DOCSLIB.ORG

INSTITUTO CARLOS CHAGAS Doutorado Em Biociências E Biotecnologia

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
INSTITUTO CARLOS CHAGAS Doutorado Em Biociências E Biotecnologia INSTITUTO CARLOS CHAGAS Doutorado em Biociências e Biotecnologia CARACTERIZAÇÃO FUNCIONAL DE DZIP1 EM CÉLULAS DE LINHAGEM HELA E CÉLULAS-TRONCO DERIVADAS DE TECIDO ADIPOSO HUMANO PATRÍCIA SHIGUNOV CURITIBA/PR 2013 INSTITUTO CARLOS CHAGAS Pós-Graduação em Biociências e Biotecnologia Patrícia Shigunov CARACTERIZAÇÃO FUNCIONAL DE DZIP1 EM CÉLULAS DE LINHAGEM HELA E CÉLULAS-TRONCO DERIVADAS DE TECIDO ADIPOSO HUMANO Tese apresentada ao Instituto Carlos Chagas como parte dos requisitos para obtenção do título de Doutora em Biociências e Biotecnologia. Orientadores: Prof. Dr. Bruno Dallagiovanna Prof. Dr. Alejandro Correa CURITIBA/PR 2013 ii iii iv Ao meu companheiro Eduardo, Á minha amada Íris, Aos meus pais e irmãos. v AGRADECIMENTOS Ao meu esposo, Eduardo Cezar Santos, agradeço o companheirismo, paciência e compreensão. Aos meus pais, Claudinéia e Nicolau Shigunov, pelo amor incondicional e por sempre terem acreditado em mim. À minha irmã, Vanessa Shigunov, pela amizade e apoio. Ao Dr. Bruno Dalagiovanna por orientar minha formação científica desde a iniciação científica ao doutoramento. Agradeço por toda a sabedoria transmitida nesse período e pela amizade. Aos membros da banca examinadora: Dr. Samuel Goldenberg, Dr. Giordano Calloni e Dra. Lysangela Ronalte Alves pela revisão criteriosa do presente trabalho. Ao Dr. Marco Stimamiglio pelo suporte nas plataformas de citometria e microscopia confocal. Ao Dr. Jose Sotelo-Silveira pelos ensinamentos nas análises de microarranjo de DNA. Aos Dr. Fabricio Marchini e Dr. Michel Batista pelo suporte na plataforma de proteômica. À todos do Laboratório de Biologia Básica de Células-Tronco: Dr. Alejandro Correa Dominguez, Crisciele Kuligovski, Dra. Alessandra Melo de Aguiar, Andressa Vaz Schittini, Dra. Ana Paula Abud, Dra. Jaiesa Zych, Axel Cofré, Ana Carolina Origa, Bruna Marcon, Anny Robert, Dra. Elizabeth de Moraes, Addeli Angulski e Thamile Reus. Pelos ensinamentos e pela amizade. Ao pessoal técnico, administrativo e de manutenção do Instituto Carlos Chagas por propiciarem excelentes condições de trabalho. À toda a equipe do Núcleo de Tecnologia Celular da Pontifícia Universidade Católica do Paraná, em especial Alexandra Senegaglia, Carmen Rebellato, Paula Hansen, Fabiane Barchick e ao Paulo Brofman. À todos os amigos e pesquisadores do Instituto Carlos Chagas pelos ensinamentos e amizade. Às agências financiadoras FIOCRUZ, CNPq, CAPES e FUNDAÇÃO ARAUCÁRIA pelo auxílio financeiro. vi RESUMO A regulação da expressão gênica em células eucariontes pode ser feita em nível transcricional e pós- transcricional. Em nível pós-transcricional, famílias de proteínas de união ao RNA participam desse processo. Muitos estudos têm apontado a família de proteínas DAZ (Deleted in Azoospermia) como estabilizadora de mRNAs e com um papel central no controle da autorrenovação de células-tronco. DZIP1 (DAZ-interacting protein) é uma proteína capaz de interagir com DAZ em células-tronco embrionárias e germinativas humanas. Em zebrafish, a proteína DZIP1 tem sido descrita como um dos reguladores da via de sinalização Hedgehog (Hh). No entanto, as funções de DZIP1 não foram descritas e há poucos dados sobre os mecanismos em que essa proteína participa. Dessa forma, o presente estudo visa a caracterização funcional de DZIP1 utilizando células HeLa e células-tronco derivadas de tecido adiposo (CTA). O trabalho é dividido em duas grandes partes: (1) Caracterização funcional de DZIP1 em células HeLa e (2) Caracterização de DZIP1 em CTA. Na primeira parte, a localização celular de DZIP1 foi determinada e é predominantemente citoplasmática com um padrão granular. A fim de identificar o tipo desses grânulos, ensaios de co-localização de DZIP1 com DCP1 (p-bodies) foram realizados e resultaram em não co-localização. Ensaio de imunofluorescência em células sob estresse oxidativo mostrou a co-localização de DZIP1 e TIA1 (marcador de grânulos de estresse). Estes resultados sugeriram que DZIP1 é um componente de complexos ribonucleoprotéicos (pelo menos em condições de estresse). Com o objetivo de identificar os mRNAs associados com DZIP1 foram realizadas imunoprecipitações dessa proteína e os mRNAs identificados por hibridação de microarranjos de DNA. As redes gênicas formadas pelos mRNAs alvos de DZIP1 indicam funções envolvendo o controle do ciclo celular e expressão gênica. O silenciamento de DZIP1 resultou em aumento no número de células em ensaio de curva de crescimento. Ensaios de EMSA utilizando sondas de homoribopolímeros sugerem que DZIP1 não interage diretamente com o RNA. A proteína DZIP1 está envolvida na via de sinalização Hh e um bloqueador específico dessa via é a ciclopamina. Observamos que a localização de DZIP1 sofre mudanças após a inibição da via Hh. Ainda, a expressão dos mRNAs associados a DZIP1 foi avaliada por qRT-PCR em células tratadas com ciclopamina e observou-se que a expressão deles aumenta com o tratamento. Porém, quando DZIP1 é silenciado ou superexpresso em células HeLa, o nível de expressão dos mRNAs associados não é afetado de forma significativa. Ainda assim, ensaios de decaimento de RNA com ActD foram realizados e demonstraram que DZIP1 não afeta a vida média dos mRNAs avaliados. Para estudar a associação de DZIP1 aos polissomos, extratos citoplasmáticos foram separados em gradiente de sacarose e a presença de DZIP1 nas frações polissomais foi visualizada por western blot. Na segunda parte deste trabalho, a localização de DZIP1 foi avaliada nas CTA em diferentes condições: normal, sob estresse oxidativo, com a via Hh bloqueada e ativada. DZIP1 apresentou um padrão de expressão granular e principalmente citoplasmático como observado em células HeLa. De maneira geral, os diferentes tratamentos não afetaram a localização de DZIP1. Em conclusão, a proteína DZIP1 participa de um complexo ribonucleoprotéico que transita nos compartimentos núcleo e citoplasma, está associada à maquinaria da tradução e sob estresse oxidativo está presente em grânulos de estresse. Estes resultados sugerem que a função de DZIP1 estaria associada ao transporte de mRNAs entre diferentes compartimentos funcionais, participando do ciclo de vida do mRNA na célula. vii ABSTRACT Regulation of gene expression in eukaryotic cells occurs both at the transcriptional and post- transcriptional level. At the post-transcriptional level, RNA-binding proteins families participate in this process. Many studies pointed to the DAZ (Deleted in Azoospermia) family as stabilizing mRNAs with a central role in controlling stem cells self-renewal. DZIP1 (DAZ-interacting protein) is a protein able to interact with DAZ in human embryonic and germ stem cells. In zebrafish, DZIP1 has been described as one of the regulators of the hedgehog signaling pathway (Hh). However, DZIP1 molecular function has not been described and there is little information about the mechanisms in which this protein is involved. This study aims to characterize the function of DZIP1 in HeLa and adipose stem cells (ASC). The work is divided into two major parts: (1) Functional characterization of DZIP1 in HeLa cells and (2) characterization of DZIP1 in ASCs. First, the cellular localization of DZIP1 was determined. The protein is predominantly cytoplasmic showing a granular pattern. In order to identify the class of these granules, localization assays of DZIP1 and DCP1 (p-bodies) were conducted and resulted in no co-localization. Immunofluorescence assays in cells under oxidative stress showed co- localization of DZIP1 and TIA1 (a stress granule marker). These results suggested that DZIP1 is a component of a ribonucleoprotein complex (at least under stress conditions). Aiming to identify mRNAs associated with DZIP1 we performed immunoprecipitation assays of the protein and the associated mRNAs were identified by hybridization of DNA microarrays. The genetic networks formed by mRNAs associated with DZIP1 indicate functions including the control of cell cycle, proliferation and gene expression. DZIP1 silencing resulted in an increase in the number of cells in growth curve assays. EMSA using homoribopolymer probes suggests that DZIP1 does not interact directly with RNA. DZIP1 protein is involved in the Hh signaling pathway of which cyclopamine is a specific inhibitor. We observed that the cellular location of DZIP1 undergoes changes after inhibition of the Hh pathway. Furthermore, the expression of mRNAs associated with DZIP1 was evaluated by qRT-PCR in cyclopamine-treated cells where they showed increased expression with treatment. When DZIP1 is silenced or overexpressed in HeLa cells, the expression level of associated mRNAs is not significantly affected. Moreover, RNA decay assays were performed with ActD showing that DZIP1 do not affect the half life of mRNAs. To study the association of DZIP1 with polysomes, cytoplasmic extracts were separated on sucrose gradient and the presence of DZIP1 in polysomal fractions was visualized by western blot. Regarding the characterization of DZIP1 in stem cells, its location was evaluated in ASCs under different conditions: normal, oxidative stress, activated and blocked Hh pathway. DZIP1 showed a pattern of granular cytoplasmic expression as observed in HeLa cells. In general, the different treatments did not affect the cellular location of DZIP1. In conclusion, the protein DZIP1 is part of a ribonucleoprotein complex that transits the nucleus and cytoplasm compartments and is associated with the translation machinery and under oxidative stress is present in stress granules. These results suggest that the function of DZIP1
Load more

Recommended publications
  • A Genome-Wide Association Study of Bisphosphonate-Associated
    Calcifed Tissue International (2019) 105:51–67 https://doi.org/10.1007/s00223-019-00546-9 ORIGINAL RESEARCH A Genome‑Wide Association Study of Bisphosphonate‑Associated Atypical Femoral Fracture Mohammad Kharazmi1 · Karl Michaëlsson1 · Jörg Schilcher2 · Niclas Eriksson3,4 · Håkan Melhus3 · Mia Wadelius3 · Pär Hallberg3 Received: 8 January 2019 / Accepted: 8 April 2019 / Published online: 20 April 2019 © The Author(s) 2019 Abstract Atypical femoral fracture is a well-documented adverse reaction to bisphosphonates. It is strongly related to duration of bisphosphonate use, and the risk declines rapidly after drug withdrawal. The mechanism behind bisphosphonate-associated atypical femoral fracture is unclear, but a genetic predisposition has been suggested. With the aim to identify common genetic variants that could be used for preemptive genetic testing, we performed a genome-wide association study. Cases were recruited mainly through reports of adverse drug reactions sent to the Swedish Medical Products Agency on a nation- wide basis. We compared atypical femoral fracture cases (n = 51) with population-based controls (n = 4891), and to reduce the possibility of confounding by indication, we also compared with bisphosphonate-treated controls without a current diagnosis of cancer (n = 324). The total number of single-nucleotide polymorphisms after imputation was 7,585,874. A genome-wide signifcance threshold of p < 5 × 10−8 was used to correct for multiple testing. In addition, we performed candidate gene analyses for a panel of 29 genes previously implicated in atypical femoral fractures (signifcance threshold of p < 5.7 × 10−6). Compared with population controls, bisphosphonate-associated atypical femoral fracture was associated with four isolated, uncommon single-nucleotide polymorphisms.
    [Show full text]
  • Supplementary Information Integrative Analyses of Splicing in the Aging Brain: Role in Susceptibility to Alzheimer’S Disease
    Supplementary Information Integrative analyses of splicing in the aging brain: role in susceptibility to Alzheimer’s Disease Contents 1. Supplementary Notes 1.1. Religious Orders Study and Memory and Aging Project 1.2. Mount Sinai Brain Bank Alzheimer’s Disease 1.3. CommonMind Consortium 1.4. Data Availability 2. Supplementary Tables 3. Supplementary Figures Note: Supplementary Tables are provided as separate Excel files. 1. Supplementary Notes 1.1. Religious Orders Study and Memory and Aging Project Gene expression data1. Gene expression data were generated using RNA- sequencing from Dorsolateral Prefrontal Cortex (DLPFC) of 540 individuals, at an average sequence depth of 90M reads. Detailed description of data generation and processing was previously described2 (Mostafavi, Gaiteri et al., under review). Samples were submitted to the Broad Institute’s Genomics Platform for transcriptome analysis following the dUTP protocol with Poly(A) selection developed by Levin and colleagues3. All samples were chosen to pass two initial quality filters: RNA integrity (RIN) score >5 and quantity threshold of 5 ug (and were selected from a larger set of 724 samples). Sequencing was performed on the Illumina HiSeq with 101bp paired-end reads and achieved coverage of 150M reads of the first 12 samples. These 12 samples will serve as a deep coverage reference and included 2 males and 2 females of nonimpaired, mild cognitive impaired, and Alzheimer's cases. The remaining samples were sequenced with target coverage of 50M reads; the mean coverage for the samples passing QC is 95 million reads (median 90 million reads). The libraries were constructed and pooled according to the RIN scores such that similar RIN scores would be pooled together.
    [Show full text]
  • List of Genes Associated with Sudden Cardiac Death (Scdgseta) Gene
    List of genes associated with sudden cardiac death (SCDgseta) mRNA expression in normal human heart Entrez_I Gene symbol Gene name Uniprot ID Uniprot name fromb D GTEx BioGPS SAGE c d e ATP-binding cassette subfamily B ABCB1 P08183 MDR1_HUMAN 5243 √ √ member 1 ATP-binding cassette subfamily C ABCC9 O60706 ABCC9_HUMAN 10060 √ √ member 9 ACE Angiotensin I–converting enzyme P12821 ACE_HUMAN 1636 √ √ ACE2 Angiotensin I–converting enzyme 2 Q9BYF1 ACE2_HUMAN 59272 √ √ Acetylcholinesterase (Cartwright ACHE P22303 ACES_HUMAN 43 √ √ blood group) ACTC1 Actin, alpha, cardiac muscle 1 P68032 ACTC_HUMAN 70 √ √ ACTN2 Actinin alpha 2 P35609 ACTN2_HUMAN 88 √ √ √ ACTN4 Actinin alpha 4 O43707 ACTN4_HUMAN 81 √ √ √ ADRA2B Adrenoceptor alpha 2B P18089 ADA2B_HUMAN 151 √ √ AGT Angiotensinogen P01019 ANGT_HUMAN 183 √ √ √ AGTR1 Angiotensin II receptor type 1 P30556 AGTR1_HUMAN 185 √ √ AGTR2 Angiotensin II receptor type 2 P50052 AGTR2_HUMAN 186 √ √ AKAP9 A-kinase anchoring protein 9 Q99996 AKAP9_HUMAN 10142 √ √ √ ANK2/ANKB/ANKYRI Ankyrin 2 Q01484 ANK2_HUMAN 287 √ √ √ N B ANKRD1 Ankyrin repeat domain 1 Q15327 ANKR1_HUMAN 27063 √ √ √ ANKRD9 Ankyrin repeat domain 9 Q96BM1 ANKR9_HUMAN 122416 √ √ ARHGAP24 Rho GTPase–activating protein 24 Q8N264 RHG24_HUMAN 83478 √ √ ATPase Na+/K+–transporting ATP1B1 P05026 AT1B1_HUMAN 481 √ √ √ subunit beta 1 ATPase sarcoplasmic/endoplasmic ATP2A2 P16615 AT2A2_HUMAN 488 √ √ √ reticulum Ca2+ transporting 2 AZIN1 Antizyme inhibitor 1 O14977 AZIN1_HUMAN 51582 √ √ √ UDP-GlcNAc: betaGal B3GNT7 beta-1,3-N-acetylglucosaminyltransfe Q8NFL0
    [Show full text]
  • Dual Proteome-Scale Networks Reveal Cell-Specific Remodeling of the Human Interactome
    bioRxiv preprint doi: https://doi.org/10.1101/2020.01.19.905109; this version posted January 19, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Dual Proteome-scale Networks Reveal Cell-specific Remodeling of the Human Interactome Edward L. Huttlin1*, Raphael J. Bruckner1,3, Jose Navarrete-Perea1, Joe R. Cannon1,4, Kurt Baltier1,5, Fana Gebreab1, Melanie P. Gygi1, Alexandra Thornock1, Gabriela Zarraga1,6, Stanley Tam1,7, John Szpyt1, Alexandra Panov1, Hannah Parzen1,8, Sipei Fu1, Arvene Golbazi1, Eila Maenpaa1, Keegan Stricker1, Sanjukta Guha Thakurta1, Ramin Rad1, Joshua Pan2, David P. Nusinow1, Joao A. Paulo1, Devin K. Schweppe1, Laura Pontano Vaites1, J. Wade Harper1*, Steven P. Gygi1*# 1Department of Cell Biology, Harvard Medical School, Boston, MA, 02115, USA. 2Broad Institute, Cambridge, MA, 02142, USA. 3Present address: ICCB-Longwood Screening Facility, Harvard Medical School, Boston, MA, 02115, USA. 4Present address: Merck, West Point, PA, 19486, USA. 5Present address: IQ Proteomics, Cambridge, MA, 02139, USA. 6Present address: Vor Biopharma, Cambridge, MA, 02142, USA. 7Present address: Rubius Therapeutics, Cambridge, MA, 02139, USA. 8Present address: RPS North America, South Kingstown, RI, 02879, USA. *Correspondence: [email protected] (E.L.H.), [email protected] (J.W.H.), [email protected] (S.P.G.) #Lead Contact: [email protected] bioRxiv preprint doi: https://doi.org/10.1101/2020.01.19.905109; this version posted January 19, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Supplementary Table 1: Adhesion Genes Data Set
    Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like,
    [Show full text]
  • High-Density Single Nucleotide Polymorphism Array Defines Novel Stage and Location-Dependent Allelic Imbalances in Human Bladder Tumors
    ResearchResearch Article Article High-Density Single Nucleotide Polymorphism Array Defines Novel Stage and Location-Dependent Allelic Imbalances in Human Bladder Tumors Karen Koed,1,3 Carsten Wiuf,4 Lise-Lotte Christensen,1 Friedrik P. Wikman,1 Karsten Zieger,1,2 Klaus Møller,2 Hans von der Maase,3 and Torben F. Ørntoft1 Molecular Diagnostic Laboratory, 1Departments of Clinical Biochemistry, 2Urology, and 3Oncology, Aarhus University Hospital; and 4Bioinformatics Research Center, Aarhus University, Aarhus, Denmark Abstract In the case of noninvasive Ta transitional cell carcinomas, this Bladder cancer is a common disease characterized by multiple includes loss of chromosome 9, or parts of it, as well as 1q+ and loss recurrences and an invasive disease course in more than 10% of the Y chromosome in males (2, 5). In invasive tumors, many of patients. It is of monoclonal or oligoclonal origin and alterations have been reported to be more or less common: 1pÀ, genomic instability has been shown at certain loci. We used a 2qÀ,4qÀ,5qÀ,8pÀ, À9, 10qÀ, 11pÀ,11qÀ, 1q+, 2p+, 5p+, 8q+, 10,000 single nucleotide polymorphism (SNP) array with an 11q13+, 17q+, and 20q+ (2, 6–8). It has been suggested that these lost average of 2,700 heterozygous SNPs to detect allelic imbalances or gained regions harbor tumor suppressor genes and oncogenes, (AI) in 37 microdissected bladder tumors from 17 patients. respectively. However, the large chromosomal areas involved often Eight tumors represented upstaging from Ta to T1, eight from contain many genes, making meaningful predictions of the T1 to T2+, and one from Ta to T2+.
    [Show full text]
  • Mutational Landscape Differences Between Young-Onset and Older-Onset Breast Cancer Patients Nicole E
    Mealey et al. BMC Cancer (2020) 20:212 https://doi.org/10.1186/s12885-020-6684-z RESEARCH ARTICLE Open Access Mutational landscape differences between young-onset and older-onset breast cancer patients Nicole E. Mealey1 , Dylan E. O’Sullivan2 , Joy Pader3 , Yibing Ruan3 , Edwin Wang4 , May Lynn Quan1,5,6 and Darren R. Brenner1,3,5* Abstract Background: The incidence of breast cancer among young women (aged ≤40 years) has increased in North America and Europe. Fewer than 10% of cases among young women are attributable to inherited BRCA1 or BRCA2 mutations, suggesting an important role for somatic mutations. This study investigated genomic differences between young- and older-onset breast tumours. Methods: In this study we characterized the mutational landscape of 89 young-onset breast tumours (≤40 years) and examined differences with 949 older-onset tumours (> 40 years) using data from The Cancer Genome Atlas. We examined mutated genes, mutational load, and types of mutations. We used complementary R packages “deconstructSigs” and “SomaticSignatures” to extract mutational signatures. A recursively partitioned mixture model was used to identify whether combinations of mutational signatures were related to age of onset. Results: Older patients had a higher proportion of mutations in PIK3CA, CDH1, and MAP3K1 genes, while young- onset patients had a higher proportion of mutations in GATA3 and CTNNB1. Mutational load was lower for young- onset tumours, and a higher proportion of these mutations were C > A mutations, but a lower proportion were C > T mutations compared to older-onset tumours. The most common mutational signatures identified in both age groups were signatures 1 and 3 from the COSMIC database.
    [Show full text]
  • CCNL1 (NM 020307) Human Untagged Clone – SC113160 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC113160 CCNL1 (NM_020307) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: CCNL1 (NM_020307) Human Untagged Clone Tag: Tag Free Symbol: CCNL1 Synonyms: ania-6a; ANIA6A; BM-001; PRO1073 Vector: pCMV6-XL5 E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: None Fully Sequenced ORF: >NCBI ORF sequence for NM_020307, the custom clone sequence may differ by one or more nucleotides ATGGCGTCCGGGCCTCATTCGACAGCTACTGCTGCCGCAGCCGCCTCATCGGCCGCCCCAAGCGCGGGCG GCTCCAGCTCCGGGACGACGACCACGACGACGACCACGACGGGAGGGATCCTGATCGGCGATCGCCTGTA CTCGGAAGTTTCACTTACCATCGACCACTCTCTGATTCCGGAGGAGAGGCTCTCGCCCACCCCATCCATG CAGGATGGGCTCGACCTGCCCAGTGAGACGGACTTACGCATCCTGGGCTGCGAGCTCATCCAGGCCGCCG GCATTCTCCTCCGGCTGCCGCAGGTGGCGATGGCAACGGGGCAGGTGTTGTTTCATCGTTTTTTCTACTC CAAATCTTTCGTCAAACACAGTTTCGAGATTGTTGCTATGGCTTGTATTAATCTTGCATCAAAAATCGAA GAAGCACCTAGAAGAATAAGAGATGTGATTAATGTATTCCACCACCTCCGCCAGTTAAGAGGAAAAAGGA CTCCAAGCCCCCTGATCCTTGATCAGAACTACATTAACACCAAAAATCAAGTTATCAAAGCAGAGAGGAG GGTGCTAAAGGAGTTGGGATTTTGTGTTCATGTCAAGCATCCTCATAAGATCATTGTTATGTATTTACAA GTCTTAGAATGTGAACGTAATCAAACCCTGGTTCAAACTGCCTGGAATTACATGAATGACAGTCTTCGAA CCAATGTGTTTGTTCGATTTCAACCAGAGACTATAGCATGTGCTTGCATCTACCTTGCAGCTAGAGCACT TCAGATTCCGTTGCCAACTCGTCCCCATTGGTTTCTTCTTTTTGGTACTACAGAAGAGGAAATCCAGGAA ATCTGCATAGAAACACTTAGGCTTTATACCAGAAAAAAGCCAAACTATGAATTACTGGAAAAAGAAGTAG AAAAAAGAAAAGTAGCCTTACAAGAAGCCAAATTAAAAGCAAAGGGATTGAATCCGGATGGAACTCCAGC
    [Show full text]
  • Epigenome-Wide Study Identified Methylation Sites Associated With
    nutrients Article Epigenome-Wide Study Identified Methylation Sites Associated with the Risk of Obesity Majid Nikpay 1,*, Sepehr Ravati 2, Robert Dent 3 and Ruth McPherson 1,4,* 1 Ruddy Canadian Cardiovascular Genetics Centre, University of Ottawa Heart Institute, 40 Ruskin St–H4208, Ottawa, ON K1Y 4W7, Canada 2 Plastenor Technologies Company, Montreal, QC H2P 2G4, Canada; [email protected] 3 Department of Medicine, Division of Endocrinology, University of Ottawa, the Ottawa Hospital, Ottawa, ON K1Y 4E9, Canada; [email protected] 4 Atherogenomics Laboratory, University of Ottawa Heart Institute, Ottawa, ON K1Y 4W7, Canada * Correspondence: [email protected] (M.N.); [email protected] (R.M.) Abstract: Here, we performed a genome-wide search for methylation sites that contribute to the risk of obesity. We integrated methylation quantitative trait locus (mQTL) data with BMI GWAS information through a SNP-based multiomics approach to identify genomic regions where mQTLs for a methylation site co-localize with obesity risk SNPs. We then tested whether the identified site contributed to BMI through Mendelian randomization. We identified multiple methylation sites causally contributing to the risk of obesity. We validated these findings through a replication stage. By integrating expression quantitative trait locus (eQTL) data, we noted that lower methylation at cg21178254 site upstream of CCNL1 contributes to obesity by increasing the expression of this gene. Higher methylation at cg02814054 increases the risk of obesity by lowering the expression of MAST3, whereas lower methylation at cg06028605 contributes to obesity by decreasing the expression of SLC5A11. Finally, we noted that rare variants within 2p23.3 impact obesity by making the cg01884057 Citation: Nikpay, M.; Ravati, S.; Dent, R.; McPherson, R.
    [Show full text]
  • Supplementary Table S2
    1-high in cerebrotropic Gene P-value patients Definition BCHE 2.00E-04 1 Butyrylcholinesterase PLCB2 2.00E-04 -1 Phospholipase C, beta 2 SF3B1 2.00E-04 -1 Splicing factor 3b, subunit 1 BCHE 0.00022 1 Butyrylcholinesterase ZNF721 0.00028 -1 Zinc finger protein 721 GNAI1 0.00044 1 Guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1 GNAI1 0.00049 1 Guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1 PDE1B 0.00069 -1 Phosphodiesterase 1B, calmodulin-dependent MCOLN2 0.00085 -1 Mucolipin 2 PGCP 0.00116 1 Plasma glutamate carboxypeptidase TMX4 0.00116 1 Thioredoxin-related transmembrane protein 4 C10orf11 0.00142 1 Chromosome 10 open reading frame 11 TRIM14 0.00156 -1 Tripartite motif-containing 14 APOBEC3D 0.00173 -1 Apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3D ANXA6 0.00185 -1 Annexin A6 NOS3 0.00209 -1 Nitric oxide synthase 3 SELI 0.00209 -1 Selenoprotein I NYNRIN 0.0023 -1 NYN domain and retroviral integrase containing ANKFY1 0.00253 -1 Ankyrin repeat and FYVE domain containing 1 APOBEC3F 0.00278 -1 Apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3F EBI2 0.00278 -1 Epstein-Barr virus induced gene 2 ETHE1 0.00278 1 Ethylmalonic encephalopathy 1 PDE7A 0.00278 -1 Phosphodiesterase 7A HLA-DOA 0.00305 -1 Major histocompatibility complex, class II, DO alpha SOX13 0.00305 1 SRY (sex determining region Y)-box 13 ABHD2 3.34E-03 1 Abhydrolase domain containing 2 MOCS2 0.00334 1 Molybdenum cofactor synthesis 2 TTLL6 0.00365 -1 Tubulin tyrosine ligase-like family, member 6 SHANK3 0.00394 -1 SH3 and multiple ankyrin repeat domains 3 ADCY4 0.004 -1 Adenylate cyclase 4 CD3D 0.004 -1 CD3d molecule, delta (CD3-TCR complex) (CD3D), transcript variant 1, mRNA.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]