q36. Arch Ophthalmol 117(2):237-41. Wolfs RC, Klaver CC, Ramrattan RS, van Duijn CM, Hofman A, de Jong PT. 1998. Genetic risk of primary open-angle glaucoma. Population-based familial aggregation study. Arch Ophthalmol 116(12):1640-5. Zeggini E, Weedon MN, Lindgren CM, Frayling TM, Elliott KS, Lango H, Timpson NJ, Perry JR, Rayner NW, Freathy RM and others. 2007. Replication of genome-wide association signals in UK samples reveals risk loci for type 2 diabetes. Science 316(5829):1336-41. Zhang B, Schmoyer D, Kirov S, Snoddy J. 2004. GOTree Machine (GOTM): a web-based platform for interpreting sets of interesting genes using Gene Ontology hierarchies. BMC Bioinformatics 5:16. Zhou Z, Vollrath D. 1999. A cellular assay distinguishes normal and mutant TIGR/myocilin protein. Hum Mol Genet 8(12):2221-8.

106

8 Appendix

8.1 Abbreviations °C Degrees Celsius µ Micro (10-6) 3’- UTR 3’ untranslated region 5’- UTR 5’ untranslated region A Adenine aa Amino acid bp Base pairs C Cytosin cDNA complementary DNA c-Terminal Carboxy-terminal DMSO Dimethyl sulfoxide ddNTP dideoxy-nucleotidetriphosphate DANN Deoxyribonucleic acid dNTP desoxy-nucleotidetriphosphate E. coli Escherichia coli EDTA Ethyene diamine tetraacetic acidl Fig. Figure G Guanine g gravity g Gram JOAG Juvenile open angle glaucoma kb Kilobasepair kDa Kilodalton l Liter M Molar m Mili (10-3) Mb Megabasepair min Minute mRNA Messenger ribonucleic acid n Nano (10-9) N-terminal Amino-terminal OD Optic density p Pico (10-12) PBS Phosphate buffered saline buffer PCR Polymerase chain reaction PCG Primary congenital glaucoma POAG Primary open angle glaucoma RNA Ribonucleic acid s Second S.cerevisiae Saccharomyces cerevisiae SDS Sodium Duodecyl Sulphate T Thymine Tab. Table Taq Thermus aquaticus TBE Tris-borate-EDTA U Units UV Ultraviolet

107

8.2 Acknowledgements

I would like to thank the following persons:

First of all Prof. Bernd Rautenstrauss for directing and guiding my work, for his patience, his openness to discussion, and for his support. Karin, Simon, and Tobias for their hospitality, friendship, and help.

Prof. Georg Fey and Prof. Winterpacht for their readiness to evaluate this thesis.

Prof. Dr. André Reis for giving me the opportunity to do my doctoral studies at the Institute of Human Genetics.

All the people at the Institute of Human Genetics in Erlangen for making my time working there so pleasant, for teaching me so much, and above all for their friendship. I would particularly like to thank Kathrin Hühne for all the help she gave me through the years, as well as Jesús Lascorz, Lorena Fernández, Christian Thiel, Christiane Zweier, Arif Ekici, Juliane Hoyer, Ulrike Hüffmeier, Steffen Uebe, Mandy Krumbiegel, the “lunch group”, and the “coffee break group”.

Dr. Jorge Azofeifa on whom I can always count, Alejandro Leal for all his help at the beginning of my time in Germany, and my colleagues at the School of Biology.The Department of International Affairs (OAICE) at the University of Costa Rica for its support regarding formation of Costa Ricans abroad .

My colleagues at the Max-Delbrück-Center in Berlin for their work with the linkage analyses. I would particularly like to thank Gudrun Nürnberg, and Franz Rüschendorf for their fast and efficient work, and Prof. Heinrich Sticht for performing the molecular modeling.

The patients of the glaucoma families for their generous collaboration and the members of the Glaucoma Research Group in Erlangen.

The German Academic Exchange Service (DAAD) for the scholarship it provided for my doctoral studies in Germany, and the Gottlieb-Daimler Foundation for their financial support at the beginning of my studies.

My parents, my brothers and sister and the rest of my family, Mathias and his family, and my friends in Costa Rica and Germany for their permanent support.

108