Iowa State University Capstones, Theses and Retrospective Theses and Dissertations Dissertations
1996 The at xonomy and phylogeny of the mycangial fungi from Dendroctonus brevicomis and D frontalis (Coleoptera: Scolytidae) Portia Tang-Wung Hsiau Iowa State University
Follow this and additional works at: https://lib.dr.iastate.edu/rtd Part of the Botany Commons, and the Plant Pathology Commons
Recommended Citation Hsiau, Portia Tang-Wung, "The at xonomy and phylogeny of the mycangial fungi from Dendroctonus brevicomis and D frontalis (Coleoptera: Scolytidae) " (1996). Retrospective Theses and Dissertations. 11374. https://lib.dr.iastate.edu/rtd/11374
This Dissertation is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State University Digital Repository. It has been accepted for inclusion in Retrospective Theses and Dissertations by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected]. INFORMATION TO USERS
Hiismamisa^ has been reproduced from the microfilm master. UMI films the text directfy from the originai or copy submitted. Hius,some thesis and dissertation copies are in ^pewriter £aoe, while others may be from ai^ type of con^uter printer.
Hie quality of this RptodnctioB is dqwadcnt the gnality of the copy suiiadtted. Broken or indistinct print, colored or poor quality ilhistrations and photographs, prim bleedthrough* substandard maigins, and iinprq>er aligmnent can adversely a£fiect reproduction.
In the unlikely event that the author did not send UMI a complete manuscript and there are missing pages, these will be noted. Also, if unauthorized copyii^t material had to be removed, a note win indicate the deletion.
Ovsrsize materials (e.g., m^ drawings, diarts) are reproduced by sectioning the original, beginning at the iq>per left-hand comer and oontinuing from left to ri^ in equal secdons with small overiqK. Eadi original is also photographed in one ei^rasure and is included in reduced form at the back of the book.
I%otqgrq>hs included in Uie manuscr^ have been reproduced xerographicaliy in this copy. Hi^er quality 6" x 9" black and white photographic prints are available for any photQgnq>hs or illustrations appearing in this for an additional chaige. Contact UMI direct^ to order.
A Sell & Howell Information Company 300 North Zeeb Road. Ann Artror. Ml 48106-1346 USA 313/761-4700 800/521-0600
The taxonomy and phylogeny of the mycangial fungi from Dendroctonus brevicomis and D. frontalis (Coleoptera: Scol)rtidae)
ty
Portia Tang-Wung Hsiau
A dissertation submitted to the graduate faculty in partial fulfillment of the requirement for the degree of DOCTOR OF PHILOSOPHY
Department: Plant Pathology Major: Plant Pathology Major Professor: Tliomas C. Harrington
Iowa State University Ames, Iowa 1996
Copyright © Portia Tang-Wung Hsiau 1996. All rights reserved UNI Number: 9635324
UMIMicrofonn 9635324 Copyright 1996, by UMI Company. All rights reserved. This microform edition is protected against unauthorized copying under Title 17, United States Code.
UMI 300 North Zeeb Road Ann Arbor, Ml 48103 ii
Graduate College Iowa State University
This is to certify that the Doctoral dissertation of
Portia Tang-Wung Hsiau has met the dissertation requirement of Iowa Sate University
Signature was redacted for privacy.
Committee Member Signature was redacted for privacy.
Committee Member Signature was redacted for privacy.
Committee Membe^ Signature was redacted for privacy.
Com^fd^tee/Member Signature was redacted for privacy.
Major Professor Signature was redacted for privacy.
For the Major Department Signature was redacted for privacy.
For the Graduate College iii
DEDICATION
My great appredation is given to my major professor. Dr. Thomas C Harrington for his support, advice and direct contributions to my work. My sincere appreciation is given to my family members, especially my parents for their love and support I am sincerely grateful to Tosak Seelanan for his care and help during my stay at Ames. I would like to thank my friends, Joseph Steimel, Doug McNew, Rich Descenzo and Sharon Parker for their help and cooperation. Also, I thank Diana Six and Scott Kelley for their cooperation in providing materials. I would like to thank my committee members. Dr. Jonathan Wendel, Dr. Edward Braun, Dr. Sandy McNabb and Dr. Lois Tiffany for their assistance. I also appreciate the direct and indirect contributions of E}r. Thomas Bruns, Dr. David Hibbett, Dr. Nils Hallenberg and Dr. Meredith Blackwell. iv
TABLE OF CONTENTS
USTOFHGURES vi
LIST OF TABLES vii
ABSTRACT viii
CHARTER 1. GENERAL INTRODUCTION 1 Introduction 1 Dissertation Organization 1 Literature Review 2 Literature Cited 5
CHARTER 2. CERATOCYSTIOPSIS BREVICOMISP. NOV., A MYCANGIAL FUNGUS FROM DENDROCTONUS BREVICOMIS (COLEOPTERA:SCOLYTIDAE) 10 Abstract 10 Introduction 10 Materials and Methods 11 Results 13 Discussion 17 Acknowledgment 19 Literature Cited 19
CHAPTERS. PHYLOGENY OF BASIDIOMYCETES ASSOCIATED WITH BARK AND AMBROSIA BEETLES (COLEOPTERA: SCOLYTIDAE) 40 Abstract 40 V
Introduction 40 Materials and Methods 43
Results 45 Discussion 48 Acknowledgment 51 Literature Cited 51
CHARTER 4. DERIVATION OF A CLADE OF BARK BEETLE ASSOCIATED FUNGI FROM PENIOPHORA, A GENUS OF WOOD DECAYING BASIDIOMYCETES 60 Abstract 60 Introduction 61 Materials and Methods 62 Results 64 Discussion 68 Acknowledgment 72 Literature Cited 72
CHAPTER 5. GENERAL CONCLUSIONS 81 General Discussion 81 Literatiu-e Cited 82
APPENDDCA. AUGNED MT-SSU-RDNA SEQUENCES 84
APPENDIX B. AUGNED ITS SEQUENCES 92
APPENDIX C. AUGNED IGS SEQUENCES 96 vi
USTOFnGURES
Figs. 1-6. Anamorph of Ceratocystiopsis brevicomi. 1. Hyphae. 2. Conidia. 3-6. Conidia and conidiophores. 35
Figs. 7-13. Teieomorph of Ceratocystiopsis brevicomi. 7. Perithecial production (arrow) from the pairing of isolates C420 x C436 on pine twig medium in 50-mm-diam Petri dish. 8. Perithecia on twig. Top view (arrow) of a perithecium showing the collar-like structure and the protruding neck. 9-10. Perithecia. 11. Asci from a smashed perithecium. 12-13. Ascospores. 12. Young ascospores; some (arrow) still in asd. 13. Mature ascospores with bulbous swelling toward one end. 37
Fig. 14. Neighbor-joining tree generated from Rogers' genetic distance based on isozyme electromorphs of Ceratocystiopsis species. 39
Fig. 15. One of the most parsimonious trees generated from mt-ssu- rDNA sequences of bark and ambrosia beetle associates and other Holobasidiomycetes. (Tree length = 1025 steps, CI = 0.628, RI = 0.716; base substitutions are shown above branches and decay indices are shown in d values below branches.) Taxa closely associated with bark or ambrosia beetles are indicated by an asterisk. 59
Fig. 16. One of 36 most parsimonious trees from the internal transcribed spacers and 5.8S rDNA sequences of Peniophora and Entomocorticium species. Tree length = 224 steps, CI = 0.665, RI = 0.670; base substitutions are shown above branches and decay indices (d value) and bootstrap values {%) are shown below branches. 79
Fig. 17. One of three most parsimonious trees from the intergenic short spacer sequences of Peniophora and Entomocorticium species. Tree length = 103 steps, CI = 0.922, RI = 0.814; base substitutions are shown above branches and decay indices (d value) and bootstrap values (%) are shown below branches. 80 vii
LIST OF TABLES
Table L Enzymes, buffer systems and staiiung procedures used in starch gel electrophoresis studies of Ceratocystiopsis species. 23
Table n. Morphological characters of Ceratocystiopsis brevicomi, C. ranaculosus and C. collifera (^m). 25
Table IE. The production of perithecia and ascospores in crosses of MAT-1 and MAT-2 isolates of Ceratocystiopsis brevicomi. 27
Table IV. The production of perithecia and ascospores in crosses between Ceratocystiopsis ranaculosus and C. brevicomi isolates. 29
Table V. Isozyme electromorphs of isolates of Ceratocystiopsis brevicomi, C. ranaculosus, C. collifera and C. minuta. 31
Table VI. Fungal isolations (number) on 1% malt extract agar from surface-sterilized prothoraxes of female Dendroctonus brevicomis collected from the Central Sierra Nevada and Santa Barbara, California. 33
Table Vn. Fungal isolations (colony forming units/beetle) on 1% malt extract agar with cycloheximide and streptomycin sulfate from ground adult Dendroctonus brevicomis females and males from the Central Sierra Nevada of California. 34
Table VIE. Isolate number, beetle associates, substrates and location of origin of isolates used for DNA sequencing. 57
Table IX. Beetle associate, tree host and location of isolates of eight Entompcorticium species used in this study. 75
Table X. Morphological characteristics and growth rate of eight Entomocorticium species and E. dendroctoni. 77 viii
ABSTRACT The mycangia of two closely related bark beetles, western pine beetle (Dendroctonus brevicomis, WPB) and southern pine beetle (D. frontalis, SPB), harbor similar fungi. Ceratocystiopsis brevicomi is described as new. It is the mycangial ascomycete of WPB and is distinct from C ranaculosus, a mycangial fungus of SPB and C. collifera, a fungus isolated &om pine tree attacked by D. valens in Mexico, based on isozyme analysis, mating tests and growth rate. Molecular phylogenetic analyses using DNA sequences of the mitochondrial small subunit rRNA (mt-ssu-rRNA) region, the internal transcribed spacers and the integenic short spacer suggested that the mycangial basidiomycetes of WPB and SPB are distinct but closely related to Entomocorticium dendroctoni, five undescribed Entomocorticium species associated with moimtain pine beetle (D. ponderosae, MPB), and the mycangial fungus of Pityoborus comatus. The data further indicate that this group of bark beetle associates is recently derived from a PeniophoraASHae ancestor. Peniophora species have wind-disseminated basidiospores, whereas Entomocorticium species do not forcibly discharge their basidiospores and rely on bark beetle dispersal. Analysis of mt-ssu-rDNA sequences further showed that the mycangial basidiomycete of D. approximatus, a close relative of SPB and WPB, was closely related to Phlebiopsis gigantea, as was an arthroconidial basidiomycete associated with MPB. Gloeocystidium ipidophilum has been found associated with the bark beetle Ips typographus on Norway spruce. Although its phylogenetic placement is not clear, its mt-ssu- rDNA sequence was close to the mushroom forming fungi Pleurotus tuberregium and Lentinula boryana. The mycangial basidiomycete of the ambrosia beetle Xyleborus dispar was foimd to be most closely related to the brown rot fungus Antrodia carbonica. Thus, the mt-ssu-rDNA data indicated ix that bark and ambrosia beetle associations have evolved at least four times in the Holobasidiomycetes. 1
CHAPTER 1. GENERAL INTRODUCTION
Introduction The purpose of this study was to identify the mycangial ascomycetes and basidiomycetes from Dendroctonus hreoicomis (western pine beetle, WPB) and D. frontalis (southern pine beetle, SPB) and to imderstand (tie phylogenetic relationships among these fungi and other bark and ambrosia beetle associates. The assodations of tree-killing bark beetles and fungi have drawn attention of entomologists and plant pathologists, but very little work has been done on the identification of the beetle-associated fungi. Hie mycangial basidiomycetes and hyphomycetes of WPB and SPB were noted more than two decades ago, but the basidiomycetes remain unidentified and there is considerable confusion on the identity of the hyphomycetes. A range of techniques were employed to characterize these taxa, including mating studies, isozyme electrophoresis, and DNA sequence analyses of a relatively conserved region (mitochondrial small subunit region of the rDNA) and relatively variable regions (the internal transcribed spacers, ITS, and the intergenic short spacer, IGS, of the nuclear rDNA).
Dissertation Organization This thesis includes three prospective manusaipts. In chapter 2, isozyme analysis and mating studies, as well as morphological comparisons, were used to identify the mycangial hyphomycete from Dendroctonus brevicomis. In chapter 3, the sequences of the mitochondrial small subunit rRNA region were used to examine the phylogenetic relationships among the mycangial fungi from the bark beetles D. approximatus, D. brevicomis, D. frontalis and Pitydborus comatus and the ambrosia beetle Xyleborus dispar, as well as basidiomycetes associated with D. ponderosae, D. 2
j^eyi and Ips typographus. In chapter 4, the fungi associated with D. brevicomis, D. frontalis, and P. comtus were compared with the fungi present in the galleries of D. jeffreyi and D. ponderosae, including Entomocorticium dendroctoni, using DNA sequences from the internal transcribed spacers and the intergenic short spacer of the rDNA regions. General conclusioiis are drawn at the end of this thesis. The aligned DNA sequences used in the analyses are provided in the appendices.
Literature Review Many fungi have adapted to insect dispersal and are commonly associated with forest insects such as bark and ambrosia beetles. The relationships among bark beetles and their associated fungi have been reviewed extensively (Beaver, 1989; Berryman, 1989; Harrington, 1993a; Harrington, 1993b; Paine et al, 1996; Whitney 1982). The bark and ambrosia beetle fungi have been demonstrated to be nutritionally beneficial to their beetle associates, detrimental to beetle development, or have little effect on the beetle brood. Some of the beetle associates have known sexual stages, which allow for classification, but many are only known by their asexual stage and are either classified as members of Deuteromycetes or have remained unnamed. Members of the ascomycetous orders Miaoascales and Ophiostomatales are often conspicuous associates of bark beetles because many are capable of causing a blue-gray stain of sapwood. However, not all blue stain is caused by these fungi. Members of Ceratocystis (Miaoascales) often cause blue stain and may be pathogenic to the tree host, but they rarely are associated with bark beetle galleries (Harrington et al, 1996). Ophiostoma, Ceratocystiopsis (Ophiostomatales) and the anamorph ganus Leptographium have sticky spores and are typically vectored by bark beetles or mites phoretic on bark beetles (Bridges and Moser, 1986; Moser et al., 1995; Harrington, 3
1988,1993a; Leach et ai,1934), but they are generally not pathogenic to the tree host (Harrington, 1993b; Owen et al., 1987; Paine et al, 1996). Although some species of the Ophiostomatales are associated with specific bark beetles, they are more commonly associated with a number of bark beetle species (Harrington, 1993b). Ceratocystiopsis ranaculosus is intimately associated with the southern pine beetle (Bridges and Perry, 1987; Harrington and Zambino, 1990) and is ttiought to have a positive influence on beetle development (Bridges, 1983). There are relatively few basidiomycetes that have been reported as associates of bark or ambrosia beetles. Among these fungi, only two are named. Entomocorticium dendroctoni (Whitney et al,1987) was isolated from walls of beetle galleries and pupal chambers of mountain pine beetle (D. ponderosae, MFB), and Gloeocystidium ipidophilum was isolated from beetle galleries oUps typographus (Siemaszko, 1939). Other basidiomycetes have been reported from the mycangia (special spore-carrying sacks in the beetle exoskeleton) of SPB and WPB, Pityoborus comtus and the ambrosia beetle Xyleborus dispar (Barras and Perry, 1972; Fumiss et al, 1987; Happ et al, 1976a, 1976b; Whitney and Cobb, 1972). An tmidentified arthroconidia-forming basidiomycete in the galleries of O. ponderosae was noted by Tsuneda et al. (1993). It appears that most of these basidiomycetes serve as food for the beetles (Bridges, 1983; Coppedge, 1995; Tsuneda et al, 1993; Whitney et al,1987). Bacteria and yeasts are commonly found in association with bark beetles (Harrington 1993a; Whitney, 1982) and some may be important in the production and interconversions of beetle pheromones (Brand et al,1975; Leufv^n et al, 1988). However, these microorganisms have not been extensively studied as bark beetle associates. The sticky spores found in the Ophiostomatales and the hydrophobic basidiospores found in Entomocorticium dendroctoni are believed to be adaptive 4 mechanisms for beetle dispersal. However, the phylogenetic relationships of the bark beetle associates and other fungi have not been studied. There are two major groups of scolytid beetles, bark beetles and ambrosia beetles. The bark beetles feed in the inner bark of trees, which is rich in nutrients. In contrast, ambrosia beetles feed in wood, which is low in nutrients, and ambrosia beedes typically carry spedHc fungi that are introduced to the xylem for feeding by the larval brood (Abrahamson and Norris, 1969; Abrahamson et al,1967; Beaver, 1989). The adult ambrosia beetles usually carry their fungi in a specialized structure called a mycangium (Happ rf al, 1976a). Only a few bark beetle species (D. brevicomis, D. frontalis, D. adjunctus Blandf., D. approximatus Dietz, and perhaps D. mexicanus Hopkins and D. vitei Wood) have well-developed mycangia with seaetory cells that are selective for the growth of certain fungal associates (Barras and Perry, 1971; Barras and Perry, 1972; Whitney and Cobb, 1972; Whitoey, 1982). The WPB and SPB are closely related (Bentz and Stock, 1986) and are each associated with four fungi. The SPB carries either Ceratocystiopsis ranacul by competing with O. minus, a blue-stain fungus that is detrimental to beetle brood development (Bridges, 1983; Bridges and Perry, 1985). The typical ambrosial type growth of the mycangial fungi found in the pupal chambers suggests that they provide nutrients for the beetles (Bridges, 1983). In addition to the mycangial fungi of SPB and WPB, Whitney et al. (1987) and Tsuneda et al. (1993) have suggested that basidiomycetes present in the pupal chambers could also be of nutritional benefit to MFB. However, the simple mycangium of MPB does not appear to sdect for spedHc fungi (Whitney and Farris, 1970), and more than one basidiomycete has been fovmd in the pupal chambers of MPB. The association between MPB and its fungi may not be as specific as that between the basidiomycetes and the Dendroctonns spedes with well-developed prothoradc mycangia. Literature Cited Abrahamson, L.P., and D.M. Norris. 1969. Symbiontic interrelationships between microbes and ambrosia beetles. IV. ambrosial fungi associated with Xyloterinus politus. J. Invertebrate Pathol. 14:381-385. Abrahamson, L.P., H.M. Chu, and D.M. Norris. 1967. Symbiotic interrelationships between microbes and ambrosia beetles, n. the organs of microbial transport and perpetuation in Trypoderdron hetulae and T. retusum (Coleoptera: Scolytidae). Entomol. Soc. Am. Ann. 63:177-180. Bentz, B.J., and M.W. Stock, 1986. Phenetic and phylogenetic relationships among ten species of Dendroctonus bark beetles (Coleoptera: Scolytidae). Ann. Entomol. Soc. Am. 79:527-534. Barras, S.J., and T.J. Perry. 1971. Gland cells and fvmgi associated with prothoradc mycangium of Dendroctonus adjunctus (Coleoptera: Scolytidae). Ann. Entomol. Soc. Am. 64:123-126. 6 Barras, SJ./ and T.J. Perry. 1972. Fungal symbionts in the prothoradc mycangiiun of Dendroctonus frontalis (Coleoptera: Scolytidae). Z. Ang. Entomol. 71:95-104. Beaver, R. A. 1989. Insect-fungus relationships in the bark and ambrosia beetles. Pp. 121-143. In: Insect-fungus interactions. Eds., N. Wilding, N. M. Collins, P. M. Hammond and J. P. Webber. Academic Press, London. Berryman A. A. 1989. Adaptive pathways in scolytid-fungus associations. Pp. 145- 159. In: Insect-fungus interaction. Eds., N. Wilding, N. M. Collins, P. M. Hammond, J. F. Webber. Academic Press, London Brand, J.M., J.W., Bracke, A.J. Markovetz, D.L Wood and L.E. Browne. 1975. Production of verbenol pheromone by a bacterium isolated from bark beetles. Nature 254:136-137. Bridges, J. R 1983. Mycangial fungi of Dendroctonus/ronte/fe (Coleoptera: Scolytidae) and their relationship to beetle population trends. Environ. Entomol. 12:858-861. Bridges, J.R., and T.J. 1985. Effects of mycangial fungi on gallery construction and distribution of bluestain in southem pine beetle-infested pine bolts. J. Entomol. Sd. 20:271-275. Bridges, J.R., and T.J. Perry. 1987. Ceratocystiopsis ranaculosus sp. nov. assodated with the southem pine beetle. Mycologia 79:630-633. Bridges, J.R., and J.C. Moser. 1986. Relationship of phoretic mites (Acari: Tarsonemidae) to the bluestaining fmigus, Ceratocystis minor, in trees infested by southem pine beetle (Coleoptera: Scolytidae). Environ. Entomol. 15:951-953. Coppedge, B.R., M.S. Frederick, and W.F. Gary. 1995. Variation in female southem pine beetle size and lipid content in relationship to fungal assodates. Can. Entomol. 127:145-153. 7 Fumiss, M.M., J.Y. Wcx), M.A. Deyrup/ and T.H. Atkinson. 1987. Prothoradc mycangivun on pine-infesting Pityoborus spp. (Coleoptera: Scolytidae). Ann. Entomoi. Soc. Am. 80:692-696. Happ, G.M., C.M. Happ, and S.J. Bairas. 1971. Fine structure of the prothoradc mycangiiun, a chamber for the culture of symbiotic fungi in the southern pine beetle, Dendroctonus frontalis. Tissue and Cell 3:291-308. Happ, G.M., C.M. Happ and S.J. Bairas. 1976a. Bark beetle-fungal symbiosis, n. Fine structure of a basidiomycetous ectosymbiont of the southern pine beetle. Can.J.Bot.54:1M9-1062. Happ, G.M., C.M. Happ, and J.R.J. French. 1976b. Ultrastructure of the mesonotal mycangium of an ambrosia beetle, Xylebonis dispar (F.) (Coleoptera: Scolytidae). Int. J. Insect Morphol. & Embryol. 5:381-391. Harrington, T. C. 1988. Leptographium spedes, their distributions, host and insect vectors. Pp. 1-39. In ;Leptographium root diseases on conifers. Eds., T. C. Harrington and F. W. Cobb, Jr. American Phytopathological Sodety Press, St. Paul, Mn. Harrington, T. C. 1993a. Biology and taxonomy of fungi assodated with bark beetles. Pp. 37-58. In: Beetle-pathogen interactions in conifer forests. Eds., R. D. Schowalter and G. M. Filip. Academic Press, New York. Harrington, T. C. 1993b. Diseases of conifers caused by spedes of Ophiostoma and Leptographium. Pp. 161-172. In: Ceratocystis and Ophiostoma: Taxonomy, Ecology, and Pathogenicity. Eds., M. J. Wingfield, K S. Seifert, and J. F. Webber. American Phytopathological Sodety Press, St. Paul, MN. Harrington, T.C. and P.J. Zambino. 1990. Ceratocystiopsis ranaculosus, not Ceratocystis minor var. barrasii, is the mycangial fvmgus of the southern pine beetle. Mycotaxon 38:103-115. 8 Ha]Tmgton,T.CJP.Steimel,MJ. Wingfield,andG.A.Kile. 1996. Isozyme variation and species delimitation in the Ceratoofstis coerulescens complex. Mycologia 88:104-113. Leach, J.G., LW. Orr and C Christensen. 1934. The interrelationships of bark beetles and blue-staining fungi in felled Norway pine timber. J. Agric Res. 49:315-341. Leufvdn, A., G. Bergstrom and E. Falsen. 1988. Oxygenated monoterpenes produced by yeasts, isolated from Ips typographus (Coleoptera: Scolytidae) and grown in phloem medium. J. Chem. Ecol. 14:353-362. Moser, J.C, T.J. Perry, J.R Bridges, and HF. Yin. 1995. Ascospore dispersal of Ceratocystiopsis ranaculosus, a mycangial fungus of the southern pine beetle. Mycologia 87:84-86. Owen, D.R., K.Q. Lindahl, Jr., D.L Wood and J.R. Parmeter, Jr. 1987. Pathogenicity of fungi isolated from Dendroctonus valens, D. brevicomis, and D. ponderosae to pine seedlings. Phytopathology 77:631-636. Paine, T.D., K.F. Raffa and T.C. Harrington. 1996. Interactions among scolytid bark beetles, their associated fungi, and live conifers. Ann. Rev. Entomol. 42: (in press). Siemaszko, W. 1939. Zespoly grzybow towarzyszacych komikom polskim. Planta Polonica 7:1-52. Tsuneda, A., S. Murakami, L. Sigler, and Y. Hiratsuka. 1993. Schizolysis of dolipore-parenthesome septa in an arthroconidial fungus associated with Dendroctonus ponderosae and in similar anamorphic fungi. Can. J. Hot. 71:1032- 1038. 9 Whitney/RS. 1982. Relationships between bark beetles and symbiotic organisms. Pp. 183-211. In: Bark beetles in North American conifers. Eds., J. B. Mitton and K. B. Sturgeon. University of Texas, Austin. Whimey, RS., and F.W. Cobb, Jr. 1972. Non-staining fungi associated with the bark beetle Dendroctonus bremcomis (Coleoptera: Scolytidae) on Pinus ponderosa. Can. J. Bot. 50:1943-1945. Whimey, RS., and S.R Farris. 1970. Maxillary mycangium in the moimtain pine beetle. Science 167:54-55. Whitney, RS., R.J. Bandoni, and F. Oberwinkler. 1987. Entomocorticium dendroctoni gen. et. sp. nov. (Basidiomycotina), a possible nutritional symbiote of the moimtain pine beetle in lodgepole pine in British Colimibia. Can.). Bot. 65:95-102. 10 CHAPTER 2. CERATOCYSTIOPSIS BREVICOMISP. NOV., A MYCANGIAL FUNGUS FROM DENDROCTONUS BREVICOMIS (COLEOPTERA; SCOLYTIDAE) A paper to be submitted to Myoologia Portia Tang-Wimg Hsiau and Iliomas C. Harrington Abstract Ceratoofstiopsis brevicomi sp. nov. is a mycangial fungus of the western pine beetle, Dendroctonus brevicomis (Coleoptera: Scolytidae). Ihe new spedes is closely related to C. ranaculosus from D. frontalis and C. collifera 6x)m D. valens but can be distinguished by the size of the peritheda and ascospores. Isozyme analysis supports the delimitation of C. brevicomi from C ranaculosus, C. collifera and C. minuta. However, C. ranaculosus is not distinguishable from C. collifera morphologically or by isozymes. The mating system of C. breoicomi is similar to that of C. ranaculosus, which is heterothallic, and peritheda are formed only in pairings between strains of opposite mating types. Key Words: Ceratocystiopsis ranaculosus, isozyme, mating type INTRODUCTION Whitney and Cobb (1972) isolated an unidentified hyphomycete from the prothoradc mycangium of female western pine beetle {Dendroctonus brevicomis LeConte, WPB) and noted that some cultures of this hyphomycete resembled the asexual stage of Ophiostoma nigrocarpum Davidson. Owen et al. (1987) and Paine and Birch (1983) conduded that the hyphomycete was the anamorph of Ophiostoma nigrocarpum. Similarly, the anamorph of 0. nigrocarpum was confused by Bridges and Perry (1987) with the h)^homycete foimd in the prothoradc mycangium of the 11 southern pine beetle (D. frontalis Zimmermann, SPB). Pairing of cultures of the h3rphomycete from the SPB resulted in development of peritheda, asd and ascospores of Ceratocystiopsis ranaculosus Perry and Bridges (Harrington and Zambino, 1990), and we had a similar result with the hyphomycete from WPB. We isolated fungi from WPB collected in Northern and Southern California in 1990 and 1991. From those isolations it was fotmd that 0. nigrocarpum was not assodated with the mycangium, but a new spedes of Ceratocystiopsis and an uiudentified basidiomycete were isolated from female beetles and surface-sterilized prothoraxes of female adults. We compared the new spedes with the morphologically similar C. ranaculosus and C. collifera. Mating studies and isozyme analysis were used to further characterize these spedes. MATERIALS AND METHODS Sixteen isolates of the new spedes were obtained from D. brevicomis collected from either the Central Sierra Nevada (isolates C420, C421, C422, C423, C429, C432, C434, C436, C437, C438 and C439) or Santa Barbara, California (C440, C441, C442, C443 and C444). The beetles were reared from bolts of naturally infested ponderosa pine. Adult beetles emerging from the bolts were sexed and either dissected or ground with glass tissue grinders. Female prothoraxes of WPB were surfaced- sterilized in modified White's solution (1 g HgCl2,6.5 g NaCl, 1.25 ml HCl, and 250 ml 95% ethanol per liter, Barras, 1972) for 1 or 2 min and rinsed twice with sterile water. The prothorax was then torn into 4 pieces and plated in 1% malt extract agar (MEA; 1% malt extract and 1.5% agar) for fungal isolation. Whole WPB females or males were ground in batches of 10 in glass grinders with 2 ml of water, and serial dilutions were plated on CSMA (1% malt extract and 1.5% agar with 200 ppm cydoheximide and 100 ppm streptomycin sulfate, Harrington, 1992). 12 The collection information for the C. ranaculosus isolates studied can be found in Harrington and Zambino (1990). One isolate of C. collifera (C710, CBS 126.89) from Mexico and two isolates of C. minuta (C112, RWD 527 and C332 collected by T. Perry from Louisiana) were also included in the isozyme analysis. Five isolates each of C. ranaculosus and of the new species were used to determine the optimal growth temperature. Two-week-old cultures from each isolate were excised with a cork borer (5 mm, size #1) from the colony margin on 2% MEA (2% malt extract and 1.5% agar). Hie mycelial plugs were transferred to the center of three 90-mm-diam, 2% MEA plates, and the plates were incubated upside down in closed plastic bags in growth chambers. Daily growth was measured at incubation temperatures ranging from 10 to 35 X! at 5 *C intervals. Mating tests, modiHed from Harrington and Zambino (1990), were conducted on pine twig medium (2% malt extract, 2% agar, and an autoclaved piece of longitudinally split section of Pinus strobus twig, with bark attached; Harrington, 1992) in 50-mm-diam Petri dishes. Plugs from 2-week-old cultures on 2% MEA were excised with a cork borer (size #1) and placed adjacent to each other. Plates were incubated at room temperature in a container, using damp paper towels to maintain high humidity, for 4 to 6 weeks and examined for peritheda and ascospores. Isozyme analyses were as described in Zambino and Harrington (1989). Fresh mycelium was vacumn-filtered to remove excess medium, and the mat of mycelium was groimd to a fine powder in liquid nitrogen. Enzyme extracts were absorbed on paper wicks and stored at -80 *C. Electrophoresis was conducted on 10% starch gels following the methods of Marty et al. (1984). Buffer systems and eletrophoresis conditions are shown in Table 1. Staining for alcohol dehydrogenase, glucosephosphate isomerase and sorbitol dehydrogenase was as desaibed by Conkle et fl/.(1982), and staining for other enzymes followed the procediu-es of Marty 13 et al (1984). Presence or absence was determined for each allele, and a distance matrix was developed using modified Rogers' (Wright 1978) genetic distance (NTSYS-pc program, Rohlf, 1990). A neighbor-joining tree was generated in Phylip 3.5 (Felsenstein, 1993). RESULTS A new species of Ceratocystiopsis was isolated ft-om whole ground female adults and prothoraxes of female western pine beetle. The new spedes was distinguished from C. ramculosus and C. coUifera by morphology and isozyme data. Ceratocystiopsis brevicomi P. T. W. Hsiau and T. C. Harrington, sp. nov. Colonia ebumea, in agaro extracto malt 40-50 mm diam. post 13 dies ad 25 "C; mycelium adpressum. Hyphae hyalinae, immersae, septatae, 1.0-7.0 ^m latae. Conidiophora hyalina, simplida, perbreve ad longae. Conidia unicellularia hyalina, plerumque obovata; parva 3.0-6.0 x 2.0-3.0 nm, granda 4.0-12.0 x 3.0-4.0 ^un. Hyphae heterothallinae. Peritheda plerumque superfidalia, interdum, immersa in agaro, atrobrunnea vel nigra ad basin, campanulata, 80-190 ^m diam.; pars superior drcumdncta per structura coUiformi; collum breve, atrobrunneimi gradle, angustatvun et pallidescens versus apicem, 20-40 [un longimi, 15-25 ^ latiun. Asd ellipsoidei vel fusiformes, evanescentes, hyalines, octosporis, 20-50 x 5- 10 (un. Ascosporae, extrusae per ostiolum in massa glutinosa, hyalinae, elongatae, imicellulares, gradles et leviter falcatae, 13-22 pn longae, 1.0-2.0 jun latae, interdum bulbiformae ad extremiun unum. Colony 40-50 mm in diam after 13 days at 25 'C on 2% malt extract agar. Mycelium aeam colored, appressed or effuse. Hyphae hyaline and branched, of 14 various width. Thin hyphae regularly septate, 1.0-3.0 [im diam, some <1.5 pmdiam, frequently fbiming coils of3045 diaxn. Thick hyphae irregularly septate, some cells slightly swollen, 3.0-7.0 jun diam (FIG. 1). On 2% malt extract agar with 0.2% yeast extract, conidiophores hyaline, simple, smooth and undifferentiated, some conidia apparently developing on the side of the hyphae directly, others on disaete conidiophores up to 60 ^m long. Conidiogenous cells proliferating sympodially but not leaving obvious denticles, producing small to laige conidia (FIGS. 2-6). Small conidia hyaline, 1-celled, flun-walled, ovoid or ellipsoidal, 3.0-6.0 x 2.0-3.0 pm. Large conidia thick-walled, oval to globose, some lemon-shaped, 4.0-12.0 x 3.0-12.0 ^m. Dark brown to black peritheda formed only when isolates of opposite mating types paired on media with pine twigs, mostly superfidal on, sometimes immersed in culture medium, base campanulate, sometimes constricted in the middle, 80-190 ^un wide (FIGS 7-10), upper part sunken with a short protuding neck surrounded by a shoulder-like or collar-like structwe. Neck dark brown, becoming lighter and tapering toward the apex, 20-40 jrni long, 15-25 )im wide. Asd evanescent, 8-spored, ellipsoidal to fusiform, 20-50 x 5-10 ^m (FIG 11). Ascospores hyaline, elongate, 1- celled, slender and slightly curved, 13-22 ^m long, 1.0-2.0 ^m wide, sometimes forming a bulbous swelling toward one end, extruded through the ostiole in a sticky mass (FIGS 12-13). HOLOTYPE: ISC 418193. ISOTYPES: ISC 418194 and 418195. All derived from pairing of Isolates of C420 and C436 from Blodgett Research Forest, EI Dorado Co., California, on Pinus ponderosa, assodated with Dendroctonus bremcomis, isolated by T. C. Harrington in 1990 and 1991, respectively. Cultures examined indude C421, C422, C423, C429, C432, C434, C437, C438, C439, C440, C441, C442, C443 and C444 from California. 15 Morphological characters of C. brevicomi, C. ranaculosus and C. collifera are given in Table n, in which we list the anamorph characters of Ceratocystis minor var. barrasii as given by Barras and Taylor (1972), the tdeomoiph diaracters of Ceratocystiopsis ranaculosus as given by Bridges and Perry (1987), and the characters of C. collifera as given by Marmolejo and Butin (1990). We were unable to locate the type specimen for C. collifera, and only one culture is available, which does not produce peritheda. We determined the anamorph and teleomorph characters of C. brevicomi and C ranaculosus firom paired cultures. Our measurements of C. ranaculosus were in the range of those given in the anamorph description of Ceratoq/stis minor var. barrasiiby Barras and Taylor (1972) and in the teleomorph description of Ceratocystiopsis ranaculosus by Bridges and Perry (1987). The teleomorph description of Ceratocystis minor var. barrasii is apparently that of O. minus, while the anamorph description of Ceratocystiopsis ranaculosus is apparently that of O. nigrocarpum (Harrington and Zambino, 1990). The anamorphs of C. brevicomi, C. ranaculosus and C. collifera are very similar, but C. brevicomi can be distinguished by its teleomorph. Although the ranges overlap, C brevicomi generally has larger peritheda and longer ascospores than C. ranaculosus and C. collifera. As illustrated by Marmolejo and Butin (1990), C. collifera has small peritheda and a relatively long neck, surrounded by a distinct collar-like structure. C. ranaculosus was reported to have peritheda of similar size but no collar like structure (Bridges and Perry, 1987). Otherwise, the morphological descriptions of C. collifera and C. ranaculosus agree dosely. The results from pairings among C. brevicomi isolates showed that it is heterothallic with two mating types (Table HI), as has been noted for C.-ranaculosus (Harrington and Zambino, 1990). Of 16 isolates of C. brevicomi examined, eight were of mating type 1 (MAT-1) and eight of mating type 2 {MAT-2). Eighty percent of the 16 pairings between isolates of opposite mating type produced peritheda and numerous ascospores. Twelve progeny from the cross between isolates C436 and C423 were recovered from a single perithedum; five MAT-1 and seven MAT-2 isolates were identified by pairing with each other and with the parent isolates. Sixty seven percent of the pairings between isolates of C ranaculosus and C. bremcomi of opposite mating type produced peritheda and relatively few ascospores (Table IV). The size of the putative hybrid peritheda, asd, and ascospores spanned the ranges of those of C. ranaculosus and C brevicmi. Although the cultural characteristics of C. brevicomi and C ramculosus were similar, the growth rate of the spedes differed significantly. The optimal growing temperature for C. ranaculosus and C. brevicomi ranged from 25-30 *C Ceratocystiopsis ranaculosus had an average daily growth of 5.32 ± 1.3 mm at 25 *C and 5.34 ± 0.9 at 30 *C, while C. brevicomi had a daily growth of 3.84 ± 0.25 mm at 25 "C and 3.84 ± 0.31 mm at 30 *C. Isozyme analysis further separated C. brevicomi from C. ranaculosus. Fifteen lod, coding for twelve enzymes, were scored for 16 isolates of C. brevicomi, 16 isolates of C. ranaculosus, one isolate of C. collifera and two isolates of C. minuta (Table V). A neighbor-joining tree was generated based on modified Rogers' genetic distance matrix (FIG 14). The 16 isolates of C ranaculosus clustered with the single isolate of C. collifera, whereas the 16 isolates of C. brevicomi dustered on another branch. The alleles of two lod (G6PD and SDH2) of the C. collifera isolate were distinct from those of C. ranaculosus, but they were shared by some of C. brevicomi isolates. Morphological aiteria did not differentiate C. ranaculosus from C. collifera, and the isozyme analyses also showed high similarity between these two spedes. C. minuta, the type spedes of Ceratocystiopsis, was used as an outgroup to root the tree. 17 These two isolates of C. minuta had very different isozyme phenotypes, indicating that one of the isolates was misidentified. Isolations from surface-sterilized, female WPB prothoraxes plated on 1% MEA are reported in Table VL Apparently, surface sterilization killed the majority of superficial propagules on the prothorax and many of the propagules in the mycangium, especially with the 2 min surface-sterilization treatment Fungi were isolated from 30-65% of WPB female prothoraxes sterilized for two minutes, but fungi were isolated from 85% of the female prothoraxes after sterilization for one minute. Ceratocystiopsis brevicomi, an unidentified basidiomycete, Ophiostorm nigrocarpum, O. minus, yeasts (including Candida species), and various molds or bacteria were isolated from the prothoraxes, but C brevicomi and the imidentified basidiomycete may have been the only mycangial inhabitants. Ceratoq/stiopsis brevicomi was only isolated from ground females, whereas, O. nigrocarpum, 0. minus, and Leptographium terebrantis were isolated from both female and male beetles (Table VU). However, the number of beetles sampled was small, and 50 colony forming imits was the minimum that could be detected by this tedmique. Thus, the quantifications are crude. DISCUSSION Ceratocystiopsis brevicomi can be distinguished from its close relatives, C. ranaculosus and C. collifera, by its larger peritheda and longer ascospores. In addition, C. ranaculosus has a faster growth rate than C. brevicomi. Hybrid peritheda apparently form when C. ranaculosus and C. brevicomi strains of opposite mating type are paired, but such peritheda produce few ascospores. Isozyme data also support the separation of C. brevicomi from C. ranaculosus and C. collifera. Although there was variation in isozyme electromorphs within C. brevicomi and C. ranaculosus. 18 we were able to identify and delimit the spedes using neighbor-joining and two- dimensional prindpal component analysis (data not shown). The oidy available isolate of C. collifera shared isozyme alleles with C. ramculosus at 13 of 15 lod. Also the size ranges of peritheda and ascospores of C. ranaculosus and C. collifera overlap. In the original description, Marmolejo and Butin (1990) illustrated the perithedum of C. collifera with a high collar-like structure surrounding the neck, but we did not observe such large collars in C. ranaculosus. No perithedal material of C. collifera is available, and Marmolejo and Butin (1990) did not compare their fungus with the earlier described C. ranaculosus. We suspect that C collifera and C. ranaculosus are the same spedes. Pairings of isolates showed that C. breoicomi and C. ranaculosus are heterothallic, which may also be the case for C. collifera. A pairing between C. collifera (C710) and C. breoicomi (C436) resulted in perithedum production but no ascospores. Pairings between C. breoicomi and C. ranaculosus also resulted in the production of few peritheda and ascospores in many cases. No peritheda resulted in the few pairings of C. collifera with C. ranaculosus. Many fungi were isolated from surface-sterilized prothoraxes of female WPB, but the high frequency of isolation of C. breoicomi relative to that of O. nigrocarpum suggests that C. brevicomi is the more likely mycangial inhabitant Moreover, the mycangium of WPB is only found in female adults, and C. brevicomi could only be isolated from female beetles. In contrast, O. nigrocarpum and other fungi tolerant of cydoheximide were isolated from both female and male beetles. Whitney and Cobb (1972) suggested that a hyphomycete was in the mycangium of WPB and that O. nigrocarpum was an external contaminant on the beetle. Harrington and Zambino (1990) and Harrington (1993a) also conduded that Ceratocystiopsis spedes are in the mycangia of SPB and WPB, and O. nigrocarpum is external to the beetles. Moser et al. 19 (1995) observed tadpole-shaped ascospores^ similar to those of C. bremcomi and C ramculosus, in sporothecae of tarsonemid mites phoretic on SPB, WPB and Ips bark beetles. Thus, mycangial transmission is not likely the only means of dispersal of C. ramculosus and C. brevicomi. Although Hausner et al. (1993) have transferred members of Ceratocystiopsis, including C collifera, C. minuta and C ranaculosus, to Ophiostoma, we prefer to recognize them as Ceratocystiopsis species. We believe that elongated ascospores and partial cycloheximide sensitivity are taxonomically informative characters and choose to place the new species in Ceratocystiopsis. Based on morphological characteristics, mating studies and isozyme analysis, we conclude that C. brevicomi is a mycangial fungus of the western pine beetle and is a close relative of C. ranaculosus and C. collifera. In the absence of perithecia, it can be distinguished from O. nigrocarpum by its conidiophores and conidia. Although Ceratocystiopsis is closely related to Ophiostoma (Harrington, 1993b; Hausner et at., 1993), we recognize these genera as distinct and place our new species within the genus with elongated ascospores, Ceratocystiopsis. ACKNOWLEDGMENTS We thank Don Dahlsten and Bill Copper for providing western pine beetle adults. Also, we gratefully acknowledge the assistance of Joe Steimel, Jonathan F. Wendel and his graduate students in isozyme analysis. LITERATURE CITED Barras, S. J. 1972. Improved White's solution for surface sterilization of pupae of Dendroctonus frontalis (Coleoptera: Scolytidae). J. Economic Entomol. 65:1504. 20 and T.J. Perry. 1972. Fungal symbionts in the prothoradc mycangium of Dendroctonus frontalis (Coleoptera: Scolytidae). Z Ang. Entomol. 71:95-104. and J.J. Taylor. 1973. Varietal Ccrafocystis minor identified ftom mycangium of Dendroctonus frontalis. Mycopath. Mycol. Applic 50:293-305. Bridges, J.R., and T.J. Perry. 1987. Ceratoq/stiopsis ranaculosus sp. noo. associated with the southern pine beetle. Mycologia 79:630-633. Conkle, M.T., P.D. Hodgekiss, L. B. Nunnally, and S. C. Hunter. 1982. Starch gd electrophoresis of conifer seeds: a laboratory manual Pp. 18. U.S. Forest Service General Technical Report PSW-64. Felsenstein, J. 1993. PHYUP (Phylogeny Inference Package) Version 3.5p. University of Washington, Seattle. Harrington, T.C. 1992. Leptographium. Pp. 129-133. In Methods for research on soilborne phytopathogenic Fungi. L. L. Singleton, J. D. Mihail and C. M. Rush. American Phytopathological Society Press, St. Paul, Minnesota. —. 1993a. Diseases of conifers caused by species of Ophiostoma and Leptographium. Pp. 161-172. In: Ceratocystis and Ophiostoma: Taxonomy, Ecology, and Pathogenicity. M. J. Wingfield, K. A. Seifert and J. F. Webber, eds. American Phytopathological Sodety Press, St. Paul, Minnesota. —. 1993b. Biology and taxonomy of fungi assodated with bark beetles. Pp. 37-58. In: Beetle-pathogen interactions in conifer forests. Eds., T. D. Schowalter and G. M. Filip. Academic Press, London. —. and P.J. Zambino. 1990. Ceratocystiopsis ranaculosus, not Ceratocystis minor vai. barrasii, is the mycangial fungus of the southern pine beetle. Mycotaxon 38:103- 115. Hausner, G., J. Reid, and G.R. Klassen. 1993. Ceratocystiopsis: a reappraisal based on molecular criteria, Mycol. Res. 97:625-633. 21 Mannolejo, J.G. and R Butin. 1990. New conifer-inhabiting spedes of Ophiostom and Ceratocystiopsis (Ascomycetes, Microascales) from Mexico. Sydowia 42:193-199. Marty, T.L., D.M. O'Malley, and R.P. Curies. 1984. A manual of starch gd electrophoresis: new microwave edition. Staff Paper #20. Pp.24. Department of Forestry, University of Wisconsin, Madison. Moser, J.C, T.J. Perry, J.R. Bridges, and H.F. Yin. 1995. Ascospore dispersal of Ceratocystiopsis ranaculosus, a mycangial fungus of the southern pine beetle. Mycologia 87:84-86. Owen, D.R., KQ. Lindahl, Jr., D.L Wood, and J.R. Parmeter, Jr. 1987. Pathogenicity of fungi isolated from Dendroctonus valens, D. brevicomis, and D. ponderosae to pine seedlings. Phytopathology 77:631-636. Rohlf,F.J. 1993. NTSYS-PC. Numerical taxonomy and multivariate analysis system, ver. 1.8. Exeter Software, Setauket, New York. Shields, C.R, T.J. Orton, and C.W. Stuber. 1983. An outline of general resource needs and procedures for the electrophoretic separation of active enzymes from plant tissue. Pp. 443-483. In: Isozymes in plant genetics and breeding, part A. Eds. S. D. Tanksley and T. J. Orton. Elsevier Science Publishers, Amsterdam, Netherlands. Whitney, H.S., and F.W. Cobb, Jr. 1972. Non-staining fimgi associated with the bark beetle Dendroctonus brevicomis (Coleoptera: Scolytidae) on Pinus ponderosa. Can. J. Bot. 50:1943-1945. Wright, S. 1980. Evolution and the genetics of populations, vol. 4. Variability within and among natural populations. University of Chicago Press. Chicago. 22 Zambino,P.J./and T.C. Harrington. 1989. Isozyme variation within and among host-spedalized varieties of Leptographium zvageneri. Mycologia 81:122-133. 23 Table 1. Enzymes, buffer systems and staining procedures used in starch gel electrophoresis of Ceratocystiopsis species. Enzyme name EC Enzyme Buffer Electromorphs number* abbreviation system^ determined Alcohol dehydrogenase 1.1.1.1 ADH E/l:l 2 Aspartate 2.6.1.1 AAT E/l:l 4 aminotransferase Diaphorase 1.8.1.4 DIAl E/l:l 2 DIA2 E/l:l 3 Fumarase 4.2.1.2 FUM E/l:l 2 Glucose-6-phosphate 1.1.1.49 G6PD E/l:l 4 dehydrogenase Giucosephosphate 5.3.1.9 GPI B/l:3 5 isomerase Glutamate 1.4.1.3 GDH B/l:3 4 dehydrogenase 24 Table L Continued. Enzyme name EC Enzyme Buffer Electromorphs number* abbreviation system^ determined Isodtrate 1.1.1.42 IDH E/l:l 3 dehydrogenase Malate dehydrogenase 1.1.1.37 MDHl B/l:3 4 MDH2 B/l:3 3 Phosphoglucomutase 5.4.2.2 PGM B/l:3 5 Phosphogluoonate 1.1.1.43 PGD E/l;l 3 dehydrogenase Sorbitol dehydrogenase 1.1.1.15 SDHl E/l:l 3 SDH2 E/l:l 4 »Nomenclature Committee of the International Union of Biochemistry (1984). b Buffer systems, electrical requirements, and references: B = pH 5.7 continuous histidine citrate system using 250 V constant voltage for 4 hr. Shields et al. (1983); E = pH 8.1 continuous morpholine citrate system using 15 W constant wattage for 6 hr, Conkle et al. (1982). Table n. Morphological characters of Ceratocystiopsis brevicomi, C ranaculosus and C. coUifera ^un). Anamorph Teleomorph Species Small Large Width of Width of Peritheda Neck Neck Asd Ascospores conidia conidia thin hyphae thick hyphae base length width Ceratoq/stiopsis 3.0^.0 X 4.0-12.0X 1.0^.0 3.0-7.0 80-190 2040 15-25 20^x 13-25X brevicomi 1.0-3.0 3.0-12.0 5-10 1-2 Ceratoq/stiopsis Z0-5.0x 4.0-12.0 x 1.0-3.0 3.0-5.0 50-110 20^ 15-25 10-30 X S-16>> ranaculosus 1.0-3.0 3.0-12.0 4-14 Ceratocystis minor 2.0-55 x 6.8-16.2 x S13 2.2-55 NA^ NA NA NA NA vaT.barrasii (from 1.5-55 1.4-10.3 Barras and Taylor, 1972) Table H. Continued. Anamorph Teleomorph Spedes Small Large Width of Width of Peritheda Neck Neck Asd Ascospores conidia conidia thin hyphae thick hyphae base length width Ceratoofstiopsis NA NA NA NA 40-150 12-60 15-25 13-17 x 9.0-15.0 x ranaculosus (from 4-6 1.0-1.5 Bridges and Perry, 1987) Ceratoofstiopsis 3.04.0 x NA 1.0-4.0 NA 60-100 2040 15-25 NA 113-15X)x collifera (from 1.0-2.0 1.0 Marmolejo and Butin, 1990) ^ Data not available. ^ Ascxjspore width not determined Table m. The production of peritheda and ascospores in crosses of MAT-1 and MAT-2 isolates of Ceratocystiopsis brevicomi. C444 C443 C439 C429 C423 C422 C421 C420 C442 C441 C440 C438 C437 C436 C434 C432 MAT-1 C432 +a + - + + - + + C434 - - + + + - + + C436 + + + + + + + + C437 - + - + + + + + C438 + + + + + - + + C440 + + - - + + + + C441 - + + + + + + + C442 - + - + + + + + MAT-2 C420 ------ C421 ------ C422 ------ C423 - _ _ _ C439 - C443 - C444 - a = peritheda and ascospores produced;= no ascospores or perithecia produced. Table IV. The production of peritheda and ascospores in crosses between Ceratocystiopsis ranaculosus and C. brevicomi isolates. C. ranaculosus C383 C381 C368 C360 C359 €341 C266 C263 C385 C342 C337 C335 C282 C264 C244 C200 C. brevicomi MAT-1 C432 +3 - + + .+- + ...-.... C434 K> C436 + + + - + + VO C437 C438 + + + + + - + + ------ C440 + - + + - + C441 + + - + + + + + C442 - + + + + + + + MAT-2 C420 + + + + + - + + C421 + + + + + + Table IV. Continued. C. ramcuJosus C383 C381 C368 C360 C359 C341 C266 C263 C385 C342 C337 C335 C282 C264 C244 C200 C. bremcomi MAT-1 C422 ------+ + + + + + + + C423 + + + + - + C429 C439 + C443 + C444 + + + + + a= peritheda and ascospores produced;= no ascospores or perithecia produced. Table V. Isozyme electromorphs of isolates of Ceratocystiopsis brevicomi, C. ranaculosus, C. coHifera and C. minuta. Species Isolates ADH AAT DlAl D1A2 FUM G6PD CP! GDH IDH MDHl MPH2 PGM PCD SDHl SDH2 C. brevicomi C420 B*BBBACBDBC B BBBB C421 BBBBABBDBC B BBBB C422,C436,C441,C443 BBBBABCDBC B CBBD C423 BBBBACCDBC B CBBD C429,C444 BBBBABCCBC B CBBD C432,C438,C442 BBBBABCCBC B CBBB C434,C437 BBACABCDBC B CBBD C439 BBBBACCCBC B CBBD C440 BBBBABCDBC B CBBB C. ranaculosus C200,C34iC381 ADBBADEBCD A CBCC C244,C264 ADBBACDBCD A CBCC C263,C266,C282, ADBBACEBCD A CBCC C335.C359,C360,C385 Table V. Continued. Species Isolates ADH AAT DlAl DIA2 FUM G6PD GPI GDH IDH MDHt MDH2 PGM PGP SDHl SDH2 C. ranaculosus C337 A D B B A C E B C D A C B C c C341 A D B B A D E B C D A B B C c C368 A D B A A D E B C D A B B c c C383 A D B B A C E B C D A C B c c C. collifera C710 ADBBABEBCD A BBCD C. minuta ai2 BCACADAAAA C EGA A a32 B A A B B A A/B'' CAB B DAAD ^ Letters represent isozyme electromorphs for each enzyme in order of decreasing anodal migration. b Two bands repsent Table VI. Fungal isolations (number) on 1% malt extract agar from surface-sterilized prothoraxes of female Dendroctonus brevicomis collected from the Central Sierra Nevada and Santa Barbara, California. Location Surface- No. of total No. of Ceratoq^t- Unidentified Ophiostoma Opkiostorm Yeasts / Molds / sterilization prothoraxes sterile iopsis basidiomycete nigrocarpum minus Candida Bacteria time (min) prothoraxes brevicomi Central 1 70 11 14 14 10 12 11 15 Sierra Nevada 2 28 20 2 0 2 111 Santa 1 10 1 51 0 116 Barbara 2 21 7 80 0 008 Table VII. Fvmgal isolations (colony forming units/beetle) on 1% malt extract agar with cycloheximide and streptomycin sulfate from ground adult Dendroctonus brevicomis females and males from the Central Sierra Nevada of California. Collection Date Beetle sex No. of beetles Ceratocystiopsis Ophwstoma Ophiostoma minus Leptogmphium brevicomi nigrocarpum terd)rantis 3 August 1990 female 8 50 100 0 50 male 10 0 2500 0 50 5 December 1990 female 10 200 500 2500 150 male 10 0 500 500 150 Fig. 1-6. Anamorph of Ceratocystiopsis brevicomi. 1. Hyphae. 2. Conidia. 3-6. Conidia and conidiophores. Figs. 7-13. Teleomorph of Ceratocystiopsis breoicomi. 7. Perithedal production (arrow) from the pairing of isolates C420 x C436 on pine twig medium in 50-mm-diam Petri dish. 8. Peritheda on twig. Top view (arrow) of a perithedum showing the collar-like structure and the protruding neck. 9-10. Peritheda. 11. Asd from a smashed perithedum. 12-13. Ascospores. 12. Young ascospores; some (arrow) still in asd. 13. Mature ascospores with bulbous swelling toward one end. 39 J-C420 012345 ^C421 C422 •C434 I a> ^C429 •Q r-|C^C432 C438 C440 tciilC439 C341 C368 C359 I -C200 I C263 C710 C. collifera C112 minuta C332 ] C. mil Fig. 14. Neighbor-joining tree generated from Rogers' genetic distance based on isozyme electromorphs of Ceratocystiopsis species. 40 CHAPTER 3. PHYLOGENY OF BASIDIOMYCETES ASSOCIATED WITH BARK AND AMBROSIA BEETLES (COLEOPTERA: SCOLYTIDAE) Portia Tang-Wung Hsiau and Hiomas C. Harrington ABSTRACT Phylogenetic analysis of mitochondrial small subimit (mt-ssu) rDNA sequences shows that there are at least four distinct groups of basidiomycetous fungi associated with the Scolytidae. Most of these fungi are not known to produce basidia or basidlospores, so their classification was heretofore unknown. Our data showed that a group of basidiomycetes present in the galleries and pupal chambers of Dendroctonus ponderosae and D. jeffreyi was found to be closely related to the mycangial basidiomycetes of D. frontalis and D. brevicomis, as were the mycangial fungus of Pityohoms cormtus and Peniophora species. A basidiomycete from the prothoradc mycangium of D. approxirmtus and a similar fungus from pupal chambers of D. ponderosae were found to be dose to Phlebiopsis gigantea. Gloeoq/stidium ipidophilum, described from the galleries of Ips typographus, was placed in the dade containing the mushroom forming Pleurotus tuberregium and Lentinula boryana. The mycangial fimgus from Xyleborus dispar was placed in the same dade as the brown rot fimgus Antrodia carbonica. We suggest that bark and ambrosia beetles assodations have evolved polyphyletically in the basidiomycetes, and co-evolution between bark beetles and their fungal assodates was not foimd. INTRODUCTION Most fungi assodated with the Scolytidae (Coleoptera) are the members of the ascomycetes (Batra, 1967; Beaver, 1989; Francke-Grosmann, 1976; Harrington, 1993a, b; Whitney, 1982), but basidiomycetes have been reported from a few genera 41 of bark and ambrosia beetles (Fumiss et al,1987; Happ et al,1976a, b; Harrington, 1993a; Whitney et al, 1987; Barras and Perry, 1972; Whitney and Cobb, 1972). The two most studied of these basidiomycetes are associated with prothoradc mycangia, which are special spore carrying sacks. These glandular mycangia line the inside of the female prothorax and have been reported in Dendroctonus adjunctus Blandfold, D. approximatus Dietz, D. breoicomis LeConte (western pine beetle, WPB), D. frontalis Zimmermann (southern pine beetle, SPB) and, perhaps, D. mexicanus Hopkins and D. vitei Wood (Barras and Perry, 1971; Francke-Grosmaim, 1966; Whitney 1982). Mycangia in these Dendroctonus spedes are believed to have a similar function as the mycangia of ambrosia beetles, that is, to carry specific nutritional symbionts into the egg galleries for subsequent feeding by the beetle brood. The basidiomycetes from two of the Dendroctonus spedes have been characterized but imnamed (Barras and Perry, 1972; Whitney and Cobb, 1972). They were dassified as basidiomycetes based on the presence of dolipore septa and clamp connections (Barras and Perry, 1972; Happ et al,1976a; Whitney and Cobb, 1972). The SPB mycangial basidiomycete has been studied extensively and is thought to have a positive influence on beetle development (Bridges, 1983; Coppedge et al, 1995). The WPB mycangial basidiomycete probably plays a similar role. We have also isolated a basidiomycete from the mycangium of D. approximatus. Only a few other basidiomycetes have been assodated with ambrosia and bark beetles. Xyleborus dispar, an ambrosia beetle, carries an ascomycete, Ambrosiella hartigii, and an unidentified basidiomycete in its mycangimn (Batra, 1967; Happ et al, 1976b). A basidiomycete assodated with the mycangiimi of the bark beetle Pityoborus comatus was reported by Fumiss et al (1987) as Holtermannia corniformis Kobayasi (Tremellales) and also thought to be the SPB mycangial basidiomycete. The monotypic genus Entomocorticium is based on E. dendroctoni Whitney et al, 42 which was found in pupal chambers and larval galleries of Dendroctonus ponderosae (mountain pine beetle, MPB) on lodgepole pine in British Columbia. This spedes was thought to be of nutritional benefit to beetle development (Whitney et al,1987). Due to the differences in growth rates and cultural morphology, Whitney et al. (1987) thought that £. dendroctoni may be closely related to Gloeocystidium ipidophilum described from Ips hfpographus in Poland by Siemaszko (1939). Tsuneda et al. (1993) described an arthroconidial fungus A'om MPB pupal chambers in lodgepole pine and suggested that this fungus could also serve as food source for MPB brood. We recently found several basidiomycetes sporulating in pupal chambers of the mountain pine beetle and the closely related Jeffrey pine beetle (D. jeffreyO in California and Colorado. Most of the above fungi do not produce basidiomes in culture, and systematic placement has proven difficult. Phylogenetic relationships among basidiomycetes have been studied using ribosomal DNA sequences (Bruns et al., 1991; Bnms et al., 1992; Bruns and Szaro, 1992; Hibbett and Vilgalys, 1993; Swann and Taylor, 1993), and we compared sequences of the bark and ambrosia beetle associates to existing data bases. Oiu* initial comparisons of the mycangial basidiomycete from D. frontalis with the 18S rDNA sequences of Swann and Taylor (1993) indicated that the mycangial species was in the Aphyllophorales. Further comparisons of mycangial fungi from D. brevicomis, D. frontalis, P. comatus, and X, dispar with the sequences of Thomas Bruns (impublished data) on the mitochondrial large subunit rRNA region (mt-lsu-rRNA) of ectomycorrhizal fimgi further indicated a link to the Aphyllophorales. Here we report sequence comparisons of the mitochondrial small subunit region (mt-ssu-rRNA) of bark and ambrosia beetle associates and with sequences of basidiomycetes in 14 families of Aphyllophorales and Agaricales (Hibbett and Donoghue, 1995). 43 MATERIALS AND METHODS Mt-ssu-rDNA sequences of 62 species of the Aphyllophorales and Agaricales were kindly provided by David Mbbett (Harvard University Herbaria, Cambridge, MA). We expanded this data set with sequences of wood decay fungi that were previously associated with forest insects or that were suspected to be closely related to bark beetle associates. Cultures of basidiomycetes were obtained from reference culture collections or were isolated by the authors (Table 1). We searched for basidiomycetes sporulating in pupal chambers of D. ponderosa in MPB-infested sugar pine (Pinus lambertiam) located in the San Bamardino Mountains of southern California, lodgepole pine (Pmus contorta var. latifolia) in the Inyo National Forest, California and ponderosa pine (.Pinus ponderosa) in Estes Park and Nederland, Colorado. Pupal chambers of Jeffrey pine beetle were also examined in Jeffrey pine (Pinus jeffreyO at Mammoth Lake, California. Cultures of these basidiomycetes were obtained by saaping white powdery or waxy fungal growth in the pupal chambers and streaking the materials on benomyl streptomycin malt extract agar (BSMA, 1% malt extract, 1.5% agar with 2 ppm benomyl powder and 100 ppm streptomycin sulfate), a selective medium for basidiomycetes, or by serially diluting the material in sterile water and plating on BSMA. Dendroctonus approximatus were collected by Scott Kelley (University of Colorado) from ponderosa pine at Durango, Colorado and frozen at -20X2. Five female prothoraxesof D. approximatus were surfaced-sterUized in modified White's solution (1 g HgCh, 6.5 g NaCl, 1.25 ml HCl, and 250 ml 95% ethanol per liter, Barras, 1972) for 30 sec and rinsed twice with sterile water. The prothorax was then torn into 4 pieces and plated on BSMA. 44 Double-Stranded DNA templates for sequencing were prepared by polymerase chain reaction (PGR) directly from mycelial scrapes (Harrington and Wingfield, 1995) using primers MSI and MS2 (White et al, 1990). DNA sequencing of each strand utilized the primers MSI and MS2 and the ABI PRISM 377 DNA sequencer and ABI PRISM 310 genetic Analyzer (Perkim-Elmer) in the DNA Sequencing Facility at Iowa State University. Sequences were aligned using CLUSTAL V (Higgins et al, 1992), followed by manual adjustments. Because the data set of Hibbett and Donoghue (1995) was large, a select number of taxa were induded for the final analysis by comparing the entire data set with the sequences of the mycangial fungi of D. frontalis, D. approximatus and Xylebonis dispar and Gloeocystidium ipidophilum from using PAUP. The sequences of the species in the major clades with the beetle associates were chosen from the data set along with those species suspected to be insect associates. In case of the presence of multiple islands, the final sequence data set was initially analyzed in PAUP using HEURISTIC searches with 100 random addition sequence replicates with only 10 trees saved at each replicate, TBR swapping with MULPAR on. All characters were given equal weight. All gaps were coded as missing data. The resulting trees were continuously searched by TBR swapping imtil completion, and all recovered trees were saved. Branch supports of individual clades using decay indices were determined with the program AUTODECAY 3.0.3 (T. Eriksson and N. Wikstrom, 1996) in conjunction with PAUP. In addition to DNA sequence analysis, the presence or absence of extracellular oxidase (Davidson et al, 1938) in certain isolates was determined on tannic add agar (1.5% malt extract, 2% agar with 0.5% tannic acid. Nobles, 1948) or gallic add agar (0.5% gallic add). 45 RESULTS Variation in mitochondrial small subunit rDNA (mt-ssu-rDNA) sequences Aligned mt-ssu-rDNA sequences are listed in Appendix A. Absolute length for sequenced taxa ranged from 489-696 bp. Hie total aligned length of this data set is 734 bp with a GC content of 31.3-39.6%. There are several major gaps in the sequences among the species due to insertions and deletions. The aligned mt-ssu- rDNA sequence can be divided into seven putative regions consisting of four relatively conserved regions and three hypervariable regions. Within relatively conserved regions, the absolute lengths of the taxa were similar and sequences were alignable, whereas, the sequence lengths of hypervariable regions varied considerably. Manual aligiunents were performed to match the highest similarity among the taxa in the hypervariable regions. Region 1, which includes base 1 to base 31, is a relatively conserved region. Region 2, which includes base 32 to base 133, is a hypervariable region ranging from 8 bp (in Gloeoqfstidium ipidophilum) to 102 bp (in the clade with Dendrophora albobadia and Peniophora species) in length. Region 3 (base 134 to base 262) is a very conserved region of 122-127 bp. Region 4 (base 263 to base 370) also is a hypervariable region ranging from 25 bp (in Heterobasidion annosum) to 104 bp (in Stereum hirsutum). Region 5 (base 371 to base 570) is another conserved region of 176-195 bp. Region 6 (base 571 to base 626) belongs to another hypervariable region ranging from 12 bp (in Phlebiopsis gigantea) to 56 bp (in Peniophora nuda) in length. The seventh region (base 627 to base 734) is the fourth conserved region of 100-105 bp. The major difference between the hypervariable and relatively conserved regions was the amoimt of indels (insertions/deletions) in the former. Excluding polymorphisms caused by gaps and missing sequences, there are 406 variable sites of 734 characters (55%) in the sequence data set. Out of 266 characters in the 46 hypervariable regions, 176 sites were variable, while 230 variable sites were found among the 468 characters in the relatively conserved regions. Only 8% of the 734 characters varied within the dade containing Dendrophora albobadia, Peniophora species and nine beetle associates. Phylogenetic analysis Heuristic searches resulted in 1200 most parsimonious trees with length of 1025 steps, a consistency index (CO of 0.628 and a retention index (RI) of 0.716. One of the shortest trees is shown in Fig 1. Most of these trees were due to minor differences in the Peniophora clade. When we kept only two beetle associates (species G and H) in the data set and excluded species A, B, C, D, E, F and Peniophora piihya, only two most parsimonious trees (length of 988, CI = 0.635 and RI = 0.643) were recovered (trees not shown). The taxa in these two trees had the topology shown in Fig. 1. Due to the great number of indels in the hypervariable regions, we also excluded all hypervariable regions from entire data set, and analyzed only the relatively conserved regions, with gaps coded as a fifth character. Only 24 trees were obtained (length of 711, CI = 0.623 and RI = 0.761), and these trees had a topology similar to those in Fig. 1. The most significant feature of the most parsimonious trees was a strongly supported, monophyletic clade (decay index 36, d36) consisting of Dendrophora albobadia, Peniophora species, the mycangial fungi from D. breoicomis, D. frontalis and P. comatus, and several fungi isolated from the pupal chambers of D. ponderosae and D. jeffreyi. Relationships among these fungi were not well resolved, and internal nodes for this "Peniophora dade" were not strongly supported by decay indices. 47 A weakly supported clade (dl) sister to the Peniophora dade consisted of Gloeocystidium ipidophilum ftx)m Ips typographus and Lmtinula boryana, which were sister to Pleurotus tuherregium (d2), an oyster mushroom (Tricholomataceae). Another dade (d3) consisted of the ambrosia fungus (sp. p from X. dispar, Antrodia carbonica and Meripilus giganteus. The ambrosia fungus had negative reactions on gallic and tannic add media, indicative of the brown rot mechanism of wood decay (Davidson et al, 1938). Antrodia carbonica and Meripilus giganteus are also brown rot fungi. The placement of this brown rot dade among the other Holobasidiomycetes is not dear. A strongly supported clade (d9) contained two imidentified bark beetle assodates, Phlebiopsis gigantea and Pulcherricium caeruleum. Placement of the mycangial fungus from D. approximatus (sp. 1) and spedes K from the pupal chambers of D. ponderosae in the Phlebiopsis gigantea subdade was very strongly supported (d20). The sequences of these three isolates were identical except three one-base indels (insertion or deletion). Oxyporus sp. was placed basal to the above four dades with bark and ambrosia beetle assodates (d2). A monophyletic dade containing Stereum hirsutum, Amylostereum chailletii and a spedes-pair, Russula compacta and Heterobasidion annosum, was placed basal to the entire tree when the tree was rooted with Hyphoderma praetermissum, a fvmctional outgroup. Extracellular oxidase Most of the tested bark and ambrosia beetle fungi, Peniophora nuda, Dendrophora albobadia, Phlebiopsis gigantea, Gloeocystidium ipidophilum and Amylostereum chailletii showed a brown diffusion zone on tannic and gallic add agar media emd are probably white rot fungi (Davidson et al, 1938). However, Xyleborus 48 dispar fungus (sp. p is probably a brown rot fungus due to lack of a brown diffusion zone on these media. DISCUSSION Phylogenetic relationships infeired A-om mt-ssu-rDNA sequences resolved the placements of the SPB and WPB mycangial fungi with the mycangial fungus Pityoborus comatus and several species from Dendroctonus ponderosa and D. jeffreyL These bark beetle associates were placed near Peniophora, a genus of wood decay fungi with wind-disseminated basidiospores. However, the relationships within the Peniophora clade were not well resolved. The identification (Fumiss et al., 1987) of the mycangial fungus from Pityoborus comatus as Hollermannia comiformis, a member of the Tremellales, appears to be in error. The cultural morphology of some of the species in the Peniophora dade resembled that of Entomocorticium dendroctoni, the type species for Entomocorticium. Species H was foimd to sporulate in the pupal chambers of D. ponderosa in ponderosa pine from Colorado, and its basidia and basidiospores were similar to those of E. dendroctoni. However, these two species were found to be distinct but closely related in another study (Chapter 4). Species G also fruited in culture and in the pupal chambers of D. ponderosae, and its basidia were similar to the other two Entomocorticium species, but it could be distinguished by its globose basidiospores. We believe that all the beetle associates in the Peniophora dade are members of Entomocorticium (Chapter 4). Entomocorticium dendroctoni was not induded in this study because there was no living culture available and we were not able to amplify the mt-ssu-rRNA region from the DNA extracted from dried field specimens (collected by Whjtney and stored at Natiu-al Resources Canada Pacific Forestry Center, Victoria, British Columbia). The genus Entomocorticium can be distinguished 49 ftom Peniophora by its short and broad sterigmata and inability to discharge basidiospores. Dendrophora can be distinguished from Peniophora based on its pigmented, thick-walled dendrohyphidia (Chamuris, 1987). The mycangial fungus of Dendroctonus approximtus (sp. D was isolated from two out of Hve beetle prothoraxes, a fairly high percentage considering that the beetles were frozen before isolation and the siuface sterilization was severe. Direct amplification of DNA extracted from whole D. approximatus using basidiomycete- spedfic primers (TTSIF and rrS4B^ Gardes and Bruns 1993) detected the presence of the DNA of species I (Kelley, Hsiau and Harrington, impublished), which further supports our contention that this fungus is intimately associated with D. approximatus. This fungus produced oidia in culture, which prompted us to compare it to another oidia-produdng basidiomycete (species K, UAMH 4919) associated with D. ponderosa (Tsuneda et al, 1993) and to the common wood decay fungus, Phlebiopsis gigantea. The 491 bp-mt-ssu-rDNA sequences for species I from D. approximatus, species K from D. ponderosa and P. gigantea differ by three one-base indels. In another analysis (not shown), the ITS (internal transcribed spacers of the rDNA) sequences of species I and P. gigantea were identical. Species I differs from P. gigantea in slower growth and having conidia and hyphae of wider diameter. We (Chapter 4) have also foimd that the mycangial fungi of D. brevicomis and D. frontalis grow slower than the non-mycangial species of Entomocorticium. When grow in culture, tiiese highly specialized mycangial fimgi tend to exhibit the ambrosia-type growth observed in beetle galleries and mycangia, and they do not show rapid mycelial growth. Gloeocystidium ipidophilum was speculated to be related to E. dendroctoni by Whitney et al. (1987) but this was not supported by the mt-ssu-rDNA sequence data. Gloeocystidium ipidophilum was placed in the poorly supported clade containing so Lentinula boryam and Pleurotus tuberregium. Some members of Gloeocystidium have been transferred to Hyphodenm (Donk, 1962; Eriksson and Ryvarden, 1975), but the mt-ssu-rDNA sequences of G. ipidophilum was quite distinct from H. praetemissum. Our cultures of Gloeocystidium ipidophilum were isolated by Halvor Soheim (1992) from Norway spruce attacked by Ips typographus, and the fungus was reported to sporulate in the galleries of this bark beetle (Siemaszko in Poland, 1938). Hie morphology of the basidium is unique and difficult to distinguish from hyphae in culture, and these may actually be conidiophores. It is not clear if I. typographus feeds on G. ipidophilum or how closely associated the beetle and fungus are. Unlike the other beetle-associated basidiomycetes, the mycangial fungus from Xyleborus dispar, species J, appears to be a brown rot fungus and may be related to the genus Antrodia. Hiis ambrosia fungus is characterized by fast growth and production of chlamydospores in culture. Perhaps these dilamydospores serve as a food source for the ambrosia beetles. Two other wood decay fungi associated with insects were included in the analysis. Heterobasidion annosum was reported to be loosely associated with scolytid beetles (Baksfii, 1952; Himes and Skelly, 1972; Hunt and Cobb, 1982). Amylostereum chailletii, is a mycangial fimgus of the woodwasp Urocerus gigas (Redfem, 1989). The mt-ssu-rDNA sequences of these two fungi suggest that they are not closely related to the bark and ambrosia beetle associates we examined. According to our phylogenetic analysis of the basidiomycetes associated with bark and ambrosia beetles, we conclude that such associations have evolved at least four times. Dendroctoms frontalis and D. brevicomis are very closely related and have mycangial ascomycetes (Chapter 2) and basidiomycetes that are also closely related. The basidiomycetes are apparently the members of Entomocorticium (Chapter 4). However, the close relative of D. brevicomis, D. approximatus (Bentz and Stock, 1986), 51 was found to be associated with a very different basidiomycete, perhaps derived from a Phldriopsis-Wme spedes. Entomocorticium dendroctoni has short and broad sterigmata and lacks forcible discharge of basidiospores, an apparent adaptation for insect dispersal. We have found up to eight odier closely related species of Entomocorticium associated with bark beetles. According to our results, Entomocorticium species are closely related to Peniophora species, and we hypothesize that Entomocorticium species were derived from a Peniophora-hke ancestor. ACKNOWLEDGMENTS We would like to thank David Hibbett for supplying the mt-ssu-rDNA sequence data, Tom Bnms for supplying the mt-lsu-rDNA sequence data, and Eric Swann for providing 18S rDNA sequence data of various basidiomycetes. We also would like to thank Diana Sbc and Scott Kelley for collecting bark beetles, and Brenda Callan at Nature Resources Canada, Pacific Forestry Center, Victoria, B. C., Canada for providing dry specimens of Entomocorticium dendroctoni. LITERATURE CITED Bakshi, 6. K 1952. OedocepMumlineatum is a comdial state of Fames annosus. Trans. Br. Mycol. Soc. 35:195. Barras, S. J. 1972. Improved White's solution for surface sterilization of pupae of Dendroctonus frontalis (Coleoptera: Scolytidae). J. Economic Entomol. 65:1504. —, and T.J. Perry. 1971. Gland cells and fungi associated with prothoradc mycangium of Dendroctonus adjunctus (Coleoptera: Scolytidae). Ann. Entomol. Soc. Am. 64:123-126. 52 —, and T. J. Perry. 1972. Fungal symbionts in the prothoradc mycangium of Dendroctonus frontalis (Coleoptera: Scolytidae). Z. Ang. EntomoL 71:95-104. Batra, L R. 1967. Ambrosia hmgi: a taxonomic revision, and nutritional studies of some spedes. Mycologia 59:976-1017. Beaver, R. A. 1989. Insect-fungus relationships in the bark and ambrosia beetles. Pp. 121-143. In: Insect-fungus interactions. Eds., N. Wilding, N. M. Collins, P. M. Hammond and J. F. Webber. Academic Press, London. Bentz, B.J., and M.W. Stock. 1986. Phenetic and phylogenetic relationships among ten species of Dendroctonus bark beetles (Coleoptera: Scolytidae). Ann. Entomol. Soc. Am. 79:527-534. Bridges, J.R., and J.C. Moser. 1986. Relationship of phoretic mites (Acari: Tarsonemidae) to the bluestaining fungus, Ceratocystis minor, in trees infested by southern pine beetle (Coleoptera: Scolytidae). Environ. Entomol. 15:951-953. Bruns, T.D., T.J. White, and J.W. Taylor. 1991. Fimgal molecular systematics. Annu. Rev. Ecol. Syst. 22:525-564. —, and T.M. Szaro. 1992. Rate and mode differences between nuclear and mitochondrial small-subimit rRNA genes in mushrooms. Mol. Biol. EvoL 9:836- 855. —, R Vilgalys, S.M. Bams, D. Gonzales, D. S. Hibbett, D. J. Lane, L. Simon, S. Stickel, T.M. Szaro, W.G. Weisburg, and M.L. Sogin. 1992. Evolutionary relationships within the fungi: analyses of nuclear small subuiut rRNA sequences. Mol. Phyl. Evol. 1:231-241. C3iamuris, G. P. 1987. Notes on stereoid fungi L the genus Dendrophora, stat. nov., and Peniophora malenconii subsp. americana, subsp. nov. ("Stereum heterosporum"). Mycotaxon. 28:543-552. 53 CoppedgC/ B.R., MS. Frederick, and W.F. Gary. 1995. Variation in f^ale southern pine beetle size and lipid content in relationship to fungal associates. Can. Entomol. 127:145-153. Davidson, R.W.,W.A. Campbell, and D.J. Blaisdell. 1938. Differentiation of wood decaying fungi by their reactions on gallic or tannic add medium. J. Agr. Research. 57:683-695. Donk,M. A. 1962. Notes on resupinate Hymenomycetes-VI. Persoonia. 2:217-238. Eriksson, J. and L. Ryvarden. 1975. The Cortickceae of North Europe. Vol. 3. Coronidum to Hyphoderma. Pp. 446-545. Fungiflora, Norway. Frandce<>rosmaim, H. 1966. liber Symbiosen von xylomycetophagenimd phloeophagen Scolytoidea mit holzbewohnenden Pilzen. Beih Mater. Org. 1: 503-522. ~. 1967. Ectosymbiosis in wood-inhabiting insects. Pp. 171-180. In: Symbiosis. VoUI, Ed., S.M. Henry. Academic Press, New York. Fumiss, M. M., J. Y. Woo, M. A. Deyrup, and T. R Atkiiison. 1987. Prothoradc mycangium on pine-infesting Pityoborus spp. (Coleoptera: Scolytidae). Ann. Entomol. Soc. Am. 80:692-696. Gardes, M., and T.D. Bruns. 1993. ITS primers with enhanced spedfidty for basidiomycetes - application to the identification of mycorrhizae and rusts. Mol. Ecol. 2:113-118. Happ, G.M., C.M. Happ and S.J. Barras. 1976a. Bark beetle-fungal symbiosis. H. Fine structure of a basidiomycetous ectosymbiont of the southern pine beetle. Can. J. Bot. 54:1049-1062. —, C.M. Happ, and J.R.J. French. 1976b. Ultrastructure of the mesonotal mycangium of an ambrosia beetle, Xyleborus dispar (F.) (Coleoptera: Scolytidae). Int. J. Insect Morphol. & Embryol. 5:381-391. 54 Harrington, T. C 1993a. Biology and taxonomy of fungi associated with bark beetles. Pp. 37-58. In: Beetle-pathogen interactions in conifer forests. Eds.,R.D. Schowalter and G. M. Filip. Academic Press, New York. —. 1993b. Diseases of conifers caused by species of PpWostoma and Leptograpftwm. 161-172. In: Ceratocystis and Ophiostoma: Taxonomy, Ecology, and Pathogenicity. Eds., M. J. Wingfield, K. S. Seifert, and J. F. Webber. American Phytopathological Society Press, St Paul, MN. —, and B.D. Wingfield. 1995. A PCR-based idenitfication method for speices of Armillaria. Mycologia 87:280-288. Hibbett, D.S., and M.J. Donoghue. 1995. Progress toward a phylogenetic classfication of the Polyporaceae through parsimony analysis of mitochondrial ribsomal DNA sequences. Can. J. Bot. 73: S853-S861. —, and R Vilgalys. 1993. Phylogenetic relationships of Lentinus (Basidiomycotina) inferred from molecular and morphological characters. Syst. Bot. 18:409-433. Higgins, D.G., A.J. Bleasby, and R. Fuchs. 199Z CLUSTAL V: improved software for multiple sequence alignment. Comput. Appl. Biosd. 8:189-191. Himes, W.E., and J.M. Skelly. 1972. An association of the black turpentine beetle, Dendroctonus terebrans, and Fomes annosus in loblolly pine. Phytopathology. 62: 670. (Abstr.) Hunt, R.S., and F.W. Cobb, JR. 1982. Potential arthropod vectors and competing fung^ of Fomes annosus in pine stximps. Can. J. Plant Pathol. 4:247-253. Nobles, M.K. 1948. Studies in forest pathology. VI. idenitification of cultures of wood-rotting fungi. Can. J. Res. 26:281-431. Redfem, D. B. 1989. The roles of the bark beetle Ips cemhrae, the woodwasp Urocerus gigas and associated fungi in dieback and death of larches. Pp. 195-204. In Insect- 55 fungus interactions. Eds., N. Wilding, N. M Collins, P. M. Hammond, and J. F. Webber. Academic Press, San Diego, California. Solheim,R 1992. FungalsuccessioninsapwoodofNorway spruce infested by the haxkheeUeIpstypographus. Eur.J.Path. 22:136-148. Siemaszko,W. 1939. Zespolygrzybowtowarzyszacychkomikompolskim. Planta Polonica 7:1-52. Swann,E.C., and J.W.Taylor. 1993. Higher taxa of basidiomycetes: an ISSrRNA perspective. Mycologia 85:923-936. Swofford, D. L 1993. PAUP: phylogenetic analysis using parsinwny, version 3.1.1 edition. Illinois Natural Ifistory Survey, Champaign. Tsimeda, A., S. Murakami, L. Sigler, and Y. Pfiratsuka. 1993. Schizolysis of dolipore-parenthesome septa in an arthroconidial fungus associated with Dendroctonus ponderosae and in similar anamorphic fungi. Can. J. Bot. 71:1032- 1038. White, T.J., T. Bnms, S. Lee, and J. Taylor. 1990. Amplification and direct sequencing of fungal ribosomalRNA genes for phylogenetics. Pp 315-322. In: PCR protocols: a guide to methods and application. Eds., M. A. Innis, D. H. Gelfand, J. J. Sninsky, and T. J. White. Academic Press, San Diego, California. Whitney, H. S. 1982. Relationships between bark beetles and symbiotic organisms. Pp. 183-211. n: Bark beetles in North American conifers: a system for the study of evolutionary biology. Eds., J. B. Milton and K. B. Sturgeon. University of Texas Press, Austin, Texas. ~, and F. W. Cobb, Jr. 1972. Non-staining fungi associated with the bark beetle Dendroctonus brevicomis (Coleoptera: Scolytidae) on Pinus ponderosa. Can. J. Bot. 50:1943-1945. 56 —, R. J. Bandoni, and F. Oberwinkler. 1987. Entomocorticium dendroctoni gen. et. sp. nov. (Basidiomycotina), a possible nutritional symbiote of the mountain pine beetle in lodgepole pine in British Columbia. Can. J. Bot. 65:95-102. Table vm. Isolate number/ beetle associates, substrates and location of origin of isolates used for DNA sequencing. Species Isolate number Associated beetle Tree host Location of oiiein Collectors Amylostereum chailletii B29 None® Larix occidentalis Oicgpn Davidson Sc R. Robertson Dendrophora albobadia B1029 (FP-101822-Sp) None Unknown Mississippi ICNakasone Gloeocystidium ipidophilum B1076 Ips typographus Picea abies Vestfold, Norway RSolhcim Hyphoderma praeUrmissum B76 None Picea rubens New Hampshire Harrington Peniophora pithya B1013 (HHB-9125-Sp) None Thuja occidentalis Michigan H. Btirdsall Phlebiopsis gigantea B115 None Picea rubens New Hampshire Haiington Sp>edes A B248 Dendroctonus frontalis Pinus sp. Texas Harrington Species B B892 D. brevicomis P. ponderosa California Hanington Species C B896 Pityoborus comatus P. ellioitii Florida J.Woo&M. Furniss SpcdesD B1040 D. ponderosae P. lambertiana California Hsiau Species E B1044 D. ponderosae P. contoria var. latifolia California Hsiau B1060 D. jeffreyi P. jeffreyi California Hsiau Species F B1048 D. ponderosae P. contorta var. latifolia California Hsiau Table Vm. Continued. Species Isolate number Associated beetle Tree host Location of oriidn Collectors SpedesG B1069 D. ponderosae P. ponderosa Colorado Hsiau SpedesH B1063 D. ponderosae P. ponderosa Colorado Hsiau Species I B1073 D. approximatus P. ponderosa Colorado Harrington Species J B267 (CBS 101.07) XyUborus dispar Unknown Unknown F.N^ Species K B1078 (UAMH 4919) D. ponderosae P. eontorta var. laiifolia Canada Tsunedartol. a Beetle association are not known for these taxa. 59 1 Species H ftom* D.jmdmsa SpeaesAfrom* D.fronbdis 2 Species B from* D.breviamis ^ Species C from* Pifyoboruscomatus Species D from* ^ D.vonderpsa Species G nbm* D.pottderosa Species E from* D.pottderosa Species E from* r w D.ponderosa Peniophorapithfa — Peniophoranuda Dendrophomalbobadia Pleurotus tuberregium Lentinuk boryam 78 CloeocustuUum* iviaopMum Pulcherridum caeruleum iromlps typographus Species I from D. approximtus* Species K from D. ponderosa* Phlebtopsis gigantea 22 I— Species J from Xyfefcorusdisjwr* 14 L!8_ ^„tfodia carbonica Meripilus giganteus Oxyporus sp. Russtda compacta Af\— Heterobttsidwn armosum Amyloslaeum dmilletii Stereum hirsuhim 81 Hyphoderm praetermissum Fig. 15. One of the most parsimonious trees generated from mt-ssu-rDNA sequences of bark and ambrosia beeue associates and other Holo- basidiomycetes. (Tree length = 1025 steps, CI = 0.628, RI = 0.716; base substitutions are shown above branches and decay indices are shown in d values below branches.) Taxa closely associated with bark or ambrosia beetles are indicated by an asterisk. 60 CHAPTER 4. DERIVATION OF A CLADE OF BARK BEETLE ASSOCIATED FUNGI FROM PENIOPHORA, A GENUS OF WOOD DECAYING BASIDIOMYCETES A paper to be submitted to Mycologia Portia Tang-Wung Hsiau and Thomas Harrington ABSTRACT In a previous study using the relatively conserved mitochondrial sequences of the small subunit rDNA, the basidiomycetes associated with the mycangia of three bark beetle species {Dendroctonus brevicomis, D. frontalis and Pityoborus cormtus) and other basidiomycetes associated with D. ponderosae were placed in a clade with species of Peniophora. To imderstand the evolutionary history of the beetle associates, phylogenetic analyses were conducted using the relatively variable regions of the nuclear rDNA, the internal transcribed spacers (ITS) and intergenic short spacer (IGS). The ITS data support our hypothesis that Entomocorticium is a monophyletic and recently derived group of bark beetle associates. Entomocorticium dendroctoni is the oiUy described species in this genus. Culture characters of eight undescribed Entomocorticium species are given, but only two of these form basidia and basidiospores in culture. Five of these new species were found to be associated with D. ponderosae, as is E. dendroctoni. The IGS data showed that E. dendroctoni and another D. ponderosae associate are in the same clade with the mycangial fungi of D. brevicomis and D. frontalis. The mycangial fungus of P. comatus and three other species associated with D. ponderosae are foimd to be sister to the £. dendroctoni clade. A species with globose basidiospores appeared to be basal to the Entomocorticium clade. Morphologically, Peniophora and Entomocorticium are similar. However, Peniophora species have wind-disseminated basidiospores and sterigmata typical for the Holobasidiomycetes. In contrast, Entomocorticium species have short and broad 61 sterigmata which are unable to forcibly discharge basidiospores. We suggest that Entomocorticium probably was derived from a Peniophora-Waz ancestor, with special adaptations for insect dispersal and for providing nutritional benefit to their vectors. INTRODUCnON Most wood decaying basidiomycetes are disseminated by wind, and only a few are noteworthy for their association with bark beetles (Coleoptera: Scolytidae). These insect-associated fungi rely on the adult beetles for dispersal to new tree hosts, where they grow in association with the developing beetle brood. Spores of these basidiomycetes must either adhere to the exoskeleton of the adult beetle, or the fungus grows within a special invagination of the adult exoskeleton, known as a mycangium. Some of the basidiomycetes associated with bark beetles have been reported to be of nutritional benefit to the beetle brood (Batra, 1967; Bridges, 1983; Coppedge et al, 1995; Tsuneda et al,1993; Whitney et al,1987). Based on our previous study of sequence analysis of the mitochondrial small subimit rRNA region (mt-ssu-rRNA, Chapter 3), up to four basidiomycete lineages have adapted to bark and ambrosia beetle associations. The mycangial fungus of Dendroctonus approximatus, a close relative of D. brevicomis LeConte (western pine beetle, WPB) and D. frontalis Zimmermann (southern pine beetle, SPB), and an arthroconidial basidiomycete (Tsimeda et al., 1993) associated with the pupal chambers of D. ponderosae Hopkins (moimtain pine beetle, MPB) were foimd to be closely related to Phlebiopsis gigantea, a common wood decaying basidiomycete. A second possible lineage is represented by Gloeocystidium ipidophilum, which was found to fruit in galleries of Ips typographus L The third lineage was represented by a brown rot fimgus isolated from the mycangivrai of the ambrosia beetle Xyleborus dispar, and this fungus was found to be related to Antrodia. The last group included 62 the mycangial fungi from D. frontalis, D. breoicomis and Pityoborus comatus Zimmermann, and several basidiomycetes from pupal chambers of D. ponderosae. These species were placed in a clade with Peniophora spedes and Dendrophora albobadia. Two of these beetle associates produced basidia and basidiospores in culture that were typical of the monotypic genus, Entomocorticium. The genus Entomocorticium is imusual among the Holobasidiomycetes in that it has short and broad sterigmata, and the basidiospores are not forcibly discharged for wind dispersal (Alexopoulos et ah, 1996; Whitney et ah, 1987). Rather, basidiospores lay on the top of collapsed basidia on the surface of the hymenium in the pupal chamber and are picked up by the adult beetle for dispersal. In order to examine the evolutionary history of this beetle-associated dade, we conducted sequence analyses of the internal transcribed spacer region (ITS, between nudear small and large subunit regions) and the intergenic short spacer (IGS, between nudear large subvmit region and 5S rRNA gene) of £. dendroctoni, related bark beetle assodates and representatives of Peniophora. MATERIALS AND METHODS Collection information of the isolates of the Entomocorticium spedes studied is fotmd in Table I. In addition, we sequenced the DNA of Peniophora spedes obtained from Forest Product Laboratory (USDA) in Madison, Wisconsin, induding P. aurantiaca (B1018, HHB-13096), P. cinerea (B1020, ME-593), P. duplex (B1022, DAOM- 31784-Sp), P. piceae (BlOlO, KJM-419-Sp), P. pithya (B1012, HHB-9125-Sp), P. pseudo- pini (B1007, FP-133550-Sp) and P. rufa (B1014, RLG-2802-Sp). We also obtained a cultvire of Dendrophora albobadia (B1029, FP-101822-Sp), a close relative of the genus Peniophora. We obtained one isolate of P. pithya (FCUG 2226) from N. Hallenberg (University of Goteborg, Sweden) and extracted DNA of P. nuda (B1006, FPL-4756) 63 from D. Hibbett (Harvard University). The species of Peniophora selected for sequencing were based on sequence similarity to the bark beetles associates, using the nSl (internal transcribed spacer 1) and the nS2 (internal transcribed spacer 2) sequence data of Hallenberg et al (1996). The internal transcribed spacers (ITS) and 5.8 S rRNA gene were amplified using the polymerase chain reaction (PGR) with primers nS5 and nS4 (White et al, 1990). The intergenic short spacer (IGS) was amplified with a new primer (PI, 5' TTG-CAG-ACG-ACT-TGA-ATG-G 3') and primer 5SRNA (5' ATC-AGA-CGG-GAT- GCG-GT 3', R. Vilgalys, Duke University). Template DNA for amplification was obtained by directly saaping mycelium as described in Harrington and Wingfield (1995), except for DNA amplification of E. dendroctoni, which used extracted DNA (Taylor and Swann 1994) from basidiospores and basidiome tissue of a dried specimen collected by K S. Whitney (Canadian Forestry Service, B.C., Canada). We used two-stage PCR amplification (Baldwin, 1992) to generate single-stranded PCR products for sequencing. Single-stranded PCR products were purified and concentrated using Microcon 100 ultrafilters (Amicon, Beverly, MA). DNA sequencing utilized sequenase 2.0, and fragment separation was conducted as described in Wendel et al. (1995). The sequencing primers ITSS, ITS3, ITS4 and ITS2 (White et al, 1990) were used for the ITS region, and 01 (Anderson and Stasovski, 1992) and PI were used for the IGS region. Sequences were aligned using CLUSTAL V (Higgins et al, 1992) followed by manual adjustments. Phylogenetic analyses were conducted using PAUP 3.1.1 (Swofford, 1993). Heuristic searches were performed with random sequence addition followed by TBR swapping with MULPAR on. Gaps were treated as missing characters. Branch supports were obtained using bootstrapping (PAUP 64 3.1.1), and determined by decay indices using AUTODECAY 3.0.3 (Eriksson and Wikstrom, 1996) in conjunction with PAUP. A large collection of isolates of the mycangial fungi of SPB and WPB were available. Thirteen SPB isolates (B17, B248, B322, B348, B408, B419, B709, B710, B711, B712, B717, B721 and B722) and ten WPB isolates (B317, B884, B885, B887, B888, B889, B892, B893, B894 and B895) were selected to cover a range of geographic distribution (Table 1). Genomic DNA was prepared as described by Lee and Taylor (1990) for PGR amplification. Primers ITS5 and ITS4 were used to amplify the ITS region, and primers CLR12 (a shortened version, Harrington and Wingfield, 1995) and 01 were used to amplify the ICS region. Polymorphisms in DNA restriction sites were examined by digesting PGR products with HindUL (Promega) following the directions supplied by the manufacture and Harrington and Wingfield (1995). Representative isolates of species of bark beetle associates were examined for their morphological characters and growth rates. Golony diameters were measiured after 8 or 26 days on MYEA plates (2% malt extract, 0.2% yeast extract and 1.5% agar) at room temperature. RESULTS The internal transcribed spacers and 5.8 S rRNA gene (ITS) Phylogenetic analyses of the ITS sequences suggest that the beetle associated fungi form a single, robust clade, closely related to but separated from Peniophora species. Aligned ITS sequences are listed in Appendix B. The ITS sequences of Entomocorticium sp. D and Entomocorticium sp. E are identical, although we observed differences in cultural morphology between these two species (Table H). Two isolates of Entomocorticium sp. F (B1048 and B1050) differ in a transition change and a one-base nucleotide indel (insertion/deletion) in their ITS sequences, and two 65 isolates of Entomocorticium sp. G (B1067 and B1068) also differ in two single-base indels. The other beetle-assodated species showed no variation in their ITS sequences, and only a representative sequence of each was used in the analyses. The total aligned region of the ITS sequence is 562 bp in length, and absolute lengths range from 545 bp to 551 bp, with a GC content of 49-52%. The absolute length of nSl ranges from 193 bp (in P. piceae) to 199 bp (in P. pithya, B1012). The absolute length of the 5.8S gene is from 157 bp (in Entomocorticium sp. F) to 159 bp (in most taxa). The absolute length of nS2 ranges from 192 bp (in P. aurantiaca and P. pseudo-pint) to 198 bp (in Entomocorticium sp. G). Excluding the polymorphisms caused by gaps, 31 % of the positions varied in ITSl and 30 % of the positions varied in ITS2, and 4% of the positions varied in the 5.8S gene. Phylogenetic analysis of ITS sequences 3delded 36 most parsimonious trees with a branch length of 224 steps, a consistency index of 0.665, and a retention index of 0.670. One of the most parsimonious trees is shown in Fig. 1. Dendrophora albobadia was chosen as an outgroup because it is morphologically similar to Peniophora, other than the presence of dendrohyphidia (Chamuris, 1987). The m!ost significant feature of the ITS tree was a strongly supported clade (decay index of 4, bootstrap value of 95%) that included all the beetle-associated Entomocorticium species and Peniophora pithya (FCUG 2226). The relationships among the beetle associates were not well resolved. The mycangial fungus of Dendroctonus frontalis, Entomocorticium sp. A, was placed as a sister taxon to Entomocorticium sp. H, a fungus found fruiting in the pupal chambers of D. ponderosae. All the tested isolates of Entomocorticium sp. D and sp. E had identical ITS sequences regardless of the beetle associate or tree host. Aside from P. pithya isolate 2226, the Peniophora species served as an outgroup to the Entomocorticium clade (Fig. 1). The other P. pithya isolate (B1012) was placed 66 sister to P. rufa (d3,67%). Peniophora piceae and P. pseudo-pini were placed as sister taxa, while P. nuda and P. cinerea were another species pair. Generally, the clades in Peniophora were not strongly supported. Each isolate of Entomocorticium sp. A and Entomocorticium sp. B produced a single ITS PGR product of 670 bp for the ITS spacers (including the 5.8S rRNA gene). Restriction of the ITS product with HindUl yielded two fragments of 190 and 490 bp in all of Entomocorticium sp. B isolates tested, but there was no restriction of this region with Entomocorticium sp. A isolates. The PGR product from the IGS short spacer region showed length polymorphisms between Entomocorticium sp. A and Entomocorticium sp. B species, but no variation was found within die spedes. The length of IGS product is 580 bp in all of Entomocorticium sp. A isolates but 550 bp in all of Entomocorticium sp. B isolates. The intergenic short spacer (IGS) Aligned IGS sequences are listed in Appendix C. The IGS sequences varied greatly between the Peniophora and Entomocorticium species. Three Peniophora species (P. duplex, P. nuda and P. piceae) and Dendrophora albobadia were initially included in the IGS data set. Each of these four taxa was used individually as an outgroup, but the ingroup topology was similar in each case. Of these four taxa, the ITS sequence analysis showed P. piceae to be closest to the ingroup, so it was chosen as the outgroup taxon in the final IGS analysis. The sequence variation excluding gaps was 29%. No variation in IGS sequences was found within the species analyzed. The total aligned sequence length of IGS was 333 bp, with a GC content of 48-50% and absolute lengths ranging from 284 bp to 310 bp (in Entomocorticium sp. B and Entomocorticium sp. C, respectively). 67 With P. piceae as the outgroup, four different gap-<»ding treatments were conducted prior to phylogenetic analyses of IGS data. Initially, gaps were treated as missing characters, and three most parsimonious trees were recovered (length of 103 steps, Q = 0.922, RI = 0.814). Secondly, each gap was coded as a binaiy character (presence or absence), in addition to treating the gaps as missing characters. Again, three most parsimonious trees were recovered (length of 144 steps, Q = 0.903, RI = 0.754) with topologies similar to those obtained from the previous treatment The third treatment deleted all gaps, and this resulted in two trees (length of 89 steps, Q = 0.944, RI = 0.865) with ambiguous placement of Entomocortidum sp. A, sp. B and E. dendroctoni. Lastly, the gaps were deleted and recoded as binary characters, and this resulted in 8 trees (length of 130 steps, CI = 0.915, RI = 0.784) with poor resolution of most of the Entomocortidum species. Placement of Entomocortidum species became more ambiguous when gaps were deleted, with or without coding, apparently due to loss of informative sites. In all four gap-coding treatments, Entomocortidum sp. G was basal to the rest of the Entomocortidum species. One of the three most parsimonious trees generated with the gaps treated as missing characters (without gap coding) is shown in Fig. 2. The incongruence among the three trees was mainly in the placement of E. dendroctoni and Entomocortidum sp. B. The IGS sequence of Entomocortidum sp. G varied substantially from the other Entomocortidum species and appeared to be basal to the genus (Fig. 2). As in the ITS sequences, the IGS sequences of Entomocortidum sp. D and sp. E were identical. In contrast to the ITS data, this species pair appeared to be sister to species C (decay index of 2, bootstrap value of 80%), and species F was basal to species C, D and E (dl, 69%). This subclade, consisting of Entomocortidum species having no known sexual stages, is sister to the other strongly supported (d4,91%) subclade consisting 68 of the mycangial basidiomycetes, species A and and two Entomocortidum species with ellipsoid basidiospores (£. dendroctoni and species H). Culture characteristics The culture morphology of the bark beetle associated fungi varied significantly, allowing for the delimitation of eight undesaibed species (Table D). The culture morphology of the SPB and WPB mycangial basidiomycetes (sp. A and sp. B) differed strongly. The coloiues of isolates of Entomocortidum sp. B were brown to light gray-brown and velvety to crustose, with radially striate grooves on MYEA, and their colony diameters were oiUy 19-27 mm after 26 days. Isolates of Entomocortidum sp. A were brown and velvety on MYEA, and reached diameters of 67-75 mm after 26 days. The morphology of Entomocortidum sp. D and sp. E differed in mycelial pigmentation and texture. The isolates of Entomocortidum sp. D from sugar pine iPinus lambertiana) were originally downy and aeamy white but became brown after several weeks. The isolates fi'om P. jeffreyi and P. contorta var. latifolia (sp. E) were velvety to farinaceous and more reddish-brown than those from Pinus lambertiana. However, the growth rates of Entomocortidum sp. D and sp. E were similar, and their ITS and IGS sequences were identical. DISCUSSION The data suggest that the clade of bark beetle associates are derived from Peniophora, a genus of wood decay fungi \ 'i Ji wind-disseminated basidiospores. Apparently, these Entomocortidum species produce basidia and basidiospores or ambrosial growth in the pupal chambers for acquisition by the young adult beetles. The genus Entomocortidum can be distinguished from Peniophora by its short and 69 broad sterigmata, which do not forcibly discharge basidiospores. The basidiospores of the Entmocorticium species, where known, are thick-walled and ellipsoid or globose and can adhere to the beetle cuticle because of their hydrophobic nature (Whitney et aU, 1987). Otherwise Entomocorticium and Peniophora are morphologically similar, including their similar cystidia. Spacer regions of rDNA sequences usually are more useful than protein coding DNA sequences for estimating relationships at lower taxonomic levels because they contain more informative sites (Suh et al,1993). The ITS resolved most of the relationships among the Peniophora but failed to resolve relationships among the Entomocorticium species. The relationships seen among the Peniophora species generally agree with the phylogenetic studies of Hallenberg et al. (1996), except for P. rufa. Peniophora rufii appeared to be basal in the ITS2 tree of Hallenberg et al. (1996), but it was shown to be more derived than most of the Peniophora spedes in our study. The ITS data placed £. dendroctoni and species B, C, A and H in the same subdade, but placement of the other beetle assodates was not well resolved. Entomocorticium sp. A and sp. H were strongly supported to be sister taxa. In contrast to the Peniophora dade (Fig. 1), the short ITS branch lengths within the Entomocorticium group suggest that the bark beetle assodates are probably recently derived. Although the ITS data did not clearly resolve relationships among the Entomocorticium spedes, the IGS sequence analysis resulted in better resolution. The IGS data showed that Entomocorticium sp. G, witti globose basidiospores, was basal to the rest of Entomocorticium spedes. Entomocorticium sp. H and E. dendroctoni, which have ellipsoid basidiospores, were in the same subdade with the mycangial basidiomycetes of SPB and WPB (spedes A and B, respectively). The most 70 significant disagreement between the ITS and IGS analyses was in the placement of the mycangial fungus of Pityoborus cormtus (species C), which was placed in the E. dendroctoni dade by ITS analysis but was placed sister to species D and E by IGS analysis. Although the morphological comparison between E, dendroctoni and Entomocorticium sp. H showed overlapping size ranges in their basidiospores, the ITS and IGS sequences showed that they differ. No pure culture of £. dendroctoni was available, so we amplified DNA extracted from a dried specimen. It is possible that the DNA amplified and sequenced was that of another Entomocorticium species. However, morphological characters of the specimen fit the description of E. dendroctoni Whitney et al (1987). Both ns and IGS analyses support our contention that the Entomocorticium clade is relatively yoimg, monophyletic and sister to the Peniophora dade. However, an isolate of P. pithya (FCUG 2226 from Piceae abies in Turkey by J. Eriksson), was placed in the Entomocorticium clade by the ITS data, imlike the other tested isolate of P. pithya (B1012). Isolate 2226 was basal to the Entomocorticium dade based on ITS sequence analysis. We were unable to amplify the IGS region for this isolate. One of the two P. pithya isolates appears to have been misidentified. The genus Entomocorticium is unusual among the Holobasidiomycetes in its inability to discharge its basidiospores, an apparent adaptation for insect dispersal. The beetle assodates apparently acquire spores of Entomocorticium from the pupal chambers and introduce the spores to a new tree host diuing beetle attack. These basidiospores also appear to serve as a food source for the beetles (Whitney et al, 1987), and the mycangial fungus of the SPB and WPB {Entomocorticium sp. A and sp. B respectively) produce swollen hyphal cells in the pupal chambers for feeding by the beetles. At least three of the Entomocorticium spedes have been assodated with 71 mycangia and apparently grow inside these highly-specialized structures. Basidiospores have not been observed in these mycangial spedes, so the ambrosial- like growth in the pupal chambers may be suitable material for entrance to the mycangiuRL These mycangial species also grow slower than the other Entomocorticium spedes, perhaps indicative of their more specialized habitat. The mycangium of D. ponderosae does not select for the grow& of specific fimgi (Whitney and Farris, 1970). There are at least sbc Entomocorticium species, an arthroconidial basidiomycetes, and two Ophiostoma species (O. clavigerum and 0. montium that are fed upon by D. ponderosae (Chapter 3; Tsimeda et al,1993; Whitney et al, 1987; Whitney and Farris, 1970). Thus, D. ponderosae does not appear to associate with specific fungi, in contrast to D. frontalis and D. brevicomis. Otu: initial hypothesis of co-evolution of bark beetles and the Entomocorticium species was not supported by our data. The Entomocorticium species have been found associated with bark beetles in both Dendroctonus and Pityoborus. Although SPB and WPS are closely related and have closely related mycangial ascomycetes ( Chapter 2) and basidiomycetes, their close relative, D. approximatus (Bentz and Stock, 1986), carries an imrelated basidiomycete in its mycangium (Chapter 3). The basidiomycete from D. approximatus is related to Phlebiopsis gigantea, as is an arthroconidial basidiomycete (Tsuneda et al., 1993) associated with D. ponderosae. The genus Entomocorticium appears to have arisen as a monophyletic group of bark beetle associates, but recent radiation of species may have occurred after the genera of bark beetles developed. Other basidiomycetes have evolved similar and perhaps competing associations with Dendroctonus spedes. 72 ACKNOWLEDGMENTS We would like to thank Jonathan F. Wendel and Tosak Seelanan for help with DNA sequencing techniques and phylogenetic analyses. Also many thanks to Nils Hallenberg for providing ITSl and ITS2 sequence data of Peniophora spedes, and providing P. pithya culture. We also would like to thank Diana Six for collecting tree material infested with D. ponderosae. Also the cooperation of Karen Nakasone and Cindy R. Bergman of Fbrest Product Laboratory (USDA) in Madison, Wisconsin is greatly appreciated for providing Peniophora and Dendrophora cultures. LITERATURE CITED Alexopoulos, C.J., C.W. Mims and M. Blackwell. 1996. Introductory Mycology. Pp. 339-342. JohnWiley& Sons, Inc. New York. Anderson, J.B., and E. Stasovaski. 1991 Molecular phytogeny of Northern Hemisphere species of Armillaria. Mycologia 84:502-516. Baldwin, B. G. 1992. Phylogenetic utility of the internal transcribed spacers of nuclear ribosomal DNA in plants; an example from the Compositae. Mol. Phyl. and Evol. 1:3-16. Batra, L. R. 1967. Ambrosia fungi: A taxonomic revision, and nutritional studies of some spedes. Mycologia 59:976-1017. Bridges, J. R. 1983. Mycangial fungi of Dendroctonus frontalis (Coleoptera: Scolytidae) and their relationship to beetle population trends. Environ. Entomol. 12:858-861. Chamuris, G. P. 1987. Notes on stereoid fimgi I. the genus Dendrophora, stat. nov., and Peniophora malenconii subsp. americana, subsp. nov. ("Stereum heterosporum"). Mycotaxon. 28:543-552. Coppedge, B.R., M.S. Frederick, and W.F. Gary. 1995. Variation in female southern pine beetle size and lipid content in relationship to fungal associates. Can. Entomol. 127:145-153. Eriksson, J., K l^ortstam and L. Ryvarden. 1978. The Corticiaceae of North Europe. Vol. 5. Mycoadella to Phanerochaete. Pp. 963-964. Fungiflora, Norway. Hallenberg, N., E. Larsson, and M. Mahlapuu. 1996. Phylogenetic studies in Peniophora. Mycol. Res. 100:179-187. Harrington, T.C., and B.D. Wingfield. 1995. A PCR-based identification method for species of Armillaria. Mycologia. 87:280-288. Higgins, D.G., A.J. Bleasby, and R. Fuchs. 1992. CLUSTAL V: improved software for multiple sequence alignment. Comput Appl. Biosd. 8:189-191. Lee, S.B. and J.W. Taylor. 1990. Isolation of DNA from fungal mycelia and single spores. Pp. 282-287. In: PCR protocols: a guide to methods and application. Eds., M. A. Innis, D. H. Gelfand, J. J. Sninsky, and T. J. White. Academic Press, Inc., San Diego, California. Suh, Y., L.B. Thien, H.E. Reeve, and E.A. Zimmer. 1993. Molecular evolution and phylogenetic implications of internal transcribed spacer sequences of ribosomal DNA in Winteraceae. Am. J. Bot. 80:1042-1055. Swofford, D. L. 1993. PAUP: phylogenetic analysis using parsimony, version 3.1.1 edition. Illinois Nature History Survey, Champaign. Taylor, J.W., and E.C. Swann. 1994, Dried samples: soft tissues 11. DNA from herbarium specimens. Pp. 166-181. In: Ancient DNA: recovery and analysis of genetic materiaifrom paleontological, archaeological, museum, medical, and forensic specimens. Eds B. Herrmann and S. Hummel. Springer-Verlag, New York. Tsimeda, A., S. Murakami, L. Sigler, and Y. Hiratsuka. 1993. Schizolysis of dolipore-parenthesome septa in an arthroconidial fungus assodated with 74 Dendroctonus ponderosae and in similar anamorphic fungi. Can. J. Bot. 71:1032- 1038. Wendel, J.F., A. Sdmable/and T. Seelanan. 1995. An imusual ribosomal DNA sequence from Gossypium gossypioides reveals andent, cryptic, intergenomic intFogression. Mol. Phyl. and Evol. 4:298-313. White, T.J., T. Bruns, S. Lee, and J. Taylor. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. Pp 315-322. In: PGR protocols: a guide to methods and application. Eds., M. A. Innis, D. H. Gelfand, J. J. Sninsky, and T. J. White. Academic Press, Inc., San Diego, California. Whitney, R S., and S.H. Farris. 1970. Maxillary mycangium in the mountain pine beetle. Sdence 176:54-55. —, RJ. Bandoni, and F. Oberwinkler. 1987. Entomocorticium dendroctoni gen. et. sp. nov. (Basidiomycotina), a possible nutritional symbiote of the mountain pine beetle in lodgepole pine in British Columbia. Can. J. Bot. 65:95-102. Table IX. Beetle associate, tree host and location of isolates of eight Entomocorticium species used in this study. Isolates Beetle associate Tree host Location Isolated by B248ab Dendroctonus Pinus sp. Angelina National Forest, Texas Harrington frontalis B17, B319^ D. frontalis P. Strongville, Mississippi Harrington 8322 D. frontalis P, ffffffff Crockett National Forest, Texas Harrington 83483 8408 D. frontalis P. Bude^ Mississippi Harrington 8419^ D. frontalis P. taeda Catahoula Ranger District, Harrington Louisiana 8709-8711®^ D. frontalis p. tarda South Carolina P.Zambino 8712, 8717, 8721, 8722® D. frontalis P. taeda Rapides Parish, Louisiana P.Zambino 810323 D. frontalis Pinus sp. Louisiana ICKlepzig 8317ab D. brevicomis Pinus sp. Southern California D.Owen 888431' D. brevicomis P. ponderosa Santa Barbara, California Harrington 8885, 8887-8889, 8890® D. brevicomis P. ponderosa Blodgett Research Forest, Harrington 88923b, 8893, 88943b, California B895'' Table IX. Continued. Species Isolates Beetle associate Tree host Location Isolated bv B B1035ab B1036ab D. brevicomis Pinus sp. Riverside Co., California Hsiau A B1038a*» C B896ab Pityoborus comaius P. elliottii Florida M. Fumiss D 81039^, B1040a^ BKMl^ D. ponderosae P. lambertiana San Bernardino Co., California Hsiau E 81043* D. ponderosae P. contorta var. latifolia Inyo National Forest, California Hsiau B1060® B106ia^ D. jeffreyi P. jeffreyi Mammoth Lake, California Hsiau F B1048ab BlOSO^b D. ponderosae P. contorta var. latifolia Inyo National Forest, California Hsiau BlOSiab G 81067® B1069®b D. ponderosae P. ponderosa Estes Park, Colorado Hsiau H B1063ab D. ponderoMe P. ponderosa Estes Park, Colorado Hsiau a Isolates sequenced for ITS . ^ Isolates sequenced for IGS. Table X. Morphological characteristics and growth rate of eight Entomocorlicium species and £. dendroctoni. ian5eter^^5SJw3SmS^^5!wIym^3!ol^^ (tun) (mm/8 days) (mm/26 days) A B248 NA® 17-19 67-71 velvety; brown B1032 NA 25-26 75 velvety; brown B B892 MA 15-16 25-26 velvety and cnistose with ladially striate grooves; brown to light gray-brown B1035 NA 17 19-27 velvety and cnistose with radially striate grooves; brown to light gray-brown C B896 NA 26-27 ND^ downy; creamy yellow D B1039 NA 67-70 ND downy; creamy white and striate when youn^ becoming light brown with age B1040 NA 62-65 ND downy; creamy white and striate when young, becoming light brown with age B1044 NA 62-64 ND velvety to farinaceous; creamy yellow to reddish-brown, not striate B1046 NA 71-72 ND velvety to farinaceous; creamy yellow to reddish-brown, not striate Table X. Continued. Spedes Isolate Number Basidiospore size Colony Diameter ulony Diameter Colony Morphology Oim) (mm/Bdavs) (mm/26 days) E B1060 NA 66 ND velvety to feirinaceous; creamy yellow to dark reddish-brown, not striate B1061 NA 64 ND velvety to forinaceous; creamy yellow to dark reddish-brown, not striate F B1048 NA 31-36 ND velvety with patches of aerial mycelium and azonate to zonate; brown B1050 NA 21-24 ND velvety with patches of aerial mycdium and azonate to zonate; brown G B1067 6.0-9.0 X 4.0^.0 42-50 ND downy and later becoming chamois-like; pinkish cream to brown B1069 6.0-9.0 X 6.0-9.0 44-49 ND downy and later becoming chamois-like; pinkish cream to brown H B1063 8.0-14.0 X 4.0-6.0 71 ND felty; creamy white E. dendroctoni^ 7..0-12.0 X 4.0-6.0 ND ND smooth surfoce; liizht tan 3 NA : basidiospores have not been observed. ^ND : Colony diameter was not determined. cThe description is based on Whitney et al., 1987. 79 21 Entomocorticium sp. G B1067 d2,91% trom D. ponderosae Entomocorticium sp. G B106 from D. ponderosae 3 Entomocorticium sp. C from Pityoborus comatus dl,51% Entomocorticium dendroctoni from D. ponderosae Entomocorticium sp.B from O. breoicomis Entomocorticium sp.H dl,79% from D. ponderosae dl, 53% d3,89% 1^ Entomocorticium sp.A from O. frontalis Entomocorticium sp.FB1048 from D. ponderosae d2,87% Entomocorticium sp.FB1050 from D. ponderosae 21 Entomocorticium sp.D d4,95% from D. ponderosae Entomocorticium sp.E from D. jeffreyi Peniophora pithya 2226 23 PenibpAoniptY^a B1012 d3,67% Peniophora rufa B10014 Peniophora pseudo-pini B1007 Peniophora piceae B1010 Peniophora nuda B1006 Peniophora cinerea B1020 dl, 83% 14 •——— Pentop/tors ouranfioca B1018 Peniophora duplex B1022 Dendrophora albobadia Fig. 16. One of 36 most parsimonious trees firom the intenial transaibed ^acer and 5.8S rDNA sequences of Peruophora and Entomocorticium species. Tree length = 224 steps, Cl = 0.665, RI = 0.670; base substitutions are shown above branches, and decay indices (d value) and bootstrap values (%) are shown below brandies. 80 J Entomocorticium sp.G from D. ponderosae Entomocorticium sp. D from D. ponderosae di, 69% Entomocorticium sp. E horn D. Jeffrey i dz, 80%—#1 dl, 61% Entomocorticium sp. C from Pitydborus comatus Entomocorticium sp. F from D. ponderosae dl, 72% 3 Entomocorticium dendroctoni from D. ponderosae 8 4 Entomocorticium sp. B d4,91% from D. brevicomis 5 Entomocorticium sp. H from D. ponderosae di,5i% J Entomocorticium sp. A from D. frontalis 55 Peniophora piceae Fig. 17. One of three most parsimonious trees from the intergenic short spacer sequences of Peniophora. and Entomocorticium species. Tree length = 103 steps, CI = 0.922, RI = 0.814. Base substitutions are shown above branches, and decay indices (d value) and bootstrap values (%) are shown below branches. 81 CHAFEER 5. GENERAL CONCLUSIONS General Discussion The mycangial hyphomycete from Dendroctonus brevicomis (western pine beetle) is described as the ascomycete Ceratocystiopsis bremcomi, which is dose to, but distinct from C. ranaculosus from D. frontalis (southern pine beetle) based on morphological characters, mating studies and isozyme analysis. Ceratoq/stiopsis collifera isolated from D. valens infested pine in Mexico by Marmolejo and Butin (1990), is foimd to be similar to C. ranaculosus and may be synonymous. Nudear libosomal DNA has proven to be a powerful phylogenetic tool because it is present in all oigaiusms with a high copy number (Hamby and 21immer, 1991). Different regions of ribosomal DNA have different rates of sequence change, and these regions can be used to examine phylogenetic questions at different taxonomic levels (Baldwin, 1992; Zimmer et al, 1989; Hamby and Zimmer, 1991). Comparison of the sequences of the mitochondrial small subimit rRNA region obtained from Hibbett and Donoghue (1995) suggests that the basidiomycetes from D. brevicomis, D. frontalis, D.jeffreyi, D. ponderosae and Pityohorus comatus are dose to the genus Peniophora. The data also suggest that the mycangial fungus from D. approximatus and the arthroconidial fungus from D. ponderosae are dosely related to Phlebiopsis gigantea, and the mycangial fungus from Xyleborus dispar is dosest to the genus Anlrodia. The relationship of Gloeocystidium ipidophilum from Ips typographus is not resolved due to lack of dosely related fungi in the data set, but its sequence placed it in the same dade with the mushroom forming Pleurotus tuberregium and Lentinula boryana. Co-evolution between bark beetles and basidiomycetes is not supported because the close relative of D. brevicomis and D. frontalis, D. approximatus, carries a mycangial fungus which is not 82 dosely related to those of the other two bark beetle spedes. Dendroctonus ponderosae assodates with at least two different groups of basidiomycetes, Entomocorticium spedes and Phlebiopsis spedes (Tsuneda et al,1993; Whitney et al, 1987). Entomocorticium spedes have been fovmd to associate with the mycangia of Dendroctonus spedes, and Pityohorus comatus. It is suggested that the basidiomycetes have evolved assodations with bark and ambrosia beetles at least four times. The sequences from the internal transcribed spacers and the intergenic short spacer of the nudear rDNA further assodate the fungi from mycangia of D. brevicomis, D. frontalis, D. ponderosae and P. comatus with the genus Entomocorticium and suggest that this group of fungi are recently derived from the genus Peniophora, a genus of wood decaying fungi with wind-disseminated basidiospores. Literature Cited Baldwin, 6. G. 1992. Phylogenetic utility of the internal transcribed spacers of nudear ribosomal DNA in plants: an example from the Compositae. Mol. Phyl. and Evol. 1:3-16. Hamby, R.K., and E.A. Zimmer. 1991. Ribosomal RNA as a phylogenetic tool in plant systematics. Pp. 50-91. In: Molecular systematics of plants. Eds., P. S. Soltis, and J. J. Doyle. Chapman and Hall, New York, New York. Hibbett, D.S., and M.J. Donoghue. 1995. Progress toward a phylogenetic dassification of the Polyporaceae through parsimony analysis of mitochondrial ribosomal DNA sequences. Can. J. Bot. 73: S853-S861. Marmolejo, J.G. and H. Butin. 1990. New conifer-inhabiting spedes of Ophiostoma and Ceratocystiopsis (Ascomycetes, Miaoascales) from Mexico. Sydowia42:193-199. 83 Tsuneda, A., S. Murakami, LSigler, and Y.Hiratsuka. 1993. Schizolysis of dolipore-parenthesome septa in an arthroconidial fungus associated with Dendroctonus ponderosae and in similar anamorphic fungi Can. J. Bot 71:1032- 1038. Whitney, H.S., R.J. Bandoni, and F. Oberwinkler. 1987. Entomocorticium dendroctoni gen. et. sp. nov. (Basidiomycotina), a possible nutritional symbiote of the mountain pine beetle in lodgepole pine in British Columbia. Can. J. Bot. 65:95-102. Zimmer, E.A., R.K. Hamby, M.L Arnold, D.A. LeBlanc, and R.C. llieriot 1989. Kibosomal RNA phylogenies and flowering plant evolution. Pp. 205-214. In: The hierarchy of life. Eds., B. Femholm, K. Bremer, and H. Jomvall. Elsevier Science, Amsterdam. 84 APPENDIX A. AUGNEDMT-SSU-RDNA SEQUENCES 10 20 30 40 SO] • • • . •] Sp«cies_H_fEom_0 ._pond«ros«a CTCGCAAGAGTGMCT-AGCTAACTGAMTCAATCTTTTTTAAGTTTTAT (49] Sped e s~B_f tonTp.Jbravt comi s CTCGCAAGAGtGAACt-AGCTAACTGAAATCAATCTTtrTTAAGTTTTAT (49] Speele«_A~from~£.~fror)Caiis CTCGCAAGAGTGAACT-AGCTAACTGAAATCAATCTTTTTTAA6TTITAT (49) Specles~C~from_Picyo. conucjs CICGCTAGTATGAACT-ACCTAACTGAAATCAATCTTTTTTAAGTriTAT (49) Specles_G~from~C._pondaro3ae ?TCGCAAGAGTGAACT-AGCTAACTGAAATCAATCTTttTTAAGTTTTAt (491 Specie s_D~£ r oiii~i).~pon 60 70 80 90 100] .1 Species_H_£Eoni_0._pondarosae TTCTAGAAAGTTACAAGG-ATTAGTTTACTAGTTTAAGrCATTTAATATA (981 Species_B~£rora~D.2i'rovico/nis TTCTATAAAGTTACAAGG-ATTAGTrrACTAGTTTAAGrCATTTAATATA (981 Species_A~from_D.3frontaiis TTCTATAAAGTTACAAGG-ATTAGTmCTAGTTTAAGTCATTTAATATA (981 Species_C~frcm~Picyo. comatas TTATATAAA6TTACAA6G-ATTAGTTTACTAGTTTAAGTTATTTAATATA (981 Species_G~froiirD._ponderosaa TTATAAAAAGTTACAAGG-ATTAGTTTACTAGTITAAGTAATTTAATATA (981 Species~D~froin_D."ponderosae TTATATGAAGTTACAAGG-ATTAGTTTACTAGTTTAAGTTATTTAATATA (981 Species~E~from~0."ponderosae TTATATAAAGTTACAAGG-ATTAGTTTACTAGTTTAAGTTATTTAATATA (981 Species~E~f rom~Bjeffreyi TTATATAAAGTTACAAGG-ATTAGTTTACTAGTTTAAGTTATTTAATATA (981 Species~F~from~ D.^ponderosae TTATAGAAAGTTACAAGGGATTAGTTTACTAGTTTAAGTTATTTAATATA (981 Peniophora_pitHya" TTATAGGAAAGTTACAAGGATTAGTTTACTAGTTTAAGTTATTTAATATA (981 Peni ophor^nuda TTCTATAAAGTTACAAGA-ATTAGTTTACTAGTTTAAGTGATTTAATAAA (981 Dendrophora_albobadia TTGTATAAAGTTACAAAA-ATTAGTTTACTAGTTTAAGTAATTCCATATA [97] Oxyporus_ap. AATGT GTCAT? (441 Species_J_from_Xyieborus_dispar TGGGCTTG-AAAT-ATTAG-TCACAAG (57) Antrodia_carbonica TGTGTGT CACAAG (461 Merlpilus_giganteus TGTGIGTCACTTGT (471 Pulcherricium_caeruleum (421 Pleurotus_tuberregiuni T GAAA-TCACATGA-CTCATTCTTATAG (681 LenCinula~boryana T AGTAACTGAA-ATCGTTTTTTTCGTGTAT- (651 Species_I~f rom_0._approximatus (311 Species_K~from~0."ponderosae (291 PhlebiopsJs giganiea (311 G1oeocysti dlum_ ipidophl1um (191 Russulajcompacia (331 Amyl ostereum_chaiHetl i (341 Heterobasldlon_annosum [341 Hyphoderma_praeterniia5ujn TAGTTGTG-TCA-ACTGTG (471 5tereufli hlrsutum ATCTAGCAAA-ACTTTGTTTGGCTA- (561 85 ( 110 120 130 140 ISO] ( •••••] Speci«s_H froa D._poiiduroa*e AATAAACAAAATAAMTAAAAAA6TAAGATAAGGTAAAGGATAATTATGA [146] Sped** B from D. bnvieomla AATAAACAAAATAAAATAAAAAAGTAAGATAAGGTAAAGGATAATTATCA [148] Species~A~from~0._frone«iis AATAAACAAAATAAAATAAAAAAGTAAGATAAGGTAAAGGATAATTATGA [148] Species C from_Pltyo. coaataa AATAAACAAAATAAAATAAAAAAGTAAGATAAGGTAAAGGATAATTATGA [148] Species~G~from D._pondero3a» AATAAACAAAATAAAATAAAAAAGTAAGATAAG6TAAAGGATAATTATGA [148] Species vTftotiTD.jponderoaae AATAAACAAAATAAAATAAAAAAGTAAGATAAGGTAAAGGATAATTATGA [148] Species~E2£ronrO-_pondarosas AATAAACAAAATAAAATAAAAAAGTAAGATAAGGTAAA6GATAATTATGA [148] Species_E_£coni 0.~ja/fr«yi AATAAACAAAATAAAATAAAAAAGTAAGATAACGTAAAGGATAATTATGA [148] Species_F from'O.'ponderosae AATAAACAAAATAAAATAAAAAAGTAAGATAAGGTAAAGGATAATTATGA [148] Panlophorl_pithy* AATAAACAAAATAAAATAAAAAAGTAAGATAAGGTAAAGGATAATTATGA [148] Peniophora nuda AATAAACAAAATAAAATAAAAAAGTAAGATAAGGTAAAGGATAATTATGA [148] Dendrophora_albobadla AATAAACCAAATAAAATAAAAAAGTAAGATAAGGTAGAGGATAATTATGA [147] Oxyporus_sp. ATTGATAACGTAAGGIAAA ATAATGA [70] Species_J_frcm_Xyiel>orus diapar AGATGTCGTAAGGGAAAATAATGA [81] Antrodla_carbonica ~ AGATGTCGTAAGGGA-AATAATGA [69] Heripilua giganteua GATAACGTAAGGGA-AATAATGA [69] Pulcherrlcium_caeruleum GAGATAAGGTAAGGGA-AATAATGA [66] PJeurotua tuberregrium GTGGTGATTGATAAGGTGTAGGGAAAAAATGA [100] Lentinula~boryana GCGGTGAAATGCGATAATGTAAAGGACAAATATCA [100] Species_I~£roiii_0._approKiniatus TTAAAAAGATAAGGTMGGGA-AATMTGA [60] Species_K from D._ponderasaa —— TTAAAAAGATAAGGTAAGGGAAAATAATGA [59] Phlebiopala gigantea TTAAAAAGATAAGGTAAGGGA-AATAATGA [60] Gloeocy3tl 160 170 180 190 200] .1 Species H_from D._ponderoaae TATTACTTTA-CTAT-AGTGITGT-CAAAAA-TTGGTGCCAGAAGACTCG [194] Species~B~from~D._brevicomi5 TATTACTTTA-CTAT-AGTGTTGT-CAAAAA-TTGGTGCCAGAAGACICG [194] Species~A~from~I>._frontaJis TATTACTTTA-CTAT-AGTGTTGT-CAAAAA-TTGGTGCCAGAAGACTCG [194] Species c_from_picyo. comaCas TATTACTTTA-CTAT-AGTGTTGT-CAAAAA-TTGGTGCCAGAAGACTCG [194] Species~G2from~D._pone(erosa8 TATTACTTTA-CTAI-AGTGTTGT-CAAAAA-TTGGTGCCAGAAGACTCG [194] Species~D_f rom~0._pondecosae TATTACTTTA-CTAT-AGTGTTGT-CAAAAA-TTGGTGCCAGAAGACTCG [194] Species~E~f rom~0 ._pondarosae TATTACTTTA-CTAT-AGTGTTGI-CAAAAA-TTGGTGCCAGAAGACTCG [194] Species~E~froni~0.~ jeffreyi TATTACTTTA-CTAT-AGTGTTGT-CAAAAA-TTGGTGCCAGAAGACrCG [194] Species~F~froiti~0._ponc(erosae TATTACTTTA-CTAT-AGTGTTGT-CAAAAA-TTGGTGCCAAAAAACTCG [194] Peni ophorajpithya' TATTACTTTA-CTAT-AGTGTTGT-CAAAAA-TTGGTGCCAGAAGACrCG [194] Peni ophor^nuda TACTACTTTA-CTAT-AGTGTTGT-CAAAAA-TTGGTGCCAGAAGACrCG [194] Dendrophora_albobadla TATTACTITA-CTAT-AGTGTTGT-CAAAAA-TTGGTGCCAGAAGACTCG [193] Oxyporus_sp. TGGTCCCTTA-CTATTAGTGTCGTCCAAATA-CTCGTGCCAGAAGACTCG [118] Species_J_from_Xyiel)orus_e(lspai: TATTACCTTA-CTAAGAGTGTCGT-CAAAAA-CTGGTGCCAGAAGACTCG [128] Antrodiajcarbonica ~ TATTACCTTA-CTAATAGTGTCGT-CAAAAA-CTGGTGCCAGAAGACTCG [116] Herlpilus_giganteua TATTACCTTA-CTATTAGTGTCGTCCAAAA—CTGGTGCCAGAAGACrCG [116] Pulcherrlcl um_caerui eum TACTACCTTA-CTATTAGTGrrGTCCAAAT—CIGGTGCCAGAAGACTCG [113] Plaurotas_tuk>erregium TATTACCTCA-CTAAAAGTGTTGTCCAAAT—CTGGTGCCAGAAGACrCG [147] Lentinula_boryana TATTA-CT-A-CTATAAGTGrTGC-CAAAT—CTGGTGCCyVGAAGACTCG [144] Species_l3from_0._approximatus TACTACCTTA-CTAT-AGTGTTGTCTAAATACCTGGTGCCAGAAGACTCG [108] Species~K_f rora_D."ponderosae TACTACCTTA-CTAT-AGTGTTGICTAAATACCTGGTGCCAGAAGACTCG (107) Phleblopsls gigariiea TACTACCTTA-CTAT-AGTGTTGTCTAAATACCTGGTGCCAGAAGACTCG [108] Gloeocysti 210 220 230 240 250] .1 Sp«cl«a_H_£rom_0._pond«roMs GTAAGACCAAAAACGCAMCGTTAGTCATCTTTATCAGGCGTAAAGGGTT 1244) Specl«*_B_£ronro._i)revico«is GTAAGACCAAAAACGCAAACGTTAGTCATCTTTATCAGGCGTAAAGGGTT [244) Specl«*~A~f ronTo.'frontJi i« GTAAGACCAAAAACGCAAACGTTAGTCATCTTTATCAGGCGTAAAGGGrr (2441 Species C~from~FiCyo. comatas GTAAGACCAAAAACGCAAACGTTAGTCATCTTTATCAGGCGTAAAGGGTT [244) Specles~G_froiB_iJ._ponelerosa» GTAACACCAAAAACGCAAACGTTAGTCATCTTTATCAGGCGTAAAGGGTT [244) Specles~D_fron~0._ponclerosae GTAAGACCAAAAACGCAAACGTIAGTCATCTTTATCAGGCGTAAAGGGIT [244) Species~B~froni~D._/>onderosae GTAAGACCAAAAACGCAAACGTTAGTCATCTTTATCAGGCGTAAAGGGTT [244) Sped e s_E_f r onTo. _ jeffteyl GTAAGACCAAAAACGCAAACGTTAGTCATCTTTATCAGGCGTAAAGGGTT [244) Sp«cies3F~fro»"O.^ponderosae GTAAGACCAAAAACGCAAACGTTAGTCATCTTTATCAGGCGTAAAGGGTT 1244) PenlophorajpltRya GTAAGACCAAAAACGCAAACGTTAGTCATCTTTATCAGGCGTAAAGGGTT (244) Peitl ophora_nuda GTAAGACCAAAAACGCAAACGTTAGTCATCTTTATCAGGCGTAAAGGGTT (244) Dendrophora_albobadla GTAAGACCAAAAACGCAAACGTTAGTCATCTTTATCAGGCGTAAAGGGTT (243) Oxyporus spT GTAAGGCGAGAGACGCAAACGTTAGTCGTCTTAATCAGGCGTAAAGGGTT [1«8) SpeciesJ3_fzom_Xyleborus_dlspar GTAAGACCAGAGACGCAAACGTTAATCATCTTAATCAGGCGTAAAGGGTT (178) Antrodla_carbonlca GTAAGACCAGAGACGCAAACGTTAATCATCATAAACAGGCGTAAAGGGTT (166) Herlpllus_gigattteus GTAAGGCCAGAGACGCAAACGTTAGTCGTCTTAATCAGGCGTAAAGGGTT (166) PalcheTrlciua_caeruleum GTAAGGCCAGAAACGCGAACGTTAGTCATCCTAAACAGGCGTAAAGGGTG [163] PI eurot us_ CutHerogi um GTAAGGTCAGAAACGCAAACGTTAGTCATCCTAATCAGGCGTAAAGGGTA (197) L«ntlnula~bocyana GTAACGCCAGAAACGCGAACGTTAGTCACATTAACCAGGCGTXAGGGGTC (194) Species_l~from_0._jpproxiinatus GTAAGGCCAGAAACGCGAACGTTAGTCCTAATAAACAGGCGTAAAGGGTA (158) Species_K £roin~0.^|pondaroaae GTAAGGCCAGAAACGCGAACGTTAGTCCTAATAAACAGGCGTAAAGGGTA (157) Ptilebiopsls gigantea GTAAGGCCAGAAACGCGAACGTTAGTCCTAATAAACAGGCGTAAAGGGTA (158) G1 oeocystldlua_lpidophi 1 um GTAAGGCCAGAAACACAAACGITAATCITAATGAACAGGCGTAAAGGGTT (141) Rassula_coapacta GTAAGGCCAGAGACACAAACGTTAATCGTCTTAATCAGGCGTAAAGGGTT [1611 Aaylostereun_challletll GTAAGGCCAGAGACGCAAACGTTAATCGTCTTAAACAGGCGTAAAGGGTT (170) Hat«robasldlon_annosum GTAAGGCCAGAGACGCAAACGTTAATCGTCTTAATCAGGCGTAAAGGGTT (165) Hyphoderma_praetermlsauiii GTAAGGCTAGAGACGCAAACGTTAGTCATCTTTAACAGGCGTAAAGGGTT (166) Steraum hlrsutum GTAAGGCCAGAGACGCGAACGTTAGTCGTCATTATCAGGCGTAAAGGGTT (180) 260 270 280 290 300) .1 Specles_H_froni_fl._pond8rosae AGTAGGCGGCCTT—AATTACC TGTCACA— -GTAGAT (277) Species_B_from~D._ijrovico/nis AGTAGGCGGCCTT—AArrACC AGTCAAA— -GTAGAT [277] Specles~A~from~0.~frontaiis AGTAGGCGGCCTT—AATTACC TGTCACA— -GTAGAT [277] Sp«cies~C~from~Pl'tyo. comatas AGTAGGCGGCCTT—AATTACC TGTCAAA— -GTAGAT (277) Specie9~G_from_0._ponderosae AGTAGGCGGCCTT—AATTACC TGTCAAA— -GTAAAT (277) Specles_D~from~D._ponderosae AGTAGGCGGCCTT—AATTACC TGTCAAA— -GTAGAT (277) Specl«s_E~£ roro_0 ._ponderosae AGTAGGCGGCCTT—AATTACC TGTCAAA— -GTAGAT (277) Species_E_froni~Z3.~Joffreyi AGTAGGCGGCCTT—AATTACC TGTCAAA— -GTAGAT [277] Sp«cies~F~froin_i)."ponderosae AGTAGGCGGCCTT—AATTACC TGTCAAA— -GTAGAT [277] Peni ophora_pithya AGTAGGCGGCCTT—AATTACC TGTCAAA— -GTAGAT [277] Penlophora_nuda TGTAGGCGGCCTT—AATTACC TGTCACA— -GTAGAT [277] Dendrophora_albobadia AGTAGGCGGCCTT—AATTACC TGTCAAA— -GTCGAT (276) Oxyporus_sp. TGTAGGCGGCTTT—AAGAAT [187] Sp€cies_J_froni_Xyieborus_dlspar TGTAGGCTGCTTT—GAAAA TCTTAAT— TTT (206) Antrodiajcarbonica ~ TGTAGGCTGCTTT—GAAAG TCTTAAC— TTT (194) Heripilus_giganteus TGTAGGCTGCTTT—GAAAA TTTTACA— TTCACT [197] Palcherrici uffl_caeruleum TGTAGGCAGCTTC—ATATGAT TTTTAA TTATAT (1951 PI eurotus_Cut>erregi um TGTAGGCAGCTT AATAA TAGC (2181 Lent inul^boryana -GTAGGCAGTTT AAAA GTTAAA TTT [218] Specics_l~from_0._approximatus TGTAGGCAGCTTCTTAAAAA [178] Species_K~from~0._ponderosae TGTAGGCAGCTTCTTAAAAA [177] Phlebiopsls gigantea TGTAGGCAGCTTCTTAAAAA [178] G1 oeocysti dl um_ ipidophl1vm CGTAGGCAGCTTT ATTAACT ATAA TTATAA (1711 Russula_compacta TGTAGGCGGTTTTT-AAATTTAC TTACAA (1891 Ainylostereum_chailletii TGTAGGCAGCTTT—GAATTTTC (1911 Hetarobasidlon_annosum TGTAGGCTGCTTTT-AACTTAGA A (1881 Hyphc^ernia praetermlssuni TGTAGGCTGCTTT—PAMATT TTATAA (1921 StezBum hlrsutum CGTAGGCijGCTTT—AAGATTTCTTTTTTTAAAAAATAGCACTCTTCTCA [228] 87 ( 310 320 330 340 350) [ •••>•) Sp«ci«a H from D._pondmros*» GAATAATCTACTAACAATTAATAC-AATAGC-ACGTTAAGTTCATT-GTA [324] Speci«s~B~froa~0. bnvieomls GAATAATCTACTAACAATTAATAC-AATAGG-ACGTTAAGTTCATT-GTA (324) Specl«s~A~from D. frontMllM GAATAATCTACTAACAATTAATAC-AATAGG-ACGTTAAGTTCATT-GTA [324) Specl«s~C~from~PiCyo. comatas GTATAATCTACTAACAATTAATAC-AATAGG-ACGTTTAGTTCATT-GTA (324) Species"G"f rora_0._ponderosae GAATAATCTACrAACAATIAATAC-AATAGG-ACGTTTAGTTCATTTGTA (325) Species~D~f rom_fl._pon 360 370 380 390 400) .) Species_H_from_fl ._ponderosae AGACAGGCTTAACTTAAGTGCTAGAGTCGAATAGAGGITAGATTAAATAA (374) Species~B~froin~0."brevicomis AGACAGGCTTAACTTAAGTGCTAGAGTCGAATAGAGGTTAGATTAAATAA (374) Specles_A_frora_fl."frontaiis AGACAGGCTTAACTTAAGTGCTAGAGTCGAATAGAGGTTAGATTAAATAA (374) Species~C~from_Plt>'o. comaCas AGACAGGCTGAACTTAAGTGCTAGAGTCGAATAGAGGTTAGATTAAATAA (374) Species_G_from_0._ponderosae AGACAGGCTTAACTTAAGTGCTAGAGTCGAATAGAGGTTAGATTAAATAA (375) Species~D_f rom~D ._pon< [ 410 420 430 440 450] Sp«cl*« H eroB D._p0ndme0Mam TACTTAAAC AAGGGGTCATATCCTGAAAGATTA-AGTAGAATACTAA [420) Sp«cl««_B from D, bravleomls TACTTAAAC AA6GGGTCATATCCTGAAAGATTA-AGTAGAATACTAA (420) Speci**_A~from~0.~front«ii5 TACTTAAAC AAGGGGTCATATCCTGAAAGATTA-AGTAGAATACTAA (420] Spades C from_Pityo. eomatas TACTTAAAC AAGGGGTCATATCCTGAAAGATTA-AGTAGAATACTAA (420] Specl«s~G~froffl D. ponderossa TACTTAAAC AAGGGGTCATATCCTGAAA6ATTA-AGTAGAATACTAA [421] Species trCtOttTD.jponderosae TACTTAAAC AAGGGGTCATATCCTGAAAGATTA-AGTAGAATACTAA (420) Specles~E~f ron~0,_ponderoaae TACTTAAAC AAGGGGTCATATCCT6AAAGATTA-AGTAGAATACTAA (420 ] Specles~E~fron~0. jeffreyl TACTTAAAC AAGGGGTCATATCCTGAAAGATTA-AGTAGAATACTAA (420) Speciea~F~from~D.~ponderosae TACTTAAAC AAGGGGTCATATCCTGAAAGATTA-AGTAGAATACTAA (420) Paniophori_picHyj~ TACTTAAAC AAGGGGTCATATCCTGAAAGATTA-AGTAGAATACTAA (421) Penlophora_nuda TACTTAAAC AAGGGGTCATATCCTGAAAGATTA-AGTAGAATACTAA (410) Dendrophora albobadia TACTTAAAC AAGGGGTCATATCCTGAAAGATTA-AGTAGAATACTAA (407) Oxyporus spT TGGT AGGGTTGGTAACTTGAGATCCTA-AGTAGAATACTAC [294] Species 3_frora Xyleborus dlspar TACTTAGAG GAGGGATTAAATCCTTAGATCCTA-AGGGGAATACTTA (318) Antrodia_carbonlca TACTTAGAGGA GGGATTAAATCCGTAGATCCTA-AGGAGAATACTAA [303] Herlpllus_glganteus TACTTAGAG GAGGGATTAAATCCTTAGATCCTAGAGGGGAATACTAA [305) Pulcherriclum caeruleum TACTTAGAG TAGAGTTCTAATTCATATATACTA-AGTAGAATACTAA [320] Pleurotus_tuberreglum TACTTAGAG TAGGGATGATATCCATAGATACTA-AGGGGAATACTAA [333] Lentinula_boryana TGCTTAGAG TAGGGAT-AAATCCTTAGATACTA-GGTGGAA-ACTAA [307] Species I'from D._approxinMtus TGCTTAGAG TAGGGTTAAAATCCTTAGAAACTACAGTGGAATACTAA [269] Species~K~from~0. ponderosae TGCTTAGAG TAGGGTTAAAATCCTTAGAAACTACAGTGGAATACTAA [267] Phleblopsls gigantea TGCTTAGAG TAGGGTTAAAATCCTTAGAAACTACAGTGGAATACTAA [268] Gloeocystldlum_lpldophllum TGCTTAGAG TAAGGTTTATATCTTTAGATACTA-GGTAGAGTACTTA (311) Russula compaota TGCTTAGAG TAGGTCTGATATCCTTAAATACTA-AGTAGAATATTAA [291] Amylostereum ehallletll TGCTTAAAG TAGGTCTAATATCCTAACAGATTA-AGTGGAATATTAA (299) Heterobasldion annosum TACTTAGAG TAGGTCTTATATCCTTAGATACTA-AGGGGAATATTAA (278) Hyphodermapraetermlssum TATTTAGATCT-AAA—TTGACAATCGTAAATCTTA-AGTAGAATACTAA (309) Stereum_hlrsutum T-CTAAGACTATAAGGGCTGATATCTTAAGATACTT-GGAGGAATATTAA (374) [ 460 470 480 490 500) [ .....) Species H from D. ponderosae -GAGCGAAGGCTTTTTTTCCACTACCGAACAAATATACTGACGCTGAGAA [469] Specles'B ftom~D.~brevicomis -GAGCGAAGGCTTTTTTTCCACTACCGAACAAATATACTGACGCTGAGAA [469] Specles"A~froni~D.~frontaiis -GAGCGAAGGCTTTTTTTCCACTACCGAACAAATATACTGACGCTGAGAA [469] Specles'c from Pityo. comatas -GAGCGAAGGCTTTTTTTCCACTACCGAACAAATATACTGACGCTGAGAA [469] Specles'G from D. ponderosae -GAGCGAAGGCTTTTTTTCCACTACCGAACAAATATACTGACCCTGAGAA [470] Specles~0_from~D.~ponderosae -GAGCGAAGGCTTTTTTTCCACTACCGAACAAATATACTGACGCTGAGAA [469] Specles'E from~D.~ponderosae -GAGCGAAGGCTTTTTTTCCACTACCGAACAAATATACTGACGCTGAGAA [469] Specles'E from~0.~jeffreyi -GAGCGAAGGCTTTTTTTCCACTACCGAACAAATATACTGACGCTGAGAA [469] Speciea~F~from~D.~ponderosae GAAGCGAAGGCTTTTTTTCCACTACCGAACAAATATACTGACGCTGAGAA [470] Penlophora plthya~ -GAGCGAAGGCTTTTTTTCCACTACCGAACAAATATACTGACGCTGAGAA [470] Peniophora'nuda -GAGCGPAGGCTTTTTTTCCACTACCGAACAATAAAACTGACGCTGAGAA [459] Dendrophora albobadia -GAGCGAAGGCTTTTTTTCCACTACCGAACAATAAAACTGACGCTGAGGA [456] Oxyporus sp. --GGCGAAGGCTTrrrT-CCATTA ATGAT—TGACGCTGAGAA [332] Species J from Xyleborus dlspar -GGGCGAAAGCATTTT-ACCACTA AAGAT—TGACGCTGAGAA [357] Ancrodla carbonlca ~ -GGGCGAAAGCATTTT-ACCACTA ATGAT—TGACGCTGAGAA [342] Merlpllul glganteus A-GGCGAAAGCTTTTTTACCACTA ATGAT—TGACGCTGAGAA [345] Pulcherricium caeruleum -AAGCGAAGGC-ATTTTTCCACTA AAGAT—TGACGCTGATAT [359] Pleurotus tuberreglum -GGGCGAAAGCTTTTTTTCTACTA ATGAT—TGACGCTGAGAA (373) Lentlnula~boryana T-GGTGAAAGCTTTTTATCTAATA ATGAT—CGAC-CTGAGGA [346] Species I~from D. approxlmatus T-GGCGAAGGC-ATTTGACCAATA AA-GAT—TGACGCTGAAAG [308] Specles~K from~D.~ponderosae T-GGCGAAGGC-ATTTGACCAATA AA-GAT—TGACGCTGAAAG [306] Phleblopsls glgantea T-GGCGAAGGC-ATTTGACCAATA AA-GAT—TGACGCTGAAAG [307] Gloeocystldlum Ipidophllum T-GGCGAAAGCTATTTTTCCATTA ATGATTGAAGCTGA GGGA [352] Russula compacta A-GGCGAAAGCTTTTTT-CCATTA ATGAT—TGACGCTCAGAA [330] Amylostereum ehallletll A-AGCGAAGGCTTATTTACCATAA ATGAT—TGACGCTGAGAA [339] Heterobasldlon annosum -GGGCGAAAGCTTTTTTACCATTA ATGAT—TGACGCTGAGAA [318] Hyphodermajpraeterml ssum T-GGCGAAAGCTTTTTT-CTATTAC TGAT—TGACGCTGAGAA [348] Stereum hlrsutum AGGGCGAAGGCTTTTTTTCCATAA ATGAT-TGAC-CTGAGGA [414] 1 89 [ 510 520 530 540 550] Sp«cl««_H_from 0. pond»roa»u ACTAAGCGGAGGATAGGMAAAGGATTAGATACCCAATTACCCCTCTCTG [519] Sp«ei«*~B_f EOnro.~br«vi comls ACTAAGGGGACGATAGGAAAAAGGATTAGATACCCAATTACCCCTCTCTG (519] Specles2A~fcom~0.~front4iis ACTAAGGGGAGGATAGGAAAAAGGATTAGATACCCAATTACCCCTCTCTG [519] Sp«cies~C~£rom~Pit/o. coaatas ACTAAGGGGAGGATAGGAAAAAGGATTAGATACCCAATTACCCCTCTCTG [519] Specles_G_£rom_0._^nd«rosj» ACTAAGGCGAGGATAGGAAAAAGGATTAGATACCCAATTACCCCTCTCTG [520] Species D~£rom D._ponderosae ACTAAGGGGAGGATAGGAAAAAGGATTAGATACCCAATTACCCCTCTCTG (519] Specles~B~£rom~0._ponderosaft ACTAAGGGGAGGATAGGAAAAA6GATTAGATACCCAATTACCCCTCTCTG [519] Species_E~from~0. jeffreyi ACTAAGGGGAGGATAGGAAAAAGGATTAGATACCCAATTACCCCTCTCTG [519] Species F frovTorponderosae ACTAAGGGGAGGATAGGAAAAAGGATTAGATACCCAATTACCCCTCTCTG [520] Penloptiora_pitHya~ ACTAAGGGGAGGATAGCAAAAAGGATTAGATACCCAATTACCCCTCTCTG [520] Peniophora_nuda ACrAAGGGGAGGATAGGAAAAAGGATTAGATACCCAATTACCCCTCTCTG [509] Dendrophora_albobadia ACTAAGGGGAGGATAGGAAAAAGGATTAGATACCCAATTACCCCTCTCTG [506] Oxyporus_sp. ACTAAGGTGAGGACAGAAAAAAGGATTGGAGACCCTTATATCCCTCACAT [382] Specles_J_£rom_Xyiet>orus dispar ACGAAGGTGAGGATAGGAAATAGGATTAGATACCCCGGTACCCCTCTCTG [407] Antrodia carboniea ~ AC6AAGGTGAGGATAGGAAATAGGATTAGATACCCCGGTACCCCTCTCTG [392] Meripilus glganteus ACGGAGGTGAGGATAGGAAATAGGATTAGATACCCCGGTACCCCTCTCTG [395] Pulcherrlciuiii_ca»ruleua ACGAAGGTGGGGATAGGAAATAG6CTTAGAGACCCATGAACCCCTCACTG [409] Pleurotua tub«rr«glvm ACGAAGGIGAGAATAGGAAATAGGATTAGATACCCAGATACCTCTCACTG (423] lentlnula'boryana ACGAAGGTGAGAATAGAAAATAGGAT-AGAGACCCAGATATCTCTCACTG [395] Species l~from_D._approxiiiiatua ACGAAGGTAAGGAGAGGAAATAGGCTTAGAGACCCATGAACCCCTTACAG (358] Species~K~fEOm_0._ponderosaa ACGAAGGTAAGGAGAGGAAATAGGCTTAGAGACCCATGAACCCCTTACAG [356] Phlebiopsls flgantaa ACGAAGGTAAGGAGAGGAAATAGGCtTAGAGACCCATGAACCCCTTACAG (357] Gloeoe^stidlua Ipidopkllum ACGAAGGTTTGAACAGAAAATAGGATTTGATACCCA-GATATCTCTTACT [401] Russula coinp'cca ACGAAGGTGAGGATAGGAAATAGGATTAGATACCCAAAATACCCCTCTCT [380] Anylostereum_challletli ACGAAGGTGAGGATAGGAAATAGGATTAGATACCCAAAATACCCCTCTCI [389] Heterobasidion annosum ACGAAGGTGAGGAAAGGAAATAGGATTAGATACCCAAAATACCCCTCTCT [368] Hyphodermajpcaetermlssum ACTAAGGGGAGGAAAGAAAAAAGGATTAGAGACCCTC-GTATCCCTCTCT [397] SterauiB_hlrsutum CCGAAGGGGAGGAGAGGAATTAGGATTAGATACCCAA-CTACCCCTCCCT [463] [ 560 570 580 590 600] [ .....] Species H from D. ponderosae TCAACGATGAA-TGGTAATTTCTAGTGATTTGTAAGATATATTACTA~T [566] Species~B~from"D.~brevicomis TCAACGATGAA-TGGTAATTTCTAGIGArTTGtAAGATCTATTACrA~t [566] Species~A~from_fl. frontalis TCAAC6ATGAA-TGGTAATTTCTAGTGATTTGrAAGATATArTACTA~T [5G6] Species~C~from Pityo. comatas TCAACGATGAA-TGGTAATTTCTAGTGATTTGTAAGATATATTACTA~T [566] Species~G~£rom D. ponderosae TCAACGATGAAATGGTAATTTCTAGTGATTIGTAAGATATATTACTA~T [568] Species~D~from~D._ponderosae TCAACGATGAA-TGGTAATTICTAGTGAtTrGTAAGATATATTACTA~T [566] Species~E from~0. ponderosae TCAACGATGAA-TGGTAATTTCTAGTGATTTGTAAGATATATTACTA~T [566] Species~E~from D. Jeffreyi TCAACGATGAA-TGGrAATTTCTAGTGATTTGrAAGATATATrACTA~T [566] Species~F~f rom~0._ponderosae TCAACGATGAA-TGGTAATTTCTAGTGATTTGTAAGATATATTACTA~T [567] Penlophora pi thy a TCAACGATGAA-TGGTAATTTCTAGTGATTTGTAAGArATATTACTA—T [567] Penlophora~nuda TCAACGATGAA-TGGTAATTTCTAGTGATTTGTAAGA?ATATTACTAAAT [558] Dendrophora albobadia TCAACGATGAA-TGGTAATTTCTAGTTATTTGTAAGATATGTTACTAAAT [555] Oxyporas_sp~ TCAACGATGAA-TGGTAGTTACTAGAAGTTTT [413] Species J from Xyleborus dlspar TCAACGATGAA-TGGTAGTTCCTAG CTTAAAAA (439] Antrodia carbonica ~ TCAACGATGAA-TGGTAGTTCCTAG TTACAAA [423] Herlpilusglganteus TCAACGATGAA-TGGTAGTTATTAGT TTAATAG [427] Pulcherricium caeruleum TAAACGATGAA-TGGTAGTGATCAGTT-TTTTTAA [442] Pleurotus_tuberregium TCAACGATGAA-TGGTGGTTGCTAGTT-TTAATAAA [457] Lentlnvla_boryana TCAACGATGAA-TGGTGG—AATGTTAGTTTTAA [426] Species I from D. approxlmatus TAAACGATGAA-TGGTGGTGATCAGTTATTA [388] Species~K~from~D._ponderosae TAAACGATGAA-TGGTGGTGATCAGTTATTA [386] Phlebiopsls gigantea TAAACGATGAA-TGGTGGTGATCAGTTATTA [387] Gloeocystidlum ipidophllum GTCAACTATGAATAGAAGTTATTGGTGA [429] Russula coflipacta GTCAACGATGAATGGTAGTTATTAGTAATAAArTT [415] Amylostereum chailletii GTCAACGATGAATGGTGGTTGCTAATTATAA [420] Heterobasidion annosum GTCAACGATGAATGGTAACTATTAGTAATAA [399] Hyphoderma praetermlssura GTCAACGATGAATGGTAGTTACTAATTTTAAAAAA [432] stereora hlrsutum GTCAACGATGAATGGTAGTTAACC TGr-AGACAAA (497) 90 [ 610 620 630 640 650] [ ••••.] Sped** H from_0._pondaroM* AAT-AGAAATATAATTACAATACTTATTAGTrTTAATGTTAACAC~GTT 613) Sp«cl«s~B~froB_0._br«vieoinis AAT-AGAAATATAATTACAATACTTATIAGTTTTAATCTTAACAC—GIT 613] Sp«ci«s2A~from_0.~froiltaiis AAT-AGAAATATAATtACAATACTTATTAGTTtTAATCTrAACAC~GTT 6131 Sp«ci««_C_from_Pityo. C0JMt 660 670 680 690 700] .) Species_H_froin_D._pondarosae AACCATTCC-GCCTTGTGAGTACGATTGCAAAATTGAAAAC-AAAAAAAT [661] Species~B_f roni~D .~i>ro vl comi s AACCATTCC-GCCTTGTGAGTACGATTGCAAAATTGAAAAC-AAAAAAAT [661] Species~A_froni_0."frontalis AACCATTCC-GCCTTGTGAGTACGATTGCAAAATTGAAAAC-AAAAAAAT [661] Species~C~from~PiCyo. comatas AACCATTCC-GCCTTGTGAGTACGATTGCAAAATTGAAAAC-AAAAAAAT (6611 Species~G~fronro._ponc(erosae AACCATTCC-GCCTTGTGAGTACGATTGCAAAATTGAAAAC-AAAAAAAT [663] Species~D_froni~0."ponderosae AACCATTCC-GCCTTGTGAGTACGATTGCAAAATTGAAAAC-AAAAAAAT [661] Species~E_froni_D."ponderosae AACCATTCC-GCCTTGTGAGTACGATTGCAAAATTGAAAAC-AAAAAAAT [661] Specles_E_f r oni~DJef freyi AACCATTCC-GCCTTGTGAGTACGATTGCAAAATTGAAAAC-AAAAAAAT [661] Species~F_frcin_D."ponderosae AACCATTCC-GCCTTGTGAGTACGATTGCAAAATTGAAAAC-AAAAAAAT [662] Peniophora_pithyiT AACCATTCC-GCCTTGTGAGTACGATTGCCAAATTGAAAAC-AAAAAAAT [662] Peniophora~nuda AACCATTCC-GCCTTGTGAGTACGATTGCCAAATTGAAAACC-AAAAAAT [654] Dendrophora_albobadia AACCATTCCCGCCTTGTGAGTACGATTGCAAAATTGAAAAC-AAAAAAAT [648] Oxyporus_sp. AACCATTCC-GCCTTGTGAGTACGACTGCAAAGTTGAAAACC-AAAAAAT [486] SpeciesJJ_from^Xyleborus_dispar AACCATTCC-GCCTTGTGAGTACGATTGCAAAATXGAAAAC-AAAAAAAT [509] Antrodiajcarbonica ~ AACCATTCC-GCCTTGTGAGTACGATTGCCAAATTGAAAACC-AAAAAAT [494] Herlpiltjs_giganteus AACCATTCC-GCCTTGTGAGTACGATTGCAAAATTGAAAACC-A?AAAAT [499] PillCher r fed am_caerul eum GACCATTCC-GCCTTGTGAGTACGATTCCCAAATTGAAAACC-AAAAAAT [513] Pleurotas_tuberregiurn AACCATTCC-GCCTTGCGAGTACGGTTGCCAAACTGAAACCCCAAAAAAT [530] Lentinula_boryana AACCATTCC-GCCTTGAGAGTACGGTCGCAAGACTGAAACCC-AAAAAAT [498] Species_I_from_D._approximatus GACCATTCC-GCCTTGTGAGTACGATTCCACAATTGAAAAC-AAAAAAAT [459] Species~K~from_0."ponderosae GACCATTCC-GCCTTGTGAGTACGATTCCACAATTGAAAAC-AAAAAAAT [457] Phlebiopsis gigariiea GACCATTCC-GCCTTGTGAGTACGATTCCACAATTGAAAAC-AAAAAAAT [458) Gloeocysti I 710 720 730 1 ( . . . ) Spades H_fcoii D._pon APPENDIX B. AUGNED INTERNAL TRANSCRIBED SPACERS AND 5.8S RDNA (nS) SEQUENCES 10 20 30 40 501 .1 EntomocorCiciUffl_sp._G_B1067 GCGAAGTICGGAATGC—GCGTrCGGTACTGAIGCTGCC-GGCAACGGGA (47) EnC omocor C i ci luTsp.~G~B10 69 CCGAAGTTCCGAATGC~GCGTTCGGTACTGATGCTGCCCGGCAACGG-A [471 En t omocor t i ci luTap.~D~ GCGAAGTTCGGAATGC—GTCTTCGGTACTGATGCTGCCCGGCAACGGGA [48] Entoaocortlci ua'ap.~E GCGAAGTTCGGAATGC—GTGTTCGGTACTGATGCTGCCCGGCAACGGGA [48] Bntonocortlcium~ap.~C GCGAAGTTCGGAATGC—GTGTCCGGTACTGATGCTGCCCGGCAACGGGA (481 EnCooocorticiuflTsp._F_B1048 GCGAAGTTCGGAATGC—GTGTTCGGTACTGATGCTGCCCGGCAACGGGA [48] EntomocorticluaT9p.~F~B10S0 GCGAAGTTCGGAATGC—GTGTTCGGTACTGATGCTGCCCGGCAACGGGA [48] EntomococtI el wn3endroctonl GCGAAGTTCGGAATGC—GTGTCCGGTACTGATGCTGCCCGGCAACGGGA [ 481 Entoaocort1el um_ap._H GCGAAGTCTGGAATGC—GTGTTCGGTATTGATGCTGCCCGGCAACGGGA [48] Bntoaoeortlci ua~sp.~A GCGAAGTCTGGAATGC—GTGTTCGGTATTGATGCTGCCCGGCAACGGGA [48] Ent oaocortl el iun~sp.~B GCGAAGTTTGGAATGC—GTGTTCGGTACTGATGCTGCCCGGCAACGGGA [48] Peniophora_pitiiya_2?26 GCGAAGTCCGGAATGC—GTGTTCGGTACTGATGCTGCCCGGCAACGGGA [48] Peniophora_plceae BlOlO GCGAAGTACGGAACGC-GTGTGAGG-ACTGA-GCTGCCCAGCGATGGGA [46] Penlophora_4urjnt7aca_Bl018 GCGAAGCTCGGAATGCTGTGCTTCGGTGCTGATGCTGCCCAGCAATGGGA [50] Pen!ophortTnada^Bl006" GCGAAGCTCGGAATGC-GTGTTCGGT-CTGATGCTGCCCAGCAATGGGA [47] Pen!ophora~cin0rea_Bl020 GCGAAGCTCGGAATGC-GTGTTCGGT-CTGATGCTGCCCAGCAATGGGA [47] Peniophora2paeudo_pini B1007 GCGAAGTCCGGTACGC—GCGTTTGACACTGA-GCTGCCCAGCGATGGGA [47] Peniophora dupisx~B102? GCGAAGCTCGGAATGC—GTGTTCGGTGCTGATGCTGCCCAGCAATGGGA [48] Penlophotajlthy* B1012 GCGAAGCTCGGAACG-TCGCACTCGGTACTGATGCTGCCCGGCAACGGCA [49] Penlophora_cuf*_hZO 014 GCGAACTTCGGAAC~TCGCTTTCGGTGCTGATGCTGCCCGGCAACGG-A [47] Dendrophora_albobadla GCGAAGTTCGGAATGC—ATGTTCGATGTTGATGCTGCCCAGCAATGGGA [48] [ 60 70 80 90 100] [ .1 En t ofliocort i ci u 110 120 130 140 150] .1 Bntomocort1cium_sp._G_B1067 CCAAGCGTGCGAGCCGAAGAGAGATCGGAAGCCC-GTATGCAA-CCCTTA [143] EntomocorticiunTsp.~G~B1069 CCAAGCGTGCGAGCCGAAGAGAGATCGGAAGCCC-GTATGCAA-CCCTTA (143) EntomocorC i ci unTap._D~ CCAAGCGTGCGAGCCGAAGAGAGATCGGAAGCTC-GTGCGCAA-CCCTTA [144] Bntontocorticium2»P-_E CCAAGCGTGCGAGCCGAAGAGAGATCGGAAGCTC-GTGCGCAA-CCCTTA (144) Entomocorti cium~sp._C CCACGCGTGCGAGCCGAAGAGAGATCGGA? 5CTC-GTATGCAA-TCCTTA [144] fin t omocorC i ciunTsp.~F_B1048 CCAAGCGTGCGAGCCGAAGAGAGATCGGAAGCCC-OCArGCAA-CCCTTA (144) EntomocortlclunT 3p.~F_B1050 CCAAGCGTGCGAGCCGAAGAGAGATCGGAAGCCC-GCATGCAA-CCCTTA (144) En t omocor11ciunSendroctonl CCACGCGTGCGAGCCGAAGAGAGATCGGAAGCTC-GTATGCAA-TCCTTA [144] EntofflocorCicium_sp._H CCAAGCGTGCGAGCCGAAGAGAGATCGGAAGCTC-GTATGCAA-TCCTTA [144] Entomocorticium~sp.~A CCAAGCATGCGAGCCGAAGAGAGATCGGAAGCTC-GTATGCAA-TCCTTA [144] EntomocorCicium'sp. B CCACGCATGCGAGCCGAAGAGAGATCGGAAGCTC-GTATGCAA-TCCTTA [144] Peniophora jpithyajUZi CCAAGCGTGCGAGCCGAAGAGAGATCGGAAGCTC-GTATGCAA-CCCTTA [144] Peniophora_piceae BlOlO CCAAGTGTGCGAGCCGAAGAGAGATCGGAGGCTC-GCATGCAA-CCCTTA [141] Peniophora_aurantTaca_B1018 CCAAGIGT-CGAGCCGATGAGAGATCGGAGGCTC-GCATGCAAACCCTTA [146] Peniop/iora_nuc(a_B1006~ CCAAGTGTGCGAGCCGAAGAGAGATCGGAGGCTC-GCATGCAA-CCCTTA [143] Peni ophora~cinerea_Bl020 CCAAGTGTGCGAGCCGAAGAGAGATCGGAGGCTC-GCATGCAA-CCCTTA (143) Peniophora_pseudo_pini B1007 CCAAGTGTGCGAGCCGAAGAGAGATCGGAGGCTC-GCATGCAAACCCTTA [144) Peni ophora~duplex~Bl02J CCAAGTGTGCGAGCCGAAGAGAGATCGGAGGCTC-GCATGCAAACCCTTA (146) Peniophorajpithya~B1012 CCAAGCGTGTGGACCGATGAGAGATCGGAGG-TCCGCATGCAA-CCTTTA (145) Paniop/iora~rufa_Br0014 CCAAGCGTGCGAGCCGAAGAGAGATCGGAGGCTT-GCATGCGAACCCTTA (143) Dendrophora albobadia CCAAGTGTGTGAGCCGAAGAGAAATCGGACGCTC-GCATGCAAACCTTTA (144) 93 ( 160 170 180 190 200] ( • . . . 1 EntonocorCiei tw_sp._G_B1067 ATATA~CCCC-ATCATGTATCAGAATGTACCTTGCGTTAACTC6CACAA [190] En toflwcorc i ci tuTsp. ~G~B10 6 9 ATATA~CCCC-ATCATGIATCAGAATGTACCTTGCGTTAACTCGCACAA [190] EntomococC iel luTap. ~0~ ATATA—CCCC-ATCATGTATCAGAATGTACCTTGCGTTAACTCGCACAA (1911 En Comocor Ci cl luTap. ~E ATATA—CCCC-ATCATGTATCAGAATGTACCTTGCGTTAACTCGCACAA [191] EnLanocorti cl luTsp. ~C ATATA-CCCC-ATCATGTATCAGAATGTACCTTGCGTTAACTCGCACAA (191) Entomocorticlua~sp.~F_B1048 ATATA--CCCC-ATCATGTATCAGAATGTACCTTGCGTTAACTCGCACAA 1191) Entomocoeticlua sp.~F~B1050 ATATA—CCCC-ATCATGTATCAGAATGTACCTTGCGTTAACTCGCACAA (191) EntomoeortlclunSandroetonl ATATA-CCCC-ATCATGTATCAGAATGTACCTTGCGTTAACTCGCACAA [ 191) Bntomoeorticlum_sp._H ATATA—CCCC-ATCATGTATCAGAATGIACCTTGCGTTAACTCGCACAA [1911 EntomacorclcluoTsp.~A ATATA-CCCC-ATCATGTATCAGAATGTACCTTGCGTTAACTCGCACAA (1911 En t oaocorCIcluoTsp.~B ATATA-CCCC-ATCATGTATCAGAATGTACCTTGCGTTAACTCGCACAA [ 1911 Penlophora _pithya_2l26 ACATA-CCCC-ATCATGTATCAGAATGTACCTTGCGTTAACTCGCACAA (1911 Penlophora_piceae~B1010 ACATA—CCCCAACGAAGTATCAGAATGTACCTTGCGTTAACTCGCACAA [189] Peniophora_aurant7aca_B1018 ACATA—CCCCAATGAAGTATCAGAATGTACCTTGCGTTAACTCGCATAA [ 1941 Peniophora~nud<_B100e~ ACATA—CCCCAATGAAGTATCAGAATGTACCTTGCGTTAACTCGCACAA (1911 Psniophora~cin«r«a_B1020 ACATA—CCCCAATGAAGTATCAGAATGTACCTTGCGTTAACTCGCACAA [1911 Penlophora_pseudo_plnl B1007 ACATA—CCCCAACGAAGTATCAGAATGTACCTTGCGTTAACTCGCACAA (1921 Penlophora_duplex_B102l ACATA—CCCCAATGAAGTATCAGAATGTACCTTGCGTTGACTCGCACAA (1941 Penlophora_plthya B1012 ACATATACCCCTACGAAGTATCAGAATGTACCTTGCGTTAACTCGCACAA [1951 Peniop/iora_rufa_Br0014 ACATA—CCCCAAGTCAGTATCAGAATGTAACTTGCGTTAACTCGCACAT (1911 Dendrophora_albobadia ACATA—CCCCAATGAAGTATCAGAATGTACCTTGCGTTAACTCGCACAA (192 ] [ 210 220 230 240 250) ( EntofflocorCicium_sp._G_B1067 ATACAACTTTCAACAACGGATCTCTTGCGTCTCGCATCGATGAAGAACGC (2401 EnComocortIcl unTsp.~G~B10 6 9 ATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGC (2401 Entomocorticlu/iTsp.'D" ATACAACTTTCAACAACGGATCTCTTGCGTCTCGCATCGATGAAGAACGC (241] EntojnocorCiciu/iTsp.'E ATACAACTTTCAACAACGGATCTCTTGCGTCTCGCATCGATGAAGAACGC (241] EntomocortlcluitTsp.JZ ATACAACTTTCAACAACGGATCTCTTGCGTCTCGCATCGATGAAGAACGC (241 ] Entomocort1cl wiT sp.~F_B1048 ATACAACTTTCAACAACGGATCTCTTGCGTCTCGCATCGATGAAGAACGC (2411 £ntomocorticiuiirsp.~F~B1050 ATACAACTTTCAACAACGGATCTCTTGCGTCTCGCATCGATGAAGAACGC (2411 Entomocortlcl uaidendroctonl ATACAACTTTCAACAACGGATCTCTTGCGTCTCGCATCGATGAAGAACGC (2 411 Bntomocortlcltm_sp._H ATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGC (2411 En t omocort i ci uiiTsp. ~A ATACAACTTTCAACAACGGATCTCTTGCGTCTCGCATCGATGAAGAACGC [241] EnComocorticiu/n~sp.~B ATACAACTTTCAACAACGGATCTCTTGCGTCTCGCATCGATGAAGAACGC (2411 Peniophora_pithya_2l26 ATACAACTTTCAACAACGGATCTCTTGCGTCTCGCATCGATGAAGAACGC [241] Penlophora^l cea e~Bl 010 ATACAACTTTCAACAACGGATCTCTTGCGTCTCGCATCGATGAAGAACGC [2391 Penlophora_auranc7aca_Bl018 ATACAACTTTCAACAACGGATCTCTTGCGTCTCGCATCGATGAAGAACGC (2441 Penlophora^nuda_Bl006" ATACAACTTTCAACAACGGATCTCTTGCGTCTCGCATCGATGAAGAACGC (2411 Peniophora_clnerea_B102 0 ATACAACTTTCAACAACGGATCTCTTGCGTCTCGCATCGATGAAGAACGC (2411 PeniophorajseudoJplnl B1007 ATATAACTTTCAACAACGGATCTCTTGCGTCTCGCATCGATGAAGAACGC [242] Peniophora~duplex~Bl02? ATACAACTTTCAACAACGGATCTCTTGCGTCTCGCATCGATGAAGAACGC [244] Peni ophora'2pi Chya~Bl 012 ATACAACTTTCAACAACGGATCTCTTGCGTCTCGCATCGATGAAGAACGC (245) Peniophora_rufaJil001A ATATAACTTTCAACAACGGATCTCTTGCGTCTCGCATCGATGAAGAACGC (241) Dendrophora_albZbadia ATATAACTTTCAACAACGGATCTCTTGCGTCTCGCATCGATGAAGAACGC (2421 I 260 270 280 290 300] [ ,1 Entomocorticium_sp._G_B1067 AGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAA [290] Bntomocorticium~sp.~G~B1069 AGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAA [290] £ntomocorticium~sp.~D~ AGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAA [291] Entomocorticium_sp._E AGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAA [291] Bntomocorticium~sp.~C AGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAA [291] Ent omocort i ci um~sp._F_B1048 AGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAA [291] EnzomocorciciunT sp.~F_B1050 AGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGIGAATCATCGAA [291] Entomocort i ci uirdendroct oni AGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAA [291] Entomocorticium_sp._H AGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAA [291] Ent omocortl cl u/iTsp. ~A AGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAA [291] EntomocortIclum'sp.~B AGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAA [291] Penlophora_plthya_2l26 AGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAA (2 91) Peniophora_plceae BlOlO AGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAA [289] Peniophora^aurantJacaJBl018 AGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAA [294] Peniophora~n uc/a_B10 0 6 • AGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAA (2 91) Peni op/iora~cinerea_Bl 020 AGCGAAATGCGATAAGTAATGTGAATTGCAGAATICAGTGAATCATCGAA [291] Penlophorajpseudo_pini B1007 AGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAA [292] Peniophora_duplex~Bl027 AGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAA [294] Peniophora_pithya~Bl012 AGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAA [295] Penl op/jora~ruf a_Br0014 AGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAA [291] Dendrophora_albobadia AGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAA (292) 94 I 310 320 330 340 350] I .] En e omocor t i ci iin_sp. _G_B10 S 7 TCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGCGGCA-CGCCTGTr [339J £n C OiKOCOrC ici UB~sp. _G~B10 6 9 TCTrTGAACGCACCTTGCGCCCCTTGGCATTCCGACGGGCA-CGCCTGTr [339] Entomocorticlum_sp.~0 TCTTTGAACGCACCTTGCCCCCCTTGGCATTCCGAGCGGCA-CGCCTGTT (340) Entonocorticiun_sp. TCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCA-CGCCTGTT [340] SncomoeorticiuaTap, _C TCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCA'CGCCTGTT (340) £neo/iiocorticiitn~sp.~F_B1048 TCTTTGAA-GCACCTTGCGCCCCTTGGCATTCCGAGGGGCA-CGCCTGTT (339) EntomocorticiunT sp.~F_B1050 TCTTTGAACGCACCTTSCGCCCCTTGGCATTCCGAGGGGCA-CGCCTGTT (340) En t o/nocor tid ua3en ( 360 370 380 390 400] I .) Entomocortiei uin_sp._G_Bl 0 67 TGAGTGTCGTGAACTCCTCCACCCTCTATCTTTTTCGGAAGGCATTGGGC (389) Entomocort ici ujn~sp. ~G_B1069 TGAGTGTCGTGAACTCCTCCACCCTCTATCTTTTTCGGAAGGCATTGGGC (389) Entomocorti ciuoTap.~D~ TGAGTGTCGTGAACTCCTCCACCCTCTATCTTTTTCGGAAGGCATTGGGC (390) Entomocortici u/iTsp. ~E TGAGTGTCGTGAACTCCTCCACCCTCTATCTTTTTCGGAAGGCATTGGGC (390) En t o/nocor C i ci uflTsp. ~C TGAGTGTCGTGAACTCCTCCACCCrCTATCTTTTTCGGAAGGCATTGGGC (390) En t ofliocort i ci unTsia. _F_B10 4 8 TGAGTGTCGTGAACTCCTCCACCCTCTATCTTTTTCGAAAGGCATTGGGC (389) EntomocorticiuaT sp.~F_B1050 TGAGTGTCGTGAACTCCTCCACCCTCTATCTTTTTCGGAAGGCATTGGGC (390) EntomocorticiumBendroctoni TGAGTGTCGTGAACTCCrCCACCCTCTATCTTTTTCGGAAGGCATTGGGC (390) Entomoeorticium_sp._H TGAGTGTCGTGAACTCCTCCACCCrCTATCTTTTTCGGAAGGCATTGGGC (390) EntOfflOCorticiunTsp.^A TGAGTGTCGTGAACTCCTCCACCCTCTATCTTTTTCGGAAGGCATTGGAC (390) En tomocor C i ci lun'sp. ~B TGAGTGTCGTGAACTCCTCCACCCTCTATCTTTTTCGGAAGGCATTGGGC (390) Peniophora_pithya_2326 TGAGTGTCGTGAACTCCTCCACCCTCTATCTTTTTCGGAAGGCATTGGGC (390) Peni ophorajpiceae~Bl010 TGAGTGTCGTGAACTCCTCCACCCTCCACCTTTTTCGGAAGGCGTTGGGC (389) Peni ophoralaurantiaca_B1018 TGAGTGTCGTGAACTCrrCCACCCTCTACCTTmCGAAAGGCATTGGGC (394 ] Pen i op/iora~nuda_Bl 0 0 6 TGAGTGTCGTGAACTCCrCCACCCTCCACCTTTTTCGAAAGGCGTTGGGC (391) Peniophora~cinerea_Bl020 TGAGTGTCGTGAACTCCTCCACCCTCCACCTTTTTCGAAAGGCGTTGGGC (391) Peniophora~pseudo_pini B1007 TGAGTGTCGTGAACTCCTCCACTCrtCACCTTTTTCGAAGGGTGTTGGGC (392) Peniophora~dupJex~Bl02l TGAGTGTCGTGAACTCCTCCACCCTCCACCTTTTTCGAAGGGTATTGGGC (394) Peniophora~pit/tya~B1012 CGAGTGTCGTGAACTCCTCCACCCCCTACCTTCTTCGGAAGGTATCGGGC (395) Peniaphora~cufa_B10014 TGAGTGTCGTGAACTCCTCCACCCCCTACCTTTTTCGAAGGGTACCGGGC (391) Dendrophora_albobadia TGAGTGTCGTGAACTCCTCCACCCTCTATCTTTTTCGGAAGGCATTGGGC (392) 410 420 430 440 450) .1 Ent omocorticium_sp._G_B1067 TGGGATTTGGGAGCTTGCGGGTCCCTGGCCGATCCGCTCTCCTTGAATAC (439) Entomoeorticium~sp.~G~B1069 TGGGATTTGGGAGCTTGCGGGTCCCTGGCCGATCCGCTCTCCTTGAATAC (439) £ntomocorticiu/n~sp.~D~ TGGGATTTGGGAGCTTGCGGGTCCCTGGCCGATCCGCTCTCCTTGAATAC (440) EntomocorticiunTsp.'^E TGGGATTTGGGAGCTTGCGGGTCCCTGGCCGATCCGCTCTCCTTGAATAC (440) Entomocorticium~sp.~C TGGGATTTGGGAGCTTGCGGGTCCCTGGCCGATCCGCTCTCCTTGAATAC [440) Ent omocorticiunTsp._F_B104 8 TGGGATTTGGGAGCTTGCGGGTCCCTGGCCGATCCGCTCTCCTTGAATAC (439) Encomocorticiu/n sp._F_B1050 TGGGATTTGGGAGCTTGCGGGTCCCTGGCCGATCCGCTCTCCTTGAATAC (440) EntomocorticiumSendrocConi TGGGATTTGGGAGCTTGCGGGTCCCTGGCCGATCCGCTCTCCTTGAATAC (440) Entomocorticiumjsp.Ji TGGGATTTGGGAGCTTGCGGGTCCCTGGCCGATCCGCTCTCCTTGAATAC (440) Entomocorticium~sp.~A TGGGATTTGGGAGCTTGCGGGTCCCTGGCCGATCCGCTCTCCTTGAATAC (440) Entomocorticium~sp.~B TGGGATTTGGGAGCTTGCGGGTCCCTGGCCGATCCGCTCTCCTTGAATAC (440] Peniophora_pit/iya_2226 TGGGATTTGGGAGCTTGCGGGTCCCTGGCCGATCCGCTCTCCTTGAATAC (440) Peniophora_piceae~Bl010 TGGGACCCGGGAGCTTGCGGGTCCCTGGCCGATCCGCTCTCCTTGAATAC (439) ?eniophora2aurant7aca_B1018 TGGGATTTGGGAG-TTGCGGGTCCCTGGCCGATCCGCTCTCCTTGAATAC [443] Peniophora_nuda_B1006~ TGGGATTTGGGAGCTTGCGGGTCCCTGGCCGATCCGCTCTCCTTGAATAC [441] Peniophora^cinerea_Bl020 TGGGATTTGGGAGCTTGCGGGTCCCTGGCCGATCCGCTCTCCTTGAATAC (441) Peniophora^seudo_pini B1007 TGGGATTTGGGAGCATGCGGGTCCCTGGCTGATCCGCTCTCCTTGAATGC [4421 Peniophora_duple*~Bl022 TGGGATTTGGGAGCATGCGGGTCCCTGGCCGATCCGCTCTCCTTGAATGC [4441 Peniopbora_pithya B1012 TGGGATTTGGGAGCTTGCGGGTCCCTGGCCGATCCGCTCTCCTTGAATAC [445] Peni op/iora~ru f a_Br0014 TGGGAATTGGGAGCTTGCGGGTCCCTGGTCGATCCGCTCTCCTTGAATAC [441] Dendrophora_alh'obadia TGGGATTTGGGAGCTTGCAGGTCCCTGGTTGATCCGCTCTCCTTGAATAC [442] 95 [ 460 470 480 490 500) t • • • • •) BnCoaocorCleliim_ap._G B1067 ATTAGTGAAGCCCTT-GCGGCCTTGGTGtOATAGTCATCTACGCCTCGGC [488] Entofliocorticiun~sp._G~B10£9 ATTAGTGAAGCCCTT-GCGGCCTTCGTGTGATAGTCATCTACGCCTCGGC [488] En t o/noeorc i ci un~ap. ~0~ ATTAGCGAAGCCCTT-GCGGCCTTGGTGTGATAGTCATCTACGCCTCGGC [489] Sntoaocortlelumjtp._B ATTAGCGAAGCCCTT-GCGGCCTTGGTGTGATAGTCATCTACGCCTCGGC [489] Entomocorticium~sp. ~C ATTAGCGAACCCCTT-GCGGCCTTGGTGTGATAGTCATCTACCCCTCGGC [489] £ntofliocorticiun~sp.~F_B1048 ATTAGCGAAGCCCTT-GCGGCCTTGGTGTGATAGTCATCTACGCCTCGGC [488] Bntomocorticiim sp.~F~B10S0 ATTAGCGAAGCCCTT-GCGGCCTTGGTGTGATAGTCATCTACGCCTCGGC [489] EntomocortleiumSendroctoni ATTAGTGAAGCCCTT-GCGGCCTTGGTGTGATAGTCATCTACGCCTCGGC [489] Entomocortleiimjsp. H ATTAGTGAAGCCCTT-GCGGCCTTGGTGTGATAGTCATCTACGCCTCGGT [489] En CoAiocorCi ci uflTsp. ~A ATTAGTGAAGCCCTT-GCGGCCTTGGTGTGATAGTCATCTACGCCTCGGC [489] Entomocort 1 ci luTsp. ~B ATTAGTGGAGCCCTT-GCGGCCTTGGTGTGATAGTCATCTACGCCTCGGC [489] Peniophora_plt/)yj_2526 ATTAGTGAAGCCCTT-GCGGCCTTGGTGTGATAGTCATCTACGCCTCGGC [489] Peniophora_pice Bntoniocorticiufli_sp._G_B1067 TTAGCGAACATATGTACCGGGACTCGCTTCCAACCGTCTCGCAAGAGACA [538] £nConiocoreiciujii_sp._G2B1069 TTAGCGAACATATGTACCGGGACTCGCTTCCAACCGTCTCGCAAGAGACA [538] En t omocorticiua_sp.~D~ TTAGCGAACATATG GGGACTCGCTTCCAACCGTCTCGCAAGAGACA [535] Entomocort i ci u/iTsp. _E TTAGCGAACATATG GGGACTCGCTTCCAACCGTCTCGCAAGAGACA [535] En t oniocor e i ci unTsp. ~C TTAGCGAACA TACGGGGACTTGCTTCCAACCGTCTCGCAAGAGACA [535] En t oniocor C i ci ua_ap._F_B1048 TTAGCGAACG TACCGGGACTCGCTTCCAACCGTCTCGCAAGAGACA [534] Entomocorti ci u/n~sp._F~B1050 TTAGCGAACG TACCGGGACTCGCTTCCAACCGTCTCGCAAGAGACA [535] Entomocort i ci u/ndsndroctoni TTAGCGAACT TACCGGGACTTGCTTCCAACCGTCTCGCAAGAGACA (53Sj En t o/nocor t i ci u/»_sp. _H TTAGCGAACT TAATGGGACTCGCTTCCAACCGTCTTGCAAGAGACA [535] EntomocorticiUffTsp.~A TTAGCGAACT TAATGGGACTCGCTTCCAACCGTCTCGCAAGAGACA [535] EntomocorticiunTsp. B TTAGCGAACT TACCGGGACTCGCTTCCAACCGTCTTGCAAGAGACA [535] Peni ophora_pithya_2l26 TTAGCGAACA TACGGGGACTCGCTTCCAACCGTCTCGCAAGAGACA [535] Peni ophora'jji cea e~Bl 010 TTAGCGAACATAT GGGAATCGCTTCCAACCGTCTCGCGAGAGACA [533] Peniophora_auranc7aca_B1018 TTAGCGAATC AATGGGGAATTGCTTCCAACCGTCTCGCAAGAGACA [539] Peni ophora~nuda_Bl006" TTAGCGAACATA CGGGAATCGCTTCCAACCGTCTCGCAAGAGACA [535] Peniophora_cinerea_B1020 TTAGCGAACATA CGGGAATCGCTTCCAACCGTCTCGCAAGAGACA [535] peniophora'^pseudojpini B1007 TTAGCGAACATGA GGGAATCGCTTACAGCCGTCTCGCAAGAGACA [536] Peni opbora'^dupl ex~Bl 025 TTAGCAAACTTA CGGGAATCGCTACCAACCGTCTCGCAAGAGACA [539] Penlop/iora~pithya~B1012 TTAGCGCATG AACGGGCATTGCTTCCAACCGTCTCGCAAGGGACA [539] Peniophora~cufa_Br0014 TTAGCGAACCC ACGGACATCGCTTCCAACCGTCTCGCAAGAGACA [535) Dendrophora_albobadi a TTAGCGAACCTATA GGGACTTGCTTCCAACCGTCTCGCAAGAGACA [538] I 560] I . 1 Entomocorticium_sp._G_B1067 ACTACTACCAAC [550] BntomocorCicium_sp.~G~B1069 ACTACTACCAAC [550] EntomocorticiuOT~sp.~D~ ACTACTACCAAC [547] En t omocorticium~sp.~E ACTACTACCAAC [547] Entomocorticium_sp._C ACTACTACCAAC [547] Entomocortici um~sp.048 ACTACTACCAAC [546] Entomocorticium sp. F'B^OSO ACTACTACCAAC [547] En t omocor t i ci umSendroct oni ACTACTACCAAC (547] Entomocorticium_sp._H ACTACTACCAAC [547] En tomocorticium_sp. ~A ACTACTACCAAC [547] Entomocorticium_sp.~B ACTACTACCAAC [547] Peniophora_pithya_2226 ATCACTTC-AAC [546] Peni ophora_piceas~Bl010 ACTACTACGAAC [545] Peniop/iora2aurant7aca_B1018 ACGACTT—AAC [549] Peni ophora_nuda_Bl006" ATCACTTCAAAC [547] Peniophora~cinerea_B1020 ATCACTTCAAAC [547] Peniophora_pseudo_pini B1007 TTGACT-CCAAC [547] Peni ophora_dupl ex~Bl 02J ATCACTTCAAAC [551] Peniophora_pithya~B1012 ACGACTACCAAC (551) Pen!ophora~ru fa_Bro 014 ATCACTACCAAC [547] Dendrophor'a_albobadi a ATCACTTCAAAC [550] 96 APPENDIX C. AUGNED INTERGENIC SHORT SPACER (IGS) SEQUENCES 10 20 30 40 SO] .] Bntomocortl ci u/B_sp. _G AATCATtGATTGGACTTCTCTCT—TCCTTTCTICCTCCATGCACCTGTA (461 Entomocortlcl u/ii_sp. ~0 AATCATTGATTGOACTTCTCrCt—TCTTTTCTICCTCCATGCACCIGTA (481 Entoaocorticium~sp.~S AATCATrGATTGGACTrCTCrCT—rCTrTTCTTCCTCCATGCACCTGTA (48) En t oiaoeortl ci laSendroct oni AATCATTGATTGOACtTCTCTCT—TCCTTT-TTTCTCCATGCACCTGTA (47) Ent omocorticiua_sp._F AATCATTGATTGGACrTCTCrcrCTTCCtTTCTTCCTCCATGCACCTGTA (50) En t omocorti cl ujn_sp. _B AATCATTGATTGCACrTCTCTCT—rCCTTT-TTTCTCCATGCACCTGTA (471 Entomocortlclum_3p.~H AATCATTGATTGGACTTCTCTCT—TCCrTT-TTTCTCCATGCACCTGtA (47] Entomocort icl wiTsp. _A AATCATTGATTCGACTTCTCTCT—TCCTTT-TTTCTCCATGCACCrGTA (47] Entomocort1clunTsp.~C AATCATTGATTGGACTTCTCTCTCTTTCTTTCTrCCTCCATGCACCTGTA (50) Peniophora_plceaeJSil010 AATCAATGATTGGACTTCTCrCT—TCCTTTCTCCTTTCATGCGGCCGTA (48) ( 60 70 80 90 100) I .1 EnComocorCicitm_sp._G CTTAGGGCCAGTCCCAAGGACTTGCGCCG-TTTGAGGTGCATGC-AGGAA (96) EnComocort1cl um~sp._D CTTAGGGCCAGTCCCAAGGACTTGCGCCG-TTTGAGGTGCATGC-AGGCT (96| Entomocortlclum sp. E CTTAGGGCCAGTCCCAAGGACTTGCGCCG-TTTGAGGTGCATGC-AGGCT (961 Ent omocort 1 cl iwSenclroct oni CTTAGGGCCAGTCCCAAGGACTTGCGCCG-TTTGAGGTGCATGC-AGGCT (951 Entomocorticlum_ap,_F CTTAGGGCCAGTCCCAAGGACTTGCGCCG-TTTGAGGTGCATGC-AGGCT (98) Entomocorticlum_ap._B CTTAGGGCCAGTCCCAAGGAC—GCGCCG-TTTGAGGTGCATGC-AGGCT (93) En t omocort icl ufli_sp. ~H TTTAGGGCCAGTCCCAAGGACTTGCGCCG-TTTGAGGTGCATGC-AGGCT (95] Entomocortlcl uin_sp. ~A CTTAGGGCCAGTCCCAAGGACTTGCGCCG-TTTGAGGTGCATGC-AGGCT (95) Entomocortlclum sp.~C CTTAGGGCCAGTCCCAAGGACTTGCGCCG-TTTGAGGTGCATGC-AGGCT (98) Peniophora_piceie_BT010 CTTAGGGCCAGTCCCAAGGACTTG-G-CTGAACCGGGCGCATGTGAG-TT [95) ( 110 120 130 140 150) I .1 En t omocort 1 cl u/n_sp. _G GAGGGAAA AGGCTCGACTTCTATATATTG-T-GGCGAAGGTTT (137] Entomocort1clunTsp.~0 GAGGGAAAAGGGAAAAGGCTCGACTTCTATACACTG-T-GGCGAAAGTTT (14 41 EntomocortlciunTsp, E GAGGGAAAAGGGAAAAGGCTCGACTTCTATACACTG-T-GGCGAAAGTTT (144] En t omocort i cl uniBendroct oni GAGGGAAGAGGGAAAAGGTTTGACTTCTATACACCG-T-GGCGAAGGTTT (143) Entomocort1clumjap._F GAGGGAAAAGGGAAAAGGCTCGACTTCTATACACTG-T-GGCGAAGGTTT (146) C/iCo/nocortici uin_sp.~B GAGGGAAGAGGGAAAAGGATTGACTTCTATACACCG-T-GGCGAAGGTTT (141) EnCoinocorCiciufli_sp.~H GAGGGAAGAGGGGAAAGGCTTGACTTCTATACACCA-T-GGCGAAGGTTT (143) Bntomocorticlum_ap.~h GAGGGAAGAGGGGAAAGGCTTGACTTGTATACACCG-T-GGCGAAGGTTT (143) EntomocortlclunTsp.~C GAGGGAAAAAGGAAAAGGCGCGACTTCTATACACTG-T-GGCGAAAGTTT (146) Pen!ophora_plceae_BT010 GTGGGAAGGGT A-GCTTGACTTCTGTAGATCGACAGG-GAAG (135) 160 170 180 190 200) .) Entomocortlclum_sp._G GCAGTAGGCCTTAG CTACATGCTTAG TTTATAG (170) Entomocortlclum_sp.JD GCAACAGGCCTTAGG AACTCATCTACATGCTT-G TTTATAG (184) Ent omocortlcl uin_sp. ~E GCAACAGGCCTTAGG AACTCATCTACATGCTT-G TTTATAG (184 ] Entomocort1ciumdendroctoni GCAATAGGCCTTAGGG AACTCATCTACATGCTT-G TTTATGG (184) Ent omocort1clum_sp._F GCAATAGGCCTTAGGG—AACTCATCTACATGCTT-G TTTATAG (187) Entomocortlclum~sp.~B TAGGG—AACTCATCTACATGCTT-G TTT (167) Entomocortlclum_sp._H GCAGCAGGCCTTAGGG—AACTCATCTACATGCTT-G TTTATGG (184) Entomocort1cium_sp._A GCAACAGGCCTTAGG AACTCATCTACATGCTT-G TTTATGG (183) Entomocorticium_sp.~C GCAACAGGCCTTAGGG AACTCATCTACATGCTT-G TTTATAG (187) Peniophora_piceae_Bl010 CC—A—TAGAGCTTA-CT-TATGCTT-GAAAAA [ 162 ] ( 210 220 230 240 250) [ .) Entomocorticium_sp._G CG-CTAGAA GCATATGGCGAGGCATAAAGAGCCTCGCAAGGGCTA (214) Bnto/nocortlcium~sp.~D TG-CTAGAA GCATATGGCGAGGCATAGAGAGCCTCGCAAGGGCTA (228) EntomocorticlunT sp.~E TG-CTAGAA GCATATGGCGAGGCATAGAGAGCCTCGCAAGGGCTA (228) Entomocortlcl umBendroctoni TG-CTAGAA GCATATGGCGAGGCATAGAAAGCCTCGCAAGGGCTA (228) Ent omocort1clum_sp._F TG-CTAGAA GCATATGGCGAGGCATAGAGAGCCTCGCAAGGGCTA (231) Entomocortlcl u/n~sp. ~B -G-CTAGAA GCATATGGCGAGGCATAGAAAGCCTCGCA TA (205) EntomocorticiumTsp.~H TG-CTAGAA GCATATGGCGAGGCATAGAGAGCCTCGCAAGAGCTA (2281 Entomocortici ujn_sp. ~A TG-CTAGAA GCATATGGCGAGGCATAGAAAGCCTCGCAAGGGCTA (227) Entomocorticium~sp. C TGTCTAGAA GCATATGGCGAGGCATAGAGAGCCTCGCAAGGGCTA (232) Peniophora_piceae_BT010 -G-C—CAATACTTGCATACAGAGAGGCATGGAGAGCCTCGCGAGGGCAT (208) 97 ( 260 270 280 290 3001 [ Bntomocorcl cl iu!_sp. _G GATTG6CATCTGAGACTT-GGGCATATGGTGCGACACGCACAATACCT6T [263] En t omoeoztici iiflTsp. ~D GATTGGCATATGAGACTT-GGGCATATGGTGCGACAGACACAGTACCT6T [277] Bntomocorticium'ap. B GATTGGCATATGAGACTT-GGGCATATGGTGCGACAGACACAGTACCTGT [277] Bntomoeorticiui^endroctonl GATTGGCATTTGAGACTT-GCGCATATGGTGCGACACACACAATACTTGT (277) Bn t omocorti ci uiii_sp. _F GATTGGCATATGAGACTT-GGGCATATGGTGCGACACACACAGTACCTGT (280) Bn t omocorti ci uoru» dispar CTAGA6ACAATGrrAACAC~GTT 461] AnCrodij carbonica ACTAGGGGCGATGTrAACAC~GTT 446] Heripllus_giganteus AATTAGTGACGATGTmCAC—GAT 451] Pulcharrlci ua_caeru2eua — —--ATTGATTTCGAGGCrAACGC—GAT 465] PleuroCus tutierreglum AACTGGTGACGATGTtAACAC—GAT 481] Lentinu2a_boryana TACTAGTACCGATGTTAACGC~GAT 450] Specles_I_f rom_D._approxIniaC us ACTGGTTTCGAGGCTAACGC~GAT 411] Species_K from_D. ponderosae ACTGGTTTCGAGGCTAACGC—GAT 409] Phlebiopsls glgariiea ACTGGTTTCGAGGCTAACGC~GAT 410] Gloeocystidlum ipidophiluia AATCACCAGTTTCGAAGCTAACGT AT 455] Russui a_coinpacia ATTAATGGCAATGTTAACAC~GAT 438] Amylosteremn_chaHletli AATTAGTAGCTATGTTAACAC—GAT 444] Heterobasidion_annostm AATTAGrAGTAATGTTAACAC~AAT 423] Hyphoderma_praetermlssua TTAGAGGCGATGITAACACACGAA 456] Stereum hirsutum AACAGGAGGCAAAGCTAACACGCGAT 523]