Distribution and Quantitative Analysis of Cidea and Cidec in Broiler Chickens: Accounting for Differential Fat Deposition Between Strains

British Poultry Science

ISSN: 0007-1668 (Print) 1466-1799 (Online) Journal homepage: http://www.tandfonline.com/loi/cbps20

Distribution and quantitative analysis of CIDEa and CIDEc in broiler chickens: accounting for differential fat deposition between strains

JZ. Huang, LM. Huang, QJ Zeng, EF. Huang, HP. Liang, Q. Wei, XH. Xie & JM. Ruan

To cite this article: JZ. Huang, LM. Huang, QJ Zeng, EF. Huang, HP. Liang, Q. Wei, XH. Xie & JM. Ruan (2017): Distribution and quantitative analysis of CIDEa and CIDEc in broiler chickens: accounting for differential fat deposition between strains, British Poultry Science, DOI: 10.1080/00071668.2017.1415426 To link to this article: https://doi.org/10.1080/00071668.2017.1415426

Accepted author version posted online: 08 Dec 2017. Published online: 20 Dec 2017.

Submit your article to this journal

Article views: 7

View related articles

View Crossmark data

Full Terms & Conditions of access and use can be found at http://www.tandfonline.com/action/journalInformation?journalCode=cbps20

Download by: [RMIT University Library] Date: 23 December 2017, At: 01:09 BRITISH POULTRY SCIENCE, 2017 https://doi.org/10.1080/00071668.2017.1415426

Distribution and quantitative analysis of CIDEa and CIDEc in broiler chickens: accounting for differential fat deposition between strains JZ. Huanga, LM. Huangb, QJ Zenga, EF. Huangc, HP. Lianga, Q. Weia, XH. Xiea and JM. Ruana aJiangxi Provincial Key Laboratory for Animal Health, Institute of Animal Population Health, College of Animal Science and Technology, Jiangxi Agricultural University, Nanchang, P. R. China; bCollege of Life Sciences and Oceanography, Shenzhen University, Shenzhen, P. R. China; cDepartment of Animal Science, Jiangxi Biotech Vocational College, Nanchang, P. R. China

ABSTRACT ARTICLE HISTORY 1. Differences in the expression of CIDEa and CIDEc in 20 different tissues were examined. Both Received 28 July 2017 CIDEa and CIDEc mRNA transcripts were predominantly but variably expressed in white adipose Accepted 4 November 2017 tissue (WAT) but were also expressed at moderate levels in the kidney and liver and at lower levels KEYWORDS CIDEa CIDEc in the ovary. Interestingly, among WAT types, both and were expressed at the lowest Chicken; CIDEa; CIDEc; levels in heart coronary WAT. expression pattern; fat 2. To better understand the roles of CIDEa and CIDEc in the fat deposition of broiler chickens, the deposition differences in lipid droplet (LD) size and mRNA levels of CIDEa and CIDEc between lean-type and fat- type broiler chicken lines were studied. LD sizes were larger in fat-type broiler lines, and CIDEa and CIDEc mRNA levels in white adipose, kidney and liver tissues were significantly higher in fat-type broiler lines than in their lean counterparts. 3. Developmental expression patterns of CIDEa and CIDEc mRNA were analysed in different tissue types (WAT, liver and kidney) in Arbor Acres broiler chickens, and CIDEa and CIDEc mRNA expression levels increased during sequential developmental stages, achieving peak expression levels at week 6. 4. These observations suggest that the functions of CIDEa and CIDEc reflect inherent characteristics of lipid metabolism that contribute to the differences in fat deposition between strains. The results in this study contribute to a more robust understanding of the tissue distribution and expression patterns of CIDEa and CIDEc mRNA and facilitate further research concerning the molecular mechanism underlying fat deposition in broiler chickens.

Introduction WT mice (Toh et al. 2008; Xu et al. 2012; Zhou et al. 2015). In contrast, CIDEc gene and its mRNA transcripts are CIDE (cell death–inducing DNA fragmentation factor 45- predominantly expressed in adipose tissue, followed by like effector) family proteins, including CIDEa, CIDEb and lung tissue and the gut in neonatal and adult cattle (Wang CIDEc/fat-specific protein 27 (Fsp27), consist of an evolu- et al. 2013). CIDEc is also highly expressed in porcine WAT, tionarily conserved CIDE-N domain that shares sequence as well as brain, small intestine and lymph, whereas it is homology with DNA fragmentation factor 40/45 (DFF40/ expressed at low levels in the kidney and stomach (Li et al. 45) (Inohara et al. 1998) and a unique CIDE-C domain that 2009). is conserved among CIDE family proteins (Wu et al. 2008). Although generally related to pro-apoptotic proteins, CIDEa and CIDEc/Fsp27 are two essential players within CIDEa and CIDEc may be involved in lipid or fat metabo-

Downloaded by [RMIT University Library] at 01:09 23 December 2017 the CIDE family. The CIDE proteins have distinct tissue lism. The CIDE family proteins are lipid droplet (LD)-asso- expression patterns, and previous studies have reported that ciated proteins that modulate various aspects of lipid CIDEa is expressed at low levels in white adipose tissue metabolic processes, including lipolysis, thermogenesis and (WAT) but highly expressed in brown adipose tissue TAG storage in BAT and in WAT, as well as fatty acid (BAT) in healthy wild-type (WT) mice (Zhou et al. 2003; oxidation and lipogenesis in the liver (Wu et al. 2008;Xu Gummesson et al. 2007; Abreu-Vieira et al. 2016). CIDEa et al. 2012). This class of proteins has also been shown to be mRNA is expressed at low levels in the spleen, liver and closely associated with LD formation, lipid storage and the heart in pigs (Li et al. 2009), whereas in humans, CIDEa is development of metabolic disorders such as obesity, dia- highly enriched in BAT and WATs, with little or no expres- betes and liver steatosis (Gong et al. 2009; Xu et al. 2012). sion in other tissues (Abreu-Vieira et al. 2016). Specific and CIDEa promotes adipose tissue expansion and lipid storage high levels of CIDEa expression have also been detected in in WT mice (Abreu-Vieira et al. 2016), and the genetic the mammary glands during pregnancy and lactation; and ablation of CIDEa results in a lean phenotype accompanied CIDEa deficiency results in reduced lipid secretion in milk by the accumulation of many smaller LDs, enhanced insulin and poor neonatal survival rates (Wang et al. 2012). Fsp27 sensitivity and resistance to diet-induced obesity (Zhou is almost exclusively found in white adipocytes and is et al. 2003; Montastier et al. 2014; Wu et al. 2014). CIDEc/ expressed at moderate levels in brown adipocytes in healthy

CONTACT JM. Ruan [email protected] Jiangxi Provincial Key Laboratory for Animal Health, Institute of Animal Population Health, College of Animal Science and Technology, Jiangxi Agricultural University, No. 1101 Zhimin Avenue, Economic and Technological Development District, Nanchang 330045, P. R. China JZ Huang and LM Huang contributed equally to this work © 2017 British Poultry Science Ltd 2 J. HUANG ET AL.

Fsp27, a close homologue of CIDEa (Wu et al. 2008), (Ningdu, China) and given ad libitum access to standard promotes lipid exchange among LDs in close physical con- growth diet and water. Blood was collected from each tact, as well as the fusion of smaller LDs to form a larger LD chicken by wing vein puncture. Serum was obtained by (Gong et al. 2011). Fsp27 also cooperates with Perilipin1, centrifuging coagulated blood at 3000 g for 10 min and another adipocyte-specific LD-associated protein to pro- stored at −20°C. Broiler chickens were killed by bloodletting mote LD growth and unilocular LD formation in white and 20 tissue samples were freshly collected and immedi- adipocytes (Sun et al. 2013). CIDEc has also been reported ately frozen in liquid nitrogen. All samples were stored at to be expressed in human subcutaneous adipocytes located −80°C until RNA isolation was performed. At the same on the surface of LDs (Li et al. 2010), and CIDEc expression time, jugular subcutaneous fat (jWAT) was fixed in 10% increases in hepatic tissue in obese humans (Hall et al. formalin buffer for histological analysis. All experimental 2010). These studies suggest that the CIDEa and CIDEc procedures followed a protocol approved by the Jiangxi genes play critical roles in modulating lipid storage and Agricultural University Animal Care and Use Committee. the development of metabolic diseases. Despite many previous studies of CIDEa and CIDEc in mice, livestock and human, few studies have been per- Biochemical index examination in serum formed on chickens. The Sanhuang (SH) broiler chicken is a typical lean Chinese indigenous breed that displays uni- Serum triglyceride concentrations were measured using an form fat in body, high intramuscular fat levels and excellent enzymatic/colorimetric GPO-PAP kit (Dongou, China) fol- ’ meat quality; however, it has a slower growth rate inferior to lowing the manufacturer s instructions. Serum cholesterol that of Arbor Acres (AA) broiler chickens, a genetically levels were determined with a total cholesterol assay kit obese breed. In contrast, AA chickens demonstrate less- (Jiancheng, China). Serum concentrations of HDL were desirable meat quality characteristics due to excessive determined using a high-density lipoprotein cholesterol abdominal lipid accumulation (Zhao et al. 2010). Thus, assay kit (Jiancheng, China). Serum concentrations of LDL these two strains of broiler chickens are ideal models for were measured with a low-density lipoprotein cholesterol studying the differences in fat deposition underlying their assay kit (Jiancheng, China). phenotypic differences. To better understand the roles of the CIDEa and CIDEc genes in the lipid metabolism of broiler chickens, we per- RNA isolation and mRNA quantification formed quantitative real-time PCR (qRT-PCR) to investi- Total RNA was extracted from the individual tissues of all gate the expression profiles of these genes in various tissues broilers using Trizol reagent (Takara, Tokyo, Japan), from AA broiler chickens. The developmental expression according to the manufacturer’s instructions. The RNA pattern of CIDEa and CIDEc was studied in various tissues samples were subjected to electrophoresis in a 1.2% agarose from broiler chickens. Differences in the expression of the gel containing ethidium bromide to verify their integrity. CIDEa and CIDEc genes in 20 tissues from both genetically Once validated, RNA was reverse transcribed to single- obese and lean broiler chickens were examined. The find- stranded cDNA and stored at −20°C until further use. The ings enhance our understanding of the evolutionary roles of mRNA levels of CIDEa, CIDEc and beta-actin (β-actin), the CIDEa and CIDEc genes and contribute basic molecular used as a reference gene to provide an internal standard, information relevant for further investigation of the func- were measured by qRT-PCR performed using SYBR Green tions of CIDEa and CIDEc in broiler chickens. PCR Master Mix (Takara, Tokyo, Japan) on an ABI 7500 (Applied Biosystems) with reaction volumes of 20 μl. The primer sequences used are listed in Table 1. The ΔCt Materials and methods method was used to calculate relative changes in mRNA −ΔΔCt Downloaded by [RMIT University Library] at 01:09 23 December 2017 Animals and sample collection abundance. The 2 method was used to analyse the qPCR data. The tissue distribution patterns of CIDEa and CIDEc in broiler chickens were determined using AA broiler chickens (n = 10, female, 6-week-old, 2321.7 ± 138.3 g body weight). Histology AA broilers (n = 30, female) were used in this study for the analysis of CIDEa and CIDEc mRNA developmental expres- The jWAT was immersion-fixed in 4% formaldehyde solu- sion patterns. The experimental period was divided into tion for 24 h, then dehydrated and embedded in paraffin three phases involving 2-week-old, 4-week-old and 6- using a standard procedure (Cinti et al. 2001). Tissues were week-old AA broiler chickens. Intra-species variations in sectioned using a standard microtome (Leica RM2255, Leica CIDEa and CIDEc expression patterns were investigated Microsystems). Sections 5 μm thick were mounted on glass using female AA broiler chickens and SH broiler chickens slides, deparaffinised, rehydrated and stained with haema- (n = 10, female, 6-week-old, 343.3 ± 13.3 g body weight). All toxylin and eosin. Diameters of stained adipocytes were the chickens were purchased from a commercial hatchery determined using Image-Pro Plus 6.0 software.

Table 1. Primer sequences used for quantitative real-time PCR (qPCR). Gene Product size Primer sequence Product (bp) Forward Reverse β-actin 300 TGCGTGACATCAAGGAGAAG TGCCAGGGTACATTGTGGTA CIDEa 251 AGTCCCTGAATGATAACACG AAGCACCTTCCGCAATAT CIDEc 84 GCCTGTGTCACTTTCGACCT GTAGGTGCCATAGAGCGTGG BRITISH POULTRY SCIENCE 3

Statistical analysis ovarian tissues and at lower levels in brain, duodenum and lung tissues; however, they had little or no expression Consolidated data were expressed as the means ± standard in the thymus, heart, spleen, lung, pectoralis, thigh muscle, errors of the means (SEM), and statistical significance was pancreas, proventriculus, gizzard or bursa of Fabricius. determined using the non-paired Student’s t-test as deter- Interestingly, among WATs, both CIDEa and CIDEc were mined by SPSS 17.0 software. Values of mRNA abundance expressed at their lowest levels in the hWAT (Figure 1(a,b)). were expressed as the fold-change relative to the average value of one group.*P<0.05, **P<0.01 and ***P<0.001.

The developmental expression pattern of CIDEa and CIDEc in broiler chickens Results To understand the developmental expression pattern of the Tissue distribution patterns of CIDEa and CIDEc mRNA CIDEa and CIDEc genes in broiler chickens, jWAT of AA transcripts in broiler chickens broiler chickens was sectioned at 2, 4 and 6 weeks of age To elucidate the precise tissue expression patterns of CIDEa and the sections stained with haematoxylin and eosin. and CIDEc genes in broiler chickens, total RNA was Adipocytes increased in size with age (Figure 2(a–c)) and extracted from 20 tissue samples of the AA broiler chickens the LDs in 4-week-old chickens were significantly larger and qPCR analysis was performed. The results indicated (P<0.001) than those in 2-week-old chickens and signifi- that both CIDEa and CIDEc mRNA transcripts were cantly smaller (P<0.01) than those in 6-week-old chickens expressed in the various tissues examined. The expression (Figure 2(d)) whereas the body weights and liver weights pattern of CIDEa mRNA was similar to that of CIDEc increased with age (Figure 2(e,f)). Total RNA was extracted mRNA, with both observed to be highly but variably from six tissue samples taken at each age for qPCR analysis. expressed in WAT (including jWAT, fWAT, hWAT, The expression levels of both CIDEa and CIDEc mRNA in gWAT and aWAT). CIDEa and CIDEc mRNA transcripts adipose tissues increased as the birds progressed through were expressed at moderate levels in kidney, liver and these three developmental stages, achieving peak expression Downloaded by [RMIT University Library] at 01:09 23 December 2017

Figure 1. The tissue distribution patterns of CIDEa and CIDEc mRNA transcripts in broiler chickens. (a) Quantitative real-time PCR analysis of β-actin, CIDEa and CIDEc mRNA expression in 20 tissues. (b,c) The tissue distribution patterns of CIDEa (b) and CIDEc (c) mRNA in AA broiler chickens. Expression levels in each tissue were determined as the fold-change in 2 −ΔΔCt levels relative to the liver with median expression set to 1. jWAT, jugular subcutaneous fat; fWAT, femoral subcutaneous fat; hWAT, heart coronary white adipose tissue; gWAT, gastric white adipose tissue; aWAT, abdominal white adipose tissue. NS: no significant difference. *P < 0.05, **P < 0.01 and ***P < 0.001. Quantitative data are presented as the means ± SEM. 4 J. HUANG ET AL. Downloaded by [RMIT University Library] at 01:09 23 December 2017

Figure 2. The developmental expression patterns of CIDEa and CIDEc in broiler chickens. (a–c) Jugular subcutaneous fat (jWAT) sections stained with haematoxylin and eosin from AA broiler chickens at 2-weeks (a), 4-weeks (b) and 6-weeks (c) of age. Scale bars = 50 µm. (d) Based on sections in (a), (b) and (c), the sizes of lipid droplets (LDs) were calculated from 100 adipocytes in each group. (e) The body weights in AA broiler chickens at 2- weeks, 4-weeks and 6-weeks of age. (f) The liver weights in AA broiler chickens at 2-weeks, 4-weeks and 6-weeks of age. (g,h) Relative mRNA expression levels of CIDEa (e) and CIDEc (f) in AA broiler chickens at 2-weeks, 4-weeks and 6-weeks of age. Expression levels in each tissue were determined as the fold-change in 2 −ΔΔCt levels relative to the liver at 2 weeks with median expression set to 1. jWAT, jugular subcutaneous fat; aWAT, abdominal white adipose tissue. NS: no significant difference. *P <0.05,**P <0.01and***P < 0.001. Quantitative data are presented as the means ± SEM.

in 6-week-old chickens. In the liver and kidney, however, Higher levels of triglyceride accumulation in AA broiler the expression levels of these two genes in 2-week-old chickens compared with SH broiler chickens chickens were significantly lower than those in 4-week-old To confirm the differences in fat deposition between the and 6-week-old chickens. There were no significant differ- two strains, TAG, cholesterol, HDL and LDL concentra- ences in the expression levels of these two genes in the liver, tions were measured in sera from SH and AA broilers. kidney and ovaries at 4 and 6 weeks in AA chickens Concentrations of serum TAG, cholesterol and LDL (Figure 2(g,h)). were significantly higher (P<0.05) in AA broilers BRITISH POULTRY SCIENCE 5

Table 2. Body weight, liver weight and serum concentrations of TAG, choles- porcine CIDEa is ubiquitously expressed in many tissues terol, HDL and LDL in AA broiler chickens and SH broiler chickens. including the liver, and is most abundant in WAT and P Parameter AA chickens SH chickens -value lymph tissue (Li et al. 2009). The present results are partially Body weight (g) 1982 ± 173.2 479 ± 67.8 0.027* consistent with the findings of Liang et al. (2003) and Li Liver weight (g) 54.2 ± 7.14 14.0 ± 1.83 0.002** TAG (mmol/l) 0.50 ± 0.04 0.37 ± 0.03 0.014* et al. (2009). The tissue expression patterns of CIDEa and Cholesterol (mmol/l) 3.16 ± 0.19 2.60 ± 0.13 0.024* CIDEc may suggest their functions. Adipose tissue is a HDL (mmol/l) 2.15 ± 0.12 1.89 ± 0.07 0.072 primary site in the body for energy storage in the form of LDL (mmol/l) 0.93 ± 0.09 0.72 ± 0.06 0.048* triglycerides. Thus, the predominant expression of chicken TAG: triglyceride; HDL: high-density lipoprotein; LDL: low-density lipoprotein. Statistical significance was determined using non-paired Student’s t-tests with CIDEa and CIDEc in WAT implies that these two genes a significance level of 0.05. might act in concert to regulate energy homeostasis and fat Data are presented as the means ± standard errors of the means (SEM). *P < deposition in chickens. 0.05; **P < 0.01. Many metabolic and physiological studies have already been performed on fat- and lean-type chicken lines (Daval compared with SH broilers. No differences in serum et al. 2000; Zhao et al. 2010). In the current study, body HDL level were observed (Table 2). In addition, the weights, liver weights, TAG and cholesterol concentrations body weights and liver weights in AA broiler chickens in sera from AA broiler chickens were significantly higher were significantly higher than in SH broiler chickens than those in SH broiler chickens. These results may indi- (Table 2). cate a higher general metabolic rate in AA broiler chickens than in the SH broiler chickens. LD is an important sub- cellular organelle responsible for lipid storage, and the sizes Expression analysis of CIDEa and CIDEc in obese and of LDs reveal their lipid storage capacity and have a positive lean broiler chickens association with the development of obesity (Bell et al. 2008; Walther and Farese 2012; Wrighton 2015). Compared with To further confirm that adipose tissue expands more SH broiler chickens, LD sizes were larger in AA broiler rapidly in obese chickens than in lean chickens, exam- chickens, which indicate a difference in lipid metabolism inations of jWAT from SH chickens and AA chickens and fat deposition between the two breeds. At the same were studied. Adipocytes were smaller and more com- time, the results from the present study also indicate that pact in the jWAT of SH chickens (Figure 3(b)) relative CIDEa and CIDEc mRNA levels in WAT from genetically to AA chickens (Figure 3(a)). Similarly, the size of LDs obese chickens (AA broiler chickens, a fat-type chicken in SH broiler chickens was significantly smaller breed) were significantly higher than those in lean chickens (P<0.01) than those in AA broiler chickens (Figure 3 (SH breed), and a similar difference between these two (c)). To characterise the mRNA levels of both CIDEa breeds was also found in liver tissues. These are consistent and CIDEc in the same tissues from obese and lean with Li et al.’s findings that CIDEa and CIDEc mRNA levels chickens, RNA was isolated from six tissues taken from in WAT from genetically obese pigs are significantly higher AA and SH broiler chickens and subjected to qPCR than those in lean pigs (Li et al. 2009). Several studies have analysis. The mRNA levels of both CIDEa and CIDEc reported that in mice, CIDEa and CIDEc play a role in in WAT (including jWAT, gWAT and aWAT) from thermogenesis and lipolysis (Zhou et al. 2003; Gong et al. obese broiler chickens were significantly higher than 2009; Xu et al. 2012). Zhao et al. have also suggested that those in their lean counterparts (P<0.001), and a CIDE genes might serve as novel targets for therapeutic similar but less marked difference was also found in interventions for obesity (Zhao et al. 2007). Additional liver tissues (Figure 3(d,e)). reports have demonstrated that CIDEa and CIDEc play critical roles in promoting hepatic triglyceride accumulation

Downloaded by [RMIT University Library] at 01:09 23 December 2017 (Matsusue et al. 2008; Zhou et al. 2012). These results Discussion suggest the potential tissue-specific roles of CIDEa and The tissue distribution of CIDEa and CIDEc in broiler CIDEc in WAT and liver tissues, which may be conserved chickens is reported for the first time in this article. across species. The differences in the expression of CIDEa Previous reports have confirmed the detection of high levels and CIDEc between these two breeds imply that these two of CIDEa expression in adipose tissues, and low expression genes might have important functions related to fat deposi- levels in the brain, liver, heart, kidney, lung, spleen, gastro- tion in broiler chickens. intestinal tract, muscle and testicular tissues (Li et al. 2009; In addition, the data presented here also show that the Abreu-Vieira et al. 2016). Danesch et al. found that FSP27/ body weight, liver weight and size of LDs in jWAT from AA CIDEc is an adipocyte-specific gene (Danesch et al. 1992), broiler chickens increase during progressive developmental but other studies have indicated that CIDEc is expressed not stages, achieving peak expression levels at 6 weeks. Hood only in adipose tissues but also in many other tissues, (1982) reported that for broiler-type chickens, growth was including the lung, heart, stomach, liver, kidney, muscle, accompanied by increased body weight, the accumulation of spleen, small intestine and colon (Liang et al. 2003; Wang fat in the body and that the growth of adipose tissue was et al. 2013). The present study showed that CIDEa and achieved by both hypertrophy and hyperplasia of adipose CIDEc were significantly expressed at high levels in broiler cells until approximately 14 weeks of age. The current data chickens, particularly in WAT, followed by the kidney, liver also show that the CIDEa and CIDEc mRNA expression and ovary and at lower levels in the brain, duodenum and levels in different tissues (WAT, liver and kidney) from lung, but had little or no expression was detectable in the AA broiler chickens increase with age. CIDE proteins were bursa of Fabricius, gizzard, proventriculus, muscle, heart, found to be localised to LDs to regulate LD fusion and spleen, thymus and other tissues. Li et al. have shown that growth, VLDL secretion and lipid secretion (Puri et al. 6 J. HUANG ET AL.

Figure 3. Expression analysis of CIDEa and CIDEc in obese and lean broiler chickens. (a,b) Jugular subcutaneous fat (jWAT) sections stained with haematoxylin

Downloaded by [RMIT University Library] at 01:09 23 December 2017 and eosin of AA broiler chickens (a) and SH broiler chickens (b). Scale bars = 50 µm. (c) Based on sections in (a) and (b), the sizes of lipid droplets (LDs) were calculated from 100 adipocytes in each group. (d,e) Relative mRNA expression levels of CIDEa (d) and CIDEc (e) in AA broiler chickens and SH broiler chickens. Expression levels in each tissue were determined as the fold-change in 2 − ΔΔCt levels relative to the SH chicken liver values set to 1. jWAT, jugular subcutaneous fat; gWAT, gastric white adipose tissue; aWAT, abdominal white adipose tissue. NS: no significant difference. *P < 0.05, **P < 0.01, and ***P < 0.001. Quantitative data are presented as the means ± SEM.

2007; Puri et al. 2008; Zhang et al. 2014). Similarly, Zhou chickens and SH broiler chickens imply that these two et al. reported that the LD sizes are smaller in CIDEa- genes might have important functions related to fat deposi- deficient brown adipocytes (Zhou et al. 2003). In contrast, tion in broiler chickens. the overexpression of CIDE proteins results in the accumulation of large LDs (Puri et al. 2007; Puri et al. 2008; Zhang et al. 2014). Therefore, CIDEa and CIDEc proteins might Acknowledgements have important physiological roles and comprise underlying molecular mechanisms in the control of lipid homeostasis We are grateful to Dr. Luo Chenting (Tsinghua University) for assis- and LD growth. tance with histology experiments. We thank American Journal Experts (AJE) for English language editing of this article. Collectively, the tissue expression patterns and developmental expression patterns of CIDEa and CIDEc demonstrated tissue-specific and development-specific characteristics in broiler chickens. The differences in the Disclosure statement expression of CIDEa and CIDEc between AA broiler No potential conflict of interest was reported by the authors. BRITISH POULTRY SCIENCE 7

Funding Gene Fsp27.” Cell Metabolism 7: 302–311. doi:10.1016/j. cmet.2008.03.003. This work was supported by grants from the National Natural Science MONTASTIER, E., S. DEJEAN,C.LE GALL, W. H. SARIS,D.LANGIN, and N. Foundation of China [Project No. 31460648]. VIGUERIE. 2014. “Adipose Tissue CIDEA Is Associated, Independently of Weight Variation, to Change in Insulin Resistance during a Longitudinal Weight Control Dietary References Program in Obese Individuals.” PLoS One 9: e98707. doi:10.1371/ journal.pone.0098707. ABREU-VIEIRA, G., A. W. FISCHER,C.MATTSSON,J.M.DE JONG,I.G. PURI, V., S. KONDA,S.RANJIT,M.AOUADI,A.CHAWLA,M.CHOUINARD,A. “ SHABALINA,M.RYDEN,J.LAURENCIKIENE, et al. 2016. Cidea Improves CHAKLADAR, and M. P. CZECH. 2007. “Fat-Specific Protein 27, a ” the Metabolic Profile through Expansion of Adipose Tissue. Novel Lipid Droplet Protein that Enhances Triglyceride Storage.” Nature Communications 7: 7433. doi:10.1038/ncomms12395. Journal of Biological Chemistry 282: 34213–34218. doi:10.1074/jbc. BELL, M., H. WANG,H.CHEN,J.C.MCLENITHAN,D.W.GONG,R.Z. M707404200. “ YANG,D.YU, et al. 2008. Consequences of Lipid Droplet Coat PURI, V., S. RANJIT,S.KONDA,S.M.NICOLORO,J.STRAUBHAAR,A. Protein Downregulation in Liver Cells: Abnormal Lipid Droplet CHAWLA,M.CHOUINARD, et al. 2008. “Cidea Is Associated with ” Metabolism and Induction of Insulin Resistance. Diabetes 57: Lipid Droplets and Insulin Sensitivity in Humans.” Proc Natl – 2037 2045. doi:10.2337/db07-1383. Acad Sci U S A 105: 7833–7838. doi:10.1073/pnas.0802063105. CINTI, S., M. C. ZINGARETTI,R.CANCELLO,E.CERESI, and P. FERRARA. SUN, Z., J. GONG,H.WU,W.XU,L.WU,D.XU,J.GAO, et al. 2013. “ 2001. Morphologic Techniques for the Study of Brown Adipose “Perilipin1 Promotes Unilocular Lipid Droplet Formation through ” Tissue and White Adipose Tissue. Methods Molecular Biology 155: the Activation of Fsp27 in Adipocytes.” Nature Communications 4: – 21 51. 1594. doi:10.1038/ncomms2581. “ DANESCH, U., W. HOECK, and G. M. RINGOLD. 1992. Cloning and TOH, S. Y., J. GONG,G.DU,J.Z.LI,S.YANG,J.YE,H.YAO, et al. 2008. Transcriptional Regulation of a Novel Adipocyte-Specific Gene, “Up-Regulation of Mitochondrial Activity and Acquirement of FSP27. CAAT-enhancer-binding Protein (C/EBP) and C/EBP-like Brown Adipose Tissue-Like Property in the White Adipose Tissue Proteins Interact with Sequences Required for Differentiation- of Fsp27 Deficient Mice.” PLoS One 3: e2890. doi:10.1371/journal. ” Dependent Expression. Journal of Biological Chemistry 267: pone.0002890. – 7185 7193. WALTHER, T. C., and R. J. FARESE. 2012. “Lipid Droplets and Cellular “ DAVAL, S., S. LAGARRIGUE, and M. DOUAIRE. 2000. Messenger RNA Lipid Metabolism.” Annual Review of Biochemistry 81: 687–714. Levels and Transcription Rates of Hepatic Lipogenesis Genes in doi:10.1146/annurev-biochem-061009-102430. ” Genetically Lean and Fat Chickens. Genetics Selection Evolution 32: WANG, J., X. CAO,H.PAN,L.HUA,M.YANG,C.LEI,X.LAN, and H. CHEN. – 521 531. doi:10.1186/1297-9686-32-5-521. 2013. “Cell Death-Inducing DFFA-like Effector C (Cidec/Fsp27) GONG, J., Z. SUN,L.WU,W.XU,N.SCHIEBER,D.XU,G.SHUI,H.YANG, Gene: Molecular Cloning, Sequence Characterization, Tissue “ R. G. PARTON, and P. LI. 2011. Fsp27 Promotes Lipid Droplet Distribution and Polymorphisms in Chinese Cattles.” Molecular Growth by Lipid Exchange and Transfer at Lipid Droplet Contact Biology Reports 40: 6765–6774. doi:10.1007/s11033-013-2793-y. ” – Sites. Journal of Cell Biology 195: 953 963. doi:10.1083/ WANG, W., N. LV,S.ZHANG,G.SHUI,H.QIAN,J.ZHANG,Y.CHEN, et al. jcb.201104142. 2012. “Cidea Is an Essential Transcriptional Coactivator Regulating “ GONG, J., Z. SUN, and P. LI. 2009. CIDE Proteins and Metabolic Mammary Gland Secretion of Milk Lipids.” Nature Medicine 18: ” – Disorders. Current Opinion in Lipidology 20: 121 126. 235–243. doi:10.1038/nm.2614. doi:10.1097/MOL.0b013e328328d0bb. WRIGHTON,K.H.2015. “Lipid Metabolism: Fatty Acids on the Move.” GUMMESSON, A., M. JERNAS,P.A.SVENSSON,I.LARSSON,C.A.GLAD,E. Nat Rev Mol Cell Biol 16: 204. doi:10.1038/nrm3972. “ SCHELE,L.GRIPETEG, et al. 2007. Relations of Adipose Tissue WU, C., Y. ZHANG,Z.SUN, and P. LI. 2008. “Molecular Evolution of CIDEA Gene Expression to Basal Metabolic Rate, Energy Cide Family Proteins: Novel Domain Formation in Early Restriction, and Obesity: Population-Based and Dietary Vertebrates and the Subsequent Divergence.” BMC Evolutionary ” Intervention Studies. The Journal of Clinical Endocrinology and Biology 8: 159. doi:10.1186/1471-2148-8-159. – Metabolism 92: 4759 4765. doi:10.1210/jc.2007-1136. WU, L., L. ZHOU,C.CHEN,J.GONG,L.XU,J.YE,D.LI, and P. LI. 2014. “ HALL, A. M., E. M. BRUNT,S.KLEIN, and B. N. FINCK. 2010. Hepatic “Cidea Controls Lipid Droplet Fusion and Lipid Storage in Brown Expression of Cell Death-Inducing DFFA-like Effector C in Obese and White Adipose Tissue.” Science China-Life Sciences 57: 107– ” Subjects Is Reduced by Marked Weight Loss. Obesity (Silver 116. doi:10.1007/s11427-013-4585-y. Spring) 18: :417-419. doi:10.1038/oby.2009.236. XU, L., L. ZHOU, and P. LI. 2012. “CIDE Proteins and Lipid “ HOOD,R.L.1982. Relationships among Growth, Adipose Cell Size, Metabolism.” Arterioscler Thromb Vasc Biol 32: 1094–1098. ” and Lipid Metabolism in Ruminant Adipose Tissue. Fed Proc 41: doi:10.1161/ATVBAHA.111.241489. – Downloaded by [RMIT University Library] at 01:09 23 December 2017 2555 2561. ZHANG, S., G. SHUI,G.WANG,C.WANG,S.SUN,C.C.ZOUBOULIS,R. “ INOHARA, N., T. KOSEKI,S.CHEN,X.WU, and G. NUNEZ. 1998. CIDE, a XIAO,J.YE,W.LI, and P. LI. 2014. “Cidea Control of Lipid Storage Novel Family of Cell Death Activators with Homology to the 45 and Secretion in Mouse and Human Sebaceous Glands.” Molecular ” kDa Subunit of the DNA Fragmentation Factor. EMBO Journal 17: and Cellular Biology 34: 1827–1838. doi:10.1128/MCB.01723-13. – 2526 2533. doi:10.1093/emboj/17.9.2526. ZHAO, D., F. ZHANG,G.CHEN,H.LI,Y.MA, and Q. LI. 2007. “The CIDE “ LI, F., Y. GU,W.DONG,H.LI,L.ZHANG,N.LI,W.LI, et al. 2010. Cell Genes Might Serve as Novel Targets for Therapeutic Intervention of Death-Inducing DFF45-like Effector, a Lipid Droplet-Associated Obesity.” Medical Hypotheses 69: 461–462. doi:10.1016/j. Protein, Might Be Involved in the Differentiation of Human mehy.2006.12.040. ” – Adipocytes. FEBS Journal 277: 4173 4183. doi:10.1111/j.1742- ZHAO, S., H. MA,G.HUANG, and S. ZOU. 2010. “Hepatic Lipolysis in 4658.2010.07806.x. Broiler Chickens with Different Fat Deposition during Embryonic LI, Y. H., T. LEI,X.D.CHEN,T.XIA,Y.PENG,Q.Q.LONG,J.ZHANG,S. Development.” Research in Veterinary Science 88: 321–325. “ Q. FENG,L.ZHOU, and Z. Q. YANG. 2009. Molecular Cloning, doi:10.1016/j.rvsc.2009.07.007. Chromosomal Location and Expression Pattern of Porcine CIDEa ZHOU, L., L. XU,J.YE,D.LI,W.WANG,X.LI,L.WU,H.WANG,F. ” – and CIDEc. Molecular Biology Reports 36: 575 582. doi:10.1007/ GUAN, and P. LI. 2012. “Cidea Promotes Hepatic Steatosis by s11033-008-9216-5. Sensing Dietary Fatty Acids.” Hepatology 56: 95–107. doi:10.1002/ LIANG, L., M. ZHAO,Z.XU,K.K.YOKOYAMA, and T. LI. 2003. hep.25611. “ Molecular Cloning and Characterization of CIDE-3, a Novel ZHOU, L., S. Y. PARK,L.XU,X.XIA,J.YE,L.SU,K.H.JEONG, et al. 2015. Member of the Cell-Death-Inducing DNA-fragmentation-factor “Insulin Resistance and White Adipose Tissue Inflammation are ” – (Dff45)-Like Effector Family. Biochemical Journal 370: 195 203. Uncoupled in Energetically Challenged Fsp27-Deficient Mice.” doi:10.1042/bj20020656. Nature Communications 6: 5949. doi:10.1038/ncomms6949. MATSUSUE, K., T. KUSAKABE,T.NOGUCHI,S.TAKIGUCHI,T.SUZUKI,S. ZHOU, Z., T. S. YON,Z.CHEN,K.GUO,C.P.NG,S.PONNIAH,S.C.LIN, “ YAMANO, and F. J. GONZALEZ. 2008. Hepatic Steatosis in Leptin- W. HONG, and P. LI. 2003. “Cidea-Deficient Mice Have Lean Deficient Mice Is Promoted by the PPARgamma Target Phenotype and are Resistant to Obesity.” Nature Genetics 35: 49– 56. doi:10.1038/ng1225.